DOCSLIB.ORG

Late Diagnosis of 5Alpha Steroid-Reductase Deficiency Due to IVS12A>G Mutation of the Srd5a2 Gene in an Adolescent Girl Presented with Primary Amenorrhea

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Late Diagnosis of 5Alpha Steroid-Reductase Deficiency Due to IVS12A>G Mutation of the Srd5a2 Gene in an Adolescent Girl Presented with Primary Amenorrhea HORMONES 2011, 10(3):230-235 Case Report Late diagnosis of 5alpha steroid-reductase deficiency due to IVS12A>G mutation of the SRD5a2 gene in an adolescent girl presented with primary amenorrhea Nicos Skordis,1,2 Christos Shammas,2 Elisavet Efstathiou,1 Amalia Sertedaki,3 Vassos Neocleous,2 Leonidas Phylactou2 1Pediatric Endocrine Unit, Makarios Hospital, Nicosia, Cyprus, 2Department of Molecular Genetics Function & Therapy, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus, 3Unit of Endocrinology, Diabetes and Metabolism, First Department of Pediatrics, Athens University, Medical School, Athens, Greece ABSTRACT BACKGROUND: The clinical spectrum of 5α-reductase deficiency, caused by mutations in the SRD5A2 gene, ranges from complete female appearance of the external genitalia at birth to nearly complete male phenotype. CASE REPORT: A 14-year-old girl presented with primary amenorrhea (PA) and lack of breast development. She was 173 cm in height, had an increased amount of pubic hair and clitoromegaly (3 cm), with a 4 cm blind vaginal pouch. Gonads were palpable in the inguinal canal bilaterally and no uterus was identified on ultrasound. C hromosomal analysis showed a 46,XY karyotype. The Testosterone/DHT ratio was high (16.5) and further increased to 29.4 after stimulation with hCG, thus favouring the diagnosis of 5α-reductase deficiency. Since the issue of gender change was not considered, gonadectomy was performed followed by successful feminisation with hormonal replacement therapy. GE- NETIC STUDIES: Molecular analysis of the SRD5A2 gene by DNA sequencing of all 5 exons revealed the presence of the splice mutation A>G at position -2 of the acceptor site of intron 1/exon 2 (IVS1-2A>G) in homozygosity. Both non-consanguineous parents were found to be heterozygotes for this mutation. CONCLUSIONS: Although rare, SRD5A2 gene defect should be suspected in any girl presenting with PA and virilisation at puberty. The IVS1-2A>G muta- tion of the SRD5A2 gene predominates in Greek-Cypriot patients with 5α-reductase deficiency and very likely reflects a founder effect. Key words: 46,XY disorder of sex development (DSD), 5α-reductase, Male pseudohermaphro- ditism, SRD5A2 gene Address for correspondence: INTRODUCTION Nicos Skordis, MD, Pediatric Endocrine Unit, Dept of Paediatrics, Nicosia 1474, Cyprus, Tel.: +357 22405000, Dihydrotestosterone (DHT) is essential for the Fax: +357 22305072, e-mail: [email protected] normal development of male external genitalia. DHT Received 02-01-11, Revised 02-03-11, Accepted 22-04-11 is derived from testosterone (T) by a process catalysed Late diagnosis of 5alpha-reductase deficiency 231 by the membrane-bound steroid 5a-reductase enzyme. CASE PRESENTATION Impaired DHT synthesis caused by 5alpha steroid A 14-year-old girl of non-consanguineous parents reductase deficiency (5α-reductase deficiency) can presented with PA and lack of breast development. lead to incomplete masculinisation of the external She was 173 cm in height, obviously virilised with genitalia in subjects with a 46,XY karyotype.1 The clini- an increased amount of pubic hair extended to the cal spectrum of a 46,XY individual with 5α-reductase inner thigh area and clitoromegaly (3 cm). She also deficiency at birth can range from complete female had a deep voice and prominent Adam’s apple. Go- appearance of the external genitalia to nearly complete nads were palpable in the inguinal canal bilaterally. male phenotype. Most patients, however, present She underwent a gynaecological examination which with genital ambiguity and are diagnosed in infancy. showed a 4 cm blind vaginal pouch. No uterus was At puberty 46,XY patients show virilisation without