DOCSLIB.ORG

W O 2017/007634 a L 12 January 2017 (12.01.2017) P O P C T

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
W O 2017/007634 a L 12 January 2017 (12.01.2017) P O P C T (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date W O 2017/007634 A l 12 January 2017 (12.01.2017) P O P C T (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every A01N 57/00 (2006.01) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, (21) International Application Number: BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, PCT/US20 16/039744 DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (22) International Filing Date: HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, 28 June 2016 (28.06.2016) KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (25) Filing Language: English PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, (26) Publication Language: English SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: 62/189,069 6 July 2015 (06.07.2015) (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (71) Applicant: THE BOARD O F REGENTS O F THE UNI¬ GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, VERSITY O F TEXAS SYSTEM [US/US]; 201 West 7th TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, Street, Austin, TX 75022 (US). TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, (72) Inventors: DEBRABANDER, Jef; 4100 Post Oak Road, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Flower Mound, TX 75022 (US). PARADA, Luis; 425 SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, Fifth Avenue, Apartment 5 1 B, New York, NY 10016 GW, KM, ML, MR, NE, SN, TD, TG). (US). Published: (74) Agent: LUBIT, Beverly, W.; CHIESA SHAHINIAN & GIANTOMASI PC, One Boland Drive, West Orange, NJ — with international search report (Art. 21(3)) 07052 (US). [Continued on next page] (54) Title: BENZAMIDE OR BENZAMINE COMPOUNDS USEFUL AS ANTICANCER AGENTS FOR THE TREATMENT OF HUMAN CANCERS (57) Abstract: The described invention provides small molecule an ti-cancer compounds for treating tumors that respond to cholesterol bio - synthesis inhibition. The compounds selectively inhibit the cholesterol biosynthetic pathway in tumor-derived cancer cells, but do not affect active mutant) normally dividing cells. (aberrant p sp aii n o o w o 2017/007634 Al II 11 II I 1 I 1 II II II llllll Hill II I II before the expiration of the time limit for amending the claims and to be republished in the event of receipt of amendments (Rule 48.2(h)) BENZAMIDE OR BENZAMINE COMPOUNDS USEFUL AS ANTICANCER AGENTS FOR THE TREATMENT OF HUMAN CANCERS CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of priority to U.S. Provisional Application No.: 62/189,069 filed on July 6, 2015, the entire contents of which are incorporated by reference herein. FIELD OF THE INVENTION [0002] The described invention relates to small molecule anti-cancer therapeutics. BACKGROUND OF THE INVENTION Gliomas [0003] Glial cells, the most abundant cell type in the central nervous system, are cells that surround neurons and provide support for and insulation between them. Unlike neurons, glial cells do not conduct electrical impulses. There are two major classes of glial cells in the central nervous system: astrocytes and oligodendrocytes (Kandel ER, et al., Principles of Neural Science, 4th Ed. McGraw-Hill New York (2000), Ch. 2, pp. 20-21). [0004] Glial cells in the vertebrate nervous system are divided into two major classes: microglia and macroglia. Microglia are phagocytes that are mobilized after infection, injury or disease, which arise from macrophages outside the nervous system. Three types of macroglial cells predominate in the vertebrate nervous system: oligodendrocytes, Schwann cells, and astrocytes. Astrocytes, the most numerous of glial cells in the central nervous system characterized by their star-like shape and the broad end-feet on their processes, are thought to play a nutritive role, and help form an impermeable lining in the brains capillaries and venules - the blood brain barrier- that prevents toxic substances in the blood from entering the brain. Oligodendrocytes, small cells with relatively few processes, and Schwann cells produce the myelin used to insulate nerve cell axons. [0005] The term "glioma" encompasses all tumors thought to originate in the glial cell linage. (Veliz, I. et al., "Advances and challenges in the molecular biology and treatment of glioblastoma - is there any hope for the future?" Ann. Trans. Med. 3(1): 7. Doi: 10.3978/j.issn.2305-5939.2014. 10.06. The location of the tumor depends on the type of cells from which it originates. [0006] Malignant gliomas exhibit properties that resemble astrocytes or oligodendrocytes, hence the designation as astrocytomas and oligodendrogliomas. These tumors are graded on a scale from I to IV, based on how normal or abnormal the cells look. Of numerous grading systems in use, the most common is the World Health Organization (WHO) grading system for glioma (Louis DN, et al., Acta Neuropathol, 2007, 114(2):97-109). Grade I tumors are slow-growing, nonmalignant, and associated with long-term survival. Grade II tumors are relatively slow-growing but sometimes recur as higher grade tumors. They can be nonmalignant or malignant. Grade III tumors are malignant and often recur as higher grade tumors. Grade IV tumors reproduce rapidly and are very aggressive malignant tumors. [0007] Low grade astrocytomas usually are localized and grow slowly. High grade astrocytomas grow at a rapid pace and are infiltrative. Astrocytomas can appear in various parts of the brain and nervous system, including the cerebellum, the