DOCSLIB.ORG

An RNA Editing Fingerprint of Cancer Stem Cell Reprogramming

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
An RNA Editing Fingerprint of Cancer Stem Cell Reprogramming View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by eScholarship - University of California UC San Diego UC San Diego Previously Published Works Title An RNA editing fingerprint of cancer stem cell reprogramming. Permalink https://escholarship.org/uc/item/4vm8q0f6 Journal Journal of translational medicine, 13(1) ISSN 1479-5876 Authors Crews, Leslie A Jiang, Qingfei Zipeto, Maria A et al. Publication Date 2015-02-12 DOI 10.1186/s12967-014-0370-3 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Crews et al. Journal of Translational Medicine (2015) 13:52 DOI 10.1186/s12967-014-0370-3 METHODOLOGY Open Access An RNA editing fingerprint of cancer stem cell reprogramming Leslie A Crews1,2, Qingfei Jiang1,2, Maria A Zipeto1,2, Elisa Lazzari1,2,3, Angela C Court1,2, Shawn Ali1,2, Christian L Barrett4, Kelly A Frazer4 and Catriona HM Jamieson1,2* Abstract Background: Deregulation of RNA editing by adenosine deaminases acting on dsRNA (ADARs) has been implicated in the progression of diverse human cancers including hematopoietic malignancies such as chronic myeloid leukemia (CML). Inflammation-associated activation of ADAR1 occurs in leukemia stem cells specifically in the advanced, often drug-resistant stage of CML known as blast crisis. However, detection of cancer stem cell-associated RNA editing by RNA sequencing in these rare cell populations can be technically challenging, costly and requires PCR validation. The objectives of this study were to validate RNA editing of a subset of cancer stem cell-associated transcripts, and to develop a quantitative RNA editing fingerprint assay for rapid detection of aberrant RNA editing in human malignancies. Methods: To facilitate quantification of cancer stem cell-associated RNA editing in exons and intronic or 3'UTR primate-specific Alu sequences using a sensitive, cost-effective method, we established an in vitro RNA editing model and developed a sensitive RNA editing fingerprint assay that employs a site-specific quantitative PCR (RESSq-PCR) strategy. This assay was validated in a stably-transduced human leukemia cell line, lentiviral-ADAR1 transduced primary hematopoietic stem and progenitor cells, and in primary human chronic myeloid leukemia stem cells. Results: In lentiviral ADAR1-expressing cells, increased RNA editing of MDM2, APOBEC3D, GLI1 and AZIN1 transcripts was detected by RESSq-PCR with improved sensitivity over sequencing chromatogram analysis. This method accurately detected cancer stem cell-associated RNA editing in primary chronic myeloid leukemia samples, establishing a cancer stem cell-specific RNA editing fingerprint of leukemic transformation that will support clinical development of novel diagnostic tools to predict and prevent cancer progression. Conclusions: RNA editing quantification enables rapid detection of malignant progenitors signifying cancer progression and therapeutic resistance, and will aid future RNA editing inhibitor development efforts. Keywords: Cancer stem cells, Leukemia stem cells, RNA editing, Biomarkers, Leukemia, ADAR1 Background RNA editing in malignant reprogramming of progenitor Dormant cancer stem cells (CSCs) are primary arbiters of cells into self-renewing CSCs, suggesting that ADARs and cancer progression and a major focus of targeted therapy their target substrates may be harbingers of cancer pro- development efforts. Deregulation of RNA editing by ad- gression [1,4,5]. enosine deaminases acting on double-stranded (ds) RNA Of particular relevance to the pathogenesis of human (ADARs) has been implicated in the progression of diverse disease, over 90% of RNA editing occurs in primate- human malignancies, including chronic and acute forms specific Alu sequences that form dsRNA secondary struc- of leukemia [1-3], lobular breast cancer [4], hepatocellular tures [8], often within non-coding regions such as introns carcinoma [5,6], and esophageal squamous cell carcinoma and 3′UTRs [9]. Most RNA editing is carried out by [7]. Recent evidence also