Progressive External Ophthalmoplegia and Vision and Hearing Loss in a Patient with Mutations in POLG2 and OPA1

OBSERVATION Progressive External Ophthalmoplegia and Vision and Hearing Loss in a Patient With Mutations in POLG2 and OPA1

Silvio Ferraris, MD; Susanna Clark, PhD; Emanuela Garelli, PhD; Guido Davidzon, MD; Steven A. Moore, MD, PhD; Randy H. Kardon, MD, PhD; Rachelle J. Bienstock, PhD; Matthew J. Longley, PhD; Michelangelo Mancuso, MD; Purificación Gutiérrez Ríos, MS; Michio Hirano, MD; William C. Copeland, PhD; Salvatore DiMauro, MD

Objective: To describe the clinical features, muscle mitochondrial DNA showed multiple deletions. The re- pathological characteristics, and molecular studies of a sults of screening for mutations in the nuclear genes asso- patient with a mutation in the gene encoding the acces- ciated with PEO and multiple mitochondrial DNA dele- sory subunit (p55) of polymerase ␥ (POLG2) and a mu- tions, including those in POLG (polymerase ␥ gene), ANT1 tation in the OPA1 gene. (gene encoding adenine nucleotide translocator 1), and PEO1, were negative, but sequencing of POLG2 revealed a Design: Clinical examination and morphological, bio- G1247C mutation in exon 7, resulting in the substitution chemical, and molecular analyses. of a highly conserved glycine with an alanine at codon 416 (G416A). Because biochemical analysis of the mutant pro- Setting: Tertiary care university hospitals and molecu- tein showed no alteration in chromatographic properties lar genetics and scientific computing laboratory. and normal ability to protect the catalytic subunit from N-ethylmaleimide, we also sequenced the OPA1 gene and Patient: A 42-year-old man experienced hearing loss, identified a novel heterozygous mutation (Y582C). progressive external ophthalmoplegia (PEO), loss of central vision, macrocytic anemia, and hypogonadism. His family history was negative for neurological disease, and Conclusion: Although we initially focused on the mu- his serum lactate level was normal. tation in POLG2, the mutation in OPA1 is more likely to explain the late-onset PEO and multisystem disorder in Results: A muscle biopsy specimen showed scattered in- this patient. tensely succinate dehydrogenase–positive and cytochrome-c oxidase–negative fibers. Southern blot of muscle Arch Neurol. 2008;65(1):125-131

Author Affiliations: Department of Pediatrics, ROGRESSIVE EXTERNAL OPH- Patients with maternal inheritance have University of Turin, Turin, Italy thalmoplegia (PEO), with point mutations in mtDNA, most com- (Drs Ferraris and Garelli); ptosis and weakness of ex- monly the A3243G transition, typically Laboratory of Molecular traocular muscles, is a com- seen in mitochondrial encephalo- Genetics and Scientific mon manifestation of mito- myopathy, lactic acidosis, and strokelike Computing Laboratory, chondrial diseases and is often associated episodes.1 National Institute of P 1 with multisystem involvement. Progres- The mendelian forms of PEO can be au- Environmental Health Sciences, sive external ophthalmoplegia is best clas- tosomal dominant or recessive, occur in National Institutes of Health, sified based on genetic transmission into about 15% of all cases, and are associated Research Triangle Park, North sporadic, maternally inherited, or men- with multiple mtDNA deletions that are due Carolina (Drs Clark, Bienstock, 3,4 Longley, and Copeland); delian traits. Sporadic cases include to nuclear gene mutations. Autosomal Department of Neurology, Kearns-Sayre syndrome and adult-onset dominant PEO has been associated with Columbia University Medical PEO with myopathy. In Kearns-Sayre syn- mutations in genes encoding adenine Center, New York, New York drome, PEO is the clinical hallmark, to- nucleotide translocator 1 (ANT1)5 and (Drs Davidzon, Hirano, and gether with pigmentary retinopathy and Twinkle, a putative mtDNA helicase DiMauro, and Ms Gutiérrez onset before the age of 20 years.2 Addi- (PEO1).6 Both protein products are in- Ríos); Departments of tional symptoms include ataxia and de- volved in mtDNA maintenance. Muta- Pathology (Dr Moore) and fects of cardiac conduction. Adult-onset tions in the polymerase ␥ (pol␥) gene Ophthalmology and Visual PEO is characterized by the exclusive or (POLG), encoding the ␣ subunit of mtDNA Sciences (Dr Kardon), ␥ University of Iowa, Iowa City; prevalent involvement of skeletal muscle, pol , were identified in patients with either and Department of although other clinical features may in- autosomal dominant PEO or autosomal re- 7,8 Neurosciences, Neurological clude deafness and cataracts. These pa- cessive PEO, but approximately one- Institute, University of Pisa, tients harbor single heteroplasmic dele- fourth of patients with PEO and multiple Pisa, Italy (Dr Mancuso). tions of mitochondrial DNA (mtDNA). deletions do not have a positive family his-

