DOCSLIB.ORG

(12) United States Patent (10) Patent No.: US 7,906,710 B2 Karunanandaa Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) United States Patent (10) Patent No.: US 7,906,710 B2 Karunanandaa Et Al US00790671 OB2 (12) United States Patent (10) Patent No.: US 7,906,710 B2 Karunanandaa et al. (45) Date of Patent: *Mar. 15, 2011 (54) TRANSGENIC PLANTS CONTAINING FOREIGN PATENT DOCUMENTS ALTERED LEVELS OF STEROD EP 0486290 11, 1991 COMPOUNDS EP O480730 4f1992 JP O9121863 5, 1997 WO WO93,021.87 2, 1993 (75) Inventors: Balasulojini Karunanandaa, St. Louis, WO WO97/032O2 1, 1997 MO (US); Martha Post-Beittenmiller, WO WO97/34003 9, 1997 St. Louis, MO (US); Mylavarapu WO WO 98.45457 10, 1998 Venkatramesh, St. Louis, MO (US); WO WO99,04622 2, 1999 Ganesh M. Kishore, St. Louis, MO WO WOOOf 61771 10, 2000 (US); Gregory M. Thorne, St. Louis, WO WOO1/31027 3, 2001 MO (US); John R. LeDeaux, St. Louis, MO (US) OTHER PUBLICATIONS Bach et al., “Cloning of cDNAS or genes encoding enzymes of sterol (73) Assignee: Monsanto Company, St. Louis,MO biosynthesis from plants and other eukaryotes: heterologous expres (US) sion and complementation analysis of mutations for functional char acterization.” Progress in Lipid Research, 36(2/3): 197-226, 1997. (*) Notice: Subject to any disclaimer, the term of this Bak et al., “Cloning and expression in Escherichia coli of the patent is extended or adjusted under 35 obtusifoliol 14-alpha-demethylase of Sorghum bicolor (L.) Moench, U.S.C. 154(b) by 0 days. a cytochrome P450 orthologous to the sterol 14-alpha-demethylases This patent is Subject to a terminal dis (CYP51) from fungi and mammals.” Plant Journal, 11(2):191-201, claimer. 1997. Bak et al., “Cloning and expression in Escherichia coli of the obtusifoliol 14-alpha-demethylase of Sorghum bicolor (L.) Moench, (21) Appl. No.: 12/477,673 a cytochrome P450 orthologous to the sterol 14-alpha-demethylases (CYP51) from fungi and mammals.” EMBL Onlinel, Database (22) Filed: Jun. 3, 2009 Accession No. U74319, abstract, 1996. Bard et al., “Genetic and biochemical aspects of yeast sterol regula (65) Prior Publication Data tion involving 3-hydroxy-3-methylglutaryl coenzyme A reductase.” US 201O/OO37354 A1 Feb. 11, 2010 J. General Microbiology, 125:415-420, 1981. Basson et al., “Structural and functional conservation between yeast and human 3-hydroxy-3-methylglutaryl coenzyme A reductases, the Related U.S. Application Data rate-limiting enzyme of sterol biosynthesis.” Molecular Cellular (62) Division of application No. 10/862,907, filedon Jun. 7, Biology, 8(9):3797-3808, 1998. 2004, now Pat. No. 7,544,863, which is a division of Broun et al., “Catalytic plasticity of fatty acid modification enzymes application No. 09/885,723, filed on Jun. 20, 2001, underlying chemical diversity of plant lipids.” Science, 282:1315 now Pat. No. 6,822,142. 1317, 1998. (60) Provisional application No. 60/260,114, filed on Jan. (Continued) 5, 2001. Primary Examiner — Russell Kallis (51) Int. Cl. CI2N 15/29 (2006.01) (74) Attorney, Agent, or Firm — Chunping Li, Esq.; SNR CI2N 15/52 (2006.01) Denton US LLP CI2N 15/82 (2006.01) AOIH 5/00 (2006.01) (57) ABSTRACT AOIH 5/10 (2006.01) (52) U.S. Cl. ........ 800/306; 800/312:800/314: 800/317; Disclosed are constructs comprising sequences encoding 800/320.1:536/23.1:536/23.2:536/23.6; 3-hydroxy-3 methylglutaryl-Coenzyme A reductase and at 435/320.1; 435/419 least one other Sterol synthesis pathway enzyme. Also dis (58) Field of Classification Search ........................ None closed are methods for using Such constructs to alter sterol See application file for complete search history. production and content in cells, plants, seeds and storage organs of plants. Also provided are oils and compositions (56) References Cited containing altered sterol levels produced by use of the dis closed constructs. Novel nucleotide sequences useful in the U.S. PATENT DOCUMENTS alteration of sterol production are also provided. Also pro 5,306,862 A 4, 1994 Chappell et al. .............. 