Optimizing Cellular Metabolism to Improve Chronic Skin Wound Healing

Total Page:16

File Type:pdf, Size:1020Kb

Optimizing Cellular Metabolism to Improve Chronic Skin Wound Healing Optimizing Cellular Metabolism to Improve Chronic Skin Wound Healing James J. Slade Honors Thesis Luis Felipe Ramirez Biomedical Engineering Rutgers University, New Brunswick Under the direction of Dr. Francois Berthiaume and Dr. Gabriel Yarmush Abstract—Despite significant advances, chronic skin wounds Wound healing is a complex process with four identifiable remain a large problem both in terms of morbidity and cost. It stages: hemostasis, inflammation, proliferation, and remodel- is estimated that in the United States, this problem afflicts 6.5 ing [6]. Hemostasis involves the formation of a blood clot that million people a year and costs more than 30 billion dollars for di- abetic foot ulcers alone [4,11]. Currently approved treatments are stops the loss of blood at the site of injury [6]. Growth factors often ineffective. This thesis seeks to leverage the large amount of released by activated platelets during the hemostasis stage information that has accumulated about metabolism in the hu- recruit immune cells such as neutrophils and macrophages [6]. man body, and to mine that information with computational mod- The infiltration of the injured tissue with these immune cells eling. It seeks to uncover whether metabolites commonly available leads to the inflammatory phase [6]. The role played by inflam- in the human body can be used to bolster the metabolism of wounded cells such as keratinocytes (the cells that form the mation is classified as both positive and negative [5]. On the epidermis), and therefore improve the natural process of wound one hand the inflammatory response clears the wound site of healing. This would offer treatment options with fewer side effects pathogens and dead cells, on the other hand the inflammatory than what is currently offered to improve wound healing. The response is thought to prevent the wound from healing and author first reduced the global set of reactions and metabolites to be responsible for scarring [5]. In the proliferation stage, in a publicly available database of cellular metabolism (the recon Database), to 357 reactions and 339 metabolites that are most keratinocytes repopulate the injury and angiogenesis leads to applicable to keratinocytes. Then, metabolic flux through a key revascularization of the tissue [6]. Keratinocytes migrate from set of 25 reactions was defined for mass balance analysis. Lastly, the edge of the injury and from hair follicles towards the the impact of variations in metabolic inputs on the metabolic flux deeper portions of the injury in part due to stimulation from distribution was investigated. By analyzing the variability of the transforming growth factor (TGF)-β [6]. Hypoxic conditions flux through each reaction in Monte Carlo simulations, reactions that are likely to be amenable to manipulation were identified. within the injury site lead to release of vascular endothelial This analysis points to the citric acid cycle as the pathway growth factor, which results in angiogenesis [6]. Fibroblasts most amenable to manipulation. Other key reaction categories are also important in the proliferation stage. In particular, they identified were glycolysis, the pentose phosphate pathway, amino regenerate the extracellular matrix by releasing proteins such acid metabolism, transport reactions, and energy production and as collagen, elastin, and matrix metalloproteinase [6]. The homeostasis. remodeling stage lasts the longest, and involves remodeling of the extracellular matrix [6]. Of particular importance is I. INTRODUCTION the conversion of type III collagen to type I collagen, which strengthens the injured tissue [6]. A. The Medical Problem Chronic wounds are characterized by a sustained inflam- Chronic skin wounds can be defined as wounds that do not matory response, increased presence of microbes, and fewer heal within three months, and include three types of wounds: and functionally deficient fibroblasts [5]. The sustained in- vascular ulcers, diabetic ulcers, and pressure ulcers [5, 2]. In flammatory response presents a problem for wound healing the United States alone, this problem is said to afflict 6.5 as it taxes oxygen and nutrient availability. The immune cells million patients [11]. The burden of diabetic foot ulcers alone that infiltrate chronic wounds also appear to have diminished on the health system in the United States is estimated to be phagocytic ability, leading to a buildup of necrotic debris [5]. $30 billion annually [4]. The prevalence of diabetic foot ulcers A common problem with chronic wounds is also the presence alone was estimated to be 68.4/1000 person-years [3]. All of of bacteria and fungi that invade the wound [5]. The interplay this