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 1), JAN 2008 WWW.ARCHNEUROL.COM 125

1 1

2 2

C D

1 1

Figure 1. Histochemical stains for hematoxylin-eosin (A), succinate dehydrogenase (SDH) (B), and cytochrome-c oxidase (COX) (C and D) of serial cross sections of muscle from the patient. In A and C, 2 fibers (labeled 1 and 2) show increased eosinophilia and COX negativity; and in B and D, 2 fibers (labeled 1 and 2) show increased SDH stain and lack of COX activity.

tory of PEO. Of these sporadic cases, only 36% carry mu- METHODS tations in 1 of the 3 genes associated with familial autosomal recessive PEO or autosomal dominant PEO, and the PATIENT REPORT remaining cases have no recognized molecular defect.9 Herein, we describe a sporadic adult patient with an This 42-year-old man underwent successful cochlear implan- unusual clinical history characterized by PEO, hearing tation at the age of 31 years after a 3-year history of progres- loss, macrocytic anemia, hypogonadism, central vision sive hearing loss. At that time, he also had macrocytic anemia loss, and mild ataxia. Skeletal muscle histochemistry re- and hypogonadism, requiring hormonal therapy. A bone mar- vealed variation in fiber size because of the presence of row biopsy specimen showed mild hypocellularity (20%- atrophic fibers. There were no ragged-red fibers, but 50%), with megaloblastic erythropoiesis and increased iron store. Blood levels of vitamin B12 and folate were normal. At the age several fibers had no cytochrome-c oxidase activity. Be- of 37 years, he complained of sudden nonprogressive and pain- cause we detected multiple mtDNA deletions in muscle, less loss of central vision. There was no family history of vi- we looked for a mutation in ANT1, PEO1, and POLG1 sion loss. (the gene encoding the catalytic subunit of pol␥) but An ophthalmologic examination at the age of 37 years showed found none. Genetic testing for Leber hereditary optic that his visual acuity with correction was 20/100 OD and neuropathy excluded the typical mtDNA mutations. 20/160 OS. On confrontation, a visual fields test confirmed the The recent report10 of a similar patient harboring a presence of central scotomata in both eyes, with a small area single mutation in the gene encoding the accessory sub- of preserved vision in the center of the scotoma. His pupils were unit (p55) of pol␥ (POLG2) prompted us to sequence normal, with no afferent pupillary defects. His intraocular pres- this gene: we identified a different heterozygous muta- sure was normal bilaterally. Ocular motility was impaired, with a mild restriction in all directions of gaze. There was no nys- tion, which, however, did not significantly impair en- tagmus. Funduscopy showed no pallor or edema of the optic zyme function. We, therefore, sequenced OPA1, which nerve and no obvious pigmentary abnormality. Optical coher- encodes a dynamin-related GTPase, and identified a ent tomography indicated loss of nerve fiber layer in both op- novel heterozygous missense mutation that better ex- tic nerves, especially in the maculopapillary bundle, which sub- plains this patient’s features. serves central vision. An electroretinogram showed that electrical

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 1), JAN 2008 WWW.ARCHNEUROL.COM 126

©2008 American Medical Association. All rights reserved. Downloaded From: http://archneur.jamanetwork.com/ on 03/22/2013 Table 1. Primers and PCR Amplification Conditions to Sequence the Coding Region of Human POLG2 a