cerebrum, the central areas of the brain, the brainstem, and the spinal cord. [0008] Pilocytic Astrocytoma (also called Juvenile Pilocytic Astrocytoma), are grade I astrocytomas, which typically stay in the area where they started and do not spread. They are considered the "most benign" (noncancerous) of all the astrocytomas. Two other, less well known grade I astrocytomas are cerebellar astrocytoma and desmoplastic infantile astrocytoma. [0009] Diffuse Astrocytoma (also called Low-Grade or Astrocytoma Grade II) (e.g., Fibrillary, Gemistocytic, Protoplasmic Astrocytoma) tend to invade surrounding tissue and grow at a relatively slow pace. [0010] An anaplastic astrocytoma is a grade III tumor. These rare tumors require more aggressive treatment than benign pilocytic astrocytoma. [0011] Astrocytoma Grade IV (also called Glioblastoma, previously named "Glioblastoma Multiforme," "Grade IV Glioblastoma," and "GBM"). There are two types of astrocytoma grade IV—primary, or de novo, and secondary. Primary tumors are very aggressive and the most common form of astrocytoma grade IV. The secondary tumors are those which originate as a lower-grade tumor and evolve into a grade IV tumor. [0012] Subependymal Giant Cell Astrocytoma—Subependymal giant cell astrocytomas are ventricular tumors associated with tuberous sclerosis. [0013] Oligodendrogliomas can be found anywhere within the cerebral hemisphere of the brain, although the frontal and temporal lobes are the most common locations. Sometimes oligodendrogliomas are mixed with other cell types. These tumors may be graded using an "A to D" system, which is based on microscopic features of the individual tumor cells. The grade indicates how quickly the tumor cells reproduce and how aggressive the tumor is. About 4% of primary brain tumors are oligodendrogliomas, representing about 10-15% of the gliomas. Only 6% of these tumors are found in infants and children. Most oligodendrogliomas occur in adults ages 50-60, and are found in men more often than women. [0014] Mixed glioma (or oligoastrocytoma) usually contain a high proportion of more than one type of cell, most often astrocytes and oligodendrocytes. Occasionally, ependymal cells are also found. The behavior of a mixed glioma appears to depend on the grade of the tumor. It is less clear whether their behavior is based on that of the most abundant cell type. [0015] Ependymal cells line the ventricles of the brain and the center of the spinal cord. These tumors are divided into four major types: subependymomas (grade I), typically slow growing tumors; myxopapillary ependymomas (grade I), typically slow growing tumors; Ependymomas (grade II), the most common of the ependymal tumors, which can be further divided into the following subtypes, including cellular ependymomas, papillary ependymomas, clear cell ependymomas, and tancytic ependymomas; and anaplastic ependymomas (grade III), typically faster growing tumors. The various types of ependymomas appear in different locations within the brain and spinal column. Subependymomas usually appear near a ventricle. Myxopapillary ependymomas tend to occur in the lower part of the spinal column. Ependymomas are usually located along, within, or next to the ventricular system. Anaplastic ependymomas are most commonly found in the brain in adults and in the lower back part of the skull (posterior fossa) in children. They are rarely found in the spinal cord. Ependymomas are relatively rare tumors in adults, accounting for 2-3% of primary brain tumors. However, they are the sixth most common brain tumor in children. About 30% of pediatric ependymomas are diagnosed in children younger than 3 years of age. [0016] Optic gliomas may involve any part of the optic pathway, and they have the potential to spread along these pathways. Most of these tumors occur in children under the age of 10.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • The Role of Genetic Variation in Predisposition to Alcohol-Related Chronic Pancreatitis
    The Role of Genetic Variation in Predisposition to Alcohol-related Chronic Pancreatitis Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Marianne Lucy Johnstone April 2015 The Role of Genetic Variation in Predisposition to Alcohol-related Chronic Pancreatitis 2015 Abstract Background Chronic pancreatitis (CP) is a disease of fibrosis of the pancreas for which alcohol is the main causative agent. However, only a small proportion of alcoholics develop chronic pancreatitis. Genetic polymorphism may affect pancreatitis risk. Aim To determine the factors required to classify a chronic pancreatic population and identify genetic variations that may explain why only some alcoholics develop chronic pancreatitis. Methods The most appropriate method of diagnosing CP was assessed using a systematic review. Genetics of different populations of alcohol-related chronic pancreatitics (ACP) were explored using four different techniques: genome-wide association study (GWAS); custom arrays; PCR of variable nucleotide tandem repeats (VNTR) and next generation sequencing (NGS) of selected genes. Results EUS and sMR were identified as giving the overall best sensitivity and specificity for diagnosing CP. GWAS revealed two associations with CP (identified and replicated) at PRSS1-PRSS2_rs10273639 (OR 0.73, 95% CI 0.68-0.79) and X-linked CLDN2_rs12688220 (OR 1.39, 1.28-1.49) and the association was more pronounced in the ACP group (OR 0.56, 0.48-0.64)and OR 2.11, 1.84-2.42). The previously identified VNTR in CEL was shown to have a lower frequency of the normal repeat in ACP than alcoholic liver disease (ALD; OR 0.61, 0.41-0.93).
