Negative Breast Cancers with the Protein Kinase D Inhibitor CRT0066101 Sahra Borges1, Edith A

Published OnlineFirst April 7, 2015; DOI: 10.1158/1535-7163.MCT-14-0945

Small Molecule Therapeutics Molecular Cancer Therapeutics Effective Targeting of Estrogen Receptor– Negative Breast Cancers with the Protein Kinase D Inhibitor CRT0066101 Sahra Borges1, Edith A. Perez1,2, E. Aubrey Thompson1, Derek C. Radisky1, Xochiquetzal J. Geiger3, and Peter Storz1

Abstract

Invasive ductal carcinomas (IDC) of the breast are associated mechanism of inhibition of PKD3 expression. Loss of ER with altered expression of hormone receptors (HR), ampliﬁ- results in upregulation of PKD3, leading to all hallmarks of cation or overexpression of HER2, or a triple-negative pheno- aggressive IDC, including increased cell proliferation, migra- type. The most aggressive cases of IDC are characterized by a tion, and invasion. This identiﬁes ER breast cancers as ideal high proliferation rate, a great propensity to metastasize, and for treatment with the PKD inhibitor CRT0066101. We show their ability to resist to standard chemotherapy, hormone that similar to a knockdown of PKD3, treatment with this therapy, or HER2-targeted therapy. Using progression tissue inhibitor targets all tumorigenic processes in vitro and microarrays, we here demonstrate that the serine/threonine decreases growth of primary tumors and metastasis in vivo. kinase protein kinase D3 (PKD3) is highly upregulated in Our data strongly support the development of PKD inhibitors estrogen receptor (ER)–negative (ER ) tumors. We identify for clinical use for ER breast cancers, including the triple- direct binding of the ER to the PRKD3 gene promoter as a negative phenotype. Mol Cancer Ther; 14(6); 1306–16. 2015 AACR.

Introduction mesenchymal and stem cell features, for which no specific targeted therapies are available (7–9). Thus, identification of Invasive ductal carcinomas (IDC) of the breast are among the tissue biomarkers that may lead to novel therapeutic strategies most aggressive types of cancer affecting women. IDCs with the is of utmost importance. worst outcome are associated either with loss of expression of The protein kinase D (PKD) family members PKD1, PKD2, and hormone receptors, estrogen receptor (ER) and progesterone PKD3 have been implicated in the progression of breast cancer. receptor (PR), overexpression, or amplification of the human PKD1 contributes to breast cancer cell proliferation (10), but epidermal growth factor receptor-2 (HER2/ErbB2), or a triple- inhibits the invasive phenotype (11, 12). This is mediated by negative phenotype [lack of expression of HER2 and both inhibition of epithelial-to-mesenchymal transition (EMT) hormone receptors (HR]. The most aggressive cases of IDC are through phosphorylation of Snail (13–16), downregulation of characterized by a high proliferation rate, a great propensity to the expression of several matrix metalloproteinases (MMP), and metastasize, and their ability to resist to standard chemother- negative-regulation of F-actin reorganization at the leading edge apy, hormone therapy, or HER2-directed agents such as tras- at multiple levels (12, 13, 17, 18). Consequently, PRKD1 (encod- tuzumab (1, 2). Particularly, triple-negative breast cancers ing PKD1) is silenced by hypermethylation in the most aggressive (TNBC), which represent approximately 20% of all cases, are breast cancers, including the TNBC subtype (11, 19). In contrast to difficult to treat, because molecular targets are lacking (3, 4). PKD1, the two other isoforms PKD2 and PKD3, in breast cancer Cytotoxic radio- and chemotherapy currently are the only cell lines seem to drive all aspects of oncogenic transformation, options for patients with TNBC (5). However, the rate of including cell proliferation, migration, invasion, and chemore- recurrence is high after such treatment (6). The high resistance sistance (20–22). Similar opposing functions in breast cancer to therapy has been partially attributed to tumors that show have been described for other kinases such as members of the Akt/ PKB kinase family (23, 24). However, how subtypes of the same 1Department of Cancer Biology, Mayo Clinic, Jacksonville, Florida. kinase family, which recognize the same substrate phosphoryla- 2Department of Hematology/Oncology, Mayo Clinic, Jacksonville, tion motif, can have opposite cellular functions remains unclear. 3 Florida. Laboratory Medicine and Pathology, Mayo Clinic, Jackson- On the basis of the recent studies for PKD enzymes, it seems that a ville, Florida. number of different parameters, such as their relative level of Note: Supplementary data for this article are available at Molecular Cancer expression or activity, their cellular localization, and/or their Therapeutics Online (http://mct.aacrjournals.org/). ability to form complexes, can differentially influence cellular Corresponding Author: Peter Storz, Mayo Clinic, Griffin Room 306, 4500 San phenotypes (25). Pablo Road, Jacksonville, FL 32224. Phone: 904-953-6909; Fax: 904-953-0277; Using progression tissue microarrays (TMA), here we dem- E-mail: [email protected] onstrate that a switch toward the isoform PKD3 is associated doi: 10.1158/1535-7163.MCT-14-0945 with the aggressiveness of breast cancer. Although PKD1 is 2015 American Association for Cancer Research. downregulated and PKD2 is expressed homogeneously at low