800,205 vided are cells, plants, seeds and storage organs of plants 5,349,126 A 9/1994 Chappell et al. .............. 800,205 comprising sequences encoding 3-hydroxy-3 methylglutaryl 5,365,017 A 11/1994 Chappell et al. ..... 800,205 Coenzyme A reductase, at least one other sterol synthesis 5,460,949 A 10, 1995 Saunders et al. ................ 435/55 5,480,805 A 1/1996 Wolfetal. ....... ... 435/320.1 pathway enzyme and at least one tocopherol synthesis 5,589,619 A 12/1996 Chappell et al. .............. 800,205 enzyme. 6,153,815 A 11/2000 Covello ........... ... 800,306 6,822, 142 B2 1 1/2004 Karunanandaa et al. ..... 800,298 7,544,863 B2 * 6/2009 Karunanandaa et al. ..... 800,306 12 Claims, 78 Drawing Sheets US 7,906.710 B2 Page 2 OTHER PUBLICATIONS Gill et al., “Membrane-bound domain of HMG CoA reductase is required for sterol-enhanced degradation of the enzyme. Cell. Cabello-Hurtado et al., “Cloning and functional expression in yeast 41:249-258, 1985. ofacDNA coding for an obtusifoliol 14-alpha-demethylase (CYP51) Gonzalez et al., Abstract of poster at Third Terpnet Meeting of the European Network on Plant Isoprenoids, May 29-30, Poiters, France, in wheat.” Biochemical and Biophysical Research Communications, 1997. 230(2):381-385, 1997. Jenkins et al., “Plant sterols, health claims and strategies to reduce Cabello-Hurtado et al., “Cloning and functional expression in yeast cardiovascular and strategies to reduce cardiovascular disease risk.” ofacDNA coding for an obtusifoliol 14-alpha-demethylase (CYP51) J. of the American College of Nutrition, 18:559-562, 1999. in wheat, EMBL Onlinel, Database Accession No.Y09291, abstract, Nakamura et al., “A large scale analysis if cDNA in Aradopsis 1996. thalian: generation of 12,028 non-redundant expressed sequence tags Chappell et al., “Is the reaction catalyzed by 3-hydroxy-3- from normalized size-selected cDNA libraries.” EMBL Onlinel, methylglutaryl coenzyme A reductase a rate-limiting step for Database Accession No. AV440215, 2000. Nguyen, “The cholesterol-lowering action of plant stanol esters. J. isoprenoid biosynthesis in plants?” Plant Physiology, 109(4): 1337 of Nutrition, 129:2109-2112, 1999. 1343, 1995. Register et al., “Structure and function of selectable and non-select Chin et al., “Nucleotide sequence of 3-hydroxy-3-methyl-glutaryl able transgenes in maize after introduction by particle bombard coenzyme A reductase, a glycoprotein of endloplasmic reticulum.' ment. Plant Mol. Biol., 25:951-961, 1994. Nature, 308 (5960):613-617, 1984. Schaeffer et al., “Plant sterol-C24-methyltransferases: different pro Colebatch et al., “Lotus faponicus root nodule ESTs: tools for func files of tobacco transformed with SMT1 or SMT2.” Lipids, 35:263 tional genomics.” EMBL Onlinel, Database Accession No. 269, 2000. AW719774, abstract, 2000. Schafer et al., “An example of intron junctional sliding in the gene Covello, “An example of intronjunctional sliding in the gene families families encoding Sqalene monooxygenase homologues in encoding squalene monooxygenase homologues in Arabidopsis Arabidopsis thaliana and Brassica napus.” Plant Molecular Biology, thaliana and Brassica napus," EMBL Onlinel, Database Accession 39(4):721-728, 1999. No. AJO05930, 1998. Schaller et al., “Expression of the Hevea brasiliensis (H.B.K.) mill. Dale et al., “Bacterial expression of the catalytic domain of Arg. 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 in 3-hydroxy-3-methylglutaryl-CoA reductase (isoform HMGR1) tobacco results in sterol overproduction.” Plant Physiol. 