identified on pelvic ultrasound. breast development, often accompanied by gender identity change, from female to male in individuals in whom gonads had not been removed.2-5 LAORBORAT Y INVESTIGATION AND RESULTS The enzyme steroid 5α-reductase exists as two Chromosomal analysis showed a normal male isoforms, 5α-R type 1 and 5α-R type 2, which have 46,XY karyotype. The diagnosis of 5α-reductase a different expression pattern. Type 1 isoenzyme is deficiency was suspected based on biochemical find- encoded by the SRD5A1 gene located on chromosome ings at base line and following hCG stimulation 5 and expressed at low levels in the prostate, whereas test (hCG 3000 Units daily for 3 consecutive days). type 2 isoenzyme is encoded by the SRD5A2 gene As shown in Table 1, the patient’s Testosterone to that maps on chromosome 2 and is expressed at high DHT ratio (T/DHT) was elevated before (16.6) and levels in the prostate and in many other androgen- further increased after hCG stimulation (29.5). The sensitive tissues.6 diagnosis of 17β-HSD-3, which may have similar 5α-reductase deficiency is caused by mutations clinical presentation, seemed unlikely because of the in the SRD5A2 gene, whereas the SRD5A1 gene has normal response of androstenedione. not been found to be mutated in this disease. To Molecular studies date, 54 different mutations of the SRD5A2 gene The screening for the IVS1-2A>G mutation in have been reported 42 of which are missense/non- our population previously reported showed a carrier sense mutations (http://www.hgmd.cf.ac.uk/ac/gene. php?gene=SRD5A2). Several SRD5A2 mutations have been identified in various populations, while others have only been described in specific ethnic groups. Table 1. Results of the hCG stimulation test (A) and the GnRH Given the significant advances in understanding the stimulation test (B) molecular basis of abnormal sexual development, it A is important to integrate current knowledge to estab- Hormones Before After lish the exact diagnosis in any subject with defects in Testosterone nmol/L 18.2 32.4 sexual differentiation. DHEAS nmol/L 4838.4 5199.4 Although most individuals with 5α-reductase de- Androsteredione nmol/L 18.5 17.5 ficiency are identified in the neonatal period because DHT nmol/L 1.10 1.10 of ambiguous genitalia, some are misdiagnosed as T/DHT 16.6 29.5 androgen insensitivity syndrome, as they often present B with the same clinical phenotype, while others escape Hormones 0 30 60 recognition completely. The current report describes FSH IU/L 10.7 17.7 20.2 the identification of the IVS1-2A>G mutation of LH IU/L 6.7 49.5 49 the SRD5A2 gene in homozygosity in an adolescent Estradiol pmol/L 102.3 - - girl presented with primary amenorrhea (PA) and SHBG nmol/L 24 - - virilisation. 232 N. SKORDIS ET AL rate of 0.98%, or 2 in 204 [95% Poisson confidence this stage. The patient was subsequently placed on interval (CI), 0.12-3.54% and/or using the binomial hormonal replacement therapy and she was success- CI, 0.12-3.5%].7 fully feminised. DNA sequencing of all five exons of the SRD5A2 gene was carried out in the patient and her parents, DISCUSSION 8 as previously described. Briefly, genomic DNA was The present report describes the clinical and mo- subjected to PCR amplification with the forward lecular characteristics of a 14-year-old virilised girl, primer 5’ gttaaggcgaaatggcagag 3’ and the reverse who presented with PA and was finally diagnosed primer 5’acgaggtcattgcagtaggg 3’, which selectively as a 46,XY individual with 5α-reductase deficiency. amplify part of intron 1 and exon 2 of the SRD5A2 The typical clinical features in 46,XY males with gene producing a fragment of 382 bp. For the de- 5α-reductase deficiency are generally those initially tection of the IVS1-2A>G mutation at the splice reported.4 Currently, the diagnosis of 5α-reductase junction intron 1/exon 2, BstNI restriction enzyme deficiency is usually made in the newborn period digest was performed. For confirmation of the iden- because most affected individuals present with am- tified IVS1-2A>G mutation, direct