information points to a set of conditions that cause a severe between the sustained inflammatory response and the presence burden on individuals and the health system, and that merits of microbes is unclear [5]. Fibroblasts found in chronic sustained research efforts. wounds have also been found to lack a normal response to growth factor and to lack normal migratory capacities [5]. TABLE I Chronic wound fluid has also been found to have an inhibitory SUMMARY OF THE METABOLISM OF WOUNDS effect on the proliferation of fibroblasts and keratinocytes, indicating problems with the factors present in chronic wounds Type of Condition Condition Sub-type Positive/ [6]. Matrix Metalloproteinases have also been found to be Negative Effect overactive in chronic wounds, which leads to a degradation Acute Hypoxia- Has positive of the extracellular matrix [6]. leads to platelet effects aggregation and the release of B. Metabolism of Wounds Hypoxia cytokines Chronic Hypoxia- Has large Many processes of wound healing demand large amounts leads to impaired negative energy production, effects of energy [13]. An especially important factor in the ability a prolonged of cells to obtain energy is the oxygen availability. Shortly inflammatory phase, after the onset of the wound, hypoxic conditions occur in and too much ROS the wound area as a result of vessel constriction and platelet accumulation Xanthine - Negative effect aggregation [8]. Acute hypoxic conditions can have benefi- Purine Catabolism Oxidoreductase- cial impacts on wound healing, whereas chronic hypoxia is Excessive ROS believed to have large deleterious effects on wound healing production L-Arginine Negative effect [10]. Chronic hypoxia impairs cellular function by limiting Deaminase- the production of ATP through aerobic glycolysis, the citric Arginine Metabolism ROS produced acid cycle, and fatty acid oxidation [10]. This ATP production Arginase - No Positive effect ROS produced is critical for sustaining all of the steps of wound healing, Decreased flux Negative effect including cell proliferation, bacterial defense, and collagen through glycolysis, synthesis [10]. Furthermore, the oxygen dependent NADPH the citric acid cycle, nucleotide synthesis, oxygenase produces reactive oxygen species (ROS) that are and fatty acid crucial for bacterial control, cytokine release, cell proliferation, catabolism- leads and angiogenesis [10]. As mentioned above, acute hypoxia is to reduced energy in the cells available also believed to play a beneficial role in wound healing [10]. for wound healing The initial hypoxia, for example, leads to platelet aggregation Impaired Glucose Uptake Increased catabolism Negative effect and the stimulation of cytokine release through the production of amino acids and carboxylic acids- of ROS [10]. Moreover, it is believed that leukocytes use the leads to breakdown of ROS gradient to infiltrate the wound tissue [10]. proteins and a limited ability to construct new Chronic wounds are characterized by local hypoxia that proteins needed for is caused by alterations of the blood vessels and reduced wound healing vascular perfusion [10]. These hypoxic conditions lead to Reduced flux through Negative effect the Pentose Phosphate reduced energy for cells, as well as to signaling cascades Pathway- less that lead to inflammatory responses [10]. In addition, hypoxia reducing equivalents leads to increased production of cytokines that promote the produced movement of neutrophils and macrophages into the wound, and the subsequent production of pro-inflammatory molecules [10]. Prolonged hypoxic conditions also prevent the production of nitric oxide through the nitric oxide synthase enzyme [10]. produces reactive oxygen species [1]. Conversely, arginine Nitric oxide normally prevents the accumulation of large quan- metabolized by arginase does not generate ROS [1]. tities of ROS, and its absence can lead to harmful accumulation of ROS [10]. Due to increased energy demand, central carbon metabolism Another key metabolic pathway involved in wound healing is very important in wound healing. Defective glucose uptake, is purine metabolism. In particular, it has been found that for example, has been found to negatively impact wound due to increased energy demand, cells engage in substantial healing [14]. The researchers found that the decline in glucose purine catabolism during wound healing [13]. Weinstein et al. uptake led to significant reductions in flux through glycol- found that xanthine oxidoreductase leads to excessive ROS ysis, the citric acid cycle, nucleotide synthesis, and fatty formation in diabetic patients, thus contributing to impaired acid catabolism [14]. The cells compensated by increasing wound healing [13]. A similar pathway involving arginine catabolism of amino acids and carboxylic acids [14]. Also of metabolism has also been studied in wound healing [1].
