DOCSLIB.ORG

The Regulation and Membrane Topology of DHCR24, a Key Enzyme in Cholesterol Synthesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Regulation and Membrane Topology of DHCR24, a Key Enzyme in Cholesterol Synthesis The regulation and membrane topology of DHCR24, a key enzyme in cholesterol synthesis by Eser J. Zerenturk A thesis submitted in fulfilment of the requirements for the Degree of Doctorate of Philosophy (Biochemistry and Molecular Genetics) School of Biotechnology and Biomolecular Sciences The University of New South Wales Submitted: December 2013 Revised: April 2014 THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or Family name: Zerenturk First name: Eser Other name/s: Jane Abbreviation for degree as given in the University calendar: PhD School: Biotechnology and Biomolecular Sciences Faculty: Science Title: The regulation and membrane topology of DHCR24, a key enzyme in cholesterol synthesis Abstract 350 words maximum: Cholesterol is necessary for mammalian life, as an essential component in cell membranes, foetal development, and a precursor for steroid hormones. Hence, cholesterol levels must be tightly regulated. Previous research has focused on an early step in cholesterol synthesis: 3- hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR), target of the cholesterol-lowering statin drugs. However, less is known about other steps in the pathway. We investigated 3β-hydroxysterol Δ24-reductase (DHCR24); involved in the last step of cholesterol synthesis, and implicated in inflammation, oxidative stress and hepatitis C virus infection. There is a paucity of fundamental information on the structure of DHCR24 and how it interacts with cellular membranes, as well as how this critical enzyme is regulated. We found that DHCR24 is an integral endoplasmic reticulum (ER) membrane protein, with multiple atypical membrane associated regions. We present biochemical evidence that the majority of the enzyme is associated with the ER membrane, contrary to published membrane topology models and in silico predictions. This has important consequences for the many functions attributed to DHCR24. In particular, those that suggest DHCR24 alters its localisation within the cell should be reassessed in light of this new information. We show that DHCR24 is regulated at multiple levels, with potent effects on cholesterol synthesis. Our findings demonstrate feedback regulation at the transcriptional and post‑translational level. Transcriptional regulation occurs through sterol regulatory element binding protein 2 (SREBP-2), mediated by dual sterol regulatory elements (SREs) within the DHCR24 promoter, which work cooperatively to regulate expression. DHCR24 activity is potently inhibited at the post‑translational level by endogenous side-chain oxysterols, in particular 24(S),25‑epoxycholesterol (24,25EC), which was independent of DHCR24 protein levels. This observation was extended to another structurally similar byproduct of the cholesterol synthesis pathway, progesterone. Another mode of regulation is through signalling. We found that phosphorylation affects DHCR24 activity, at a known phosphorylation site, T110. We found that protein kinase C (PKC) also ablated DHCR24 activity, through an unknown phosphorylation site. These findings provide fundamental new insights into DHCR24 and its regulation, indicating it may be an important regulatory step in cholesterol synthesis and maintaining cellular cholesterol homeostasis. Declaration relating to disposition of project thesis/dissertation I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only). 16/05/2014 …………………………………………………………… ……………………………………..……………… ……….……………………...…….… Signature Witness Date The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years must be made in writing. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research. FOR OFFICE USE ONLY Date of completion of requirements for Award: ORIGINALITY STATEMENT ‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’ Signed …………………………………………… Date …………………………………………… i COPYRIGHT STATEMENT ‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.' Signed …………………………………………… Date …………………………………………… AUTHENTICITY STATEMENT ‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’ Signed …………………………………………… Date …………………………………………… ii ABSTRACT Cholesterol is necessary for mammalian life, as an essential component in cell membranes, fetal development, and a precursor for steroid hormones. Hence, cholesterol levels must be tightly regulated. Previous research has focused on an early step in cholesterol synthesis: 