Exon Primer Forward Primer Reverse Temperature, °C Size, bp 1 TGAGTGATGGGAGAGTGTGC TCCGACTACTTCAAAAAGATGAGAA 62 488 2-3 CCACCAAGCTTAGCCAACAT GCCCAACAAATGTTTTTACCA 63 680 4 TCGCACATTTGCTGAATAAAA GACACCACGTTTGCACCTTA 60 381 5 GGCCAGGTGACAGAGTGAGA TTCCTGTGGCCAGATTCTAAA 63 391 6 GGGGGCAGCTGAATATGTTA CGAGATCCAAAATGGTCCTG 62 357 7 AGGGTGATTTGTGGCTTCAC TCCCTGCTGAGGCAATTAAC 62 360 8 TGAGTATTCTCTTCACAGTTTTGGTT AAGGCAAAGGGGCTAGAAAT 62 332

Abbreviations: bp, base pair; PCR, polymerase chain reaction; POLG2, gene encoding the accessory subunit (p55) of polymerase ␥. a The PCR amplification conditions were as follows: first cycle, 96°C for 3 minutes; second cycle, 35 cycles of 94°C for 35 seconds, melting temperature for 35 seconds, and 72°C for 35 seconds; and last cycle, 72°C for 10 minutes.

responses were just below normal for the dark-adapted bright flash stimulus and normal for other stimuli. The results of mul- Table 2. Respiratory Chain Activities Referred to the Activity tifocal electroretinography were normal. On neurologic exami- of the Matrix Enzyme CS in Muscle Extracts of the Patient nation, he showed mild ataxia and tremor. An electrocardio- and of 69 Control Subjects gram and rhythm strip were normal, with no conduction block. A complete blood cell count confirmed significant macrocytic nmol/min per CS Units anemia. A subsequent bone marrow smear analysis revealed that erythroid precursors were decreased (13%) and showed mega- Muscle Extracts Controls, of the Patient loblastic changes. Granulopoiesis showed a full range of matu- Enzyme (Complex) Mean (SD) (% of Controls) ration. Lactic and pyruvic acid levels in serum were normal. Magnetic resonance imaging was not performed because of coch- NADH–cytochrome-c reductase 103 (38) 73 (71) lear implants, but the result of imaging performed at the age of (I plus III) 30 years was normal. A muscle biopsy specimen from the left Succinate–cytochrome-c reductase 71 (20) 70 (99) (II plus III) quadriceps showed mild variation in fiber size because of the Cytochrome-c oxidase (IV) 283 (50) 238 (84) presence of atrophic fibers. There were no target fibers and no Succinate dehydrogenase (II) 101 (31) 107 (106) signs of inflammation, necrosis, regeneration, or endomysial fibrosis. Although no ragged-red fibers were identified, sev- Abbreviations: CS, citrate synthase; NADH, nicotinamide adenine eral fibers were devoid of cytochrome-c oxidase activity dinucleotide. (Figure 1). The amount of neutral lipid seemed normal. Genetic testing for Leber hereditary optic neuropathy excluded mutations at nucleotide positions 3460, 11778, and using pET-p55CHIS as the template and the mutagenic 14484 in mtDNA. These 3 mutations account for 90% of Leber primer 5Ј-ATTTCTGTGTGGCCTGCTTATTTGGAAACT-3Ј hereditary optic neuropathy cases. and its complement (Oligos Etc, Wilsonville, Oregon) using a kit (QuikChange Site-Directed Mutagenesis kit; Stratagene, BIOCHEMICAL AND MOLECULAR ANALYSES Loyola, California). DNA sequencing of the new plasmid pET-G416A p55CHIS confirmed the G416A substitution. The Respiratory chain enzymes in muscle biopsy specimens were G416A was grown, expressed, purified, and stored, as de- assayed by described methods.11 Total DNA from the patient’s scribed previously.10,14 muscle was extracted using standard protocols.12 Southern blot analysis was performed by standard techniques. The ANT1, DNA POLYMERASE ASSAYS Twinkle, and POLG1 genes were screened by direct sequencing, as described.13 The processivity of pol␥ was determined by monitoring exten- To amplify the coding region of human POLG2,wede- sion of a 5Ј-end–labeled 35-mer hybridized to M13mp18 DNA, signed primers from intronic sequences flanking the exons, as as previously described.10 Reaction products at low and high described in Table 1. Polymerase chain reaction amplifica- sodium chloride conditions were resolved by denaturing poly- tion was performed in a volume of 20 µL, containing 50 ng of acrylamide gel electrophoresis and were visualized with an im- genomic DNA, 12.5 pmol of each of the primers, 200 µmol of ager (Typhoon 9400 Phosphorimager; Molecular Dynamics, each deoxyribonucleotide triphosphate, and 0.5 U of Taq poly- Sunnyvale, California) and National Institutes of Health soft- merase. Cycling conditions are given in Table 1. DNA se- ware (Image 1.63). quences were analyzed (ABI PRISM 310 genetic analyzer; Ap- The protection by the inhibitor N-ethylmaleimide (NEM) plied Biosystems Division, Perkin Elmer, Foster City, California) was measured on the reconstituted 2-subunit form of pol␥ at and checked (Sequence Navigator program; Applied Biosys- 75-mmol/L sodium chloride, as described.14,15 tems Division, Perkin Elmer). We also amplified and sequenced all 30 exons and flanking regions of OPA1. RESULTS PROTEIN PREPARATION BIOCHEMICAL AND MOLECULAR ANALYSIS The catalytic and accessory subunits of human pol␥ were overexpressed and purified, as described.14 The G416A de- Southern blot of muscle mtDNA revealed multiple bands rivative of p55 was constructed by site-directed mutagenesis, inadditiontothe16.5-kilobasebandofnormalmtDNA(data