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 7,906,710 B2 Karunanandaa Et Al
    US00790671 OB2 (12) United States Patent (10) Patent No.: US 7,906,710 B2 Karunanandaa et al. (45) Date of Patent: *Mar. 15, 2011 (54) TRANSGENIC PLANTS CONTAINING FOREIGN PATENT DOCUMENTS ALTERED LEVELS OF STEROD EP 0486290 11, 1991 COMPOUNDS EP O480730 4f1992 JP O9121863 5, 1997 WO WO93,021.87 2, 1993 (75) Inventors: Balasulojini Karunanandaa, St. Louis, WO WO97/032O2 1, 1997 MO (US); Martha Post-Beittenmiller, WO WO97/34003 9, 1997 St. Louis, MO (US); Mylavarapu WO WO 98.45457 10, 1998 Venkatramesh, St. Louis, MO (US); WO WO99,04622 2, 1999 Ganesh M. Kishore, St. Louis, MO WO WOOOf 61771 10, 2000 (US); Gregory M. Thorne, St. Louis, WO WOO1/31027 3, 2001 MO (US); John R. LeDeaux, St. Louis, MO (US) OTHER PUBLICATIONS Bach et al., “Cloning of cDNAS or genes encoding enzymes of sterol (73) Assignee: Monsanto Company, St. Louis,MO biosynthesis from plants and other eukaryotes: heterologous expres (US) sion and complementation analysis of mutations for functional char acterization.” Progress in Lipid Research, 36(2/3): 197-226, 1997. (*) Notice: Subject to any disclaimer, the term of this Bak et al., “Cloning and expression in Escherichia coli of the patent is extended or adjusted under 35 obtusifoliol 14-alpha-demethylase of Sorghum bicolor (L.) Moench, U.S.C. 154(b) by 0 days. a cytochrome P450 orthologous to the sterol 14-alpha-demethylases This patent is Subject to a terminal dis (CYP51) from fungi and mammals.” Plant Journal, 11(2):191-201, claimer. 1997. Bak et al., “Cloning and expression in Escherichia coli of the obtusifoliol 14-alpha-demethylase of Sorghum bicolor (L.) Moench, (21) Appl.