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR), target of the cholesterol-lowering statin drugs. However, less is known about other steps in the pathway. We investigated 3β-hydroxysterol Δ24-reductase (DHCR24); involved in the last step of cholesterol synthesis, and implicated in inflammation, oxidative stress and hepatitis C infection infection. There is a paucity of fundamental information on the structure DHCR24 and how it interacts with cellular membranes, as well as how this critical enzyme is regulated. We found that DHCR24 is an integral endoplasmic reticulum (ER) membrane protein, with multiple atypical membrane associated regions. Prediction programs and previous studies have shown conflicting results regarding which regions of DHCR24 are associated with the membrane, although there was general agreement that this was limited to only the N-terminal portion. Here, we present biochemical evidence that in fact the majority of the enzyme is associated with the ER membrane. This has important consequences for the many functions attributed to DHCR24. In particular, those that suggest DHCR24 alters its localisation within the cell should be reassessed in light of this new information. We show that DHCR24 is regulated at multiple levels, with potent effects on cholesterol synthesis. Our findings demonstrate feedback regulation at the transcriptional and post-translational level. Transcriptional regulation occurs through dual sterol regulatory elements (SREs) within the DHCR24 promoter, which work cooperatively to regulate expression. DHCR24 is potently inhibited at the post-translational level by endogenous side-chain oxysterols, in particular 24(S),25-epoxycholesterol, and the steroid hormone, progesterone. Another mode of regulation is through signalling. We found that phosphorylation affects DHCR24 activity, at a known phosphorylation site, T110. We found that protein kinase C (PKC) also ablated DHCR24 activity, through an unknown phosphorylation site. These findings indicate DHCR24 may be an important regulatory step in cholesterol synthesis and maintaining cellular cholesterol homeostasis. iii iv LIST OF PUBLICATIONS Zerenturk E.J.*, Kristiana I.*, Gill S., Brown A.J. (2012) The endogenous regulator 24(S),25-epoxycholesterol inhibits cholesterol synthesis at DHCR24 (Seladin-1). Biochim Biophys Acta 1821: 1269-1277. Zerenturk E.J.*, Sharpe L.J.*, Brown A.J. (2012) Sterols regulate 3β-hydroxysterol Δ24-reductase (DHCR24) via dual sterol regulatory elements: cooperative induction of key enzymes in lipid synthesis by Sterol Regulatory Element Binding Proteins. Biochim Biophys Acta 1821: 1350-1360. Zerenturk E.J., Sharpe L.J.,
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • De Novo Sequencing and Transcriptome Analysis Reveal Key Genes Regulating Steroid Metabolism in Leaves, Roots, Adventitious Roots and Calli of Periploca Sepium Bunge
    ORIGINAL RESEARCH published: 21 April 2017 doi: 10.3389/fpls.2017.00594 De novo Sequencing and Transcriptome Analysis Reveal Key Genes Regulating Steroid Metabolism in Leaves, Roots, Adventitious Roots and Calli of Periploca sepium Bunge Jian Zhang 1, 2, 3, Xinglin Li 1, 3*, Fuping Lu 1, 3, Shanying Wang 1, 3, Yunhe An 4, Xiaoxing Su 4, Xiankuan Li 2, Lin Ma 2 and Guangjian Han 5 1 Key Lab of Industrial Fermentation Microbiology, Tianjin University of Science and Technology, Ministry of Education, Tianjin, China, 2 School of Traditional Chinese Materia Medica, Tianjin University of Traditional Chinese Medicine, Tianjin, China, 3 College of Bioengineering, Tianjin University of Science and Technology, Tianjin, China, 4 Beijing Center for Physical and Chemical Analysis, Beijing, China, 5 Shachuan Biotechnology, Tianjin, China Edited by: Periploca sepium Bunge is a traditional medicinal plant, whose root bark is important Peng Zhang, Institute of Plant Physiology and for Chinese herbal medicine. Its major bioactive compounds are C21 steroids and Ecology, SIBS, CAS, China periplocin, a kind of cardiac glycoside, which are derived from the steroid synthesis Reviewed by: pathway. However, research on P. sepium genome or transcriptomes and their related Kun Yu, genes has been lacking for a long time. In this study we estimated this species Hubei University of Chinese Medicine, China nuclear genome size at 170 Mb (using flow cytometry). Then, RNA sequencing of Jun Yang, four different tissue samples of P. sepium (leaves, roots, adventitious roots, and Shanghai Chenshan Plant Science Research Center (CAS), China calli) was done using the sequencing platform Illumina/Solexa Hiseq 2,500.
