OBSERVATION Progressive External Ophthalmoplegia and Vision and Hearing Loss in a Patient With Mutations in POLG2 and OPA1 Silvio Ferraris, MD; Susanna Clark, PhD; Emanuela Garelli, PhD; Guido Davidzon, MD; Steven A. Moore, MD, PhD; Randy H. Kardon, MD, PhD; Rachelle J. Bienstock, PhD; Matthew J. Longley, PhD; Michelangelo Mancuso, MD; Purificación Gutiérrez Ríos, MS; Michio Hirano, MD; William C. Copeland, PhD; Salvatore DiMauro, MD Objective: To describe the clinical features, muscle mitochondrial DNA showed multiple deletions. The re- pathological characteristics, and molecular studies of a sults of screening for mutations in the nuclear genes asso- patient with a mutation in the gene encoding the acces- ciated with PEO and multiple mitochondrial DNA dele- sory subunit (p55) of polymerase ␥ (POLG2) and a mu- tions, including those in POLG (polymerase ␥ gene), ANT1 tation in the OPA1 gene. (gene encoding adenine nucleotide translocator 1), and PEO1, were negative, but sequencing of POLG2 revealed a Design: Clinical examination and morphological, bio- G1247C mutation in exon 7, resulting in the substitution chemical, and molecular analyses. of a highly conserved glycine with an alanine at codon 416 (G416A). Because biochemical analysis of the mutant pro- Setting: Tertiary care university hospitals and molecu- tein showed no alteration in chromatographic properties lar genetics and scientific computing laboratory. and normal ability to protect the catalytic subunit from N-ethylmaleimide, we also sequenced the OPA1 gene and Patient: A 42-year-old man experienced hearing loss, identified a novel heterozygous mutation (Y582C). progressive external ophthalmoplegia (PEO), loss of cen- tral vision, macrocytic anemia, and hypogonadism. His family history was negative for neurological disease, and Conclusion: Although we initially focused on the mu- his serum lactate level was normal. tation in POLG2, the mutation in OPA1 is more likely to explain the late-onset PEO and multisystem disorder in Results: A muscle biopsy specimen showed scattered in- this patient. tensely succinate dehydrogenase–positive and cyto- chrome-c oxidase–negative fibers. Southern blot of muscle Arch Neurol. 2008;65(1):125-131 Author Affiliations: Department of Pediatrics, ROGRESSIVE EXTERNAL OPH- Patients with maternal inheritance have University of Turin, Turin, Italy thalmoplegia (PEO), with point mutations in mtDNA, most com- (Drs Ferraris and Garelli); ptosis and weakness of ex- monly the A3243G transition, typically Laboratory of Molecular traocular muscles, is a com- seen in mitochondrial encephalo- Genetics and Scientific mon manifestation of mito- myopathy, lactic acidosis, and strokelike Computing Laboratory, chondrial diseases and is often associated episodes.1 National Institute of P 1 with multisystem involvement. Progres- The mendelian forms of PEO can be au- Environmental Health Sciences, sive external ophthalmoplegia is best clas- tosomal dominant or recessive, occur in National Institutes of Health, sified based on genetic transmission into about 15% of all cases, and are associated Research Triangle Park, North sporadic, maternally inherited, or men- with multiple mtDNA deletions that are due Carolina (Drs Clark, Bienstock, 3,4 Longley, and Copeland); delian traits. Sporadic cases include to nuclear gene mutations. Autosomal Department of Neurology, Kearns-Sayre syndrome and adult-onset dominant PEO has been associated with Columbia University Medical PEO with myopathy. In Kearns-Sayre syn- mutations in genes encoding adenine Center, New York, New York drome, PEO is the clinical hallmark, to- nucleotide translocator 1 (ANT1)5 and (Drs Davidzon, Hirano, and gether with pigmentary retinopathy and Twinkle, a putative mtDNA helicase DiMauro, and Ms Gutiérrez onset before the age of 20 years.2 Addi- (PEO1).6 Both protein products are in- Ríos); Departments of tional symptoms include ataxia and de- volved in mtDNA maintenance. Muta- Pathology (Dr Moore) and fects of cardiac conduction. Adult-onset tions in the polymerase ␥ (pol␥) gene Ophthalmology and Visual PEO is characterized by the exclusive or (POLG), encoding the ␣ subunit of mtDNA Sciences (Dr Kardon), ␥ University of Iowa, Iowa City; prevalent involvement of skeletal muscle, pol , were identified in patients with either and Department of although other clinical features may in- autosomal dominant PEO or autosomal re- 7,8 Neurosciences, Neurological clude deafness and cataracts. These pa- cessive PEO, but approximately one- Institute, University of Pisa, tients harbor single heteroplasmic dele- fourth of patients with PEO and multiple Pisa, Italy (Dr Mancuso). tions of mitochondrial DNA (mtDNA). deletions do not have a positive family his- (REPRINTED) ARCH NEUROL / VOL 65 (NO. 