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 1), JAN 2008 WWW.ARCHNEUROL.COM 127

100

60 B Reactions with p140 alone T G G C C T G C T T A T T T G % Activity Reactions with p140 plus wild-type p55 G Reactions with p140 plus G416A-p55 40

0 0.2 0.4 0.6 0.8 1.0 Figure 2. Electropherogram of the POLG2 (gene encoding the accessory NEM, mmol/L subunit [p55] of polymerase ␥) sequence showing the heterozygous G1247C transversion in exon 7 (arrow). A, normal sequence; B, patient’s sequence. Figure 4. G416A-p55 protects p140 against inactivation by N-ethylmaleimide (NEM). DNA polymerase activity was measured as described in the “DNA Polymerase Assays” subsection of the “Methods” section, except that 2-mercaptoethanol was excluded. Reactions contained 75-mmol/L sodium chloride, 8.0 ng (58 fmol) of p140 either alone or in the presence of 6.3 ng (116 fmol) of wild-type p55 or G416A-p55 and the indicated amounts of NEM.

tion profile for the mutant G416A protein. The G416A mu- G416A tant protein eluted from the MonoS column as a single peak at the identical position as the WT-p55 protein. The mutant G416A-p55 had identical chromatographic properties as the WT-p55, indicative of correct folding. The peak fraction was chosen for further analysis.