    [Show full text]
  • Characterization of the Ergosterol Biosynthesis Pathway in Ceratocystidaceae
    Journal of Fungi Article Characterization of the Ergosterol Biosynthesis Pathway in Ceratocystidaceae Mohammad Sayari 1,2,*, Magrieta A. van der Nest 1,3, Emma T. Steenkamp 1, Saleh Rahimlou 4 , Almuth Hammerbacher 1 and Brenda D. Wingfield 1 1 Department of Biochemistry, Genetics and Microbiology, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria 0002, South Africa; [email protected] (M.A.v.d.N.); [email protected] (E.T.S.); [email protected] (A.H.); brenda.wingfi[email protected] (B.D.W.) 2 Department of Plant Science, University of Manitoba, 222 Agriculture Building, Winnipeg, MB R3T 2N2, Canada 3 Biotechnology Platform, Agricultural Research Council (ARC), Onderstepoort Campus, Pretoria 0110, South Africa 4 Department of Mycology and Microbiology, University of Tartu, 14A Ravila, 50411 Tartu, Estonia; [email protected] * Correspondence: [email protected]; Fax: +1-204-474-7528 Abstract: Terpenes represent the biggest group of natural compounds on earth. This large class of organic hydrocarbons is distributed among all cellular organisms, including fungi. The different classes of terpenes produced by fungi are mono, sesqui, di- and triterpenes, although triterpene ergosterol is the main sterol identified in cell membranes of these organisms. The availability of genomic data from members in the Ceratocystidaceae enabled the detection and characterization of the genes encoding the enzymes in the mevalonate and ergosterol biosynthetic pathways. Using Citation: Sayari, M.; van der Nest, a bioinformatics approach, fungal orthologs of sterol biosynthesis genes in nine different species M.A.; Steenkamp, E.T.; Rahimlou, S.; of the Ceratocystidaceae were identified.
    [Show full text]
  • The Role of Genetic Variation in Predisposition to Alcohol-Related Chronic Pancreatitis
    The Role of Genetic Variation in Predisposition to Alcohol-related Chronic Pancreatitis Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Marianne Lucy Johnstone April 2015 The Role of Genetic Variation in Predisposition to Alcohol-related Chronic Pancreatitis 2015 Abstract Background Chronic pancreatitis (CP) is a disease of fibrosis of the pancreas for which alcohol is the main causative agent. However, only a small proportion of alcoholics develop chronic pancreatitis. Genetic polymorphism may affect pancreatitis risk. Aim To determine the factors required to classify a chronic pancreatic population and identify genetic variations that may explain why only some alcoholics develop chronic pancreatitis. Methods The most appropriate method of diagnosing CP was assessed using a systematic review. Genetics of different populations of alcohol-related chronic pancreatitics (ACP) were explored using four different techniques: genome-wide association study (GWAS); custom arrays; PCR of variable nucleotide tandem repeats (VNTR) and next generation sequencing (NGS) of selected genes. Results EUS and sMR were identified as giving the overall best sensitivity and specificity for diagnosing CP. GWAS revealed two associations with CP (identified and replicated) at PRSS1-PRSS2_rs10273639 (OR 0.73, 95% CI 0.68-0.79) and X-linked CLDN2_rs12688220 (OR 1.39, 1.28-1.49) and the association was more pronounced in the ACP group (OR 0.56, 0.48-0.64)and OR 2.11, 1.84-2.42). The previously identified VNTR in CEL was shown to have a lower frequency of the normal repeat in ACP than alcoholic liver disease (ALD; OR 0.61, 0.41-0.93).