supports a role for aberrant ADAR-mediated C6 deamination of adenosines (A) to inosines (I) [10]. The ADAR family consists of three mem- * Correspondence: [email protected] ADAR ADARB1 1 bers, ADAR1 ( ), ADAR2 ( ), and ADAR3 Division of Regenerative Medicine, Department of Medicine, Moores Cancer ADARB2 Center at University of California, La Jolla, CA 92093, USA ( ). In mouse hematopoietic development, ADAR1 2Sanford Consortium for Regenerative Medicine, La Jolla, CA 92037, USA plays a key role in hematopoietic stem cell (HSC) survival Full list of author information is available at the end of the article © 2015 Crews et al.; licensee BioMed Central. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Crews et al. Journal of Translational Medicine (2015) 13:52 Page 2 of 12 [11] and cell fate determination [12,13], and ADAR1 is the Methods primary RNA editase expressed in human hematopoietic Primary samples and tissue processing stem and progenitor cells [1]. At the transcript level, RNA A large collection of leukemia patient samples and normal editing can affect mRNA stability, localization, nuclear re- age-matched control bone marrow samples were obtained tention, and alternative splicing [14-16]. While RNA editing from consenting patients in accordance with Institutional targets are relatively conserved in normal tissues [17], Review Board approved protocols at UCSD and the CSC-associated editing changes in response to malig- University of Toronto (Additional file 1: Table S1). Peri- nant microenvironments could dramatically alter gene pheral blood or bone marrow samples were processed by product stability and function. Additionally, aberrant Ficoll density centrifugation and viable cells stored in liquid RNA editing may drive stem cell regulatory transcript nitrogen. Normal peripheral blood mononuclear cells recoding and microRNA deregulation [18] leading to (MNC) were obtained from AllCells (Alameda, CA). Mono- therapeutic resistance. nuclear cells from control or CML patient samples were Advances in next-generation sequencing technologies then further purified by magnetic bead separation of CD34+ and bioinformatics tools have led to the identification of cells (MACS; Miltenyi, Bergisch Gladbach, Germany) for hundreds of thousands of RNA editing sites throughout subsequent FACS-purification of hematopoietic progenitor the human transcriptome [19,20], the majority of which cells (CD34+CD38+Lin-) that represent the LSC fraction in are localized to hyper-edited regions [21]. With the BC CML [23]. Datasets from previous RNA-seq analyses of availability of such massive new datasets, it is now crit- purified CML LSC are available through the NIH Sequence ical to apply this knowledge to mine new and existing Read Archive (SRA), accession ID SRP028528. RNA-sequencing (RNA-seq) datasets of human tissues, to identify disease-relevant RNA editing loci. Previously, Primary CSC purification we found that human leukemia stem cells (LSC) from For primary patient-derived LSC purification, CD34- patients with blast crisis (BC) chronic myeloid leukemia selected cells were stained with fluorescent antibodies (CML) harbored increased expression of ADAR1 com- against human CD34, CD38, lineage markers (cocktail, all pared with normal and chronic phase (CP) progenitors antibodies from BD Biosciences, San Diego, CA) and pro- [1]. Since RNA editing may be selectively inhibited, it is of pidium iodide as previously described [1,23,24]. Following great clinical relevance to develop diagnostic and prognostic staining, cells were analyzed and sorted using a FACS Aria tools capable of accurately detecting fingerprints of aberrant II (Sanford Consortium Stem Cell Core Facility), and RNA editing activity signifying cancer progression and hematopoietic progenitor (CD34+CD38+Lin-) populations therapeutic resistance. However, the functional role of RNA were isolated. Freshly-sorted cells were collected in lysis editing of individual transcripts, and its role in cancer pro- buffer (Qiagen, Germantown, MD) for RNA extraction gression and drug resistance, has not been widely addressed followed by RNA-seq or qRT-PCR analyses as previously due to a lack of tools