DOCSLIB.ORG

Supporting Information for Proteomics DOI 10.1002/Pmic.200500072

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Information for Proteomics DOI 10.1002/Pmic.200500072 Supporting Information for Proteomics DOI 10.1002/pmic.200500072 Peter Nilsson, Linda Paavilainen, Karin Larsson, Jenny dling, Mrten Sundberg, Ann-Catrin Andersson, Caroline Kampf, Anja Persson, Cristina Al-Khalili Szigyarto, Jenny Ottosson, Erik Bjrling, Sophia Hober, Henrik Wernrus, Kenneth Wester, Fredrik Pontn and Mathias Uhlen Towards a human proteome atlas: High-throughput generation of mono-specific antibodies for tissue profiling ª 2005 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.de Supplementary Table 1 Towards a human proteome atlas Antibody ID Ensembl Gene ID Gene name Gene description 1 HPRK140001 ENSG00000151456 C14orf145 (HUGO ID) ND 2 HPRK140003 ENSG00000100439 ABHD4 (HUGO ID) ABHYDROLASE DOMAIN CONTAINING 4. 3 HPRK140004 ENSG00000100811 YY1 (HUGO ID) TRANSCRIPTIONAL REPRESSOR PROTEIN YY1 (YIN AND YANG 1) (YY-1) (DELTA TRANSCRIP 4 HPRK140006 ENSG00000157379 DHRS1 (HUGO ID) DEHYDROGENASE/REDUCTASE (SDR FAMILY) MEMBER 1; DEHYDROGENASE/REDUCTASE S 5 HPRK140007 ENSG00000165516 KLHDC2 (HUGO ID) KELCH DOMAIN CONTAINING PROTEIN 2 (HEPATOCELLULAR CARCINOMA-ASSOCIATED ANT 6 HPRK140008 ENSG00000182338 ISGF3G (HUGO ID) TRANSCRIPTIONAL REGULATOR ISGF3 GAMMA SUBUNIT (IFN-ALPHA RESPONSIVE TRANSC 7 HPRK140009 ENSG00000100557 C14orf105 (HUGO ID) ND 8 HPRK140010 ENSG00000100836 PABPN1 (HUGO ID) POLY(A) BINDING PROTEIN, NUCLEAR 1; OCULOPHARYNGEAL MUSCULAR DYSTROPHY; PO 9 HPRK140011 ENSG00000131980 AND1_HUMAN (SWISSPROT ID) ACIDIC NUCLEOPLASMIC DNA-BINDING PROTEIN 1 (AND-1). 10 HPRK140012 ENSG00000165588 OTX2 (HUGO ID) HOMEOBOX PROTEIN OTX2. 11 HPRK140013 ENSG00000071246 NM_014909 (RefSeq ID) ND 12 HPRK140014 ENSG00000100450 GZMH (HUGO ID) GRANZYME H PRECURSOR (EC 3.4.21.-) (CYTOTOXIC T-LYMPHOCYTE PROTEINASE) (CATHE 13 HPRK140015 ENSG00000100600 LGMN (HUGO ID) LEGUMAIN PRECURSOR (EC 3.4.22.34) (ASPARAGINYL ENDOPEPTIDASE) (PROTEASE, CYST 14 HPRK140016 ENSG00000100697 DICER1 (HUGO ID) ENDORIBONUCLEASE DICER (EC 3.1.26.-) (HELICASE WITH RNASE MOTIF) (HELICASE-MOI). 15 HPRK140017 ENSG00000100813 ACINUS (HUGO ID) APOPTOTIC CHROMATIN CONDENSATION INDUCER IN THE NUCLEUS (ACINUS). 16 HPRK140018 ENSG00000100868 Y297_HUMAN (SWISSPROT ID) ND 17 HPRK140019 ENSG00000100749 VRK1 (HUGO ID) VACCINIA RELATED KINASE 1; VACCINIA-RELATED KINASE-1. 18 HPRK140020 ENSG00000183032 SLC25A21 (HUGO ID) MITOCHONDRIAL 2-OXODICARBOXYLATE CARRIER. 19 HPRK140021 ENSG00000081181 ARG2 (HUGO ID) ARGINASE II, MITOCHONDRIAL PRECURSOR (EC 3.5.3.1) (NON-HEPATIC ARGINASE) (KIDNEY 20 HPRK140022 ENSG00000100439 ABHD4 (HUGO ID) ABHYDROLASE DOMAIN CONTAINING 4. 21 HPRK140023 ENSG00000100697 DICER1 (HUGO ID) ENDORIBONUCLEASE DICER (EC 3.1.26.-) (HELICASE WITH RNASE MOTIF) (HELICASE-MOI). 