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 7,906,710 B2 Karunanandaa Et Al
    US00790671 OB2 (12) United States Patent (10) Patent No.: US 7,906,710 B2 Karunanandaa et al. (45) Date of Patent: *Mar. 15, 2011 (54) TRANSGENIC PLANTS CONTAINING FOREIGN PATENT DOCUMENTS ALTERED LEVELS OF STEROD EP 0486290 11, 1991 COMPOUNDS EP O480730 4f1992 JP O9121863 5, 1997 WO WO93,021.87 2, 1993 (75) Inventors: Balasulojini Karunanandaa, St. Louis, WO WO97/032O2 1, 1997 MO (US); Martha Post-Beittenmiller, WO WO97/34003 9, 1997 St. Louis, MO (US); Mylavarapu WO WO 98.45457 10, 1998 Venkatramesh, St. Louis, MO (US); WO WO99,04622 2, 1999 Ganesh M. Kishore, St. Louis, MO WO WOOOf 61771 10, 2000 (US); Gregory M. Thorne, St. Louis, WO WOO1/31027 3, 2001 MO (US); John R. LeDeaux, St. Louis, MO (US) OTHER PUBLICATIONS Bach et al., “Cloning of cDNAS or genes encoding enzymes of sterol (73) Assignee: Monsanto Company, St. Louis,MO biosynthesis from plants and other eukaryotes: heterologous expres (US) sion and complementation analysis of mutations for functional char acterization.” Progress in Lipid Research, 36(2/3): 197-226, 1997. (*) Notice: Subject to any disclaimer, the term of this Bak et al., “Cloning and expression in Escherichia coli of the patent is extended or adjusted under 35 obtusifoliol 14-alpha-demethylase of Sorghum bicolor (L.) Moench, U.S.C. 154(b) by 0 days. a cytochrome P450 orthologous to the sterol 14-alpha-demethylases This patent is Subject to a terminal dis (CYP51) from fungi and mammals.” Plant Journal, 11(2):191-201, claimer. 1997. Bak et al., “Cloning and expression in Escherichia coli of the obtusifoliol 14-alpha-demethylase of Sorghum bicolor (L.) Moench, (21) Appl.
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • Effects on Steroid 5-Alpha Reductase Gene Expression of Thai Rice Bran Extracts and Molecular Dynamics Study on SRD5A2
    biology Article Effects on Steroid 5-Alpha Reductase Gene Expression of Thai Rice Bran Extracts and Molecular Dynamics Study on SRD5A2 Chiranan Khantham 1 , Wipawadee Yooin 1,2 , Korawan Sringarm 2,3 , Sarana Rose Sommano 2,4 , Supat Jiranusornkul 1, Francisco David Carmona 5,6 , Wutigri Nimlamool 7 , Pensak Jantrawut 1,2, Pornchai Rachtanapun 8,9 and Warintorn Ruksiriwanich 1,2,8,* 1 Department of Pharmaceutical Sciences, Faculty of Pharmacy, Chiang Mai University, Chiang Mai 50200, Thailand; [email protected] (C.K.); [email protected] (W.Y.); [email protected] (S.J.); [email protected] (P.J.) 2 Cluster of Research and Development of Pharmaceutical and Natural Products Innovation for Human or Animal, Chiang Mai University, Chiang Mai 50200, Thailand; [email protected] (K.S.); [email protected] (S.R.S.) 3 Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand 4 Plant Bioactive Compound Laboratory (BAC), Department of Plant and Soil Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand 5 Departamento de Genética e Instituto de Biotecnología, Universidad de Granada, 18071 Granada, Spain; [email protected] 6 Instituto de Investigación Biosanitaria ibs.GRANADA, 18014 Granada, Spain 7 Citation: Khantham, C.; Yooin, W.; Department of Pharmacology, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand; Sringarm, K.; Sommano, S.R.; [email protected] 8 Cluster of Agro Bio-Circular-Green Industry, Faculty of Agro-Industry, Chiang Mai University, Jiranusornkul, S.; Carmona, F.D.; Chiang Mai 50100, Thailand; [email protected] Nimlamool, W.; Jantrawut, P.; 9 School of Agro-Industry, Faculty of Agro-Industry, Chiang Mai University, Chiang Mai 50100, Thailand Rachtanapun, P.; Ruksiriwanich, W.