109:761 from Arabidopsis thaliana, and its inactivation by phosphorylation at 770, 1995. Ser577 by Brassica oleracea 3-hydroxy-3-methylglutaryl-CoA Schaller et al., “Overexpression of an arabidopsis cDNA encoding a reductase kinase. Eur: J. Biochem., 233:506-513, 1995. sterol-C24(1)-methyltransferase in tobacco modifies the ration of Deavarenne, "Regulation of squalene synthase, a key enzyme of 24-methyl cholesterol to sitosterol and is associated with growth sterol biosynthesis, in tobacco.” Plant Physiology, 129:1095-1106, reduction.” Plant Physiol., 118:461–469, 1998. 2002. Shintani et al., “Elevating the vitamin E content of plants through Downing et al., “The isolation of two mutants of Saccharomyces metabolic engineering.” Science, 282(5396): 2098-2100, 1998. cerevisiae which demonstrate increased activity of 3-hydroxy-3- Tada et al., “Mechanism of photoregulated cartogenesis in methylglutaryl coenzyme a reductase. Biochemical and Biophysical Rhodoturul minuta v. photoinduction of 3-hydroxy-3-methyl Research Communications, 94(3):974-979, 1980. glutaryl coenzyme A reductase.” Plant and Cell Physiol. 23(4):615 Fourgoux-Nicol et al., “Isolation of rapeseed genes expressed early 621, 1982. and specifically during development of the male gametophyte. Plant Van der Hoeven et al., “Generation of ESTs retrieved from tomato Molecular Biology, 40:857-872, 1999. radicule tissue.” EMBL Onlinel, Database Accession No. GenBank Accession No. AJO05930, dated Apr. 20, 1999. AW625933, abstract, 2000. GenBank Accession No. AW.625933, dated Mar. 28, 2000. Yoder et al., “Transformation systems for generating marker-free GenBank Accession No. AW719774, dated Apr. 19, 2000. transgenic plants.” Bio/Technology, 12:263-267, 1994. GenBank Accession No. U74319, dated Mar. 18, 1997. GenBank Accession No. YO9291, dated Apr. 18, 2005. * cited by examiner U.S. Patent Mar. 15, 2011 Sheet 1 of 78 US 7,906,710 B2 squalene epoxidase Sterol methyl transferase I -- HO W 24-methylene cycloartenol HO cycloartenol Sterol C4 demethylase obtusifoliol HO obtusifoliol stigmasta-7-enol Cl4c-demethylase campesterol HO HO sterol methy sterol C5 transferase II desaturase 5. HO / sitosterol Sa HO stigmasterol HO sitostanol F.G. 1 U.S. Patent US 7,906,710 B2 (IO Z*9IH U.S. Patent Mar. 15, 2011 Sheet 3 Of 78 US 7,906,710 B2 Kpnl 8744 Sac 8738 EcoRI 8728 Stu 8724 Xbal 8716 Clai 8711 Bgll 8704 Ban.H. 7759 Sacl 8701 Xbal 7753 Xho 87OO Sal 7747 Kpni 8695 Pst 657 Not 669 Pst 7745 XhoI 678 Hind 7729 O Ora 7692 Pvt 1045 Drai 7615-N Pst 1235 Pyu 288 Pvu 736 PSt 7236 Nico 1614 Pvu 1882 Pvu.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Organic Matter Composition Related to Methane Ebullitive Flux of an Urban Coastal Lagoon, Southeastern Brazil
    Quim. Nova, Vol. 42, No. 6, 619-627, 2019 http://dx.doi.org/10.21577/0100-4042.20170373 ORGANIC MATTER COMPOSITION RELATED TO METHANE EBULLITIVE FLUX OF AN URBAN COASTAL LAGOON, SOUTHEASTERN BRAZIL Alessandra da Fonseca Vianaa,*, , Marco Aurélio dos Santosa, Marcelo Corrêa Bernardesb and Marcelo Amorima aInstituto Alberto Luiz Coimbra de Pós-Graduação e Pesquisa de Engenharia, Universidade Federal do Rio de Janeiro, 21941-450 Rio de Janeiro – RJ, Brasil b Departamento de Geoquímica, Universidade Federal Fluminense, 24020-141 Niterói – RJ, Brasil Artigo Recebido em 25/04/2019; aceito em 04/06/2019; publicado na web em 26/06/2019 In 2016, Brazil emitted 18.25 Tg of methane. Some of these emissions occur through continental aquatic ecosystems, locations of fate and accumulation of organic and inorganic matter. Thus, the aim of this study is to evaluate the origin of organic matter in Rodrigo de Freitas Lagoon, an eutrophic, coastal and chocked lagoon in Rio de Janeiro, Brazil, through the determination of n-alkanes and sterols compounds in the upper two centimeters of sediment and compare these data with methane ebullitive flux. The concentrations of n-alkanes varied between 2.43 and 25.82 µg g-1. C29 was predominant compound in most sites, but also with important petrogenic source evidenced by the occurrence of Unresolved Complex Misture. The total concentration of sterols ranged from 2.76 to 56.01 µg g-1. β-sitostanol was the most abundant compound and coprostanol was the most relevant at the sites under -2 -1 -2 -1 influence of domestic effluents. 4CH ebullitive flux averaged 199 mg m d in the dry period and 9.3 mg m d during the wet season.