22 HPRK140024 ENSG00000140043 ZADH1 (HUGO ID) ZINC BINDING ALCOHOL DEHYDROGENASE, DOMAIN CONTAINING 1. 23 HPRK140025 ENSG00000140006 NM_080666 (RefSeq ID) ND 24 HPRK140027 ENSG00000100664 EIF5 (HUGO ID) EUKARYOTIC TRANSLATION INITIATION FACTOR 5 (EIF-5). 25 HPRK140028 ENSG00000178974 FBXO34 (HUGO ID) F-BOX ONLY PROTEIN 34. 26 HPRK140029 ENSG00000119699 TGFB3 (HUGO ID) TRANSFORMING GROWTH FACTOR BETA 3 PRECURSOR (TGF-BETA 3). 27 HPRK140030 ENSG00000133965 NM_033426 (RefSeq ID) ND 28 HPRK140031 ENSG00000090061 CCNK (HUGO ID) CYCLIN K. 29 HPRK140032 ENSG00000169413 RNASE6 (HUGO ID) RIBONUCLEASE K6 PRECURSOR (EC 3.1.27.-) (RNASE K6). 30 HPRK140033 ENSG00000131966 ACTR10 (HUGO ID) ACTIN-RELATED PROTEIN 10 (HARP11). 31 HPRK140034 ENSG00000176784 Q8N9A6 (SPTREMBL ID) ND 32 HPRK140035 ENSG00000020426 MNAT1 (HUGO ID) CDK-ACTIVATING KINASE ASSEMBLY FACTOR MAT1 (RING FINGER PROTEIN MAT1) (MENAG 33 HPRK140036 ENSG00000100906 NFKBIA (HUGO ID) NF-KAPPAB INHIBITOR ALPHA (MAJOR HISTOCOMPATIBILITY COMPLEX ENHANCER- BINDING Transcript removed from current Ensembl version 34 HPRK140037 ENSG00000179627 ND (20.34c.1); one other transcript 35 HPRK140038 ENSG00000100714 MTHFD1 (HUGO ID) C-1-TETRAHYDROFOLATE SYNTHASE, CYTOPLASMIC (C1-THF SYNTHASE) [INCLUDES: METH 36 HPRK140039 ENSG00000136367 ZFHX2 (HUGO ID) ZINC FINGER HOMEOBOX PROTEIN 2. 37 HPRK140040 ENSG00000130235 NM_032714 (RefSeq ID) ND 38 HPRK140041 ENSG00000140006 NM_080666 (RefSeq ID) ND 39 HPRK140042 ENSG00000151413 C14orf127 (HUGO ID) ND 40 HPRK140043 ENSG00000166126 AMN (HUGO ID) AMNIONLESS PROTEIN PRECURSOR 41 HPRK140044 ENSG00000165591 NM_174912 (RefSeq ID) ND 42 HPRK140045 ENSG00000100578 Y586_HUMAN (SWISSPROT ID) ND 43 HPRK140046 ND ND ND 44 HPRK140047 ND ND ND 45 HPRK140048 ND ND ND 46 HPRK140049 ND ND ND 47 HPRK140050 ND ND ND 48 HPRK140056 ND ND ND 49 HPRK140057 ND ND ND 50 HPRK140058 ND ND ND 51 HPRK140059 ND ND ND 52 HPRK140060 ND ND ND 53 HPRK140064 ND ND ND 54 HPRK140065 ND ND ND 55 HPRK140066 ND ND ND 56 HPRK140069 ENSG00000151320 AKAP6 (HUGO ID) A-KINASE ANCHOR PROTEIN 6 (PROTEIN KINASE A ANCHORING PROTEIN 6) (PRKA6) (A-KINA 57 HPRK140071 ENSG00000100888 HELSNF1 (HUGO ID) CHROMODOMAIN-HELICASE-DNA-BINDING PROTEIN HELSNF1 (HELICASE WITH SNF2 DOMA 58 HPRK140072 ENSG00000139913 C14orf21 (HUGO ID) ND 59 HPRK140073 ENSG00000174373 Q9Y408 (SPTREMBL ID) SIMILAR TO TUBERIN-LIKE PROTEIN 1 (FRAGMENT). 60 HPRK140074 ENSG00000119599 WDR21 (HUGO ID) WD-REPEAT PROTEIN 21 61 HPRK140075 ENSG00000012963 C14orf130 (HUGO ID) ND 62 HPRK140076 ENSG00000140043 ZADH1 (HUGO ID) ZINC BINDING ALCOHOL DEHYDROGENASE, DOMAIN CONTAINING 1. 63 HPRK140077 ENSG00000023608 SNAPC1 (HUGO ID) SNRNA ACTIVATING PROTEIN COMPLEX 43 KDA SUBUNIT (SNAPC 43 KDA SUBUNIT) (PROXIM 64 HPRK140078 ENSG00000133984 SYNJ2BP (HUGO ID) SYNAPTOJANIN 2 BINDING PROTEIN (MITOCHONDRIAL OUTER MEMBRANE PROTEIN 25). 