    [Show full text]
  • Electronic Supplementary Material (ESI) for Metallomics
    Electronic Supplementary Material (ESI) for Metallomics. This journal is © The Royal Society of Chemistry 2018 Uniprot Entry name Gene names Protein names Predicted Pattern Number of Iron role EC number Subcellular Membrane Involvement in disease Gene ontology (biological process) Id iron ions location associated 1 P46952 3HAO_HUMAN HAAO 3-hydroxyanthranilate 3,4- H47-E53-H91 1 Fe cation Catalytic 1.13.11.6 Cytoplasm No NAD biosynthetic process [GO:0009435]; neuron cellular homeostasis dioxygenase (EC 1.13.11.6) (3- [GO:0070050]; quinolinate biosynthetic process [GO:0019805]; response to hydroxyanthranilate oxygenase) cadmium ion [GO:0046686]; response to zinc ion [GO:0010043]; tryptophan (3-HAO) (3-hydroxyanthranilic catabolic process [GO:0006569] acid dioxygenase) (HAD) 2 O00767 ACOD_HUMAN SCD Acyl-CoA desaturase (EC H120-H125-H157-H161; 2 Fe cations Catalytic 1.14.19.1 Endoplasmic Yes long-chain fatty-acyl-CoA biosynthetic process [GO:0035338]; unsaturated fatty 1.14.19.1) (Delta(9)-desaturase) H160-H269-H298-H302 reticulum acid biosynthetic process [GO:0006636] (Delta-9 desaturase) (Fatty acid desaturase) (Stearoyl-CoA desaturase) (hSCD1) 3 Q6ZNF0 ACP7_HUMAN ACP7 PAPL PAPL1 Acid phosphatase type 7 (EC D141-D170-Y173-H335 1 Fe cation Catalytic 3.1.3.2 Extracellular No 3.1.3.2) (Purple acid space phosphatase long form) 4 Q96SZ5 AEDO_HUMAN ADO C10orf22 2-aminoethanethiol dioxygenase H112-H114-H193 1 Fe cation Catalytic 1.13.11.19 Unknown No oxidation-reduction process [GO:0055114]; sulfur amino acid catabolic process (EC 1.13.11.19) (Cysteamine
    [Show full text]
  • Crystal Structure of Steroid Reductase SRD5A Reveals Conserved Steroid Reduction Mechanism
    ARTICLE https://doi.org/10.1038/s41467-020-20675-2 OPEN Crystal structure of steroid reductase SRD5A reveals conserved steroid reduction mechanism Yufei Han 1,9, Qian Zhuang2,9, Bo Sun3,9, Wenping Lv 4,9, Sheng Wang5,9, Qingjie Xiao6, Bin Pang1, ✉ Youli Zhou1, Fuxing Wang1, Pengliang Chi6, Qisheng Wang3, Zhen Li7, Lizhe Zhu 4, Fuping Li8, Dong Deng6 , ✉ ✉ ✉ Ying-Chih Chiang 1 , Zhenfei Li 2 & Ruobing Ren 1 Steroid hormones are essential in stress response, immune system regulation, and repro- 1234567890():,; duction in mammals. Steroids with 3-oxo-Δ4 structure, such as testosterone or progesterone, are catalyzed by steroid 5α-reductases (SRD5As) to generate their corresponding 3-oxo-5α steroids, which are essential for multiple physiological and pathological processes. SRD5A2 is already a target of clinically relevant drugs. However, the detailed mechanism of SRD5A- mediated reduction remains elusive. Here we report the crystal structure of PbSRD5A from Proteobacteria bacterium, a homolog of both SRD5A1 and SRD5A2, in complex with the cofactor NADPH at 2.0 Å resolution. PbSRD5A exists as a monomer comprised of seven transmembrane segments (TMs). The TM1-4 enclose a hydrophobic substrate binding cavity, whereas TM5-7 coordinate cofactor NADPH through extensive hydrogen bonds network. Homology-based structural models of HsSRD5A1 and -2, together with biochemical char- acterization, define the substrate binding pocket of SRD5As, explain the properties of disease-related mutants and provide an important framework for further understanding of the mechanism of NADPH mediated steroids 3-oxo-Δ4 reduction. Based on these analyses, the design of therapeutic molecules targeting SRD5As with improved specificity and therapeutic efficacy would be possible.
