DOCSLIB.ORG

ADAR1 Promotes Malignant Progenitor Reprogramming in Chronic Myeloid Leukemia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ADAR1 Promotes Malignant Progenitor Reprogramming in Chronic Myeloid Leukemia ADAR1 promotes malignant progenitor reprogramming in chronic myeloid leukemia Qingfei Jianga,b,c, Leslie A. Crewsa,b,c, Christian L. Barrettd, Hye-Jung Chune, Angela C. Courta,b,c, Jane M. Isquitha,b,c,f, Maria A. Zipetoa,b,c,g, Daniel J. Goffa,b,c, Mark Mindenh, Anil Sadarangania,b,c, Jessica M. Rusertc,i, Kim-Hien T. Daoj, Sheldon R. Morrisa,b, Lawrence S. B. Goldsteinc,i,k, Marco A. Marrae, Kelly A. Frazerd, and Catriona H. M. Jamiesona,b,c,1 aStem Cell Program, Department of Medicine, bMoores Cancer Center, dDivision of Genome Information Sciences, Department of Pediatrics, iDepartment of Cellular and Molecular Medicine, and kHoward Hughes Medical Institute, University of California at San Diego, La Jolla, CA 92093; eCanada’s Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, BC, Canada V5Z 1L3; fDepartment of Animal Science, California Polytechnic State University, San Luis Obispo, CA 93405; gDepartment of Health Sciences, University of Milano-Bicocca, 20052 Milan, Italy; hPrincess Margaret Hospital, Toronto, ON, Canada M5T 2M9; jCenter for Hematologic Malignancies, Oregon Health and Science University Knight Cancer Institute, Portland, OR 97239; and cSanford Consortium for Regenerative Medicine, La Jolla, CA 92037 Edited* by Irving L. Weissman, Stanford University, Stanford, CA, and approved November 30, 2012 (received for review July 30, 2012) The molecular etiology of human progenitor reprogramming into ADAR2 are active in embryonic cell types (18), and ADAR3 self-renewing leukemia stem cells (LSC) has remained elusive. Al- may play a nonenzymatic regulatory role in RNA editing activity though DNA sequencing has uncovered spliceosome gene muta- (22). ADAR enzymes regulate fetal and adult hematopoietic stem tions that promote alternative splicing and portend leukemic cell (HSC) maintenance and stem cell responses to inflammation transformation, isoform diversity also may be generated by RNA (23–26). ADAR-mediated adenosine-to-inosine (A-to-I) RNA editing mediated by adenosine deaminase acting on RNA (ADAR) editing in an Alu sequence containing dsRNA hairpin structures enzymes that regulate stem cell maintenance. In this study, whole- (14, 20) can generate alternative donor or acceptor splice sites transcriptome sequencing of normal, chronic phase, and serially (27, 28), alter RNA structure (21), modulate regulatory RNAs transplantable blast crisis chronic myeloid leukemia (CML) progen- and gene silencing activities (29), and introduce codon sequence itors revealed increased IFN-γ pathway gene expression in concert alterations (29). Interestingly, ADAR deregulation has been im- plicated in a variety of malignant cell types (30, 31). However, the with BCR-ABL amplification, enhanced expression of the IFN-re- MEDICAL SCIENCES sponsive ADAR1 p150 isoform, and a propensity for increased functional effects of RNA editing in leukemia have not been adenosine-to-inosine RNA editing during CML progression. Lenti- elucidated. Here we examined the role of ADAR1-mediated RNA editing in malignant reprogramming of myeloid progenitors viral overexpression experiments demonstrate