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • Electronic Supplementary Material (ESI) for Metallomics
    Electronic Supplementary Material (ESI) for Metallomics. This journal is © The Royal Society of Chemistry 2018 Uniprot Entry name Gene names Protein names Predicted Pattern Number of Iron role EC number Subcellular Membrane Involvement in disease Gene ontology (biological process) Id iron ions location associated 1 P46952 3HAO_HUMAN HAAO 3-hydroxyanthranilate 3,4- H47-E53-H91 1 Fe cation Catalytic 1.13.11.6 Cytoplasm No NAD biosynthetic process [GO:0009435]; neuron cellular homeostasis dioxygenase (EC 1.13.11.6) (3- [GO:0070050]; quinolinate biosynthetic process [GO:0019805]; response to hydroxyanthranilate oxygenase) cadmium ion [GO:0046686]; response to zinc ion [GO:0010043]; tryptophan (3-HAO) (3-hydroxyanthranilic catabolic process [GO:0006569] acid dioxygenase) (HAD) 2 O00767 ACOD_HUMAN SCD Acyl-CoA desaturase (EC H120-H125-H157-H161; 2 Fe cations Catalytic 1.14.19.1 Endoplasmic Yes long-chain fatty-acyl-CoA biosynthetic process [GO:0035338]; unsaturated fatty 1.14.19.1) (Delta(9)-desaturase) H160-H269-H298-H302 reticulum acid biosynthetic process [GO:0006636] (Delta-9 desaturase) (Fatty acid desaturase) (Stearoyl-CoA desaturase) (hSCD1) 3 Q6ZNF0 ACP7_HUMAN ACP7 PAPL PAPL1 Acid phosphatase type 7 (EC D141-D170-Y173-H335 1 Fe cation Catalytic 3.1.3.2 Extracellular No 3.1.3.2) (Purple acid space phosphatase long form) 4 Q96SZ5 AEDO_HUMAN ADO C10orf22 2-aminoethanethiol dioxygenase H112-H114-H193 1 Fe cation Catalytic 1.13.11.19 Unknown No oxidation-reduction process [GO:0055114]; sulfur amino acid catabolic process (EC 1.13.11.19) (Cysteamine
    [Show full text]
  • Optimizing Cellular Metabolism to Improve Chronic Skin Wound Healing
    Optimizing Cellular Metabolism to Improve Chronic Skin Wound Healing James J. Slade Honors Thesis Luis Felipe Ramirez Biomedical Engineering Rutgers University, New Brunswick Under the direction of Dr. Francois Berthiaume and Dr. Gabriel Yarmush Abstract—Despite significant advances, chronic skin wounds Wound healing is a complex process with four identifiable remain a large problem both in terms of morbidity and cost. It stages: hemostasis, inflammation, proliferation, and remodel- is estimated that in the United States, this problem afflicts 6.5 ing [6]. Hemostasis involves the formation of a blood clot that million people a year and costs more than 30 billion dollars for di- abetic foot ulcers alone [4,11]. Currently approved treatments are stops the loss of blood at the site of injury [6]. Growth factors often ineffective. This thesis seeks to leverage the large amount of released by activated platelets during the hemostasis stage information that has accumulated about metabolism in the hu- recruit immune cells such as neutrophils and macrophages [6]. man body, and to mine that information with computational mod- The infiltration of the injured tissue with these immune cells eling. It seeks to uncover whether metabolites commonly available leads to the inflammatory phase [6]. The role played by inflam- in the human body can be used to bolster the metabolism of wounded cells such as keratinocytes (the cells that form the mation is classified as both positive and negative [5]. On the epidermis), and therefore improve the natural process of wound one hand the inflammatory response clears the wound site of healing. This would offer treatment options with fewer side effects pathogens and dead cells, on the other hand the inflammatory than what is currently offered to improve wound healing.
    [Show full text]
  • Integrierte Omics-Analysen Zur Charakterisierung Physiologischer Effekte Von Schilddrüsenhormonen Und Von Spezifischen Schilddrüsenhormon-Metaboliten
    Integrierte Omics-Analysen zur Charakterisierung physiologischer Effekte von Schilddrüsenhormonen und von spezifischen Schilddrüsenhormon-Metaboliten INAUGURALDISSERTATION zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Universität Greifswald vorgelegt von Janine Golchert geboren am 08.02.1991 Greifswald, 09.03.2020 Dekan: Prof. Dr. Werner Weitschies 1. Gutachter: Prof. Dr. Uwe Völker 2. Gutachter: Prof. Dr. Klaudia Brix Tag der Promotion: 10.09.2020 Inhaltsverzeichnis Inhaltsverzeichnis Abkürzungsverzeichnis ..................................................................................................... V Zusammenfassung ........................................................................................................... VII Summary ............................................................................................................................ IX 1 Einleitung ...................................................................................................................... 1 1.1 Biosynthese der klassischen Schilddrüsenhormone T3 und T4 in der Schilddrüse . 1 1.2 Transport und Metabolismus der klassischen Schilddrüsenhormone T3 und T4 ..... 3 1.3 Regulation der Schilddrüsenhormone .................................................................... 4 1.4 Molekulare Wirkmechanismen von Schilddrüsenhormonen ................................... 5 1.5 Physiologische Wirkungen von Schilddrüsenhormonen ........................................