    [Show full text]
  • Late Diagnosis of 5Alpha Steroid-Reductase Deficiency Due to IVS12A>G Mutation of the Srd5a2 Gene in an Adolescent Girl Presented with Primary Amenorrhea
    HORMONES 2011, 10(3):230-235 Case Report Late diagnosis of 5alpha steroid-reductase deficiency due to IVS12A>G mutation of the SRD5a2 gene in an adolescent girl presented with primary amenorrhea Nicos Skordis,1,2 Christos Shammas,2 Elisavet Efstathiou,1 Amalia Sertedaki,3 Vassos Neocleous,2 Leonidas Phylactou2 1Pediatric Endocrine Unit, Makarios Hospital, Nicosia, Cyprus, 2Department of Molecular Genetics Function & Therapy, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus, 3Unit of Endocrinology, Diabetes and Metabolism, First Department of Pediatrics, Athens University, Medical School, Athens, Greece ABSTRACT BACKGROUND: The clinical spectrum of 5α-reductase deficiency, caused by mutations in the SRD5A2 gene, ranges from complete female appearance of the external genitalia at birth to nearly complete male phenotype. CASE REPORT: A 14-year-old girl presented with primary amenorrhea (PA) and lack of breast development. She was 173 cm in height, had an increased amount of pubic hair and clitoromegaly (3 cm), with a 4 cm blind vaginal pouch. Gonads were palpable in the inguinal canal bilaterally and no uterus was identified on ultrasound. C hromosomal analysis showed a 46,XY karyotype. The Testosterone/DHT ratio was high (16.5) and further increased to 29.4 after stimulation with hCG, thus favouring the diagnosis of 5α-reductase deficiency. Since the issue of gender change was not considered, gonadectomy was performed followed by successful feminisation with hormonal replacement therapy. GE- NETIC STUDIES: Molecular analysis of the SRD5A2 gene by DNA sequencing of all 5 exons revealed the presence of the splice mutation A>G at position -2 of the acceptor site of intron 1/exon 2 (IVS1-2A>G) in homozygosity.
    [Show full text]
  • Optimizing Cellular Metabolism to Improve Chronic Skin Wound Healing
    Optimizing Cellular Metabolism to Improve Chronic Skin Wound Healing James J. Slade Honors Thesis Luis Felipe Ramirez Biomedical Engineering Rutgers University, New Brunswick Under the direction of Dr. Francois Berthiaume and Dr. Gabriel Yarmush Abstract—Despite significant advances, chronic skin wounds Wound healing is a complex process with four identifiable remain a large problem both in terms of morbidity and cost. It stages: hemostasis, inflammation, proliferation, and remodel- is estimated that in the United States, this problem afflicts 6.5 ing [6]. Hemostasis involves the formation of a blood clot that million people a year and costs more than 30 billion dollars for di- abetic foot ulcers alone [4,11]. Currently approved treatments are stops the loss of blood at the site of injury [6]. Growth factors often ineffective. This thesis seeks to leverage the large amount of released by activated platelets during the hemostasis stage information that has accumulated about metabolism in the hu- recruit immune cells such as neutrophils and macrophages [6]. man body, and to mine that information with computational mod- The infiltration of the injured tissue with these immune cells eling. It seeks to uncover whether metabolites commonly available leads to the inflammatory phase [6]. The role played by inflam- in the human body can be used to bolster the metabolism of wounded cells such as keratinocytes (the cells that form the mation is classified as both positive and negative [5]. On the epidermis), and therefore improve the natural process of wound one hand the inflammatory response clears the wound site of healing. This would offer treatment options with fewer side effects pathogens and dead cells, on the other hand the inflammatory than what is currently offered to improve wound healing.
    [Show full text]
  • Disruption of Androgen Metabolism, Regulation and Effects: Involvement of Steroidogenic Enzymes
    Disruption of Androgen Metabolism, Regulation and Effects: Involvement of Steroidogenic Enzymes Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Cornelia Fürstenberger, aus Basel, Schweiz Basel, 2014 Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät auf Antrag von Prof. Dr. Alex Odermatt (Fakultätsverantwortlicher) ________________________ Fakultätsverantwortlicher Prof. Dr. Alex Odermatt und Prof. Dr. Rik Eggen (Korreferent) ________________________ Korreferent Prof. Dr. Rik Eggen Basel, den 20. Mai 2014 ________________________ Dekan Prof. Dr. Jörg Schibler 2 Table of content Table of content I. Abbreviations ................................................................................................................................. 6 1. Summary ........................................................................................................................................ 9 2. Introduction .................................................................................................................................. 12 2.1 Steroid hormones .................................................................................................................. 12 2.2 Steroidogenesis ..................................................................................................................... 14 2.3 Steroid hormones in health and disease ..............................................................................
    [Show full text]