that ADAR1 p150 into LSC that drive BC transformation in CML. promotes expression of the myeloid transcription factor PU.1 and Whole-transcriptome sequencing coupled with quantitative induces malignant reprogramming of myeloid progenitors. More- RT-PCR (qRT-PCR) analysis demonstrated increased IFN-re- over, enforced ADAR1 p150 expression was associated with produc- sponsive ADAR1 expression in LSC from primary BC CML pa- β tion of a misspliced form of GSK3 implicated in LSC self-renewal. tient samples as compared with CP CML and normal cord blood Finally, functional serial transplantation and shRNA studies dem- progenitors. This increase coincided with enhanced expression of onstrate that ADAR1 knockdown impaired in vivo self-renewal inflammatory pathway genes during the progression from CP to capacity of blast crisis CML progenitors. Together these data pro- BC. Moreover, ADAR1 p150 mRNA expression correlated with vide a compelling rationale for developing ADAR1-based LSC de- BCR-ABL amplification and increased A-to-I editing with dif- tection and eradication strategies. ferential expression of ADAR target genes in BC CML. Lentiviral ADAR1 p150 expression induced PU.1 expression that promotes lthough advanced malignancies are diverse in phenotype, expansion of myeloid progenitors and was associated with pro- Athey often exhibit stem-cell properties including enhanced duction of a misspliced form of glycogen synthase kinase (GSK)- survival, differentiation, quiescence, and self-renewal potential 3β that has been implicated in LSC self-renewal (7). Lentiviral ADAR1 knockdown also reduced BC LSC self-renewal capacity (1, 2). Early insights into the molecular pathogenesis of cancer − − − − stemmed from the discovery of the Philadelphia chromosome in RAG2 / γc / mice. These data shed light on the contribution + (Ph ) and its constitutively active BCR-ABL1 tyrosine kinase in of ADAR1-mediated RNA editing to malignant progenitor chronic myeloid leukemia (CML) (3–5). Tyrosine kinase inhibitor reprogramming driving leukemic progression. (TKI) therapy targeting BCR-ABL1 suppresses CML during the chronic phase (CP) of the disease in most patients able to tolerate Results long-term therapy (6). Although the CP stage of CML often can Inflammatory Mediator-Driven RNA Editing Portends Blastic Trans- be controlled for long periods of time with standard TKI thera- formation. To investigate the mechanisms driving malignant pies, subsequent genetic and epigenetic alterations promote pro- reprogramming of myeloid progenitors into LSC, we performed genitor expansion and the generation of self-renewing leukemia whole-transcriptome sequencing (RNA-seq) on FACS-purified + + − stem cells (LSC) that fuel disease progression and blast crisis (BC) CD34 CD38 Lin progenitor cells isolated from primary CML transformation along with TKI resistance (7, 8). Furthermore, TKI discontinuation usually results in CML resurgence, suggesting – that quiescent progenitors persist despite therapy (9 12). Author contributions: Q.J., M.A.M., K.A.F., and C.H.M.J. designed research; Q.J., C.L.B., Mutations in spliceosome genes and alternative splicing of H.-J.C., A.C.C., J.M.I., M.A.Z., D.J.G., A.S., and J.M.R. performed research; M.M., A.S., K.