sequencing was biguous genitalia.9 Some children, however, either also employed on an automated Beckman Coulter escape diagnosis or they are misdiagnosed as having CEQ 2000 sequencer. The IVS1-2A>G mutation of partial or complete androgen insensitivity syndrome. SRD5A2 gene was identified in a homozygous state The application of molecular testing is a mandatory in our patient (Figure 1). diagnostic tool for identifying the underlying cause, The diagnosis of SRD5A2 was confirmed by mo- since biochemical findings in such cases can be mis- lecular studies as indicated above. The subsequent leading.7,10 The molecular diagnostic approach using and difficult decision to be made was the possible genetic screening of the SRD5A2 gene permits diagno- gender change and consequent maintenance or re- sis without the need of dynamic testing even in patients moval of the gonads. Based on an extensive discussion, who had their testes removed.4 If the diagnosis is not genetic counselling and psychological support of the made at an early age, the child begins to virilise rather parents, the issue of gender change at this critical than feminise at puberty if the gonads have not been age of the patient was not considered appropriate or removed. The clinical signs in the present case are acceptable. Therefore, gonadectomy was performed those seen in affected individuals at puberty, namely with no plastic surgery of the external genitalia at enlargement of the phallus, virilisation, deepening of the voice, prominent Adam’s apple and absence of breast development. The late diagnosis of affected males with 5α-reductase deficiency has been less commonly reported in recent studies compared to earlier pub- lications, in which the majority of the 168 reported cases were diagnosed in infancy or childhood.4,5,8-36 Most affected subjects with 5α-reductase deficiency presented striking ambiguity of the genitalia with a clitoral-like phallus, severely bifid scrotum, pseu- dovaginal perineoscrotal hypospadias and a rudimen- tary prostate. More masculinised individuals lacked a separate vaginal opening or had a blind vaginal pouch which opened into the urethra.
Load more

Recommended publications
  • De Novo Sequencing and Transcriptome Analysis Reveal Key Genes Regulating Steroid Metabolism in Leaves, Roots, Adventitious Roots and Calli of Periploca Sepium Bunge
    ORIGINAL RESEARCH published: 21 April 2017 doi: 10.3389/fpls.2017.00594 De novo Sequencing and Transcriptome Analysis Reveal Key Genes Regulating Steroid Metabolism in Leaves, Roots, Adventitious Roots and Calli of Periploca sepium Bunge Jian Zhang 1, 2, 3, Xinglin Li 1, 3*, Fuping Lu 1, 3, Shanying Wang 1, 3, Yunhe An 4, Xiaoxing Su 4, Xiankuan Li 2, Lin Ma 2 and Guangjian Han 5 1 Key Lab of Industrial Fermentation Microbiology, Tianjin University of Science and Technology, Ministry of Education, Tianjin, China, 2 School of Traditional Chinese Materia Medica, Tianjin University of Traditional Chinese Medicine, Tianjin, China, 3 College of Bioengineering, Tianjin University of Science and Technology, Tianjin, China, 4 Beijing Center for Physical and Chemical Analysis, Beijing, China, 5 Shachuan Biotechnology, Tianjin, China Edited by: Periploca sepium Bunge is a traditional medicinal plant, whose root bark is important Peng Zhang, Institute of Plant Physiology and for Chinese herbal medicine. Its major bioactive compounds are C21 steroids and Ecology, SIBS, CAS, China periplocin, a kind of cardiac glycoside, which are derived from the steroid synthesis Reviewed by: pathway. However, research on P. sepium genome or transcriptomes and their related Kun Yu, genes has been lacking for a long time. In this study we estimated this species Hubei University of Chinese Medicine, China nuclear genome size at 170 Mb (using flow cytometry). Then, RNA sequencing of Jun Yang, four different tissue samples of P. sepium (leaves, roots, adventitious roots, and Shanghai Chenshan Plant Science Research Center (CAS), China calli) was done using the sequencing platform Illumina/Solexa Hiseq 2,500.