1306 Mol Cancer Ther; 14(6) June 2015

Targeting of ER Breast Cancer with CRT0066101

levels in different breast cancer subtypes as well as in normal was produced in HEK293FT cells using the ViraPower Lentiviral tissue, PKD3 is highly upregulated in ER-negative (ER )tumors. Expression System (Life Technologies). MDA-MB-231 cells We identify estrogen-dependent signaling as the mechanism were infected with PKD3-shRNA lentivirus to generate stable cell of inhibition of PKD3 expression in ER-expressing ductal cancer lines. After infection, cell pools were selected using puromycin cells. Loss of ER results in upregulation of PKD3, leading to (1 mg/mL) for 15 days. increased cell proliferation, migration, and invasion. These data identify ER breast cancers as ideal cancers for treatment with Plasmids and transfections the PKD inhibitor CRT0066101, because they express little or To generate a PKD3 promoter-luciferase reporter, the human no PKD1 and high levels of PKD3. We show that, similar to a PRKD3 promoter region (1000 to þ3) was cloned in pGL3 knockdown of PKD3, treatment with this inhibitor targets plasmid from Promega via BglII and XhoI restriction sites, using most tumorigenic processes in vitro, and also decreases growth 50-TTTTTTGTCCCTTCTGTTTTTGAT-30 and 50-GACGGAAAGAAA- of primary tumors and prevents metastasis in vivo.Thus,because TTAGAAAATTTT-30 as primers. The pRL-CMV-Renilla luciferase it can be given orally, it may be developed for treatment plasmid was from Promega. The ERa (pEGFP-C1-ERa; #28230) of PKD1-negative breast cancers, including the triple-negative expression plasmid was from Addgene. The pSuper-PKD2-shRNA phenotype. plasmid was obtained by cloning the oligonucleotides 50-GAT- CCCCGTTCCCTGAGTGTGGCTTCTTCAAGAGAGAAGCCACAC- Materials and Methods TCAGGGAACTTTTTGGAAA-30 and 50-AGCTTTTCCAAAAAGTT- CCCTGAGTGTGGCTTCTCTCTTGAAGAAGCCACACTCAGGGA- Cell lines, antibodies, and reagents ACGGG-30 into pSuper. GenJet from SignaGen was used for The MDA-MB-231-luc2 cell line was obtained from PerkinEl- transfection of breast cancer cells. mer in May 2009. All other cells lines were obtained from the American Type Culture Collection in August 2008. All cell lines Cell lysates and Western blot analysis were not further authenticated. MCF-7, MDA-MB-231, and Cells were washed twice with ice-cold phosphate-buffered T47D cells were maintained in Dulbecco's Modified Eagle saline (PBS; 140 mmol/L NaCl, 2.7 mmol/L KCl, 8 mmol/L Medium (DMEM) with 10% fetal bovine serum (FBS). MDA- Na HPO , 1.5 mmol/L KH PO , pH 7.2) and lysed with Buffer MB-468 and HCC1954 were maintained in RPMI-1640 with 2 4 2 4 A (50 mmol/L Tris–HCl, pH 7.4, 1% Triton X-100, 150 mmol/L 10% FBS. BT20 cells were maintained in Eagle's minimal essen- NaCl, 5 mmol/L EDTA, pH 7.4) plus Protease Inhibitor Cocktail tial medium with 10% FBS, 2 mmol/L L-glutamine, 1.5 g/L (Sigma-Aldrich). Lysates were used for Western blot analysis as sodium bicarbonate, 0.1 mmol/L nonessential amino acids described previously (12). (NEAA), and 1 mmol/L sodium pyruvate. MCF-10A cells were maintained in DMEM/Ham's F-10 medium (50:50 v/v) with 5% Immunofluorescence horse serum, 20 ng/mL EGF, 0.5 mg/mL hydrocortisone, 100 Cells were seeded in 8-well ibiTreat m-Slides (ibidi) and treated ng/mL cholera toxin, 10 mg/mL insulin, and 1% penicillin/ as indicated. Before fixation with 