to quantify functionally relevant RNA described [1]. editing events in a sensitive, cost-effective manner. Trad- itional Sanger sequencing is not sufficiently sensitive to de- High-fidelity PCR and Sanger sequencing analysis tect editing events in rare stem cell regulatory transcripts, For PCR and targeted Sanger sequencing analysis, 1-2 μL and transcriptome-wide profiling of RNA editing can be of first-strand cDNA templates were prepared for PCR in costly, technically challenging [22], and analysis requires 25-50 μL reaction volumes using the high-fidelity KOD expertise in specialized bioinformatics methods. Hot Start DNA Polymerase kit according to the manufac- To address these challenges, we developed and ap- turer’s instructions (EMD Millipore, Temecula, CA). plied a straightforward, clinically amenable assay to val- “Outer” primers (Additional file 2: Table S2) used for se- idate and
Load more

Recommended publications
  • Download Download
    Robyn A Lindley. Medical Research Archives vol 8 issue 8. Medical Research Archives REVIEW ARTICLE Review of the mutational role of deaminases and the generation of a cognate molecular model to explain cancer mutation spectra Author Robyn A Lindley1,2 1Department of Clinical Pathology 2GMDx Genomics Ltd, The Victorian Comprehensive Cancer Centre Level 3 162 Collins Street, Faculty of Medicine, Dentistry & Health Sciences Melbourne VIC3000, AUSTRALIA University of Melbourne, Email: [email protected] 305 Gratton Street, Melbourne, VIC 3000, AUSTRALIA Email: [email protected] Correspondence: Robyn A Lindley, Department of Clinical Pathology, Faculty of Medicine, Dentistry & Health Sciences, University of Melbourne, 305 Gratton Street, Melbourne VIC 3000 AUSTRALIA Mobile: +61 (0) 414209132 Email: [email protected] Abstract Recent developments in somatic mutation analyses have led to the discovery of codon-context targeted somatic mutation (TSM) signatures in cancer genomes: it is now known that deaminase mutation target sites are far more specific than previously thought. As this research provides novel insights into the deaminase origin of most of the somatic point mutations arising in cancer, a clear understanding of the mechanisms and processes involved will be valuable for molecular scientists as well as oncologists and cancer specialists in the clinic. This review will describe the basic research into the mechanism of antigen-driven somatic hypermutation of immunoglobulin variable genes (Ig SHM) that lead to the discovery of TSM signatures, and it will show that an Ig SHM-like signature is ubiquitous in the cancer exome. Most importantly, the data discussed in this review show that Ig SHM-like cancer-associated signatures are highly targeted to cytosine (C) and adenosine (A) nucleotides in a characteristic codon-context fashion.
    [Show full text]
  • Supplementary Information.Pdf
    Supplementary Information Whole transcriptome profiling reveals major cell types in the cellular immune response against acute and chronic active Epstein‐Barr virus infection Huaqing Zhong1, Xinran Hu2, Andrew B. Janowski2, Gregory A. Storch2, Liyun Su1, Lingfeng Cao1, Jinsheng Yu3, and Jin Xu1 Department of Clinical Laboratory1, Children's Hospital of Fudan University, Minhang District, Shanghai 201102, China; Departments of Pediatrics2 and Genetics3, Washington University School of Medicine, Saint Louis, Missouri 63110, United States. Supplementary information includes the following: 1. Supplementary Figure S1: Fold‐change and correlation data for hyperactive and hypoactive genes. 2. Supplementary Table S1: Clinical data and EBV lab results for 110 study subjects. 3. Supplementary Table S2: Differentially expressed genes between AIM vs. Healthy controls. 4. Supplementary Table S3: Differentially expressed genes between CAEBV vs. Healthy controls. 5. Supplementary Table S4: Fold‐change data for 303 immune mediators. 6. Supplementary Table S5: Primers used in qPCR assays. Supplementary Figure S1. Fold‐change (a) and Pearson correlation data (b) for 10 cell markers and 61 hypoactive and hyperactive genes identified in subjects with acute EBV infection (AIM) in the primary cohort. Note: 23 up‐regulated hyperactive genes were highly correlated positively with cytotoxic T cell (Tc) marker CD8A and NK cell marker CD94 (KLRD1), and 38 down‐regulated hypoactive genes were highly correlated positively with B cell, conventional dendritic cell