65 HPRK140079 ENSG00000100664 EIF5 (HUGO ID) EUKARYOTIC TRANSLATION INITIATION FACTOR 5 (EIF-5). 66 HPRK140081 ENSG00000140092 FBLN5 (HUGO ID) FIBULIN-5 PRECURSOR (FIBL-5) (DEVELOPMENTAL ARTERIES AND NEURAL CREST EGF-LIKE 67 HPRK140082 ENSG00000165417 GTF2A1 (HUGO ID) TRANSCRIPTION INITIATION FACTOR IIA ALPHA AND BETA CHAINS (TFIIA P35 AND P19 SUBU 68 HPRK140083 ENSG00000165934 CPSF2 (HUGO ID) CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR, 100 KDA SUBUNIT (CPSF 100 KDA 69 HPRK140084 ENSG00000099814 Q9Y4F5 (SPTREMBL ID) ND 70 HPRK140085 ENSG00000100764 PSMC1 (HUGO ID) 26S PROTEASE REGULATORY SUBUNIT 4 (P26S4). Transcript removed from current Ensembl version 71 HPRK140086 ENSG00000185567 ND (20.34c.1); one other transcript (no translation) 72 HPRK140088 ENSG00000183790 Q96DQ3 (SPTREMBL ID) ND 73 HPRK140089 ENSG00000184577 Gene removed from current database (20.34c.1) ND 74 HPRK140090 ENSG00000157227 MMP14 (HUGO ID) MATRIX METALLOPROTEINASE-14 PRECURSOR (EC 3.4.24.-) (MMP-14) (MEMBRANE-TYPE MA 75 HPRK140091 ENSG00000129566 TEP1 (HUGO ID) TELOMERASE-ASSOCIATED PROTEIN 1; TELOMERASE PROTEIN COMPONENT 1. 76 HPRK140092 ENSG00000165894 Q96DE2 (SPTREMBL ID) ND 77 HPRK140093 ENSG00000136305 CIDEB (HUGO ID) CELL DEATH ACTIVATOR CIDE-B (CELL DEATH-INDUCING DFFA-LIKE EFFECTOR B). 78 HPRK140094 ENSG00000100906 NFKBIA (HUGO ID) NF-KAPPAB INHIBITOR ALPHA (MAJOR HISTOCOMPATIBILITY COMPLEX ENHANCER- BINDING 79 HPRK140095 ENSG00000100591 AHSA1 (HUGO ID) ACTIVATOR OF 90 KDA HEAT SHOCK PROTEIN ATPASE HOMOLOG 1 (AHA1) (P38) (HSPC322) 80 HPRK140096 ENSG00000100938 GMPR2 (HUGO ID) GMP REDUCTASE 2 (EC 1.7.1.7) (GUANOSINE 5'-MONOPHOSPHATE OXIDOREDUCTASE 2) (G 81 HPRK140097 ENSG00000100567 PSMA3 (HUGO ID) PROTEASOME SUBUNIT ALPHA TYPE 3 (EC 3.4.25.1) (PROTEASOME COMPONENT C8) (MACR 82 HPRK140098 ENSG00000100784 RPS6KA5 (HUGO ID) RIBOSOMAL PROTEIN S6 KINASE, 90KDA, POLYPEPTIDE 5 ISOFORM A; MITOGEN- AND STRE 83 HPRK140099 ENSG00000100644 HIF1A (HUGO ID) HYPOXIA-INDUCIBLE FACTOR 1 ALPHA (HIF-1 ALPHA) (HIF1 ALPHA) (ARNT INTERACTING PRO 84 HPRK140111 ND ND ND 85 HPRK140112 ND ND ND 86 HPRK140113 ND ND ND 87 HPRK140117 ND ND ND 88 HPRK140119 ND ND ND 89 HPRK140120 ND ND ND 90 HPRK140135 ND ND ND 91 HPRK140140 ND ND ND 92 HPRK220001 ENSG00000133422 K852_HUMAN (SWISSPROT ID) ND 93 HPRK220002 ENSG00000177663 IL17R (HUGO ID) INTERLEUKIN-17 RECEPTOR PRECURSOR (IL-17 RECEPTOR). 94 HPRK220003 ENSG00000130487 NM_138433 (RefSeq ID) ND 95 HPRK220004 ENSG00000182424 NM_152669 (RefSeq ID) ND 96 HPRK220005 ENSG00000100425 BRD1 (HUGO ID) BROMODOMAIN-CONTAINING PROTEIN 1 (BR140-LIKE PROTEIN). 97 HPRK220006 ENSG00000100357 ADSL (HUGO ID) ADENYLOSUCCINATE LYASE (EC 4.3.2.2) (ADENYLOSUCCINASE) (ASL) (ASASE). 