MUTANT G416A PROTECTS THE CATALYTIC SUBUNIT FROM NEM SIMILAR TO WT-p55 Figure 3. Coomassie-stained gel of the purified recombinant G416A-p55 protein. With the purified protein, we assayed the ability of the G416A-p55 to protect the p140 catalytic subunit not shown). The activities of respiratory chain enzymes were of pol␥ from inactivation by NEM (Figure 4), because essentially normal (Table 2). The patient did not harbor it was previously documented that the isolated catalytic mutations in the ANT1, Twinkle,orPOLG1 genes. p140 subunit is sensitive to inactivation by NEM.14 AnalysisofthePOLG2geneshowedaheterozygousG→C N-ethylmaleimide covalently binds to solvent-assess- transversion at nucleotide 1247 in exon 7, which changes able sulfhydryl groups (cysteine side chains) and steri- a highly conserved glycine at codon 416 to alanine cally interferes with activity. However, the WT-p55 ac- (Figure 2). The G1247C mutation eliminates an ScrFI re- cessory subunit protects the catalytic subunit from striction site detectable by polymerase chain reaction re- NEM, indicating a physical shielding of any critical cys- strictionlengthfragmentpolymorphism.Thispolymorphism teine residues by the bound p55. Thus, this assay mea- wasnotdetectedinmorethan100controlsubjects.Sequenc- sures the extent of p55 binding to the p140 subunit. ingofOPA1revealedanovel1741A→Gtransitionthatcauses Figure 4 shows that the profile of the NEM curve with a Tyr582Cys amino acid substitution. G416A-p55 was similar to that with WT-p55, indicating that mutant and wild-type proteins bind to the cata- BIOCHEMICAL ANALYSIS OF THE G416A lytic subunit in a similar manner. In fact, the WT-p55 MUTANT p55 PROTEIN stimulated the activity of the catalytic subunit by 2-fold, whereas the G416A-p55 stimulated the p140 activity by We tested whether the phenotypic changes caused by the 2.5-fold. The comparable ability of mutant and WT-p55 G416A substitution would also result in measurable bio- proteins to protect the catalytic subunit indicates that chemical defects. The wild-type p55 (WT-p55) and the there is a normal physical interaction between the mu- G416A p55, both lacking the mitochondrial targeting se- tant accessory subunit and the catalytic subunit of pol␥. quence, were overproduced in Escherichia coli and purified to apparent homogeneity, as described in the “Pro- PROCESSIVITY tein Preparation” subsection of the “Methods” section, and their in vitro biochemical properties were compared. The role of the p55 accessory subunit is to increase pro- Figure 3 shows a Coomassie-stained gel of the purifica- cessivity (ie, the number of nucleotides synthesized on

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 1), JAN 2008 WWW.ARCHNEUROL.COM 128

©2008 American Medical Association. All rights reserved. Downloaded From: http://archneur.jamanetwork.com/ on 03/22/2013 a DNA template per binding event). Wild-type p55 in- WT p55 – – – + + – – – – + + – – creases the processivity of the isolated catalytic subunit G416A-p55 – – – – – + + – – – – + + from approximately 100 nucleotides to several thou- p140 – + + + + + + + + + + + + sand nucleotides, suggesting that the holoenzyme can syn- thesize almost the whole mitochondrial genome in a single binding event. The high processivity conferred by the p55 subunit to the catalytic subunit is caused by increased binding affinity of the complex to DNA and by en- hanced salt tolerance. To assess the effect of the mutant G416A protein, we extended a phosphorus-32 end- labeled oligonucleotide annealed to M13 single- stranded DNA in the presence and absence of a DNA trap. The sequencing gel in Figure 5 depicts the processivity of the p140 catalytic subunit in the presence or absence of the p55 subunit (mutant or wild type). Lanes 1 through 6 show the products of reactions performed in the presence of a DNA trap and reflect true processivity, whereas lanes 7 through 12 show reaction products obtained without a DNA trap and represent multiple binding events. Odd-numbered lane reactions were performed at a low salt concentration, while even- numbered lane reactions were performed at a high salt concentration (150-mmol/L sodium chloride). Compar- ing lanes 3 and 4 with lanes 1 and 2 demonstrates the degree of stimulation and the length of products in the 100 presence of the WT-p55 subunit. Comparing lanes 4 and 5 shows that the stimulation by G416A-p55 was similar to, if not better than, that by WT-p55, indicating that the mutation did not impair the stimulation of processivity.