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • The Battle Between Retroviruses and APOBEC3 Genes: Its Past and Present
    viruses Review The Battle between Retroviruses and APOBEC3 Genes: Its Past and Present Keiya Uriu 1,2,†, Yusuke Kosugi 3,4,†, Jumpei Ito 1 and Kei Sato 1,2,* 1 Division of Systems Virology, Department of Infectious Disease Control, International Research Center for Infectious Diseases, Institute of Medical Science, The University of Tokyo, Tokyo 1088639, Japan; [email protected] (K.U.); [email protected] (J.I.) 2 Graduate School of Medicine, The University of Tokyo, Tokyo 1130033, Japan 3 Laboratory of Systems Virology, Institute for Frontier Life and Medical Sciences, Kyoto University, Kyoto 6068507, Japan; [email protected] 4 Graduate School of Pharmaceutical Sciences, Kyoto University, Kyoto 6068501, Japan * Correspondence: [email protected]; Tel.: +81-3-6409-2212 † These authors contributed equally to this work. Abstract: The APOBEC3 family of proteins in mammals consists of cellular cytosine deaminases and well-known restriction factors against retroviruses, including lentiviruses. APOBEC3 genes are highly amplified and diversified in mammals, suggesting that their evolution and diversification have been driven by conflicts with ancient viruses. At present, lentiviruses, including HIV, the causative agent of AIDS, are known to encode a viral protein called Vif to overcome the antiviral effects of the APOBEC3 proteins of their hosts. Recent studies have revealed that the acquisition of an anti-APOBEC3 ability by lentiviruses is a key step in achieving successful cross-species transmission. Here, we summarize the current knowledge of the interplay between mammalian APOBEC3 proteins and viral infections and introduce a scenario of the coevolution of mammalian APOBEC3 genes and viruses. Keywords: APOBEC3; lentivirus; Vif; arms race; gene diversification; coevolution Citation: Uriu, K.; Kosugi, Y.; Ito, J.; Sato, K.
    [Show full text]
  • Deaminase-Independent Mode of Antiretroviral Action in Human and Mouse APOBEC3 Proteins
    microorganisms Review Deaminase-Independent Mode of Antiretroviral Action in Human and Mouse APOBEC3 Proteins Yoshiyuki Hakata 1,* and Masaaki Miyazawa 1,2 1 Department of Immunology, Kindai University Faculty of Medicine, 377-2 Ohno-Higashi, Osaka-Sayama, Osaka 589-8511, Japan; [email protected] 2 Kindai University Anti-Aging Center, 3-4-1 Kowakae, Higashiosaka, Osaka 577-8502, Japan * Correspondence: [email protected]; Tel.: +81-72-367-7660 Received: 8 December 2020; Accepted: 9 December 2020; Published: 12 December 2020 Abstract: Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3 (APOBEC3) proteins (APOBEC3s) are deaminases that convert cytosines to uracils predominantly on a single-stranded DNA, and function as intrinsic restriction factors in the innate immune system to suppress replication of viruses (including retroviruses) and movement of retrotransposons. Enzymatic activity is supposed to be essential for the APOBEC3 antiviral function. However, it is not the only way that APOBEC3s exert their biological function. Since the discovery of human APOBEC3G as a restriction factor for HIV-1, the deaminase-independent mode of action has been observed. At present, it is apparent that both the deaminase-dependent and -independent pathways are tightly involved not only in combating viruses but also in human tumorigenesis. Although the deaminase-dependent pathway has been extensively characterized so far, understanding of the deaminase-independent pathway remains immature. Here, we review existing knowledge regarding the deaminase-independent antiretroviral functions of APOBEC3s and their molecular mechanisms. We also discuss the possible unidentified molecular mechanism for the deaminase-independent antiretroviral function mediated by mouse APOBEC3. Keywords: APOBEC3; deaminase-independent antiretroviral function; innate immunity 1.