98 HPRK220007 ENSG00000100239 K685_HUMAN (SWISSPROT ID) ND 99 HPRK220008 ENSG00000100382 ND ND 100 HPRK220009 ENSG00000180957 PITPN (HUGO ID) PHOSPHATIDYLINOSITOL TRANSFER PROTEIN BETA ISOFORM (PTDINS TRANSFER PROTEIN Transcript removed from current database 101 HPRK220010 ENSG00000183664 ND (19.34a.1), one other transcripts 102 HPRK220011 ENSG00000025708 ECGF1 (HUGO ID) THYMIDINE PHOSPHORYLASE PRECURSOR (EC 2.4.2.4) (TDRPASE) (TP) (PLATELET-DERIVED 103 HPRK220012 ENSG00000100094 NM_020315 (RefSeq ID) ND 104 HPRK220013 ENSG00000099942 CRKL (HUGO ID) CRK-LIKE PROTEIN 105 HPRK220014 ENSG00000099942 CRKL (HUGO ID) CRK-LIKE PROTEIN 106 HPRK220015 ENSG00000172404 NM_145174 (RefSeq ID) HSC3 107 HPRK220016 ENSG00000100220 NM_014306 (RefSeq ID) SIMILAR TO C. ELEGENS HYPOTHETICAL 55.2 KD PROTEIN F16A11.2. 108 HPRK220018 ENSG00000186998 NM_133455 (RefSeq ID) EMILIN AND MULTIMERIN-DOMAIN CONTAINING PROTEIN 1; PUTATIVE EMU1. 109 HPRK220019 ENSG00000093009 CDC45L (HUGO ID) CDC45-RELATED PROTEIN (PORC-PI-1). 110 HPRK220021 ND ND ND 111 HPRK220022 ND ND ND 112 HPRK220023 ENSG00000184164 NM_024324 (RefSeq ID) ND 113 HPRK220024 ND ND ND 114 HPRK220025 ND ND ND 115 HPRK220026 ND ND ND 116 HPRK220027 ENSG00000100241 SBF1 (HUGO ID) SET BINDING FACTOR 1 (SBF1) (MYOTUBULARIN-RELATED PROTEIN 5). 117 HPRK220028 ENSG00000133422
Load more

Recommended publications
  • An RNA Editing Fingerprint of Cancer Stem Cell Reprogramming
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by eScholarship - University of California UC San Diego UC San Diego Previously Published Works Title An RNA editing fingerprint of cancer stem cell reprogramming. Permalink https://escholarship.org/uc/item/4vm8q0f6 Journal Journal of translational medicine, 13(1) ISSN 1479-5876 Authors Crews, Leslie A Jiang, Qingfei Zipeto, Maria A et al. Publication Date 2015-02-12 DOI 10.1186/s12967-014-0370-3 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Crews et al. Journal of Translational Medicine (2015) 13:52 DOI 10.1186/s12967-014-0370-3 METHODOLOGY Open Access An RNA editing fingerprint of cancer stem cell reprogramming Leslie A Crews1,2, Qingfei Jiang1,2, Maria A Zipeto1,2, Elisa Lazzari1,2,3, Angela C Court1,2, Shawn Ali1,2, Christian L Barrett4, Kelly A Frazer4 and Catriona HM Jamieson1,2* Abstract Background: Deregulation of RNA editing by adenosine deaminases acting on dsRNA (ADARs) has been implicated in the progression of diverse human cancers including hematopoietic malignancies such as chronic myeloid leukemia (CML). Inflammation-associated activation of ADAR1 occurs in leukemia stem cells specifically in the advanced, often drug-resistant stage of CML known as blast crisis. However, detection of cancer stem cell-associated RNA editing by RNA sequencing in these rare cell populations can be technically challenging, costly and requires PCR validation. The objectives of this study were to validate RNA editing of a subset of cancer stem cell-associated transcripts, and to develop a quantitative RNA editing fingerprint assay for rapid detection of aberrant RNA editing in human malignancies.