    [Show full text]
  • Characterization of the Ergosterol Biosynthesis Pathway in Ceratocystidaceae
    Journal of Fungi Article Characterization of the Ergosterol Biosynthesis Pathway in Ceratocystidaceae Mohammad Sayari 1,2,*, Magrieta A. van der Nest 1,3, Emma T. Steenkamp 1, Saleh Rahimlou 4 , Almuth Hammerbacher 1 and Brenda D. Wingfield 1 1 Department of Biochemistry, Genetics and Microbiology, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria 0002, South Africa; [email protected] (M.A.v.d.N.); [email protected] (E.T.S.); [email protected] (A.H.); brenda.wingfi[email protected] (B.D.W.) 2 Department of Plant Science, University of Manitoba, 222 Agriculture Building, Winnipeg, MB R3T 2N2, Canada 3 Biotechnology Platform, Agricultural Research Council (ARC), Onderstepoort Campus, Pretoria 0110, South Africa 4 Department of Mycology and Microbiology, University of Tartu, 14A Ravila, 50411 Tartu, Estonia; [email protected] * Correspondence: [email protected]; Fax: +1-204-474-7528 Abstract: Terpenes represent the biggest group of natural compounds on earth. This large class of organic hydrocarbons is distributed among all cellular organisms, including fungi. The different classes of terpenes produced by fungi are mono, sesqui, di- and triterpenes, although triterpene ergosterol is the main sterol identified in cell membranes of these organisms. The availability of genomic data from members in the Ceratocystidaceae enabled the detection and characterization of the genes encoding the enzymes in the mevalonate and ergosterol biosynthetic pathways. Using Citation: Sayari, M.; van der Nest, a bioinformatics approach, fungal orthologs of sterol biosynthesis genes in nine different species M.A.; Steenkamp, E.T.; Rahimlou, S.; of the Ceratocystidaceae were identified.
    [Show full text]
  • Polycystic Ovary Syndrome
    Review: Polycystic ovary syndrome Polycystic ovary syndrome Maharaj S, MBChB, FCP(SA) Amod A, MBChB, FCP(SA) Department of Endocrinology and Metabolism, Division of Medicine, Nelson R Mandela School of Medicine, University of KwaZulu-Natal, South Africa Correspondence to: Dr Sureka Maharaj, e-mail: [email protected] Keywords: polycystic ovary syndrome, PCOS, polycystic ovarian disease, PCOD, polycystic ovarian morphology, PCOM Introduction The description of polycystic ovaries dates back as far as 17211 but it was Stein and Leventhal who first reported the disorder, that we now know as the polycystic ovary (or ovarian) syndrome (PCOS), in seven women with amenorrhoea, enlarged ovaries with multiple cysts and hirsutism.2 These patients were treated with ovarian wedge resection and of the seven all had return of their menstrual cycles, and two conceived. With the advent of hormonal assays in the late 1960’s and early 1970’s, the diagnostic focus expanded to include endocrine abnormalities in the hypothalamic-pituitary-gonadal (HPG) axis.3 Elevated luteinising hormone (LH) levels and hyperandrogenaemia were therefore added to the diagnostic criteria for PCOS.4 The advent of pelvic ultrasonography in the late 1970’s allowed for the non-invasive detection of polycystic ovarian morphology. However, this tool confounded matters when it was discovered that polycystic ovaries was a “common finding in normal women”,5 and that it also occurred in diverse endocrine disorders such as hypothyroidism, hyperprolactinaemia, congenital adrenal hyperplasia and hypothalamic amenorrhoea.6 The finding of polycystic ovaries in normal women has been variably referred to as polycystic ovarian disease (PCOD), polycystic ovaries (PCO) and polycystic ovarian morphology (PCOM).