COMMENT

Multiple deleted molecules of mtDNA accumulate in post- mitotic tissues in a group of mitochondrial disorders because of mutations in nuclear genes controlling mtDNA synthesis and maintenance. The clinical hallmark of these disorders is PEO, usually associated with a variety of other symptoms. POLG1 is the nuclear master gene of mtDNA replication and repair. It encodes pol␥, the only DNA polymerase found in animal cell mitochondria and, thus, bears sole responsibility for DNA synthesis in all replication and repair transactions involving mtDNA. Pol␥ is synthesized as a longer precursor containing an amino- terminal leader sequence that targets the protein to mitochondria and is then cleaved off. Mature pol␥ is a 140-kDa polypeptide composed of 2 functionally differ- 0 1 2 3 4 5 6 7 8 9 10 11 12 ent domains, a polymerase domain encompassing the Figure 5. G416A-p55 stimulates processive DNA synthesis of polymerase ␥ C-terminus and an exonuclease domain with proofread- (pol␥). Primer extension reactions were performed as described in the “DNA ing activity, located on the N-terminus.4 In addition, pol␥ Polymerase Assays” subsection of the “Methods” section. Reactions hasa5Ј-deoxyribosephosphate lyase activity that can re- contained p140 catalytic subunit (lanes 1-6), wild-type (WT) p55 (lanes Ј 3 and 4), G416A-p55 (lanes 5-6), and singly primed M13 DNA. Activity was move a 5 -deoxyribosephosphate group during base ex- measured at 0-mmol/L sodium chloride (odd lanes) or 150-mmol/L sodium 16 cision repair. In human mitochondria, pol␥ is part of chloride (even lanes). Lane 0 had no enzyme. Reaction products were an enzyme complex containing an accessory subunit of resolved by denaturing polyacrylamide gel electrophoresis. The arrow marks the unextended 35-mer primer. The marker 100 indicates the number of 55 kDa, p55. This subunit forms a dimer in solution, nucleotides synthesized past the primer. ϩ indicates present; −, absent. which binds tightly to the pol␥ monomer to form a het- 17 erotrimer with the structure AB2. The accessory subunit p55 stabilizes binding to primer template DNA and pair function of pol␥ by stimulating 2 subreactions in the stimulates the catalytic activity of pol␥ under physiologi- repair process.19 cal conditions.18 It seems that p55 does not increase the The tertiary structure of pol␥ B can be divided into polymerization rate but enhances the base excision re- 3 domains (Figure 6). Domain 1 contains a 7-stranded

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 1), JAN 2008 WWW.ARCHNEUROL.COM 129

W414 P415 G416 G416 Y417 L418 G419 T420

Figure 6. Position of the G416A side chain on the ribbon structure of the human accessory subunit in one monomer within the p55 dimer. The ribbon drawing was generated with Swiss PDB viewer from Protein Data Bank file 2G4C.20 The inset is an expanded view of the structure around G416 in domain 3.

␤ sheet, which is antiparallel, except for strand 1, which tation in this patient changes a glycine to an alanine at is located at one edge of the sheet. One face of the sheet position 416. The highly conserved glycine residue is at is covered with helices C and G. The other face of the the end of a short helix before a loop structure in do- twisted sheet has a pocket formed by helices F and H. main 3 of the p55 monomer. This domain is not in- Domain 2 is inserted between strand 1 and helix F of do- volved in dimerization of the second accessory subunit, main 1 and contains secondary structure elements that but may play an important role in the structure of this interact with their symmetry counterparts in the dimer. domain, thereby affecting the interaction with the cata- Domain 3 contains a 5-stranded mixed ␤ sheet that is lytic subunit. Biochemical analysis of the recombinant sandwiched between helices J and M on one side and a G416A-p55 protein showed that it protects the pol␥ cata- ␤ hairpin and helix K on the other side.20,21 lytic subunit from NEM and can stimulate processive DNA Recently, a mutation was identified in a 60-year-old synthesis, implying that protein-protein interaction with woman with apparent autosomal dominant PEO start- the catalytic subunit is not impaired. Recently, the Na- ing in her 40s, multiple mtDNA deletions in muscle, and tional Center for Biotechnology Information reported this cytochrome-c oxidase–deficient muscle fibers.10 This mu- same G1247C transversion in exon 8 of the POLG2 gene tation changed a conserved Gly451 to glutamic acid near in 1 of 8 sequences, but no frequency was reported for the C-terminus of domain 3 on the surface of the pro- this mutation, which cannot be a frequent polymor- tein between helix L and ␤-sheet 19. Biochemical analy- phism because it was not found in more than 100 con- sis of the recombinant protein demonstrated a dramatic trols. Because the pathogenicity of the POLG2 mutation loss of processivity, decreased NEM protection, and loss appears dubious, while this article was in press we also of interaction with the catalytic subunit. Thus, this do- sequenced the gene encoding OPA1, a dynamin-related main provides the subunit interaction with the pol␥ cata- GTPase involved in mitochondrial fusion. This choice was lytic subunit, enhancing DNA binding and processivity prompted by the recently described association of mu- of the pol␥ complex. tations in OPA1 with optic atrophy, PEO, hearing loss, Our patient was younger but also had PEO, multiple multiple mtDNA deletions and COX-negative fibers in mtDNA deletions in muscle, and cytochrome-c oxidase– muscle, all features present in our patient.22,23 We iden- negative fibers. He seemed to be a sporadic case. The mu- tified a heterozygous missense mutation (Y582C) that