    [Show full text]
  • Download Download
    Robyn A Lindley. Medical Research Archives vol 8 issue 8. Medical Research Archives REVIEW ARTICLE Review of the mutational role of deaminases and the generation of a cognate molecular model to explain cancer mutation spectra Author Robyn A Lindley1,2 1Department of Clinical Pathology 2GMDx Genomics Ltd, The Victorian Comprehensive Cancer Centre Level 3 162 Collins Street, Faculty of Medicine, Dentistry & Health Sciences Melbourne VIC3000, AUSTRALIA University of Melbourne, Email: [email protected] 305 Gratton Street, Melbourne, VIC 3000, AUSTRALIA Email: [email protected] Correspondence: Robyn A Lindley, Department of Clinical Pathology, Faculty of Medicine, Dentistry & Health Sciences, University of Melbourne, 305 Gratton Street, Melbourne VIC 3000 AUSTRALIA Mobile: +61 (0) 414209132 Email: [email protected] Abstract Recent developments in somatic mutation analyses have led to the discovery of codon-context targeted somatic mutation (TSM) signatures in cancer genomes: it is now known that deaminase mutation target sites are far more specific than previously thought. As this research provides novel insights into the deaminase origin of most of the somatic point mutations arising in cancer, a clear understanding of the mechanisms and processes involved will be valuable for molecular scientists as well as oncologists and cancer specialists in the clinic. This review will describe the basic research into the mechanism of antigen-driven somatic hypermutation of immunoglobulin variable genes (Ig SHM) that lead to the discovery of TSM signatures, and it will show that an Ig SHM-like signature is ubiquitous in the cancer exome. Most importantly, the data discussed in this review show that Ig SHM-like cancer-associated signatures are highly targeted to cytosine (C) and adenosine (A) nucleotides in a characteristic codon-context fashion.
    [Show full text]
  • Supplementary Information.Pdf
    Supplementary Information Whole transcriptome profiling reveals major cell types in the cellular immune response against acute and chronic active Epstein‐Barr virus infection Huaqing Zhong1, Xinran Hu2, Andrew B. Janowski2, Gregory A. Storch2, Liyun Su1, Lingfeng Cao1, Jinsheng Yu3, and Jin Xu1 Department of Clinical Laboratory1, Children's Hospital of Fudan University, Minhang District, Shanghai 201102, China; Departments of Pediatrics2 and Genetics3, Washington University School of Medicine, Saint Louis, Missouri 63110, United States. Supplementary information includes the following: 1. Supplementary Figure S1: Fold‐change and correlation data for hyperactive and hypoactive genes. 2. Supplementary Table S1: Clinical data and EBV lab results for 110 study subjects. 3. Supplementary Table S2: Differentially expressed genes between AIM vs. Healthy controls. 4. Supplementary Table S3: Differentially expressed genes between CAEBV vs. Healthy controls. 5. Supplementary Table S4: Fold‐change data for 303 immune mediators. 6. Supplementary Table S5: Primers used in qPCR assays. Supplementary Figure S1. Fold‐change (a) and Pearson correlation data (b) for 10 cell markers and 61 hypoactive and hyperactive genes identified in subjects with acute EBV infection (AIM) in the primary cohort. Note: 23 up‐regulated hyperactive genes were highly correlated positively with cytotoxic T cell (Tc) marker CD8A and NK cell marker CD94 (KLRD1), and 38 down‐regulated hypoactive genes were highly correlated positively with B cell, conventional dendritic cell
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • The Battle Between Retroviruses and APOBEC3 Genes: Its Past and Present
    viruses Review The Battle between Retroviruses and APOBEC3 Genes: Its Past and Present Keiya Uriu 1,2,†, Yusuke Kosugi 3,4,†, Jumpei Ito 1 and Kei Sato 1,2,* 1 Division of Systems Virology, Department of Infectious Disease Control, International Research Center for Infectious Diseases, Institute of Medical Science, The University of Tokyo, Tokyo 1088639, Japan; [email protected] (K.U.); [email protected] (J.I.) 2 Graduate School of Medicine, The University of Tokyo, Tokyo 1130033, Japan 3 Laboratory of Systems Virology, Institute for Frontier Life and Medical Sciences, Kyoto University, Kyoto 6068507, Japan; [email protected] 4 Graduate School of Pharmaceutical Sciences, Kyoto University, Kyoto 6068501, Japan * Correspondence: [email protected]; Tel.: +81-3-6409-2212 † These authors contributed equally to this work. Abstract: The APOBEC3 family of proteins in mammals consists of cellular cytosine deaminases and well-known restriction factors against retroviruses, including lentiviruses. APOBEC3 genes are highly amplified and diversified in mammals, suggesting that their evolution and diversification have been driven by conflicts with ancient viruses. At present, lentiviruses, including HIV, the causative agent of AIDS, are known to encode a viral protein called Vif to overcome the antiviral effects of the APOBEC3 proteins of their hosts. Recent studies have revealed that the acquisition of an anti-APOBEC3 ability by lentiviruses is a key step in achieving successful cross-species transmission. Here, we summarize the current knowledge of the interplay between mammalian APOBEC3 proteins and viral infections and introduce a scenario of the coevolution of mammalian APOBEC3 genes and viruses. Keywords: APOBEC3; lentivirus; Vif; arms race; gene diversification; coevolution Citation: Uriu, K.; Kosugi, Y.; Ito, J.; Sato, K.