-H.T.D., coding and noncoding RNAs are emerging as important drivers L.S.B.G., M.A.M., and K.A.F. contributed new reagents/analytic tools; Q.J., L.A.C., C.L.B., of transcriptomic diversity that fuel leukemic progression and H.-J.C., A.C.C., J.M.I., M.A.Z., D.J.G., S.R.M., and C.H.M.J. analyzed data; and Q.J., L.A.C., therapeutic resistance (7, 8, 13). Moreover, previous studies re- and C.H.M.J. wrote the paper. veal extensive RNA editing in the human transcriptome (14–17), The authors declare no conflict of interest. primarily in primate-specific Alu sequences (18–20), which pro- *This Direct Submission article had a prearranged editor. motes splice isoform diversity. RNA editing activity is mediated Freely available online through the PNAS open access option. by the adenosine deaminase acting on dsRNA (ADAR) family of 1To whom correspondence should be addressed. E-mail: [email protected]. editases (21), which includes ADAR1 (also known as ADAR), This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. ADAR2 (ADARB1), and ADAR3 (ADARB2). ADAR1 and 1073/pnas.1213021110/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1213021110 PNAS Early Edition | 1of6 Downloaded by guest on October 2, 2021 Imatinib- A FGF SIGNALING G treated PATHWAY(N) NATURAL PROTEOGLYCAN KILLER 3.00 SYNDECAN-MEDIATED ROLE OF MEF2D CELL MEDIATED 2.00 SIGNALING IN CYTOTOXICITY(K) 1.00 EVENTS(N) T-CELL 0.00 APOPTOSIS(B) -1.00 PDGFR-BETA BCELL T CELL -2.00 CP-13 CP-05 CP-01 BC-17 BC-06 BC-02 CP-12 CP-04 CP-19 BC-05 BC-08 BC-09 CP-02 CB-03 BC-07 CB-02 CP-06 BC-25 SIGNALING BCELL ACTIVATION(P) CB-01 FAM107B NECTIN ACTIVATION(P) -3.00 PATHWAY(N) RECEPTOR CD70 ADHESION THROMBOXANE RPS6KA2 A2 SIGNALING DCTN4 PATHWAY(N) FARP1 SPHINGOSINE RECEPTOR PATHWAY(K) RAP1GAP2 1-PHOSPHATE SIGNALING(N) SERINC5 S1P1 NRP1 PATHWAY(N) (S1P) KIF1C PATHWAY(N) CPM TRAIL NLRC5 SIGNALING T CELL ZCCHC7 EVENTS SIGNALING LARGE RECEPTOR MXRA7 REGULATION OF PATHWAY(N) MEDIATED BY SIGNALING NEK11 PTP1B(N) NUCLEAR STAT1 PATHWAY(K) TSPAN13 SMAD2/3 TNF RECEPTOR MGAT4A SIGNALING(N) CDK9 SIGNALING IL12RB1 BCR SIGNALING PLASMA GLYPICAN 1 C4orf34 P38 MAPKPATHWAY(N) PATHWAY(N) AGPS MEMBRANE NETWORK(N) TMEM154 ESTROGEN SIGNALING OLFML2A PATHWAY(N) GLYPICAN VCAN RECEPTOR PATHWAY(N) TCR SIGNALING ANXA2 SIGNALING(N) FBXW7 REGULATION OF CLASS I PI3K IN LY96 NAIVE CD4+ T RBM47 REGULATION OF P38-ALPHA SIGNALING GALNT3 AND EVENTS(N) CELLS(N) PTPN14 CYTOPLASMIC TRIM38 AND P38-BETA(N) IL1-MEDIATED HDAC5 SIGNALING FLNB NUCLEAR TCR SIGNALING CMTM8 BMP RECEPTOR EVENTS(N) SMAD2/3 IN CLMN SIGNALING(N) ARHGAP25 SIGNALING(N) NAIVE CD8+ T CUEDC1 TGF-BETA BC Increased in CML CELLS(N) SLC27A1 RECEPTOR TCR LAPTM5 γ ALOX5 IFN- SIGNALING(N) SIGNALING(R) SLC35E3 SPATS2L IL6-MEDIATED PATHWAY(N) RNASET2 MS4A7 SIGNALING CD58 EVENTS(N) RAB31 FDR 4.0E-05 0.01 IL12-MEDIATED PLCD3 SIGNALING MEF2A CDS2 EVENTS(N) LRRFIP1 PIK3IP1 NCUBE1 ICOSLG MEF2D ADAR1 mRNA Expression ANXA6 BC HCK *P<0.05 VIL2 2 FGD6 p150 r =0.63, P=0.058 RNF125 20 **P<0.05 50 TPM4 2 S100A16 p110 r =0.42, P=0.162 FRMD4B MYO5C GUCY1A3 40 ABCA1 15 PKM2 SSBP2 SNX2 30 KIAA2018 PROM1 10 RUNX2 DUSP3 20 ANPEP TIMP2 SH3BP2 ARHGAP26 5 MAML2 10 SMAD1 TCF7L2 SVIL ADAR1 mRNA Expression PLCB1 0 0 COQ10B ATF3 d 0.0 0.5 1.0 1.5 2.0 2.5 IRGQ Ratio of p150 to p110 mRNA Levels mRNA Ratio of p150 to p110 CP SESN1 RNF11 BCR-ABL mRNA Expression CLEC2B CML CML BC RHOC Cord Bloo RIPK2 NSUN7 RASGEF1B CNST A-to-I Editing Changes in CML BC v.