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • The Role of Genetic Variation in Predisposition to Alcohol-Related Chronic Pancreatitis
    The Role of Genetic Variation in Predisposition to Alcohol-related Chronic Pancreatitis Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Marianne Lucy Johnstone April 2015 The Role of Genetic Variation in Predisposition to Alcohol-related Chronic Pancreatitis 2015 Abstract Background Chronic pancreatitis (CP) is a disease of fibrosis of the pancreas for which alcohol is the main causative agent. However, only a small proportion of alcoholics develop chronic pancreatitis. Genetic polymorphism may affect pancreatitis risk. Aim To determine the factors required to classify a chronic pancreatic population and identify genetic variations that may explain why only some alcoholics develop chronic pancreatitis. Methods The most appropriate method of diagnosing CP was assessed using a systematic review. Genetics of different populations of alcohol-related chronic pancreatitics (ACP) were explored using four different techniques: genome-wide association study (GWAS); custom arrays; PCR of variable nucleotide tandem repeats (VNTR) and next generation sequencing (NGS) of selected genes. Results EUS and sMR were identified as giving the overall best sensitivity and specificity for diagnosing CP. GWAS revealed two associations with CP (identified and replicated) at PRSS1-PRSS2_rs10273639 (OR 0.73, 95% CI 0.68-0.79) and X-linked CLDN2_rs12688220 (OR 1.39, 1.28-1.49) and the association was more pronounced in the ACP group (OR 0.56, 0.48-0.64)and OR 2.11, 1.84-2.42). The previously identified VNTR in CEL was shown to have a lower frequency of the normal repeat in ACP than alcoholic liver disease (ALD; OR 0.61, 0.41-0.93).
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 7,906,710 B2 Karunanandaa Et Al
    US00790671 OB2 (12) United States Patent (10) Patent No.: US 7,906,710 B2 Karunanandaa et al. (45) Date of Patent: *Mar. 15, 2011 (54) TRANSGENIC PLANTS CONTAINING FOREIGN PATENT DOCUMENTS ALTERED LEVELS OF STEROD EP 0486290 11, 1991 COMPOUNDS EP O480730 4f1992 JP O9121863 5, 1997 WO WO93,021.87 2, 1993 (75) Inventors: Balasulojini Karunanandaa, St. Louis, WO WO97/032O2 1, 1997 MO (US); Martha Post-Beittenmiller, WO WO97/34003 9, 1997 St. Louis, MO (US); Mylavarapu WO WO 98.45457 10, 1998 Venkatramesh, St. Louis, MO (US); WO WO99,04622 2, 1999 Ganesh M. Kishore, St. Louis, MO WO WOOOf 61771 10, 2000 (US); Gregory M. Thorne, St. Louis, WO WOO1/31027 3, 2001 MO (US); John R. LeDeaux, St. Louis, MO (US) OTHER PUBLICATIONS Bach et al., “Cloning of cDNAS or genes encoding enzymes of sterol (73) Assignee: Monsanto Company, St. Louis,MO biosynthesis from plants and other eukaryotes: heterologous expres (US) sion and complementation analysis of mutations for functional char acterization.” Progress in Lipid Research, 36(2/3): 197-226, 1997. (*) Notice: Subject to any disclaimer, the term of this Bak et al., “Cloning and expression in Escherichia coli of the patent is extended or adjusted under 35 obtusifoliol 14-alpha-demethylase of Sorghum bicolor (L.) Moench, U.S.C. 154(b) by 0 days. a cytochrome P450 orthologous to the sterol 14-alpha-demethylases This patent is Subject to a terminal dis (CYP51) from fungi and mammals.” Plant Journal, 11(2):191-201, claimer. 1997. Bak et al., “Cloning and expression in Escherichia coli of the obtusifoliol 14-alpha-demethylase of Sorghum bicolor (L.) Moench, (21) Appl.