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 1), JAN 2008 WWW.ARCHNEUROL.COM 130

©2008 American Medical Association. All rights reserved. Downloaded From: http://archneur.jamanetwork.com/ on 03/22/2013 changes a highly conserved tyrosine to a cysteine. Al- 3. Zeviani M, Servidei S, Gellera C, Bertini E, DiMauro S, DiDonato S. An autoso- though not yet fully characterized, this mutation is more mal dominant disorder with multiple deletions of mitochondrial DNA starting at the D-loop region. Nature. 1989;339(6222):309-311. likely than the POLG2 mutation to explain the clinical 4. Spinazzola A, Zeviani M. Disorders of nuclear-mitochondrial intergenomic signaling. and laboratory features of this patient. Gene. 2005;354:162-168. 5. Kaukonen J, Juselius JK, Tiranti V, et al. Role of adenine nucleotide translocator Accepted for Publication: April 26, 2007. 1 in mtDNA maintenance. Science. 2000;289(5480):782-785. Correspondence: Salvatore DiMauro, MD, Department 6. Spelbrink JN, Li FY, Tiranti V, et al. Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like pro- of Neurology, Columbia University, Russ Berrie Medi- tein localized in mitochondria. Nat Genet. 2001;28(3):223-231. cal Science Pavilion, 1150 St Nicholas Ave, Room 313, 7. Van Goethem G, Dermaut B, Lo¨fgren A, Martin JJ, Van Broeckhoven C. Muta- New York, NY 10032 ([email protected]). tion of POLG is associated with progressive external ophthalmoplegia charac- Author Contributions: Study concept and design: Ferraris, terized by mtDNA deletions. Nat Genet. 2001;28(3):211-212. 8. Lamantea E, Tiranti V, Bordoni A, et al. Mutations of mitochondrial DNA poly- Longley, Mancuso, Hirano, and Copeland. Acquisition of merase ␥A are a frequent cause of autosomal dominant or recessive progres- data: Ferraris, Clark, Garelli, Davidzon, Moore, Kardon, sive external ophthalmoplegia. Ann Neurol. 2002;52(2):211-219. Longley, Gutiérrez Ríos, and Copeland. Analysis and in- 9. Hudson G, Deschauer M, Taylor RW, et al. POLG1, C10ORF2, and ANT1 muta- terpretation of data: Ferraris, Clark, Garelli, Davidzon, tions are uncommon in sporadic progressive external ophthalmoplegia with mul- Moore, Bienstock, Longley, Hirano, Copeland, and DiM- tiple mitochondrial DNA deletions. Neurology. 2006;66(9):1439-1441. 10. Longley MJ, Clark S, Man CYW, et al. Mutant POLG2 disrupts DNA polymerase auro. Drafting of the manuscript: Ferraris, Clark, Garelli, ␥ subunits and causes progressive external ophthalmoplegia. Am J Hum Genet. Longley, Mancuso, and Copeland. Critical revision of the 2006;78(6):1026-1034. manuscript for important intellectual content: Clark, Dav- 11. DiMauro S, Servidei S, Zeviani M, et al. Cytochrome c oxidase deficiency in Leigh idzon, Moore, Kardon, Bienstock, Gutiérrez Ríos, Hi- syndrome. Ann Neurol. 1987;22(4):498-506. rano, Copeland, and DiMauro. Obtained funding: Ferraris 12. Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2001:6.4-6.11. and Copeland. Administrative, technical, and material sup- 13. Filosto M, Mancuso M, Nishigaki Y, et al. Clinical and genetic heterogeneity in port: Clark, Garelli, Davidzon, Bienstock, Longley, progressive external ophthalmoplegia due to mutations in polymerase ␥. Arch Mancuso, Gutiérrez Ríos, Hirano, and Copeland. Study Neurol. 