Load more

Recommended publications
  • How Asbestos Drives the Tissue Towards Tumors: YAP Activation, Macrophage and Mesothelial Precursor Recruitment, RNA Editing, and Somatic Mutations
    Oncogene (2018) 37:2645–2659 https://doi.org/10.1038/s41388-018-0153-z ARTICLE How asbestos drives the tissue towards tumors: YAP activation, macrophage and mesothelial precursor recruitment, RNA editing, and somatic mutations 1 2 3 3 3 4 Hubert Rehrauer ● Licun Wu ● Walter Blum ● Lazslo Pecze ● Thomas Henzi ● Véronique Serre-Beinier ● 1 5 2 3 6 Catherine Aquino ● Bart Vrugt ● Marc de Perrot ● Beat Schwaller ● Emanuela Felley-Bosco Received: 1 September 2017 / Revised: 11 December 2017 / Accepted: 30 December 2017 / Published online: 6 March 2018 © The Author(s) 2018. This article is published with open access Abstract Chronic exposure to intraperitoneal asbestos triggered a marked response in the mesothelium well before tumor development. Macrophages, mesothelial precursor cells, cytokines, and growth factors accumulated in the peritoneal lavage. Transcriptome profiling revealed YAP/TAZ activation in inflamed mesothelium with further activation in tumors, paralleled by increased levels of cells with nuclear YAP/TAZ. Arg1 was one of the highest upregulated genes in inflamed tissue and tumor. Inflamed tissue showed increased levels of single-nucleotide variations, with an RNA-editing signature, which were 1234567890();,: even higher in the tumor samples. Subcutaneous injection of asbestos-treated, but tumor-free mice with syngeneic mesothelioma tumor cells resulted in a significantly higher incidence of tumor growth when compared to naïve mice supporting the role of the environment in tumor progression. Introduction The association of exposure to asbestos with development of mesothelioma has been demonstrated in the seminal experimental work of Wagner in the 1960s [1]. In 1987, Kane and co-workers [2] observed that already a single dose These authors contributed equally: Hubert Rehrauer, Licun Wu.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.
    [Show full text]
  • Altered Regulation of Adipomir Editing with Aging
    International Journal of Molecular Sciences Article Altered Regulation of adipomiR Editing with Aging Sabel Meadows, Abbagael Seidler, Madison Wall, Jamika Page, Cara Taylor, Brendin Flinn , Robin Turner and Nalini Santanam * Department of Biomedical Sciences, Joan C Edwards School of Medicine, Marshall University, Huntington, WV 25755, USA; [email protected] (S.M.); [email protected] (A.S.); [email protected] (M.W.); [email protected] (J.P.); [email protected] (C.T.); fl[email protected] (B.F.); [email protected] (R.T.) * Correspondence: [email protected] Received: 18 August 2020; Accepted: 17 September 2020; Published: 20 September 2020 Abstract: Adipose dysfunction with aging increases risk to insulin resistance and other chronic metabolic diseases. We previously showed functional changes in microRNAs involved in pre-adipocyte differentiation with aging resulting in adipose dysfunction. However, the mechanisms leading to this dysfunction in microRNAs in adipose tissue (adipomiRs) during aging are not well understood. We determined the longitudinal changes in expression of adipomiRs and studied their regulatory mechanisms, such as miRNA biogenesis and editing, in an aging rodent model, with Fischer344 Brown-Norway hybrid rats at ages ranging from 3 to 30 months (male/females, × n > 8). Expression of adipomiRs and their edited forms were determined by small-RNA sequencing. RT-qPCR was used to measure the mRNA expression of biogenesis and editing enzymes. Sanger sequencing was used to validate editing with aging. Differential expression of adipomiRs involved in adipocyte differentiation and insulin signaling was altered with aging. Sex- and age-specific changes in edited adipomiRs were observed. An increase in miRNA biogenesis and editing enzymes (ADARs and their splice variants) were observed with increasing age, more so in female than male rats.