    [Show full text]
  • Como As Enzimas Agem?
    O que são enzimas? Catalizadores biológicos - Aceleram reações químicas específicas sem a formação de produtos colaterais PRODUTO SUBSTRATO COMPLEXO SITIO ATIVO ENZIMA SUBSTRATO Características das enzimas 1 - Grande maioria das enzimas são proteínas (algumas moléculas de RNA tem atividade catalítica) 2 - Funcionam em soluções aquosas diluídas, em condições muito suaves de temperatura e pH (mM, pH neutro, 25 a 37oC) Pepsina estômago – pH 2 Enzimas de organismos hipertermófilos (crescem em ambientes quentes) atuam a 95oC 3 - Apresentam alto grau de especificidade por seus reagentes (substratos) Molécula que se liga ao sítio ativo Região da enzima e que vai sofrer onde ocorre a a ação da reação = sítio ativo enzima = substrato 4 - Peso molecular: varia de 12.000 à 1 milhão daltons (Da), são portanto muito grandes quando comparadas ao substrato. 5 - A atividade catalítica das Enzimas depende da integridade de sua conformação protéica nativa – local de atividade catalítica (sitio ativo) Sítio ativo e toda a molécula proporciona um ambiente adequado para ocorrer a reação química desejada sobre o substrato A atividade de algumas enzimas podem depender de outros componentes não proteicos Enzima ativa = Holoenzimas Parte protéica das enzimas + cofator Apoenzima ou apoproteína •Íon inorgânico •Molécula complexa (coenzima) Covalentemente ligados à apoenzima GRUPO PROSTÉTICO COFATORES Elemento com ação complementar ao sitio ativo as enzimas que auxiliam na formação de um ambiente ideal para ocorrer a reação química ou participam diretamente dela
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • Electronic Supplementary Material (ESI) for Metallomics
    Electronic Supplementary Material (ESI) for Metallomics. This journal is © The Royal Society of Chemistry 2018 Uniprot Entry name Gene names Protein names Predicted Pattern Number of Iron role EC number Subcellular Membrane Involvement in disease Gene ontology (biological process) Id iron ions location associated 1 P46952 3HAO_HUMAN HAAO 3-hydroxyanthranilate 3,4- H47-E53-H91 1 Fe cation Catalytic 1.13.11.6 Cytoplasm No NAD biosynthetic process [GO:0009435]; neuron cellular homeostasis dioxygenase (EC 1.13.11.6) (3- [GO:0070050]; quinolinate biosynthetic process [GO:0019805]; response to hydroxyanthranilate oxygenase) cadmium ion [GO:0046686]; response to zinc ion [GO:0010043]; tryptophan (3-HAO) (3-hydroxyanthranilic catabolic process [GO:0006569] acid dioxygenase) (HAD) 2 O00767 ACOD_HUMAN SCD Acyl-CoA desaturase (EC H120-H125-H157-H161; 2 Fe cations Catalytic 1.14.19.1 Endoplasmic Yes long-chain fatty-acyl-CoA biosynthetic process [GO:0035338]; unsaturated fatty 1.14.19.1) (Delta(9)-desaturase) H160-H269-H298-H302 reticulum acid biosynthetic process [GO:0006636] (Delta-9 desaturase) (Fatty acid desaturase) (Stearoyl-CoA desaturase) (hSCD1) 3 Q6ZNF0 ACP7_HUMAN ACP7 PAPL PAPL1 Acid phosphatase type 7 (EC D141-D170-Y173-H335 1 Fe cation Catalytic 3.1.3.2 Extracellular No 3.1.3.2) (Purple acid space phosphatase long form) 4 Q96SZ5 AEDO_HUMAN ADO C10orf22 2-aminoethanethiol dioxygenase H112-H114-H193 1 Fe cation Catalytic 1.13.11.19 Unknown No oxidation-reduction process [GO:0055114]; sulfur amino acid catabolic process (EC 1.13.11.19) (Cysteamine
    [Show full text]
  • University Microfilms