    [Show full text]
  • Strand Breaks for P53 Exon 6 and 8 Among Different Time Course of Folate Depletion Or Repletion in the Rectosigmoid Mucosa
    SUPPLEMENTAL FIGURE COLON p53 EXONIC STRAND BREAKS DURING FOLATE DEPLETION-REPLETION INTERVENTION Supplemental Figure Legend Strand breaks for p53 exon 6 and 8 among different time course of folate depletion or repletion in the rectosigmoid mucosa. The input of DNA was controlled by GAPDH. The data is shown as ΔCt after normalized to GAPDH. The higher ΔCt the more strand breaks. The P value is shown in the figure. SUPPLEMENT S1 Genes that were significantly UPREGULATED after folate intervention (by unadjusted paired t-test), list is sorted by P value Gene Symbol Nucleotide P VALUE Description OLFM4 NM_006418 0.0000 Homo sapiens differentially expressed in hematopoietic lineages (GW112) mRNA. FMR1NB NM_152578 0.0000 Homo sapiens hypothetical protein FLJ25736 (FLJ25736) mRNA. IFI6 NM_002038 0.0001 Homo sapiens interferon alpha-inducible protein (clone IFI-6-16) (G1P3) transcript variant 1 mRNA. Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 GALNTL5 NM_145292 0.0001 (GALNT15) mRNA. STIM2 NM_020860 0.0001 Homo sapiens stromal interaction molecule 2 (STIM2) mRNA. ZNF645 NM_152577 0.0002 Homo sapiens hypothetical protein FLJ25735 (FLJ25735) mRNA. ATP12A NM_001676 0.0002 Homo sapiens ATPase H+/K+ transporting nongastric alpha polypeptide (ATP12A) mRNA. U1SNRNPBP NM_007020 0.0003 Homo sapiens U1-snRNP binding protein homolog (U1SNRNPBP) transcript variant 1 mRNA. RNF125 NM_017831 0.0004 Homo sapiens ring finger protein 125 (RNF125) mRNA. FMNL1 NM_005892 0.0004 Homo sapiens formin-like (FMNL) mRNA. ISG15 NM_005101 0.0005 Homo sapiens interferon alpha-inducible protein (clone IFI-15K) (G1P2) mRNA. SLC6A14 NM_007231 0.0005 Homo sapiens solute carrier family 6 (neurotransmitter transporter) member 14 (SLC6A14) mRNA.
    [Show full text]
  • 1 APOBEC-Mediated Mutagenesis in Urothelial Carcinoma Is Associated
    bioRxiv preprint doi: https://doi.org/10.1101/123802; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. APOBEC-mediated mutagenesis in urothelial carcinoma is associated with improved survival, mutations in DNA damage response genes, and immune response Alexander P. Glaser MD, Damiano Fantini PhD, Kalen J. Rimar MD, Joshua J. Meeks MD PhD APG, DF, KJR, JJM: Northwestern University, Department of Urology, Chicago, IL, 60607 Running title: APOBEC mutagenesis in bladder cancer *Corresponding author: Joshua J. Meeks, MD PhD 303 E. Chicago Ave. Tarry 16-703 Chicago, IL 60611 Email: [email protected] Keywords (4-6): • Urinary bladder neoplasms • APOBEC Deaminases • Mutagenesis • DNA damage • Interferon Abbreviations and Acronyms: TCGA – The Cancer Genome Atlas ssDNA – single stranded DNA APOBEC –apolipoprotein B mRNA editing catalytic polypeptide-like GCAC – Genome Data Analysis Center MAF – mutation annotation format “APOBEC-high” – tumors enriched for APOBEC mutagenesis “APOBEC-low” – tumors not enriched for APOBEC mutagenesis 1 bioRxiv preprint doi: https://doi.org/10.1101/123802; this version posted April 4, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: Background: The APOBEC family of enzymes is responsible for a mutation signature characterized by a TCW>T/G mutation. APOBEC-mediated mutagenesis is implicated in a wide variety of tumors, including bladder cancer. In this study, we explore the APOBEC mutational signature in bladder cancer and the relationship with specific mutations, molecular subtype, gene expression, and survival.