    [Show full text]
  • A Detailed Genome-Wide Reconstruction of Mouse Metabolism Based on Human Recon 1
    UC San Diego UC San Diego Previously Published Works Title A detailed genome-wide reconstruction of mouse metabolism based on human Recon 1 Permalink https://escholarship.org/uc/item/0ck1p05f Journal BMC Systems Biology, 4(1) ISSN 1752-0509 Authors Sigurdsson, Martin I Jamshidi, Neema Steingrimsson, Eirikur et al. Publication Date 2010-10-19 DOI http://dx.doi.org/10.1186/1752-0509-4-140 Supplemental Material https://escholarship.org/uc/item/0ck1p05f#supplemental Peer reviewed eScholarship.org Powered by the California Digital Library University of California Sigurdsson et al. BMC Systems Biology 2010, 4:140 http://www.biomedcentral.com/1752-0509/4/140 RESEARCH ARTICLE Open Access A detailed genome-wide reconstruction of mouse metabolism based on human Recon 1 Martin I Sigurdsson1,2,3, Neema Jamshidi4, Eirikur Steingrimsson1,3, Ines Thiele3,5*, Bernhard Ø Palsson3,4* Abstract Background: Well-curated and validated network reconstructions are extremely valuable tools in systems biology. Detailed metabolic reconstructions of mammals have recently emerged, including human reconstructions. They raise the question if the various successful applications of microbial reconstructions can be replicated in complex organisms. Results: We mapped the published, detailed reconstruction of human metabolism (Recon 1) to other mammals. By searching for genes homologous to Recon 1 genes within mammalian genomes, we were able to create draft metabolic reconstructions of five mammals, including the mouse. Each draft reconstruction was created in compartmentalized and non-compartmentalized version via two different approaches. Using gap-filling algorithms, we were able to produce all cellular components with three out of four versions of the mouse metabolic reconstruction.
    [Show full text]
  • Steroidal Triterpenes of Cholesterol Synthesis
    Molecules 2013, 18, 4002-4017; doi:10.3390/molecules18044002 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Review Steroidal Triterpenes of Cholesterol Synthesis Jure Ačimovič and Damjana Rozman * Centre for Functional Genomics and Bio-Chips, Faculty of Medicine, Institute of Biochemistry, University of Ljubljana, Zaloška 4, Ljubljana SI-1000, Slovenia; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +386-1-543-7591; Fax: +386-1-543-7588. Received: 18 February 2013; in revised form: 19 March 2013 / Accepted: 27 March 2013 / Published: 4 April 2013 Abstract: Cholesterol synthesis is a ubiquitous and housekeeping metabolic pathway that leads to cholesterol, an essential structural component of mammalian cell membranes, required for proper membrane permeability and fluidity. The last part of the pathway involves steroidal triterpenes with cholestane ring structures. It starts by conversion of acyclic squalene into lanosterol, the first sterol intermediate of the pathway, followed by production of 20 structurally very similar steroidal triterpene molecules in over 11 complex enzyme reactions. Due to the structural similarities of sterol intermediates and the broad substrate specificity of the enzymes involved (especially sterol-Δ24-reductase; DHCR24) the exact sequence of the reactions between lanosterol and cholesterol remains undefined. This article reviews all hitherto known structures of post-squalene steroidal triterpenes of cholesterol synthesis, their biological roles and the enzymes responsible for their synthesis. Furthermore, it summarises kinetic parameters of enzymes (Vmax and Km) and sterol intermediate concentrations from various tissues. Due to the complexity of the post-squalene cholesterol synthesis pathway, future studies will require a comprehensive meta-analysis of the pathway to elucidate the exact reaction sequence in different tissues, physiological or disease conditions.