    [Show full text]
  • Biennial Review of 40 CFR Part 503 As Required Under the Clean Water Act Section 405(D)(2)(C)
    United States Office of Water EPA-822R18003 Environmental Protection Agency Office of Science and Technology June 2019 4304T Biennial Review of 40 CFR Part 503 As Required Under the Clean Water Act Section 405(d)(2)(C) Biosolids Biennial Review Reporting Period 2016–2017 EPA-822R18003 Biennial Review of 40 CFR Part 503 As Required Under the Clean Water Act Section 405(d)(2)(C) Biosolids Biennial Review Reporting Period 2016–2017 U.S. Environmental Protection Agency Office of Water Office of Science and Technology Washington, D.C. June 2019 Biosolids Biennial Review Reporting Period 2016–2017 NOTICE This document has been reviewed in accordance with U.S. EPA policy and approved for publication. The report was prepared with the support of RTI International under the direction and review of the Office of Science and Technology. This document is not a regulation and does not change or substitute for statutory provisions and the EPA regulations. Thus, this document does not impose legally binding requirements on the EPA, states, tribes, or the regulated community. While the EPA has made every effort to ensure the accuracy of the discussion in this document, the obligations of the regulated community are determined by statutes, regulations, or other legally binding requirements. In the event of a conflict between the discussion in this document and any statute or regulation, this document would not be controlling. Mention of trade names or commercial products does not constitute endorsement or recommendation for their use. This document can be downloaded from the EPA’s website at http://www.epa.gov/biosolids.
    [Show full text]
  • The Role of Genetic Variation in Predisposition to Alcohol-Related Chronic Pancreatitis
    The Role of Genetic Variation in Predisposition to Alcohol-related Chronic Pancreatitis Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Marianne Lucy Johnstone April 2015 The Role of Genetic Variation in Predisposition to Alcohol-related Chronic Pancreatitis 2015 Abstract Background Chronic pancreatitis (CP) is a disease of fibrosis of the pancreas for which alcohol is the main causative agent. However, only a small proportion of alcoholics develop chronic pancreatitis. Genetic polymorphism may affect pancreatitis risk. Aim To determine the factors required to classify a chronic pancreatic population and identify genetic variations that may explain why only some alcoholics develop chronic pancreatitis. Methods The most appropriate method of diagnosing CP was assessed using a systematic review. Genetics of different populations of alcohol-related chronic pancreatitics (ACP) were explored using four different techniques: genome-wide association study (GWAS); custom arrays; PCR of variable nucleotide tandem repeats (VNTR) and next generation sequencing (NGS) of selected genes. Results EUS and sMR were identified as giving the overall best sensitivity and specificity for diagnosing CP. GWAS revealed two associations with CP (identified and replicated) at PRSS1-PRSS2_rs10273639 (OR 0.73, 95% CI 0.68-0.79) and X-linked CLDN2_rs12688220 (OR 1.39, 1.28-1.49) and the association was more pronounced in the ACP group (OR 0.56, 0.48-0.64)and OR 2.11, 1.84-2.42). The previously identified VNTR in CEL was shown to have a lower frequency of the normal repeat in ACP than alcoholic liver disease (ALD; OR 0.61, 0.41-0.93).