    [Show full text]
  • Deaminase-Independent Mode of Antiretroviral Action in Human and Mouse APOBEC3 Proteins
    microorganisms Review Deaminase-Independent Mode of Antiretroviral Action in Human and Mouse APOBEC3 Proteins Yoshiyuki Hakata 1,* and Masaaki Miyazawa 1,2 1 Department of Immunology, Kindai University Faculty of Medicine, 377-2 Ohno-Higashi, Osaka-Sayama, Osaka 589-8511, Japan; [email protected] 2 Kindai University Anti-Aging Center, 3-4-1 Kowakae, Higashiosaka, Osaka 577-8502, Japan * Correspondence: [email protected]; Tel.: +81-72-367-7660 Received: 8 December 2020; Accepted: 9 December 2020; Published: 12 December 2020 Abstract: Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3 (APOBEC3) proteins (APOBEC3s) are deaminases that convert cytosines to uracils predominantly on a single-stranded DNA, and function as intrinsic restriction factors in the innate immune system to suppress replication of viruses (including retroviruses) and movement of retrotransposons. Enzymatic activity is supposed to be essential for the APOBEC3 antiviral function. However, it is not the only way that APOBEC3s exert their biological function. Since the discovery of human APOBEC3G as a restriction factor for HIV-1, the deaminase-independent mode of action has been observed. At present, it is apparent that both the deaminase-dependent and -independent pathways are tightly involved not only in combating viruses but also in human tumorigenesis. Although the deaminase-dependent pathway has been extensively characterized so far, understanding of the deaminase-independent pathway remains immature. Here, we review existing knowledge regarding the deaminase-independent antiretroviral functions of APOBEC3s and their molecular mechanisms. We also discuss the possible unidentified molecular mechanism for the deaminase-independent antiretroviral function mediated by mouse APOBEC3. Keywords: APOBEC3; deaminase-independent antiretroviral function; innate immunity 1.
    [Show full text]
  • Strand Breaks for P53 Exon 6 and 8 Among Different Time Course of Folate Depletion Or Repletion in the Rectosigmoid Mucosa
    SUPPLEMENTAL FIGURE COLON p53 EXONIC STRAND BREAKS DURING FOLATE DEPLETION-REPLETION INTERVENTION Supplemental Figure Legend Strand breaks for p53 exon 6 and 8 among different time course of folate depletion or repletion in the rectosigmoid mucosa. The input of DNA was controlled by GAPDH. The data is shown as ΔCt after normalized to GAPDH. The higher ΔCt the more strand breaks. The P value is shown in the figure. SUPPLEMENT S1 Genes that were significantly UPREGULATED after folate intervention (by unadjusted paired t-test), list is sorted by P value Gene Symbol Nucleotide P VALUE Description OLFM4 NM_006418 0.0000 Homo sapiens differentially expressed in hematopoietic lineages (GW112) mRNA. FMR1NB NM_152578 0.0000 Homo sapiens hypothetical protein FLJ25736 (FLJ25736) mRNA. IFI6 NM_002038 0.0001 Homo sapiens interferon alpha-inducible protein (clone IFI-6-16) (G1P3) transcript variant 1 mRNA. Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 GALNTL5 NM_145292 0.0001 (GALNT15) mRNA. STIM2 NM_020860 0.0001 Homo sapiens stromal interaction molecule 2 (STIM2) mRNA. ZNF645 NM_152577 0.0002 Homo sapiens hypothetical protein FLJ25735 (FLJ25735) mRNA. ATP12A NM_001676 0.0002 Homo sapiens ATPase H+/K+ transporting nongastric alpha polypeptide (ATP12A) mRNA. U1SNRNPBP NM_007020 0.0003 Homo sapiens U1-snRNP binding protein homolog (U1SNRNPBP) transcript variant 1 mRNA. RNF125 NM_017831 0.0004 Homo sapiens ring finger protein 125 (RNF125) mRNA. FMNL1 NM_005892 0.0004 Homo sapiens formin-like (FMNL) mRNA. ISG15 NM_005101 0.0005 Homo sapiens interferon alpha-inducible protein (clone IFI-15K) (G1P2) mRNA. SLC6A14 NM_007231 0.0005 Homo sapiens solute carrier family 6 (neurotransmitter transporter) member 14 (SLC6A14) mRNA.