4% paraformaldehyde (20 min- streptomycin. NEAAs were obtained from Mediatech, EGF from utes, 4C), cells were washed twice with PBS. Fixed cells were PeproTech, and insulin and hydrocortisone from Sigma-Aldrich. washed three times in PBS, permeabilized with 0.1% Triton X-100 Anti-b-actin antibody was obtained from Sigma-Aldrich; anti- in PBS (2 minutes, room temperature), and then blocked with Ki67 from Dako; anti-cleaved PARP, anti-cleaved caspase-3, and blocking solution [3% bovine serum albumin (BSA) and 0.05% anti-MMP9 from Cell Signaling Technology; anti-COX-2 from Tween 20 in PBS] for 30 minutes at room temperature. F-actin was Cayman Chemical; anti-smooth muscle actin (SMA), anti-GFP, stained with Alexa Fluor 633–Phalloidin (Life Technologies), and anti-cyclin D1 from Abcam; anti-Snail from Abgent; anti- nuclei with 40,6-diamidino-2-phenylindole dihydrochloride vimentin (for Western blotting) from Santa Cruz Biotechnology; (DAPI; Sigma-Aldrich) in blocking solution. After extensive and anti-N-cadherin and anti-vimentin [for immunohistochem- washes with PBS, cells were mounted in ibidi mounting medium istry (IHC)] from Epitomics. The rabbit polyclonal antibody (ibidi). Samples were examined using an IX81 DSU Spinning specific for PKD2 was from Upstate Biotechnology and the Disc Confocal from Olympus with a 40 objective. rabbit polyclonal antibody specific for PKD3 used for immu- noblotting was from Bethyl Laboratories. The mouse monoclo- Proliferation, migration, and invasion assays nal antibody specific for PKD3 (H00023683-M01) used for Transwell migration and invasion assays were performed as IHC was from Abnova. The mouse monoclonal antibody spe- described previously (12). Briefly, Transwell chambers were left cific for PKD1 was raised by Creative Biolabs/Creative Dynamics uncoated (migration assay) or coated with Matrigel (2 mg/well; and is further described in ref. (11). Secondary horseradish BD Biosciences), dried overnight, and rehydrated for 1 hour with peroxidase (HRP)–linked antibodies were obtained from Roche 40 mL of tissue culture media. Cells were harvested, washed once Applied Science. Luciferin was obtained from Gold Biotechnol- with media containing 1% BSA, and resuspended in media ogy. Fulvestrant and b-estradiol (E2) were purchased from containing 0.1% BSA. Then, 100,000 cells were seeded per Trans- Sigma-Aldrich. The PKD-specific inhibitor CRT0066101 was well insert. NIH-3T3 conditioned medium served as a chemoat- obtained from Cancer Research Technology. tractant in the lower chamber. Remaining cells were used to Lentiviral shRNA expression and shRNA constructs control the expression of genes of interest by Western blot anal- Specific lentiviral expression constructs for short hairpin RNA ysis. After 16 hours, cells on top of the Transwell insert were (shRNA) targeting human PKD3 were purchased from Sigma- removed and cells that had migrated/invaded to the lower surface Aldrich (MISSION shRNA Plasmid DNA). Constructs used were of the filters were fixed in 4% paraformaldehyde, stained with NM_005813.x-3393s1c1 (labeled as PKD3-shRNA#1) and DAPI, and counted. For impedance-based real-time chemotactic NM_005813.x-2494s1c1 (labeled as PKD3-shRNA#2). Lentivirus assays, cells were seeded onto an E-Plate (for proliferation assays)

www.aacrjournals.org Mol Cancer Ther; 14(6) June 2015 1307

Borges et al.