    [Show full text]
  • Chemical and Microbiological Water Quality of Subsurface Agricultural
    In cooperation with the U.S. Department of Agriculture, Natural Resources Conservation Service and the Lenawee Conservation District Chemical and Microbiological Water Quality of Subsurface Agricultural Drains during a Field Trial of Liquid Dairy Manure Effluent Application Rate and Varying Tillage Practices, Upper Tiffin Watershed, Southeastern Michigan By Sheridan Kidd Haack and Joseph W. Duris Open-File Report 2008–1189 U.S. Department of the Interior U.S. Geological Survey U.S. Department of the Interior DIRK KEMPTHORNE, Secretary U.S. Geological Survey Mark D. Myers, Director U.S. Geological Survey, Reston, Virginia 2008 For product and ordering information: World Wide Web: http://www.usgs.gov/pubprod Telephone: 1-888-ASK-USGS For more information on the USGS—the Federal source for science about the Earth, its natural and living resources, natural hazards, and the environment: World Wide Web: http://www.usgs.gov Telephone: 1-888-ASK-USGS Suggested citation: Haack, S.K., and Duris, Joseph W., 2008, Chemical and microbiological water quality of subsurface agricultural drains during a field trial of liquid dairy manure effluent application rate and varying tillage practices, Upper Tiffin Watershed, southeastern Michigan: U.S. Geological Survey Open-File Report 2008– 1189, 38 p. Any use of trade, product, or firm names is for descriptive purposes only and does not imply endorsement by the U.S. Government. Although this report is in the public domain, permission must be secured from the individual copyright owners to reproduce any copyrighted
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • Electronic Supplementary Material (ESI) for Metallomics
    Electronic Supplementary Material (ESI) for Metallomics. This journal is © The Royal Society of Chemistry 2018 Uniprot Entry name Gene names Protein names Predicted Pattern Number of Iron role EC number Subcellular Membrane Involvement in disease Gene ontology (biological process) Id iron ions location associated 1 P46952 3HAO_HUMAN HAAO 3-hydroxyanthranilate 3,4- H47-E53-H91 1 Fe cation Catalytic 1.13.11.6 Cytoplasm No NAD biosynthetic process [GO:0009435]; neuron cellular homeostasis dioxygenase (EC 1.13.11.6) (3- [GO:0070050]; quinolinate biosynthetic process [GO:0019805]; response to hydroxyanthranilate oxygenase) cadmium ion [GO:0046686]; response to zinc ion [GO:0010043]; tryptophan (3-HAO) (3-hydroxyanthranilic catabolic process [GO:0006569] acid dioxygenase) (HAD) 2 O00767 ACOD_HUMAN SCD Acyl-CoA desaturase (EC H120-H125-H157-H161; 2 Fe cations Catalytic 1.14.19.1 Endoplasmic Yes long-chain fatty-acyl-CoA biosynthetic process [GO:0035338]; unsaturated fatty 1.14.19.1) (Delta(9)-desaturase) H160-H269-H298-H302 reticulum acid biosynthetic process [GO:0006636] (Delta-9 desaturase) (Fatty acid desaturase) (Stearoyl-CoA desaturase) (hSCD1) 3 Q6ZNF0 ACP7_HUMAN ACP7 PAPL PAPL1 Acid phosphatase type 7 (EC D141-D170-Y173-H335 1 Fe cation Catalytic 3.1.3.2 Extracellular No 3.1.3.2) (Purple acid space phosphatase long form) 4 Q96SZ5 AEDO_HUMAN ADO C10orf22 2-aminoethanethiol dioxygenase H112-H114-H193 1 Fe cation Catalytic 1.13.11.19 Unknown No oxidation-reduction process [GO:0055114]; sulfur amino acid catabolic process (EC 1.13.11.19) (Cysteamine
    [Show full text]
  • Phytosterols As Tracers of Terrestrial and Wetland Carbon to Ten Thousand Islands, Florida, USA