    [Show full text]
  • The Regulation and Membrane Topology of DHCR24, a Key Enzyme in Cholesterol Synthesis
    The regulation and membrane topology of DHCR24, a key enzyme in cholesterol synthesis by Eser J. Zerenturk A thesis submitted in fulfilment of the requirements for the Degree of Doctorate of Philosophy (Biochemistry and Molecular Genetics) School of Biotechnology and Biomolecular Sciences The University of New South Wales Submitted: December 2013 Revised: April 2014 THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or Family name: Zerenturk First name: Eser Other name/s: Jane Abbreviation for degree as given in the University calendar: PhD School: Biotechnology and Biomolecular Sciences Faculty: Science Title: The regulation and membrane topology of DHCR24, a key enzyme in cholesterol synthesis Abstract 350 words maximum: Cholesterol is necessary for mammalian life, as an essential component in cell membranes, foetal development, and a precursor for steroid hormones. Hence, cholesterol levels must be tightly regulated. Previous research has focused on an early step in cholesterol synthesis: 3- hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR), target of the cholesterol-lowering statin drugs. However, less is known about other steps in the pathway. We investigated 3β-hydroxysterol Δ24-reductase (DHCR24); involved in the last step of cholesterol synthesis, and implicated in inflammation, oxidative stress and hepatitis C virus infection. There is a paucity of fundamental information on the structure of DHCR24 and how it interacts with cellular membranes, as well as how this critical enzyme is regulated. We found that DHCR24 is an integral endoplasmic reticulum (ER) membrane protein, with multiple atypical membrane associated regions. We present biochemical evidence that the majority of the enzyme is associated with the ER membrane, contrary to published membrane topology models and in silico predictions.
    [Show full text]
  • Links Between Iron and Lipids: Implications in Some Major Human Diseases
    pharmaceuticals Review Links Between Iron and Lipids: Implications in Some Major Human Diseases Stephanie Rockfield, Ravneet Chhabra, Michelle Robertson, Nabila Rehman, Richa Bisht and Meera Nanjundan * Department of Cell Biology, Microbiology and Molecular Biology, University of South Florida, Tampa, FL 336200, USA; srockfi[email protected] (S.R.); [email protected] (R.C.); [email protected] (M.R.); [email protected] (N.R.); [email protected] (R.B.) * Correspondence: [email protected]; Tel.: +1-813-974-8133 Received: 31 August 2018; Accepted: 19 October 2018; Published: 22 October 2018 Abstract: Maintenance of iron homeostasis is critical to cellular health as both its excess and insufficiency are detrimental. Likewise, lipids, which are essential components of cellular membranes and signaling mediators, must also be tightly regulated to hinder disease progression. Recent research, using a myriad of model organisms, as well as data from clinical studies, has revealed links between these two metabolic pathways, but the mechanisms behind these interactions and the role these have in the progression of human diseases remains unclear. In this review, we summarize literature describing cross-talk between iron and lipid pathways, including alterations in cholesterol, sphingolipid, and lipid droplet metabolism in response to changes in iron levels. We discuss human diseases correlating with both iron and lipid alterations, including neurodegenerative disorders, and the available evidence regarding the potential mechanisms underlying how iron may promote disease pathogenesis. Finally, we review research regarding iron reduction techniques and their therapeutic potential in treating patients with these debilitating conditions. We propose that iron-mediated alterations in lipid metabolic pathways are involved in the progression of these diseases, but further research is direly needed to elucidate the mechanisms involved.
    [Show full text]
  • The Pennsylvania State University the Graduate School College Of
    The Pennsylvania State University The Graduate School College of Medicine THE INVOLVEMENT OF THE STEROL RESPONSE ELEMENT BINDING PROTEINS IN LIPOGENESIS IN THE SEB-1 SEBACEOUS MODEL SYSTEM A Thesis in Integrative Biosciences by Terry Michael Smith © 2006 Terry Michael Smith Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy December 2006 The thesis of Terry Michael Smith was reviewed and approved* by the following: Gary A. Clawson Professor of Pathology, and Biochemistry and Molecular Biology Thesis Co-Advisor Co-chair of Committee Diane Thiboutot Professor of Dermatology Thesis Co-Advisor Co-chair of Committee Melvin Billingsley Professor of Pharmacology, Biotechnology, and Entrepreneurship Peter Hudson Professor of Biology Director, Huck Institute Craig Meyers Professor of Microbiology and Immunology Jack Vanden Heuvel Professor of Veterinary and Biomedical Sciences *Signatures are on file in the Graduate School iii ABSTRACT Excessive lipid production is an integral factor in the pathogenesis of acne. As such, an understanding of the molecular signaling involved in sebaceous gland lipid production is needed to identify therapeutic targets to improve acne. The sterol response element binding proteins (SREBPs) are a class of transcription factors known to regulate lipid production, particularly in response to insulin in the liver. We hypothesize that the SREBPs are important in sebaceous gland lipid metabolism, and thus represent a potential drug target for the treatment of acne. The correlation between severity of acne and insulin-like growth factor-1 (IGF-1) levels in women led us to investigate the effects of IGF-1 on sebaceous lipid production and SREBP-1 levels.
    [Show full text]