or a CIM-Plate 16 Transwell (for migration/invasion assays) from (Promega), and centrifuged (13,000 rpm, 10 minutes, 4C). Roche Applied Science. After attachment, cell migration or inva- Assays for luciferase activity were performed according to the sion (coating of top well with 2 mg of Matrigel) toward NIH-3T3 Promega Luciferase assay protocol and measured using a Ver- conditioned media was continuously monitored in real time for itas luminometer (Symantec). Luciferase activity of the PRKD3 the indicated times using the xCELLigence RTCA DP Instrument promoter-luciferase reporter was normalized to Renilla luci- from Roche Applied Science. ferase activity. Expression of proteins was controlled by West- ern blot analysis. Patient samples, TMAs, and IHC Tissue samples were initially collected with the approval of the Chromatin immunoprecipitation Mayo Clinic Institutional Review Board (IRB) under protocol Chromatin immunoprecipitation (ChIP) assays were per- MC0033. Written informed consent for the use of these tissues formed using the Imprint Chromatin Immunoprecipitation Kit in research was obtained from all participants. Generation of the from Sigma-Aldrich according to the manufacturer's protocol. TMA was performed under protocol 09-001642. Therefore, all Five micrograms of primary antibody (anti-GFP, Abcam) or fi fi unique patient identi ers and con dential data were removed rabbit IgG control was used for ChIPs. Immunoprecipitates were fi 0 and tissue samples were de-identi ed. The Mayo Clinic IRB analyzed by PCR using the primer sets 5 -TGACAATGCCTGT- assessed the protocol 09-001642 as minimal risk and waived the CAGCTTC-30 and 50-AAACGCGAATGTGACCCTAC-30 to amplify need for further consent. All data were analyzed anonymously. a 243 bp fragment (ERa site 1) or 50-TGATAGACACGCTCGC- fi 0 0 0 TMAs were deparaf nized (1 hour at 60 C), dewaxed in xylene GACT-3 and 5 -TGCCGGGAGCTGTAGTTCCT-3 to amplify a fi ( ve times for 4 minutes), and gradually rehydrated with ethanol 199-bp fragment (ERa site 2) of the human PRKD3 promoter. (100%, 95%, and 75%, twice with each concentration for 3 minutes). The rehydrated TMA sections were rinsed in water and subjected to hematoxylin and eosin (H&E) staining or to antigen Bioinformatics retrieval in citrate buffer (pH 6.0) as previously described (26). Evaluation of expression of PRKD3 in annotated breast cancer Slides were treated with 3% hydrogen peroxide (5 minutes) to datasets was performed using the Nextbio server (www.nextbio. reduce endogenous peroxidase activity and washed with PBS com; ref. 27). KM Plotter data were obtained using the current – containing 0.5% Tween 20 (PBS–Tween 20). Proteins of interest release of Kaplan Meier Plotter [www.kmplot.com; (28); 2012 ¼ were detected using indicated specific antibodies diluted in PBS– version, n 2,978], interrogating using Affymetrix ID: Tween 20 and visualized using the EnVisionþ Dual Link Labelled "211084_x_at," survival set at distant metastasis-free survival, Polymer Kit following the manufacturer's instructions (Dako). auto select best cutoff set at checked, follow-up threshold set at Images were captured using the Aperio ScanScope slide scanner all, and array quality control set at exclude biased arrays. (Aperio). Statistical analysis Orthotopic tumor models and treatment GraphPad Prism version 4.0c software (GraphPad Software) Animal experiments were performed under protocols A43213 was used for all statistical analyses. Statistical significance (P < and A17313 approved by the Mayo Clinic Institutional Animal 0.05) was determined using a two-tailed Student t test and Care and Use Committee (IACUC). Female nonobese diabetic standard deviations. severe combined immunodeficiency (NOD scid) mice were anesthetized, and 500,000 cells washed three times in PBS and m Results mixed with 30 L of complete Matrigel (BD Biosciences) were injected into the fourth mammary gland on the right side of PKD3 is highly expressed in ER breast cancers and correlates each animal. As indicated, cell lines used were MDA-MB-231. with aggressiveness Luc (MDA-MB-231-luc2 from PerkinElmer; additionally expres- Loss of gene expression of PRKD1 (encoding for PKD1) is a sing luciferase), MDA-MB-231.Luc stably expressing control marker for aggressive breast cancer (11, 17). Using isoform- shRNA (scr-shRNA), or two different shRNAs specifically target- specific antibodies, we determined the expression pattern of ing PKD3 (PKD3-shRNA#1 and PKD3-shRNA#2). For studies PKD1 and the two oncogenic versions of this kinase family, with CRT0066101, mice were treated orally with 80 mg/kg PKD2 and PKD3, in normal breast (n ¼ 60 samples) and TNBC CRT0066101 diluted in a 5% dextrose saline solution (Sig- (n ¼ 40 samples). Whereas PKD1 is the main isoform expressed ma-Aldrich) or 5% dextrose saline solution alone (control) in normal breast, TNBC show an isoform switch toward expres- every other day starting 14 days after cell injection. Body weight sion of PKD3 (Fig. 1A). PKD2 generally was weakly expressed, and tumor volume (caliper measurement) were determined but is also slightly downregulated in TNBC. In order to evaluate once per week. The presence of metastases was detected using whether increased PKD3 expression is indeed linked to the the IVIS Spectrum Imaging System (PerkinElmer). At the end- triple-negative phenotype, we evaluated annotated clinical point, primary tumors and sites of metastasis were removed and breast cancer datasets from 13 different studies. In all studies, triple-negative biopsy samples showed significantly increased analyzed as indicated. þ expression of PRKD3 as compared with triple-positive (ER / þ þ Luciferase reporter assay PR /HER2 ) biopsies (Supplementary Table S1). Using The Cells were transfected with PRKD3 promoter-luciferase re- Gene Set Analysis Cell Lines module of GOBO (29, 30), we porter (2 mg), Renilla luciferase reporter (0.1 mg), and pEGFP- then analyzed a panel of 51 breast cancer cell lines and also ERa expression construct (2 mg) in 6-well plates, as indicated. found a reverse correlation of PRKD3 gene expression between Twenty-four hours after transfection, cells were washed twice basal and luminal breast cancer types (Fig. 1B, left). A similar with ice-cold PBS, scraped in 250-mL Passive Lysis Buffer reverse correlation was found between TNBC and HR-positive