    [Show full text]
  • 1 APOBEC-Mediated Mutagenesis in Urothelial Carcinoma Is Associated
    bioRxiv preprint doi: https://doi.org/10.1101/123802; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. APOBEC-mediated mutagenesis in urothelial carcinoma is associated with improved survival, mutations in DNA damage response genes, and immune response Alexander P. Glaser MD, Damiano Fantini PhD, Kalen J. Rimar MD, Joshua J. Meeks MD PhD APG, DF, KJR, JJM: Northwestern University, Department of Urology, Chicago, IL, 60607 Running title: APOBEC mutagenesis in bladder cancer *Corresponding author: Joshua J. Meeks, MD PhD 303 E. Chicago Ave. Tarry 16-703 Chicago, IL 60611 Email: [email protected] Keywords (4-6): • Urinary bladder neoplasms • APOBEC Deaminases • Mutagenesis • DNA damage • Interferon Abbreviations and Acronyms: TCGA – The Cancer Genome Atlas ssDNA – single stranded DNA APOBEC –apolipoprotein B mRNA editing catalytic polypeptide-like GCAC – Genome Data Analysis Center MAF – mutation annotation format “APOBEC-high” – tumors enriched for APOBEC mutagenesis “APOBEC-low” – tumors not enriched for APOBEC mutagenesis 1 bioRxiv preprint doi: https://doi.org/10.1101/123802; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: Background: The APOBEC family of enzymes is responsible for a mutation signature characterized by a TCW>T/G mutation. APOBEC-mediated mutagenesis is implicated in a wide variety of tumors, including bladder cancer. In this study, we explore the APOBEC mutational signature in bladder cancer and the relationship with specific mutations, molecular subtype, gene expression, and survival.
    [Show full text]
  • Diversification of AID/APOBEC-Like Deaminases in Metazoa: Multiplicity
    Diversification of AID/APOBEC-like deaminases in PNAS PLUS metazoa: multiplicity of clades and widespread roles in immunity Arunkumar Krishnana, Lakshminarayan M. Iyera, Stephen J. Hollandb, Thomas Boehmb, and L. Aravinda,1 aNational Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, MD 20894; and bDepartment of Developmental Immunology, Max Planck Institute of Immunobiology and Epigenetics, 79108 Freiburg, Germany Edited by Anjana Rao, La Jolla Institute and University of California San Diego, La Jolla, CA, and approved February 23, 2018 (received for review November 30, 2017) AID/APOBEC deaminases (AADs) convert cytidine to uridine in viruses and retrotransposons through hypermutation of DNA during single-stranded nucleic acids. They are involved in numerous muta- reverse transcription (APOBEC3s) (21). genic processes, including those underpinning vertebrate innate and The deaminase superfamily displays a conserved β-sheet with adaptive immunity. Using a multipronged sequence analysis strategy, five β-strands arranged in 2-1-3-4-5 order interleaved with three we uncover several AADs across metazoa, dictyosteliida, and algae, α-helices forming an α/β-fold (the deaminase fold) (22), which it including multiple previously unreported vertebrate clades, and shares with JAB/RadC, AICAR transformylase, formate de- versions from urochordates, nematodes, echinoderms, arthropods, hydrogenase accessory subunit (FdhD), and Tm1506 superfamilies lophotrochozoans, cnidarians, and porifera. Evolutionary analysis sug- of proteins. The active site consists of two zinc (Zn)-chelating gests a fundamental division of AADs early in metazoan evolution into motifs, respectively typified by the signatures HxE/CxE/DxE at secreted deaminases (SNADs) and classical AADs, followed by diver- the end of helix 2 and CxnC (where x is any amino acid and n is ≥2) sification into several clades driven by rapid-sequence evolution, gene located in loop 5 and the beginning of helix 3 (Fig.