    [Show full text]
  • Anne Tamar-Mattis, JD* Advocates for Informed Choice
    Report to the Inter-American Commission on Human Rights: Medical Treatment of People with Intersex Conditions as a Human Rights Violation Anne Tamar-Mattis, JD* Advocates for Informed Choice March 13, 2013 I. Introduction Americans born with intersex conditions, or variations of sex anatomy, face a wide range of violations to their sexual and reproductive rights, as well as the rights to bodily integrity and individual autonomy. Beginning in infancy and continuing throughout childhood, children with intersex conditions are subject to irreversible sex assignment and involuntary genital normalizing surgery, sterilization, medical display and photography of the genitals, and medical experimentation. In adulthood, and sometimes in childhood, people with intersex conditions may also be denied necessary medical treatment. Moreover, intersex individuals suffer life-long physical and emotional injury as a result of such treatment. These human rights violations often involve tremendous physical and psychological pain and arguably rise to the level of torture or cruel, inhuman, or degrading treatment (CIDT).† The treatment experienced by American intersex people is a violation of the American Convention on Human Rights. The Convention recognizes torture and cruel, inhuman, or degrading treatment (CIDT) as human rights abuses. Under Article V, “(1) Every person has the right to have his physical, mental, and moral integrity respected. (2) No one shall be subjected to torture or to cruel, inhuman, or degrading punishment or treatment.” §1-2. In order to demonstrate why specific medical practices are human rights abuses against intersex people, we have applied Article 16 of the Convention Against Torture (CAT), and interpretations by the European Court of Human Rights and the mandate of the Special Rapporteur on Torture (SRT).
    [Show full text]
  • 46 XY Gonadal Dysgenesis in Adulthood 'Pitfalls of Late Diagnosis'
    BMJ Case Reports: first published as 10.1136/bcr.12.2010.3626 on 10 February 2012. Downloaded from Reminder of important clinical lesson 46 XY gonadal dysgenesis in adulthood ‘pitfalls of late diagnosis’ Jarna Naing Hamin, 1 Francis Raymond P Arkoncel,2 Frances Lina Lantion-Ang, 1 1 Mark Anthony S Sandoval 1 Section of Endocrinology, Diabetes and Metabolism, Department of Medicine, Philippine General Hospital, University of the Philippines Manila, Manila, Philippines ; 2 Division of Urology, Department of Surgery, Philippine General Hospital, University of the Philippines Manila, Manila, Philippines Correspondence to Dr Mark Anthony S Sandoval, [email protected] Summary Disorders of sex development (DSD) include congenital conditions where developments of chromosomal, gonadal or anatomical sex are atypical. Ostrer in 2000, reported a prevalence of 1:20 000 for 46 XY DSD and complete gonadal dysgenesis. A 21-year-old patient consulted for sexual ambiguity at the out-patient department of the Philippine general hospital. At birth, the perceived female external genitalia and clitoromegaly, led the parents to register and eventually rear the patient as a female. At puberty, he developed masculine features and growth of phallus. Patient was more interested in male activities and began to identify himself as male in the community. The discrepancy between his birth certifi cate and his male gender jeopardised his ambition to become a policeman; this led him to seek medical consult. On physical examination, he was phenotypically male. The external genitalia showed the phallus length of 3.5 cm and perineoscrotal hypospadias. Chromosomal sex was normal 46 XY with neither numerical nor structural aberrations in all cell lines, serum testosterone was low and gonadotrophins were elevated.