    INFORMATION TO USERS This dissertation was produced from a microfilm copy of the original document. While the most advanced technological means to photograph and reproduce this document have been used, the quality is heavily dependent upon the quality of the original submitted. The following explanation of techniques is provided to help you understand markings or patterns which may appear on this reproduction. 1. The sign or "target" for pages apparently lacking from the document photographed is "Missing Page(s)". If it was possible to obtain the missing page(s) or section, they are spliced into the film along with adjacent pages. This may have necessitated cutting thru an image and duplicating adjacent pages to insure you complete continuity. 2. When an image on the film is obliterated with a large round black mark, it is an indication that the photographer suspected that the copy may have moved during exposure and thus cause a blurred image. You will find a good image of the page in the adjacent frame. 3. Wher, a map, drawing or chart, etc., was part of the material being photographed the photographer followed a definite method in "sectioning" the material. It is customary to begin photoing at the upper left hand corner of a large sheet and to continue photoing from left to right in equal sections with a small overlap. If necessary, sectioning is continued again - beginning below the first row and continuing on until complete. 4. The majority of users indicate that the textual content is of greatest value, however, a somewhat higher quality reproduction could be made from "photographs" if essential to the understanding of the dissertation.
    [Show full text]
  • The Effect of Osmotic Shock on Release of Bacterial Proteins and on Active Transport
    The Effect of Osmotic Shock on Release of Bacterial Proteins and on Active Transport LEON A. HEPPEL From the Department of Biochemistry and Molecular Biology, Corncll University, Ithaca, New York 14850 ABSTRACT Osmotic shock is a procedure in which Gram-negative bacteria are treated as follows. First they are suspended in 0.5 ~t sucrose containing ethylenediaminetetraacetate. After removal of the sucrose by centrifugation, the pellet of ceils is rapidly dispersed in cold, very dilute, MgC12. This causes the selective release of a group of hydrolytic enzymes. In addition, there is selective release of certain binding proteins. So far, binding proteins for D-galac- tose, L-leucine, and inorganic sulfate have been discovered and purified. The binding proteins form a reversible complex with the substrate but catalyze no chemical change, and no enzymatic activities have been detected. Various lines of evidence suggest that the binding proteins may play a role in active transport: (a) osmotic shock causes a large drop in transport activity associated with the release of binding protein; (b) transport-negative mutants have been found which lack the corresponding binding protein; (¢) the affinity constants for binding and transport are similar; and (d) repression of active transport of leucine was accompanied by loss of binding protein. The binding proteins and hydrolytic enzymes released by shock appear to be located in the cell envelope. Glucose 6-phosphate acts as an inducer for its own transport system when supplied exogenously, but not when generated endogenously from glucose. In recent years, investigators have directed attention to a group of degradative enzymes and other proteins in Escherichia cdi and related Gram-negative organisms which are not bound to isolated cell wails or membranes; yet it is believed that they are confined to a surface compartment rather than existing free in the cytoplasm.