    [Show full text]
  • Insights Into the Structures and Multimeric Status of APOBEC Proteins Involved in Viral Restriction and Other Cellular Functions
    viruses Review Insights into the Structures and Multimeric Status of APOBEC Proteins Involved in Viral Restriction and Other Cellular Functions Xiaojiang S. Chen 1,2,3 1 Molecular and Computational Biology, Departments of Biological Sciences, Chemistry, University of Southern California, Los Angeles, CA 90089, USA; [email protected]; Tel.: +1-213-740-5487 2 Genetic, Molecular and Cellular Biology Program, Keck School of Medicine, Norris Comprehensive Cancer Center, University of Southern California, Los Angeles, CA 90089, USA 3 Center of Excellence in NanoBiophysics/Structural Biology, University of Southern California, Los Angeles, CA 90089, USA Abstract: Apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) proteins belong to a family of deaminase proteins that can catalyze the deamination of cytosine to uracil on single- stranded DNA or/and RNA. APOBEC proteins are involved in diverse biological functions, including adaptive and innate immunity, which are critical for restricting viral infection and endogenous retroelements. Dysregulation of their functions can cause undesired genomic mutations and RNA modification, leading to various associated diseases, such as hyper-IgM syndrome and cancer. This review focuses on the structural and biochemical data on the multimerization status of individual APOBECs and the associated functional implications. Many APOBECs form various multimeric complexes, and multimerization is an important way to regulate functions for some of these proteins at several levels, such as deaminase activity, protein stability, subcellular localization, protein storage Citation: Chen, X.S. Insights into and activation, virion packaging, and antiviral activity. The multimerization of some APOBECs is the Structures and Multimeric Status more complicated than others, due to the associated complex RNA binding modes.
    [Show full text]
  • Supplementary Table 1A. Genes Significantly Altered in A4573 ESFT
    Supplementary Table 1A. Genes significantly altered in A4573 ESFT cells following BMI-1knockdown genesymbol genedescription siControl siBMI1 FC Direction P-value AASS aminoadipate-semialdehyde synthase | tetra-peptide repeat homeobox-like6.68 7.24 1.5 Up 0.007 ABCA2 ATP-binding cassette, sub-family A (ABC1), member 2 | neural5.44 proliferation,6.3 differentiation1.8 and Upcontrol, 1 0.006 ABHD4 abhydrolase domain containing 4 7.51 6.69 1.8 Down 0.002 ACACA acetyl-Coenzyme A carboxylase alpha | peroxiredoxin 5 | similar6.2 to High mobility7.26 group2.1 protein UpB1 (High mobility0.009 group protein 1) (HMG-1) (Amphoterin) (Heparin-binding protein p30) | Coenzyme A synthase ACAD9 acyl-Coenzyme A dehydrogenase family, member 9 9.25 8.59 1.6 Down 0.008 ACBD3 acyl-Coenzyme A binding domain containing 3 7.89 8.53 1.6 Up 0.008 ACCN2 amiloride-sensitive cation channel 2, neuronal 5.47 6.28 1.8 Up 0.005 ACIN1 apoptotic chromatin condensation inducer 1 7.15 7.79 1.6 Up 0.008 ACPL2 acid phosphatase-like 2 6.04 7.6 2.9 Up 0.000 ACSL4 acyl-CoA synthetase long-chain family member 4 6.72 5.8 1.9 Down 0.001 ACTA2 actin, alpha 2, smooth muscle, aorta 9.18 8.44 1.7 Down 0.003 ACYP1 acylphosphatase 1, erythrocyte (common) type 7.09 7.66 1.5 Up 0.009 ADA adenosine deaminase 6.34 7.1 1.7 Up 0.009 ADAL adenosine deaminase-like 7.88 6.89 2.0 Down 0.006 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 6.57 7.65 2.1 Up 0.000 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 6.49 7.13 1.6 Up 0.008 ADCY9 adenylate cyclase 9 6.5 7.18
    [Show full text]
  • The Eukaryotic Translation Initiation Factor 2, a Hero Turned Villain in Β Cells
    The eukaryotic translation initiation factor 2, a hero turned villain in β cells By Baroj Abdulkarim Université libre de Bruxelles Faculty of Medicine ULB Center for Diabetes Research Academic year 2016-2017 Jury Members: Dr. Ingrid Langer (President) Dr. Miriam Cnop (Promoter and secretary) Dr. Mariana Igoillo Esteve (Co-Promoter) Dr. Daniel Christophe Dr. Christophe Erneux Dr. Claudine Heinrichs Dr. Amar Abderrahmani Dr. Patrick Gilon Dedicated to my daughter Elîn 2 Contents Papers constituting this thesis .................................................................................... 4 Abbreviations .............................................................................................................. 5 Abstract ...................................................................................................................... 8 Résumé ...................................................................................................................... 9 Introduction ............................................................................................................... 10 Diabetes mellitus ................................................................................................... 10 How β cells work ................................................................................................ 11 Type 2 and monogenic diabetes ........................................................................ 12 Free fatty acids and diabetes ...............................................................................
    [Show full text]