    [Show full text]
  • An RNA Editing Fingerprint of Cancer Stem Cell Reprogramming
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by eScholarship - University of California UC San Diego UC San Diego Previously Published Works Title An RNA editing fingerprint of cancer stem cell reprogramming. Permalink https://escholarship.org/uc/item/4vm8q0f6 Journal Journal of translational medicine, 13(1) ISSN 1479-5876 Authors Crews, Leslie A Jiang, Qingfei Zipeto, Maria A et al. Publication Date 2015-02-12 DOI 10.1186/s12967-014-0370-3 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Crews et al. Journal of Translational Medicine (2015) 13:52 DOI 10.1186/s12967-014-0370-3 METHODOLOGY Open Access An RNA editing fingerprint of cancer stem cell reprogramming Leslie A Crews1,2, Qingfei Jiang1,2, Maria A Zipeto1,2, Elisa Lazzari1,2,3, Angela C Court1,2, Shawn Ali1,2, Christian L Barrett4, Kelly A Frazer4 and Catriona HM Jamieson1,2* Abstract Background: Deregulation of RNA editing by adenosine deaminases acting on dsRNA (ADARs) has been implicated in the progression of diverse human cancers including hematopoietic malignancies such as chronic myeloid leukemia (CML). Inflammation-associated activation of ADAR1 occurs in leukemia stem cells specifically in the advanced, often drug-resistant stage of CML known as blast crisis. However, detection of cancer stem cell-associated RNA editing by RNA sequencing in these rare cell populations can be technically challenging, costly and requires PCR validation. The objectives of this study were to validate RNA editing of a subset of cancer stem cell-associated transcripts, and to develop a quantitative RNA editing fingerprint assay for rapid detection of aberrant RNA editing in human malignancies.
    [Show full text]
  • Download Download
    Robyn A Lindley. Medical Research Archives vol 8 issue 8. Medical Research Archives REVIEW ARTICLE Review of the mutational role of deaminases and the generation of a cognate molecular model to explain cancer mutation spectra Author Robyn A Lindley1,2 1Department of Clinical Pathology 2GMDx Genomics Ltd, The Victorian Comprehensive Cancer Centre Level 3 162 Collins Street, Faculty of Medicine, Dentistry & Health Sciences Melbourne VIC3000, AUSTRALIA University of Melbourne, Email: [email protected] 305 Gratton Street, Melbourne, VIC 3000, AUSTRALIA Email: [email protected] Correspondence: Robyn A Lindley, Department of Clinical Pathology, Faculty of Medicine, Dentistry & Health Sciences, University of Melbourne, 305 Gratton Street, Melbourne VIC 3000 AUSTRALIA Mobile: +61 (0) 414209132 Email: [email protected] Abstract Recent developments in somatic mutation analyses have led to the discovery of codon-context targeted somatic mutation (TSM) signatures in cancer genomes: it is now known that deaminase mutation target sites are far more specific than previously thought. As this research provides novel insights into the deaminase origin of most of the somatic point mutations arising in cancer, a clear understanding of the mechanisms and processes involved will be valuable for molecular scientists as well as oncologists and cancer specialists in the clinic. This review will describe the basic research into the mechanism of antigen-driven somatic hypermutation of immunoglobulin variable genes (Ig SHM) that lead to the discovery of TSM signatures, and it will show that an Ig SHM-like signature is ubiquitous in the cancer exome. Most importantly, the data discussed in this review show that Ig SHM-like cancer-associated signatures are highly targeted to cytosine (C) and adenosine (A) nucleotides in a characteristic codon-context fashion.
    [Show full text]
  • T Lymphocytes Mrna, and Protein Expression in Activated Networks
    MicroRNA Regulation of Molecular Networks Mapped by Global MicroRNA, mRNA, and Protein Expression in Activated T Lymphocytes This information is current as of September 23, 2021. Yevgeniy A. Grigoryev, Sunil M. Kurian, Traver Hart, Aleksey A. Nakorchevsky, Caifu Chen, Daniel Campbell, Steven R. Head, John R. Yates III and Daniel R. Salomon J Immunol 2011; 187:2233-2243; Prepublished online 25 July 2011; Downloaded from doi: 10.4049/jimmunol.1101233 http://www.jimmunol.org/content/187/5/2233 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2011/07/25/jimmunol.110123 Material 3.DC1 References This article cites 83 articles, 31 of which you can access for free at: http://www.jimmunol.org/content/187/5/2233.full#ref-list-1 Why The JI? Submit online. by guest on September 23, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology MicroRNA Regulation of Molecular Networks Mapped by Global MicroRNA, mRNA, and Protein Expression in Activated T Lymphocytes Yevgeniy A.