2003;60(9):1279-1284. supervision: Kardon, Longley, Copeland, and DiMauro. 14. Lim SE, Longley MJ, Copeland WC. The mitochondrial p55 accessory subunit of human DNA polymerase ␥ enhances DNA binding, promotes processive DNA Financial Disclosure: None reported. synthesis, and confers N-ethylmaleimide resistance. J Biol Chem. 1999;274 Funding/Support: This study was supported by grant (53):38197-38203. 756 from Regione Piemonte, Ricerca finalizzata 2004 15. Longley MJ, Copeland WC. Purification, separation, and identification of the hu- (Dr Ferraris); Wellstone Muscular Dystrophy Corpo- man mtDNA polymerase with and without its accessory subunit. Methods Mol rate Research Center grant (Dr Moore), grant NS11766 Biol. 2002;197:245-257. 16. Longley MJ, Prasad R, Srivastava DK, Wilson SH, Copeland WC. Identification of from the National Institute for Neurological Disorders a5Ј-deoxyribose phosphate lyase activity in human DNA polymerase gamma and and Stroke (Drs Hirano and DiMauro), the Intramural its role in mitochondrial base excision repair in vitro. Proc Natl Acad SciUSA. Research Program of the National Institute of Environ- 1988;95(21):12244-12248. mental Health Sciences (Dr Copeland), and grant 17. Yakubovskaya E, Chen Z, Carrodeguas JA, Kisker C, Bogenhagen DF. Functional human mitochondrial polymerase ␥ forms a heterotrimer. J Biol Chem. 2006; HD32062 from the National Institute of Child Health 281(1):374-382. and Development (Dr DiMauro), National Institutes of 18. Carrodeguas JA, Pinz KG, Bogenhagen DB. DNA binding properties of human Health; an unrestricted grant from Research to Prevent pol ␥B. J Biol Chem. 2002;277(51):50008-50014. Blindness (Dr Kardon); the Muscular Dystrophy Asso- 19. Pinz KG, Bogenhagen DF. The influence of the DNA polymerase ␥ accessory sub- ciation (Drs Hirano and DiMauro); and the Marriott unit on base excision repair by the catalytic subunit. DNA Repair (Amst). 2006; 5(1):121-128. Mitochondrial Disorder Clinical Research Fund (Drs 20. Fan L, Kim S, Farr CL, et al. A novel processive mechanism for DNA synthesis Hirano and DiMauro). revealed by structure, modeling and mutagenesis of the accessory subunit of human mitochondrial DNA polymerase. J Mol Biol. 2006;358(5):1229-1243. 21. Carrodeguas JA, Theis K, Bogenhagen DF, Kisker C. Crystal structure and deletion REFERENCES analysis show that the accessory subunit of mammalian DNA polymerase ␥, Pol␥B, functions as a homodimer. Mol Cell. 2001;7(1):43-54. 1. DiMauro S, Bonilla E. Mitochondrial encephalomyopathies. In: Engel AG, Franzini- 22. Amati-Bonneau P, Valentino ML, Reynier P, et al. OPA1 mutations induce mito- Armstrong C, eds. Myology. Vol 2. New York, NY: McGraw-Hill Co; 2004:1623- chondrial DNA instability and optic atrophy “plus” phenotypes. Brain. In press. 1662. 23. Hudson G, Amati-Bonneau P, Blakely EL, et al. Mutations of OPA1 causes domi- 2. Rowland LP. Mitochondrial encephalomyopathies: lumping, splitting, and melding. nant optic atrophy with external ophthalmoplegia, ataxia, deafness and mul- In: Schapira AHV, DiMauro S, eds. Mitochondrial Disorders in Neurology. Ox- tiple mitochondrial DNA deletions: a novel disorder of mtDNA maintenance. ford, England: Butterworth-Heinemann; 1994:116-129. Brain. In press.

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 1), JAN 2008 WWW.ARCHNEUROL.COM 131