1), JAN 2008 WWW.ARCHNEUROL.COM 125 ©2008 American Medical Association. All rights reserved. Downloaded From: http://archneur.jamanetwork.com/ on 03/22/2013 A B 1 1 2 2 C D 1 1 2 2 Figure 1. Histochemical stains for hematoxylin-eosin (A), succinate dehydrogenase (SDH) (B), and cytochrome-c oxidase (COX) (C and D) of serial cross sections of muscle from the patient. In A and C, 2 fibers (labeled 1 and 2) show increased eosinophilia and COX negativity; and in B and D, 2 fibers (labeled 1 and 2) show increased SDH stain and lack of COX activity. tory of PEO. Of these sporadic cases, only 36% carry mu- METHODS tations in 1 of the 3 genes associated with familial auto- somal recessive PEO or autosomal dominant PEO, and the PATIENT REPORT remaining cases have no recognized molecular defect.9 Herein, we describe a sporadic adult patient with an This 42-year-old man underwent successful cochlear implan- unusual clinical history characterized by PEO, hearing tation at the age of 31 years after a 3-year history of progres- loss, macrocytic anemia, hypogonadism, central vision sive hearing loss. At that time, he also had macrocytic anemia loss, and mild ataxia. Skeletal muscle histochemistry re- and hypogonadism, requiring hormonal therapy. A bone mar- vealed variation in fiber size because of the presence of row biopsy specimen showed mild hypocellularity (20%- atrophic fibers. There were no ragged-red fibers, but 50%), with megaloblastic erythropoiesis and increased iron store. Blood levels of vitamin B12 and folate were normal. At the age several fibers had no cytochrome-c oxidase activity. Be- of 37 years, he complained of sudden nonprogressive and pain- cause we detected multiple mtDNA deletions in muscle, less loss of central vision. There was no family history of vi- we looked for a mutation in ANT1, PEO1, and POLG1 sion loss. (the gene encoding the catalytic subunit of pol␥) but An ophthalmologic examination at the age of 37 years showed found none. Genetic testing for Leber hereditary optic that his visual acuity with correction was 20/100 OD and neuropathy excluded the typical mtDNA mutations. 20/160 OS. On confrontation, a visual fields test confirmed the The recent report10 of a similar patient harboring a presence of central scotomata in both eyes, with a small area single mutation in the gene encoding the accessory sub- of preserved vision in the center of the scotoma. His pupils were unit (p55) of pol␥ (POLG2) prompted us to sequence normal, with no afferent pupillary defects. His intraocular pres- this gene: we identified a different heterozygous muta- sure was normal bilaterally. Ocular motility was impaired, with a mild restriction in all directions of gaze. There was no nys- tion, which, however, did not significantly impair en- tagmus. Funduscopy showed no pallor or edema of the optic zyme function. We, therefore, sequenced OPA1, which nerve and no obvious pigmentary abnormality. Optical coher- encodes a dynamin-related GTPase, and identified a ent tomography indicated loss of nerve fiber layer in both op- novel heterozygous missense mutation that better ex- tic nerves, especially in the maculopapillary bundle, which sub- plains this patient’s features. serves central vision. An electroretinogram showed that electrical (REPRINTED) ARCH NEUROL / VOL 65 (NO. 1), JAN 2008 WWW.ARCHNEUROL.COM 126 ©2008 American Medical Association. All rights reserved. Downloaded From: http://archneur.jamanetwork.com/ on 03/22/2013 Table 1. Primers and PCR Amplification Conditions to Sequence the Coding Region of Human POLG2 a Exon Primer Forward Primer Reverse Temperature, °C Size, bp 1 TGAGTGATGGGAGAGTGTGC TCCGACTACTTCAAAAAGATGAGAA 62 488 2-3 CCACCAAGCTTAGCCAACAT GCCCAACAAATGTTTTTACCA 63 680 4 TCGCACATTTGCTGAATAAAA GACACCACGTTTGCACCTTA 60 381 5 GGCCAGGTGACAGAGTGAGA TTCCTGTGGCCAGATTCTAAA 63 391 6 GGGGGCAGCTGAATATGTTA CGAGATCCAAAATGGTCCTG 62 357 7 AGGGTGATTTGTGGCTTCAC TCCCTGCTGAGGCAATTAAC 62 360 8 TGAGTATTCTCTTCACAGTTTTGGTT AAGGCAAAGGGGCTAGAAAT 62 332 Abbreviations: bp, base pair; PCR, polymerase chain reaction; POLG2, gene encoding the accessory subunit (p55) of polymerase ␥. a The PCR amplification conditions were as follows: first cycle, 96°C for 3 minutes; second cycle, 35 cycles of 94°C for 35 seconds, melting temperature for 35 seconds, and 72°C for 35 seconds; and last cycle, 72°C for 10 minutes. responses were just below normal for the dark-adapted bright flash stimulus and normal for other stimuli. The results of mul- Table 2. Respiratory Chain Activities Referred to the Activity tifocal electroretinography were normal. On neurologic exami- of the Matrix Enzyme CS in Muscle Extracts of the Patient nation, he showed mild ataxia and tremor. An electrocardio- and of 69 Control Subjects gram and rhythm strip were normal,