    [Show full text]
  • Supplementary Information.Pdf
    Supplementary Information Whole transcriptome profiling reveals major cell types in the cellular immune response against acute and chronic active Epstein‐Barr virus infection Huaqing Zhong1, Xinran Hu2, Andrew B. Janowski2, Gregory A. Storch2, Liyun Su1, Lingfeng Cao1, Jinsheng Yu3, and Jin Xu1 Department of Clinical Laboratory1, Children's Hospital of Fudan University, Minhang District, Shanghai 201102, China; Departments of Pediatrics2 and Genetics3, Washington University School of Medicine, Saint Louis, Missouri 63110, United States. Supplementary information includes the following: 1. Supplementary Figure S1: Fold‐change and correlation data for hyperactive and hypoactive genes. 2. Supplementary Table S1: Clinical data and EBV lab results for 110 study subjects. 3. Supplementary Table S2: Differentially expressed genes between AIM vs. Healthy controls. 4. Supplementary Table S3: Differentially expressed genes between CAEBV vs. Healthy controls. 5. Supplementary Table S4: Fold‐change data for 303 immune mediators. 6. Supplementary Table S5: Primers used in qPCR assays. Supplementary Figure S1. Fold‐change (a) and Pearson correlation data (b) for 10 cell markers and 61 hypoactive and hyperactive genes identified in subjects with acute EBV infection (AIM) in the primary cohort. Note: 23 up‐regulated hyperactive genes were highly correlated positively with cytotoxic T cell (Tc) marker CD8A and NK cell marker CD94 (KLRD1), and 38 down‐regulated hypoactive genes were highly correlated positively with B cell, conventional dendritic cell
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • The Battle Between Retroviruses and APOBEC3 Genes: Its Past and Present
    viruses Review The Battle between Retroviruses and APOBEC3 Genes: Its Past and Present Keiya Uriu 1,2,†, Yusuke Kosugi 3,4,†, Jumpei Ito 1 and Kei Sato 1,2,* 1 Division of Systems Virology, Department of Infectious Disease Control, International Research Center for Infectious Diseases, Institute of Medical Science, The University of Tokyo, Tokyo 1088639, Japan; [email protected] (K.U.); [email protected] (J.I.) 2 Graduate School of Medicine, The University of Tokyo, Tokyo 1130033, Japan 3 Laboratory of Systems Virology, Institute for Frontier Life and Medical Sciences, Kyoto University, Kyoto 6068507, Japan; [email protected] 4 Graduate School of Pharmaceutical Sciences, Kyoto University, Kyoto 6068501, Japan * Correspondence: [email protected]; Tel.: +81-3-6409-2212 † These authors contributed equally to this work. Abstract: The APOBEC3 family of proteins in mammals consists of cellular cytosine deaminases and well-known restriction factors against retroviruses, including lentiviruses. APOBEC3 genes are highly amplified and diversified in mammals, suggesting that their evolution and diversification have been driven by conflicts with ancient viruses. At present, lentiviruses, including HIV, the causative agent of AIDS, are known to encode a viral protein called Vif to overcome the antiviral effects of the APOBEC3 proteins of their hosts. Recent studies have revealed that the acquisition of an anti-APOBEC3 ability by lentiviruses is a key step in achieving successful cross-species transmission. Here, we summarize the current knowledge of the interplay between mammalian APOBEC3 proteins and viral infections and introduce a scenario of the coevolution of mammalian APOBEC3 genes and viruses. Keywords: APOBEC3; lentivirus; Vif; arms race; gene diversification; coevolution Citation: Uriu, K.; Kosugi, Y.; Ito, J.; Sato, K.