    [Show full text]
  • Integrierte Omics-Analysen Zur Charakterisierung Physiologischer Effekte Von Schilddrüsenhormonen Und Von Spezifischen Schilddrüsenhormon-Metaboliten
    Integrierte Omics-Analysen zur Charakterisierung physiologischer Effekte von Schilddrüsenhormonen und von spezifischen Schilddrüsenhormon-Metaboliten INAUGURALDISSERTATION zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Universität Greifswald vorgelegt von Janine Golchert geboren am 08.02.1991 Greifswald, 09.03.2020 Dekan: Prof. Dr. Werner Weitschies 1. Gutachter: Prof. Dr. Uwe Völker 2. Gutachter: Prof. Dr. Klaudia Brix Tag der Promotion: 10.09.2020 Inhaltsverzeichnis Inhaltsverzeichnis Abkürzungsverzeichnis ..................................................................................................... V Zusammenfassung ........................................................................................................... VII Summary ............................................................................................................................ IX 1 Einleitung ...................................................................................................................... 1 1.1 Biosynthese der klassischen Schilddrüsenhormone T3 und T4 in der Schilddrüse . 1 1.2 Transport und Metabolismus der klassischen Schilddrüsenhormone T3 und T4 ..... 3 1.3 Regulation der Schilddrüsenhormone .................................................................... 4 1.4 Molekulare Wirkmechanismen von Schilddrüsenhormonen ................................... 5 1.5 Physiologische Wirkungen von Schilddrüsenhormonen ........................................
    [Show full text]
  • A Detailed Genome-Wide Reconstruction of Mouse Metabolism Based on Human Recon 1
    UC San Diego UC San Diego Previously Published Works Title A detailed genome-wide reconstruction of mouse metabolism based on human Recon 1 Permalink https://escholarship.org/uc/item/0ck1p05f Journal BMC Systems Biology, 4(1) ISSN 1752-0509 Authors Sigurdsson, Martin I Jamshidi, Neema Steingrimsson, Eirikur et al. Publication Date 2010-10-19 DOI http://dx.doi.org/10.1186/1752-0509-4-140 Supplemental Material https://escholarship.org/uc/item/0ck1p05f#supplemental Peer reviewed eScholarship.org Powered by the California Digital Library University of California Sigurdsson et al. BMC Systems Biology 2010, 4:140 http://www.biomedcentral.com/1752-0509/4/140 RESEARCH ARTICLE Open Access A detailed genome-wide reconstruction of mouse metabolism based on human Recon 1 Martin I Sigurdsson1,2,3, Neema Jamshidi4, Eirikur Steingrimsson1,3, Ines Thiele3,5*, Bernhard Ø Palsson3,4* Abstract Background: Well-curated and validated network reconstructions are extremely valuable tools in systems biology. Detailed metabolic reconstructions of mammals have recently emerged, including human reconstructions. They raise the question if the various successful applications of microbial reconstructions can be replicated in complex organisms. Results: We mapped the published, detailed reconstruction of human metabolism (Recon 1) to other mammals. By searching for genes homologous to Recon 1 genes within mammalian genomes, we were able to create draft metabolic reconstructions of five mammals, including the mouse. Each draft reconstruction was created in compartmentalized and non-compartmentalized version via two different approaches. Using gap-filling algorithms, we were able to produce all cellular components with three out of four versions of the mouse metabolic reconstruction.