    [Show full text]
  • 5-Α Reductase Deficiency in Two Siblings: a Case Report
    Elmer ress Case Report J Med Cases. 2016;7(7):263-265 5-α Reductase Deficiency in Two Siblings: A Case Report Ivana Capina, c, Mary Ryanb Abstract genitalia and undervirilization [4]. Androgen receptors must be present and responsive to DHT and testosterone in order for A deficiency of 5-α reductase is a rare genetic disorder that affects external sexual characteristics to take effect. A defect in any of 46,XY patients. The lack of enzyme causes inadequate differen- the previously mentioned enzymes or hormone receptors could tiation of the gonads, leading to ambiguous genitalia or complete lead to discordance between genotype and phenotype [5]. feminization of the external genitalia. Two sisters presented to their Androgen insensitivity is the most common disorder endocrinologist complaining of primary amenorrhea. Molecular stud- of sexual development with an incidence of 2:100,000 to ies revealed the SRD5A2 His231Arg gene mutation and karyotype 5:100,000 [6]. It is an X-linked recessive disorder in which showed 46,XY genotype. The diagnosis was supported by their high there are mutations coding for the androgen receptor leading to testosterone/dihydrotestosterone (DHT) ratio, response to the hCG partial androgen insensitivity, complete androgen insensitivity stimulation test and their elevated sex hormone binding globulin or mild androgen insensitivity [5]. Partial androgen insensitiv- (SHBG) levels. The siblings continued to identify as the female gen- ity syndrome (PAIS) is just as common as complete androgen der and were placed on oral premarin to develop secondary female insensitivity syndrome (CAIS), if not more [6]. Since it is the sexual characteristics.
    [Show full text]
  • Effects on Steroid 5-Alpha Reductase Gene Expression of Thai Rice Bran Extracts and Molecular Dynamics Study on SRD5A2
    biology Article Effects on Steroid 5-Alpha Reductase Gene Expression of Thai Rice Bran Extracts and Molecular Dynamics Study on SRD5A2 Chiranan Khantham 1 , Wipawadee Yooin 1,2 , Korawan Sringarm 2,3 , Sarana Rose Sommano 2,4 , Supat Jiranusornkul 1, Francisco David Carmona 5,6 , Wutigri Nimlamool 7 , Pensak Jantrawut 1,2, Pornchai Rachtanapun 8,9 and Warintorn Ruksiriwanich 1,2,8,* 1 Department of Pharmaceutical Sciences, Faculty of Pharmacy, Chiang Mai University, Chiang Mai 50200, Thailand; [email protected] (C.K.); [email protected] (W.Y.); [email protected] (S.J.); [email protected] (P.J.) 2 Cluster of Research and Development of Pharmaceutical and Natural Products Innovation for Human or Animal, Chiang Mai University, Chiang Mai 50200, Thailand; [email protected] (K.S.); [email protected] (S.R.S.) 3 Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand 4 Plant Bioactive Compound Laboratory (BAC), Department of Plant and Soil Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand 5 Departamento de Genética e Instituto de Biotecnología, Universidad de Granada, 18071 Granada, Spain; [email protected] 6 Instituto de Investigación Biosanitaria ibs.GRANADA, 18014 Granada, Spain 7 Citation: Khantham, C.; Yooin, W.; Department of Pharmacology, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand; Sringarm, K.; Sommano, S.R.; [email protected] 8 Cluster of Agro Bio-Circular-Green Industry, Faculty of Agro-Industry, Chiang Mai University, Jiranusornkul, S.; Carmona, F.D.; Chiang Mai 50100, Thailand; [email protected] Nimlamool, W.; Jantrawut, P.; 9 School of Agro-Industry, Faculty of Agro-Industry, Chiang Mai University, Chiang Mai 50100, Thailand Rachtanapun, P.; Ruksiriwanich, W.