    [Show full text]
  • Diversification of AID/APOBEC-Like Deaminases in Metazoa: Multiplicity
    Diversification of AID/APOBEC-like deaminases in PNAS PLUS metazoa: multiplicity of clades and widespread roles in immunity Arunkumar Krishnana, Lakshminarayan M. Iyera, Stephen J. Hollandb, Thomas Boehmb, and L. Aravinda,1 aNational Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, MD 20894; and bDepartment of Developmental Immunology, Max Planck Institute of Immunobiology and Epigenetics, 79108 Freiburg, Germany Edited by Anjana Rao, La Jolla Institute and University of California San Diego, La Jolla, CA, and approved February 23, 2018 (received for review November 30, 2017) AID/APOBEC deaminases (AADs) convert cytidine to uridine in viruses and retrotransposons through hypermutation of DNA during single-stranded nucleic acids. They are involved in numerous muta- reverse transcription (APOBEC3s) (21). genic processes, including those underpinning vertebrate innate and The deaminase superfamily displays a conserved β-sheet with adaptive immunity. Using a multipronged sequence analysis strategy, five β-strands arranged in 2-1-3-4-5 order interleaved with three we uncover several AADs across metazoa, dictyosteliida, and algae, α-helices forming an α/β-fold (the deaminase fold) (22), which it including multiple previously unreported vertebrate clades, and shares with JAB/RadC, AICAR transformylase, formate de- versions from urochordates, nematodes, echinoderms, arthropods, hydrogenase accessory subunit (FdhD), and Tm1506 superfamilies lophotrochozoans, cnidarians, and porifera. Evolutionary analysis sug- of proteins. The active site consists of two zinc (Zn)-chelating gests a fundamental division of AADs early in metazoan evolution into motifs, respectively typified by the signatures HxE/CxE/DxE at secreted deaminases (SNADs) and classical AADs, followed by diver- the end of helix 2 and CxnC (where x is any amino acid and n is ≥2) sification into several clades driven by rapid-sequence evolution, gene located in loop 5 and the beginning of helix 3 (Fig.
    [Show full text]
  • Insights Into the Structures and Multimeric Status of APOBEC Proteins Involved in Viral Restriction and Other Cellular Functions
    viruses Review Insights into the Structures and Multimeric Status of APOBEC Proteins Involved in Viral Restriction and Other Cellular Functions Xiaojiang S. Chen 1,2,3 1 Molecular and Computational Biology, Departments of Biological Sciences, Chemistry, University of Southern California, Los Angeles, CA 90089, USA; [email protected]; Tel.: +1-213-740-5487 2 Genetic, Molecular and Cellular Biology Program, Keck School of Medicine, Norris Comprehensive Cancer Center, University of Southern California, Los Angeles, CA 90089, USA 3 Center of Excellence in NanoBiophysics/Structural Biology, University of Southern California, Los Angeles, CA 90089, USA Abstract: Apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC) proteins belong to a family of deaminase proteins that can catalyze the deamination of cytosine to uracil on single- stranded DNA or/and RNA. APOBEC proteins are involved in diverse biological functions, including adaptive and innate immunity, which are critical for restricting viral infection and endogenous retroelements. Dysregulation of their functions can cause undesired genomic mutations and RNA modification, leading to various associated diseases, such as hyper-IgM syndrome and cancer. This review focuses on the structural and biochemical data on the multimerization status of individual APOBECs and the associated functional implications. Many APOBECs form various multimeric complexes, and multimerization is an important way to regulate functions for some of these proteins at several levels, such as deaminase activity, protein stability, subcellular localization, protein storage Citation: Chen, X.S. Insights into and activation, virion packaging, and antiviral activity. The multimerization of some APOBECs is the Structures and Multimeric Status more complicated than others, due to the associated complex RNA binding modes.