    [Show full text]
  • Deaminase-Independent Mode of Antiretroviral Action in Human and Mouse APOBEC3 Proteins
    microorganisms Review Deaminase-Independent Mode of Antiretroviral Action in Human and Mouse APOBEC3 Proteins Yoshiyuki Hakata 1,* and Masaaki Miyazawa 1,2 1 Department of Immunology, Kindai University Faculty of Medicine, 377-2 Ohno-Higashi, Osaka-Sayama, Osaka 589-8511, Japan; [email protected] 2 Kindai University Anti-Aging Center, 3-4-1 Kowakae, Higashiosaka, Osaka 577-8502, Japan * Correspondence: [email protected]; Tel.: +81-72-367-7660 Received: 8 December 2020; Accepted: 9 December 2020; Published: 12 December 2020 Abstract: Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3 (APOBEC3) proteins (APOBEC3s) are deaminases that convert cytosines to uracils predominantly on a single-stranded DNA, and function as intrinsic restriction factors in the innate immune system to suppress replication of viruses (including retroviruses) and movement of retrotransposons. Enzymatic activity is supposed to be essential for the APOBEC3 antiviral function. However, it is not the only way that APOBEC3s exert their biological function. Since the discovery of human APOBEC3G as a restriction factor for HIV-1, the deaminase-independent mode of action has been observed. At present, it is apparent that both the deaminase-dependent and -independent pathways are tightly involved not only in combating viruses but also in human tumorigenesis. Although the deaminase-dependent pathway has been extensively characterized so far, understanding of the deaminase-independent pathway remains immature. Here, we review existing knowledge regarding the deaminase-independent antiretroviral functions of APOBEC3s and their molecular mechanisms. We also discuss the possible unidentified molecular mechanism for the deaminase-independent antiretroviral function mediated by mouse APOBEC3. Keywords: APOBEC3; deaminase-independent antiretroviral function; innate immunity 1.
    [Show full text]
  • Strand Breaks for P53 Exon 6 and 8 Among Different Time Course of Folate Depletion Or Repletion in the Rectosigmoid Mucosa
    SUPPLEMENTAL FIGURE COLON p53 EXONIC STRAND BREAKS DURING FOLATE DEPLETION-REPLETION INTERVENTION Supplemental Figure Legend Strand breaks for p53 exon 6 and 8 among different time course of folate depletion or repletion in the rectosigmoid mucosa. The input of DNA was controlled by GAPDH. The data is shown as ΔCt after normalized to GAPDH. The higher ΔCt the more strand breaks. The P value is shown in the figure. SUPPLEMENT S1 Genes that were significantly UPREGULATED after folate intervention (by unadjusted paired t-test), list is sorted by P value Gene Symbol Nucleotide P VALUE Description OLFM4 NM_006418 0.0000 Homo sapiens differentially expressed in hematopoietic lineages (GW112) mRNA. FMR1NB NM_152578 0.0000 Homo sapiens hypothetical protein FLJ25736 (FLJ25736) mRNA. IFI6 NM_002038 0.0001 Homo sapiens interferon alpha-inducible protein (clone IFI-6-16) (G1P3) transcript variant 1 mRNA. Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 GALNTL5 NM_145292 0.0001 (GALNT15) mRNA. STIM2 NM_020860 0.0001 Homo sapiens stromal interaction molecule 2 (STIM2) mRNA. ZNF645 NM_152577 0.0002 Homo sapiens hypothetical protein FLJ25735 (FLJ25735) mRNA. ATP12A NM_001676 0.0002 Homo sapiens ATPase H+/K+ transporting nongastric alpha polypeptide (ATP12A) mRNA. U1SNRNPBP NM_007020 0.0003 Homo sapiens U1-snRNP binding protein homolog (U1SNRNPBP) transcript variant 1 mRNA. RNF125 NM_017831 0.0004 Homo sapiens ring finger protein 125 (RNF125) mRNA. FMNL1 NM_005892 0.0004 Homo sapiens formin-like (FMNL) mRNA. ISG15 NM_005101 0.0005 Homo sapiens interferon alpha-inducible protein (clone IFI-15K) (G1P2) mRNA. SLC6A14 NM_007231 0.0005 Homo sapiens solute carrier family 6 (neurotransmitter transporter) member 14 (SLC6A14) mRNA.
    [Show full text]