    Phytosterols as tracers of terrestrial and wetland carbon to Ten Thousand Islands, Florida, USA: Implications for trophic resource use in the eastern oyster, Crassostrea virginica Derek J. Detweiler1, Ludovic Hermabessiere2, Patricia K. Goodman3, Aswani K. Volety1, Philippe Soudant2, Ai Ning Loh1 1 Center for Marine Science, University of North Carolina Wilmington 2 Laboratoire des Sciences de l’Environnement Marin, Institut Universitaire Européen de la Mer, Université de Bretagne Occidentale 3 Department of Marine and Ecological Sciences & Vester Field Station, Florida Gulf Coast University Background PRE-1900’s WATER FLOW Historic Flow Current Flow CERP Flow (U.S. Dept. Interior) Faka Union Canal (Everglades Foundation) CERP = Comprehensive Everglades Restoration Plan Rationale • The eastern oyster (Crassostrea virginica) • Distributed along Atlantic and Gulf coasts • Ecosystem service providers • Shoreline protection and stabilization • Water quality improvement • Substrate for mangrove propagation • “Canary in the coal mine” Condition indices for C. virginica in TTI oysters Loh et al. (2017) Volety et al. (2014) Rationale • Assessing oyster diet using phytosterols • Biochemicals in primary producers originating from C30 precursor • Well-preserved in estuarine environments • Determine organic matter sources – source specificity • Sterol proportions and configuration provides insight to community assemblages (uconn.edu) (sfsu.edu) (sms.si.edu) Bianchi and Canuel (2011) Objectives What is the pre-restoration impact on source contributions of terrestrial and aquatic organic matter as well as its quality and use as trophic resource? 1. Identify types and sources of sterols from POM, BMA, and oyster tissue. 2. Determine possible food source contributors to TTI. 3. Correlate biomarkers with food source quality. 4. Assess impact of altered freshwater discharge on C.
    [Show full text]
  • Granny Smith
    www.nature.com/scientificreports OPEN Ethylene –dependent and –independent superfcial scald resistance mechanisms in ‘Granny Received: 19 March 2018 Accepted: 17 July 2018 Smith’ apple fruit Published: xx xx xxxx Evangelos Karagiannis1, Michail Michailidis1, Georgia Tanou1,2, Martina Samiotaki3, Katerina Karamanoli4, Evangelia Avramidou5, Ioannis Ganopoulos6, Panagiotis Madesis7 & Athanassios Molassiotis 1 Superfcial scald is a major physiological disorder of apple fruit (Malus domestica Borkh.) characterized by skin browning following cold storage; however, knowledge regarding the downstream processes that modulate scald phenomenon is unclear. To gain insight into the mechanisms underlying scald resistance, ‘Granny Smith’ apples after harvest were treated with diphenylamine (DPA) or 1-methylcyclopropene (1-MCP), then cold stored (0 °C for 3 months) and subsequently were ripened at room temperature (20 °C for 8 days). Phenotypic and physiological data indicated that both chemical treatments induced scald resistance while 1-MCP inhibited the ethylene-dependent ripening. A combination of multi-omic analysis in apple skin tissue enabled characterization of potential genes, proteins and metabolites that were regulated by DPA and 1-MCP at pro-symptomatic and scald- symptomatic period. Specifcally, we characterized strata of scald resistance responses, among which we focus on selected pathways including dehydroabietic acid biosynthesis and UDP-D-glucose regulation. Through this approach, we revealed scald-associated transcriptional, proteomic and metabolic signatures and identifed pathways modulated by the common or distinct functions of DPA and 1-MCP. Also, evidence is presented supporting that cytosine methylation-based epigenetic regulation is involved in scald resistance. Results allow a greater comprehension of the ethylene– dependent and –independent metabolic events controlling scald resistance.