    [Show full text]
  • Steroidal Triterpenes of Cholesterol Synthesis
    Molecules 2013, 18, 4002-4017; doi:10.3390/molecules18044002 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Review Steroidal Triterpenes of Cholesterol Synthesis Jure Ačimovič and Damjana Rozman * Centre for Functional Genomics and Bio-Chips, Faculty of Medicine, Institute of Biochemistry, University of Ljubljana, Zaloška 4, Ljubljana SI-1000, Slovenia; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +386-1-543-7591; Fax: +386-1-543-7588. Received: 18 February 2013; in revised form: 19 March 2013 / Accepted: 27 March 2013 / Published: 4 April 2013 Abstract: Cholesterol synthesis is a ubiquitous and housekeeping metabolic pathway that leads to cholesterol, an essential structural component of mammalian cell membranes, required for proper membrane permeability and fluidity. The last part of the pathway involves steroidal triterpenes with cholestane ring structures. It starts by conversion of acyclic squalene into lanosterol, the first sterol intermediate of the pathway, followed by production of 20 structurally very similar steroidal triterpene molecules in over 11 complex enzyme reactions. Due to the structural similarities of sterol intermediates and the broad substrate specificity of the enzymes involved (especially sterol-Δ24-reductase; DHCR24) the exact sequence of the reactions between lanosterol and cholesterol remains undefined. This article reviews all hitherto known structures of post-squalene steroidal triterpenes of cholesterol synthesis, their biological roles and the enzymes responsible for their synthesis. Furthermore, it summarises kinetic parameters of enzymes (Vmax and Km) and sterol intermediate concentrations from various tissues. Due to the complexity of the post-squalene cholesterol synthesis pathway, future studies will require a comprehensive meta-analysis of the pathway to elucidate the exact reaction sequence in different tissues, physiological or disease conditions.
    [Show full text]
  • Radhakrishnan, Iii 4
    NATURE OF THE GENETIC BLOCKS IN THE ISOLEUCINE-VALINE MUTANTS OF SALMONELLA R. P. WAGNER AND ARLOA BERGQUIST The Genetics Laboratory of the Department of Zoology, The Uniuersity of Texas, Austin, Texas Received April 26, 1960 HE metabolic pathways leading to the biosynthesis of isoleucine and valine are now sufficiently well understood, as a result of the work of a number of investigators ( STRASSMAN,THOMAS and WEINHOUSE1955; STRASSMAN,THOMAS, LOCKEand WEINHOUSE1956; STRASSMAN,SHATTON, CORSEY and WEINHOUSE 1958; UMBARGER1958a,b; ADELBERG1955; WAGNER,RADHAKRISHNAN and SNELL1958; RADHAKRISHNAN,WAGNER and SNELL1960; and RADHAKRISHNAN and SNELL1960) to make it possible to investigate the nature of the genetic blocks in mutant organisms requiring isoleucine and valine. This communication describes the results of the investigation of a series of mutants of Salmonella typhimurium originally isolated in the laboratory of DR. M. DEMEREC,The Carnegie Institute of Washington, Cold Spring Harbor, New York. It is limited to the purely biochemical aspects of these mutants, but is ,preceded by a com- munication from GLANVILLEand DEMEREC1960, which describes the linkage studies made with these mutants, and correlates the genetic with the biochemical 3ata. The biosynthesis of isoleucine and valine is believed to occur as shown in Figure 1. In the work to be described here only the steps proceeding from the 3-keto acids, a-acetolactic acid and a-aceto-P-hydroxybutyricacid, have been :onsidered in detail. The following abbreviations are used in Figure I and in mbsequent parts of this communication: AHB = a-aceto-a-hydroxybutyric acid; CHa C Ha CHa CHa I 1 I I c*o CHa-C-OH CHfC-OH CHI-C-H 1 I TPNH 1 I c.0 ~ *Valine I COOH COOH I COOH I COOH (PYRUVIC ACID) (ALI I (HKVI I (DHV) I I I I I I I I + Pyruvic Acid Step1 StepII Stepm Step H 4 I I I I cn3 CH, I CH3 I I I I I CHZ C=O I CH~CH~C-OH Threonine-GO I ~CH3CH2-~-OH-C=0I+! I I I I COOH COOH COOH COOH COOH (U-kmtobutyric acid1 (AH01 (HKII (DUI) (KI) FIGURE1 .-The biosynthetic pathway leading to isoleucine and valine.
    [Show full text]