    [Show full text]
  • Crystal Structure of Steroid Reductase SRD5A Reveals Conserved Steroid Reduction Mechanism
    ARTICLE https://doi.org/10.1038/s41467-020-20675-2 OPEN Crystal structure of steroid reductase SRD5A reveals conserved steroid reduction mechanism Yufei Han 1,9, Qian Zhuang2,9, Bo Sun3,9, Wenping Lv 4,9, Sheng Wang5,9, Qingjie Xiao6, Bin Pang1, ✉ Youli Zhou1, Fuxing Wang1, Pengliang Chi6, Qisheng Wang3, Zhen Li7, Lizhe Zhu 4, Fuping Li8, Dong Deng6 , ✉ ✉ ✉ Ying-Chih Chiang 1 , Zhenfei Li 2 & Ruobing Ren 1 Steroid hormones are essential in stress response, immune system regulation, and repro- 1234567890():,; duction in mammals. Steroids with 3-oxo-Δ4 structure, such as testosterone or progesterone, are catalyzed by steroid 5α-reductases (SRD5As) to generate their corresponding 3-oxo-5α steroids, which are essential for multiple physiological and pathological processes. SRD5A2 is already a target of clinically relevant drugs. However, the detailed mechanism of SRD5A- mediated reduction remains elusive. Here we report the crystal structure of PbSRD5A from Proteobacteria bacterium, a homolog of both SRD5A1 and SRD5A2, in complex with the cofactor NADPH at 2.0 Å resolution. PbSRD5A exists as a monomer comprised of seven transmembrane segments (TMs). The TM1-4 enclose a hydrophobic substrate binding cavity, whereas TM5-7 coordinate cofactor NADPH through extensive hydrogen bonds network. Homology-based structural models of HsSRD5A1 and -2, together with biochemical char- acterization, define the substrate binding pocket of SRD5As, explain the properties of disease-related mutants and provide an important framework for further understanding of the mechanism of NADPH mediated steroids 3-oxo-Δ4 reduction. Based on these analyses, the design of therapeutic molecules targeting SRD5As with improved specificity and therapeutic efficacy would be possible.
    [Show full text]
  • Disruption of Androgen Metabolism, Regulation and Effects: Involvement of Steroidogenic Enzymes
    Disruption of Androgen Metabolism, Regulation and Effects: Involvement of Steroidogenic Enzymes Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der Universität Basel von Cornelia Fürstenberger, aus Basel, Schweiz Basel, 2014 Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät auf Antrag von Prof. Dr. Alex Odermatt (Fakultätsverantwortlicher) ________________________ Fakultätsverantwortlicher Prof. Dr. Alex Odermatt und Prof. Dr. Rik Eggen (Korreferent) ________________________ Korreferent Prof. Dr. Rik Eggen Basel, den 20. Mai 2014 ________________________ Dekan Prof. Dr. Jörg Schibler 2 Table of content Table of content I. Abbreviations ................................................................................................................................. 6 1. Summary ........................................................................................................................................ 9 2. Introduction .................................................................................................................................. 12 2.1 Steroid hormones .................................................................................................................. 12 2.2 Steroidogenesis ..................................................................................................................... 14 2.3 Steroid hormones in health and disease ..............................................................................
    [Show full text]
  • Health and Wellbeing of People with Intersex Variations Information and Resource Paper
    Health and wellbeing of people with intersex variations Information and resource paper The Victorian Government acknowledges Victorian Aboriginal people as the First Peoples and Traditional Owners and Custodians of the land and water on which we rely. We acknowledge and respect that Aboriginal communities are steeped in traditions and customs built on a disciplined social and cultural order that has sustained 60,000 years of existence. We acknowledge the significant disruptions to social and cultural order and the ongoing hurt caused by colonisation. We acknowledge the ongoing leadership role of Aboriginal communities in addressing and preventing family violence and will continue to work in collaboration with First Peoples to eliminate family violence from all communities. Family Violence Support If you have experienced violence or sexual assault and require immediate or ongoing assistance, contact 1800 RESPECT (1800 737 732) to talk to a counsellor from the National Sexual Assault and Domestic Violence hotline. For confidential support and information, contact Safe Steps’ 24/7 family violence response line on 1800 015 188. If you are concerned for your safety or that of someone else, please contact the police in your state or territory, or call 000 for emergency assistance. To receive this publication in an accessible format, email the Diversity unit <[email protected]> Authorised and published by the Victorian Government, 1 Treasury Place, Melbourne. © State of Victoria, Department of Health and Human Services, March 2019 Victorian Department of Health and Human Services (2018) Health and wellbeing of people with intersex variations: information and resource paper. Initially prepared by T.