    [Show full text]
  • Optimizing Cellular Metabolism to Improve Chronic Skin Wound Healing
    Optimizing Cellular Metabolism to Improve Chronic Skin Wound Healing James J. Slade Honors Thesis Luis Felipe Ramirez Biomedical Engineering Rutgers University, New Brunswick Under the direction of Dr. Francois Berthiaume and Dr. Gabriel Yarmush Abstract—Despite significant advances, chronic skin wounds Wound healing is a complex process with four identifiable remain a large problem both in terms of morbidity and cost. It stages: hemostasis, inflammation, proliferation, and remodel- is estimated that in the United States, this problem afflicts 6.5 ing [6]. Hemostasis involves the formation of a blood clot that million people a year and costs more than 30 billion dollars for di- abetic foot ulcers alone [4,11]. Currently approved treatments are stops the loss of blood at the site of injury [6]. Growth factors often ineffective. This thesis seeks to leverage the large amount of released by activated platelets during the hemostasis stage information that has accumulated about metabolism in the hu- recruit immune cells such as neutrophils and macrophages [6]. man body, and to mine that information with computational mod- The infiltration of the injured tissue with these immune cells eling. It seeks to uncover whether metabolites commonly available leads to the inflammatory phase [6]. The role played by inflam- in the human body can be used to bolster the metabolism of wounded cells such as keratinocytes (the cells that form the mation is classified as both positive and negative [5]. On the epidermis), and therefore improve the natural process of wound one hand the inflammatory response clears the wound site of healing. This would offer treatment options with fewer side effects pathogens and dead cells, on the other hand the inflammatory than what is currently offered to improve wound healing.
    [Show full text]
  • 82299391.Pdf
    Biochimica et Biophysica Acta 1798 (2010) 1144–1152 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamem Influence of the nature of the sterol on the behavior of palmitic acid/sterol mixtures and their derived liposomes Zhong-Kai Cui a, Guillaume Bastiat a, Chester Jin a, Amir Keyvanloo b, Michel Lafleur a,⁎ a Department of Chemistry, Université de Montréal, C.P. 6128, Succ. Centre Ville, Montréal, Québec, Canada H3C 3J7 b Department of Physics, Simon Fraser University, Burnaby, British Columbia, Canada V5A 1S6 article info abstract Article history: The phase behavior of mixtures formed with palmitic acid (PA) and one of the following sterols Received 4 November 2009 (dihydrocholesterol, ergosterol, 7-dehydrocholesterol, stigmasterol and stigmastanol), in a PA/sterol molar Received in revised form 18 December 2009 ratio of 3/7, has been characterized by IR and 2H NMR spectroscopy at different pH. Our study shows that it is Accepted 4 February 2010 possible to form liquid-ordered (lo) lamellar phases with these binary non-phospholipid mixtures. The Available online 12 February 2010 characterization of alkyl chain dynamics of PA in these systems revealed the large ordering effect of the Keywords: sterols. It was possible to extrude these systems, using standard extrusion techniques, to form large Palmitic acid unilamellar vesicles (LUVs), except in the case of ergosterol-containing mixture. The resulting LUVs Sterol displayed a very limited passive permeability consistent with the high sterol concentration. In addition, the Liquid-ordered phase stability of these PA/sterol self-assembled bilayers was also found to be pH-sensitive, therefore, potentially Liposome useful as nanovectors.
    [Show full text]
  • Integrierte Omics-Analysen Zur Charakterisierung Physiologischer Effekte Von Schilddrüsenhormonen Und Von Spezifischen Schilddrüsenhormon-Metaboliten
    Integrierte Omics-Analysen zur Charakterisierung physiologischer Effekte von Schilddrüsenhormonen und von spezifischen Schilddrüsenhormon-Metaboliten INAUGURALDISSERTATION zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät der Universität Greifswald vorgelegt von Janine Golchert geboren am 08.02.1991 Greifswald, 09.03.2020 Dekan: Prof. Dr. Werner Weitschies 1. Gutachter: Prof. Dr. Uwe Völker 2. Gutachter: Prof. Dr. Klaudia Brix Tag der Promotion: 10.09.2020 Inhaltsverzeichnis Inhaltsverzeichnis Abkürzungsverzeichnis ..................................................................................................... V Zusammenfassung ........................................................................................................... VII Summary ............................................................................................................................ IX 1 Einleitung ...................................................................................................................... 1 1.1 Biosynthese der klassischen Schilddrüsenhormone T3 und T4 in der Schilddrüse . 1 1.2 Transport und Metabolismus der klassischen Schilddrüsenhormone T3 und T4 ..... 3 1.3 Regulation der Schilddrüsenhormone .................................................................... 4 1.4 Molekulare Wirkmechanismen von Schilddrüsenhormonen ................................... 5 1.5 Physiologische Wirkungen von Schilddrüsenhormonen ........................................
    [Show full text]