    [Show full text]
  • Supplementary Table 1A. Genes Significantly Altered in A4573 ESFT
    Supplementary Table 1A. Genes significantly altered in A4573 ESFT cells following BMI-1knockdown genesymbol genedescription siControl siBMI1 FC Direction P-value AASS aminoadipate-semialdehyde synthase | tetra-peptide repeat homeobox-like6.68 7.24 1.5 Up 0.007 ABCA2 ATP-binding cassette, sub-family A (ABC1), member 2 | neural5.44 proliferation,6.3 differentiation1.8 and Upcontrol, 1 0.006 ABHD4 abhydrolase domain containing 4 7.51 6.69 1.8 Down 0.002 ACACA acetyl-Coenzyme A carboxylase alpha | peroxiredoxin 5 | similar6.2 to High mobility7.26 group2.1 protein UpB1 (High mobility0.009 group protein 1) (HMG-1) (Amphoterin) (Heparin-binding protein p30) | Coenzyme A synthase ACAD9 acyl-Coenzyme A dehydrogenase family, member 9 9.25 8.59 1.6 Down 0.008 ACBD3 acyl-Coenzyme A binding domain containing 3 7.89 8.53 1.6 Up 0.008 ACCN2 amiloride-sensitive cation channel 2, neuronal 5.47 6.28 1.8 Up 0.005 ACIN1 apoptotic chromatin condensation inducer 1 7.15 7.79 1.6 Up 0.008 ACPL2 acid phosphatase-like 2 6.04 7.6 2.9 Up 0.000 ACSL4 acyl-CoA synthetase long-chain family member 4 6.72 5.8 1.9 Down 0.001 ACTA2 actin, alpha 2, smooth muscle, aorta 9.18 8.44 1.7 Down 0.003 ACYP1 acylphosphatase 1, erythrocyte (common) type 7.09 7.66 1.5 Up 0.009 ADA adenosine deaminase 6.34 7.1 1.7 Up 0.009 ADAL adenosine deaminase-like 7.88 6.89 2.0 Down 0.006 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 6.57 7.65 2.1 Up 0.000 ADARB1 adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) 6.49 7.13 1.6 Up 0.008 ADCY9 adenylate cyclase 9 6.5 7.18
    [Show full text]
  • The Eukaryotic Translation Initiation Factor 2, a Hero Turned Villain in Β Cells
    The eukaryotic translation initiation factor 2, a hero turned villain in β cells By Baroj Abdulkarim Université libre de Bruxelles Faculty of Medicine ULB Center for Diabetes Research Academic year 2016-2017 Jury Members: Dr. Ingrid Langer (President) Dr. Miriam Cnop (Promoter and secretary) Dr. Mariana Igoillo Esteve (Co-Promoter) Dr. Daniel Christophe Dr. Christophe Erneux Dr. Claudine Heinrichs Dr. Amar Abderrahmani Dr. Patrick Gilon Dedicated to my daughter Elîn 2 Contents Papers constituting this thesis .................................................................................... 4 Abbreviations .............................................................................................................. 5 Abstract ...................................................................................................................... 8 Résumé ...................................................................................................................... 9 Introduction ............................................................................................................... 10 Diabetes mellitus ................................................................................................... 10 How β cells work ................................................................................................ 11 Type 2 and monogenic diabetes ........................................................................ 12 Free fatty acids and diabetes ...............................................................................
    [Show full text]
  • Apoptotic Cells Inflammasome Activity During the Uptake of Macrophage
    Downloaded from http://www.jimmunol.org/ by guest on October 2, 2021 is online at: average * The Journal of Immunology published online 20 April 2012 from submission to initial decision 4 weeks from acceptance to publication http://www.jimmunol.org/content/early/2012/04/20/jimmun ol.1103760 Complement Protein C1q Directs Macrophage Polarization and Limits Inflammasome Activity during the Uptake of Apoptotic Cells Marie E. Benoit, Elizabeth V. Clarke, Pedro Morgado, Deborah A. Fraser and Andrea J. Tenner J Immunol Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/suppl/2012/04/20/jimmunol.110376 0.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of October 2, 2021. Published April 20, 2012, doi:10.4049/jimmunol.1103760 The Journal of Immunology Complement Protein C1q Directs Macrophage Polarization and Limits Inflammasome Activity during the Uptake of Apoptotic Cells Marie E. Benoit, Elizabeth V. Clarke, Pedro Morgado, Deborah A. Fraser, and Andrea J. Tenner Deficiency in C1q, the recognition component of the classical complement cascade and a pattern recognition receptor involved in apoptotic cell clearance, leads to lupus-like autoimmune diseases characterized by auto-antibodies to self proteins and aberrant innate immune cell activation likely due to impaired clearance of apoptotic cells.
    [Show full text]