    [Show full text]
  • Intersex Conditions and Differences of Sex Development
    Intersex conditions and differences of sex development: Theology, ethics, and care Author: Erik Lenhart Persistent link: http://hdl.handle.net/2345/bc-ir:105008 This work is posted on eScholarship@BC, Boston College University Libraries. Boston College Electronic Thesis or Dissertation, 2015 Copyright is held by the author, with all rights reserved, unless otherwise noted. Lenhart 1 Intersex Conditions and Differences of Sex Development: Theology, Ethics, and Care A Thesis Submitted in Partial Fulfillment of the Requirements for the S.T.L. Degree of Boston College School of Theology and Ministry by Erik Lenhart, OFM Cap. Director: Lisa Sowle-Cahill Reader: Andrea Vicini, S.J. Spring 2015 Lenhart 2 Table of Contents Thesis Abstract 3 Acknowledgements 4 Preface 5 Foreword: A Word on Words 7 Introduction: Fiction and Reality 10 Chapter 1: Defining Intersexuality 12 Chapter 2: History of Care and Classification 20 Chapter 3: Theories and Practice in the 21st Century 31 Chapter 4: Catholic Responses: Foundations of 39 Anthropology and Prudent Reflections on Intersex Chapter 5: Hearing Intersex Voices and 70 Promoting Flourishing and Vocation Conclusion: Variation in the Body of Christ 81 Bibliography 83 Lenhart 3 Abstract Intersex conditions (ICs) or disorders of sex development (DSDs) are biological variations that cause difficulties in determining whether a person is male or female at birth. In the 1950s, cosmetic surgery aimed to “normalize” the infant’s body became the standard of care when a child is born with an IC/DSD. Many adults who were operated on as infants, however, have begun to voice their dissatisfaction with the surgeries, which have caused tremendous long-term physical and emotional pain.
    [Show full text]
  • Characterization of Precursor-Dependent Steroidogenesis in Human Prostate Cancer Models
    cancers Article Characterization of Precursor-Dependent Steroidogenesis in Human Prostate Cancer Models Subrata Deb 1 , Steven Pham 2, Dong-Sheng Ming 2, Mei Yieng Chin 2, Hans Adomat 2, Antonio Hurtado-Coll 2, Martin E. Gleave 2,3 and Emma S. Tomlinson Guns 2,3,* 1 Department of Pharmaceutical Sciences, College of Pharmacy, Larkin University, Miami, FL 33169, USA; [email protected] 2 The Vancouver Prostate Centre at Vancouver General Hospital, 2660 Oak Street, Vancouver, BC V6H 3Z6, Canada; [email protected] (S.P.); [email protected] (D.-S.M.); [email protected] (M.Y.C.); [email protected] (H.A.); [email protected] (A.H.-C.); [email protected] (M.E.G.) 3 Department of Urologic Sciences, Faculty of Medicine, University of British Columbia, Vancouver, BC V5Z 1M9, Canada * Correspondence: [email protected]; Tel.: +1-604-875-4818 Received: 14 August 2018; Accepted: 17 September 2018; Published: 20 September 2018 Abstract: Castration-resistant prostate tumors acquire the independent capacity to generate androgens by upregulating steroidogenic enzymes or using steroid precursors produced by the adrenal glands for continued growth and sustainability. The formation of steroids was measured by liquid chromatography-mass spectrometry in LNCaP and 22Rv1 prostate cancer cells, and in human prostate tissues, following incubation with steroid precursors (22-OH-cholesterol, pregnenolone, 17-OH-pregnenolone, progesterone, 17-OH-progesterone). Pregnenolone, progesterone, 17-OH-pregnenolone, and 17-OH-progesterone increased C21 steroid (5-pregnan-3,20-dione, 5-pregnan-3,17-diol-20-one, 5-pregnan-3-ol-20-one) formation in the backdoor pathway, and demonstrated a trend of stimulating dihydroepiandrosterone or its precursors in the backdoor pathway in LNCaP and 22Rv1 cells.
    [Show full text]