1308 Mol Cancer Ther; 14(6) June 2015 Molecular Cancer Therapeutics

Targeting of ER Breast Cancer with CRT0066101

ABNormal TNBC

3 - y

2 2 2 U) (A 1 PKD1

PKD1 intensit * 1 1 0 Normal TNBC

expression 0 expression 0 1.5 2 2 y

U) –1 –1

(A * PKD2 0.5 PRKD3 Log PRKD3 Log PKD2 intensit

0 –2 –2 Normal TNBC

4 * n = 12 n = 14 n = 25 n = 25 n = 15

y 3

U) 2

(A D PKD3 1 PKD3 intensit 1.0 HR = 1.68 (1.14–2.47) log-rank P = 0.0079 0 Normal TNBC 0.8 asis- al st

C iv a 0.6 Invasive ductal carcinoma t e

HER2–, ER+ HER2+, ER+ HER2+, ER– * m 3 0.4 ant free surv Dist

2 0.2 Low PRKD3 - (AU) High PRKD3 ER

1 0.0

PKD3 intensity PKD3 intensity 0 5101520 0 Time (years) ER+ ER–

Figure 1. PKD3 is highly expressed in ER breast cancers and correlates with aggressiveness. A, TMA slides containing human TNBC (n ¼ 40) and normal human breast tissue samples (n ¼ 60) were analyzed for PKD1, PKD2, and PKD3 expression using isoform-specific antibodies. Scale bar, 100 mm. Statistical analysis of PKD1, PKD2, and PKD3 intensity was performed using Aperio positive pixel count algorithm in the Imagescope software (Aperio). B, analysis of PRKD3 gene expression in breast cancer cells lines using the Gene Set Analysis Cell Lines module of GOBO. Cell lines were grouped into Basal A (n ¼ 12), Basal B (n ¼ 14), or Luminal (n ¼ 25) subtypes (left), or TNBC (n ¼ 25) and HR-positive (n ¼ 15) subtypes (right). C, TMA slides containing histologically confirmed IDC of indicated subtypes were analyzed for PKD3 expression using an isoform-specific antibody. Scale bar, 100 mm. þ þ Statistical analysis of PKD3 intensity in ER or ER groups (n ¼ 44 for ER ; n ¼ 41 for ER ) was performed using Aperio positive pixel count algorithm in the Imagescope software (Aperio). D, the Kaplan–Meier plot depicting the impact of levels of PRKD3 gene expression on the metastasis-free survival of patients (n ¼ 1,353) with ER breast cancer. In A and C, P values were acquired with the Student t test using Prism v5 software. , P < 0.05, statistical significance. In A and C, representative pictures from each group are depicted. cell lines (Fig. 1B, right), indicating that loss of HR expression ERa regulates PKD3 expression levels in breast cancer cells and increased PRKD3 expression may be linked. To test this, we To determine whether ERa could directly affect PRKD3 þ analyzed ER-positive (ER ; n ¼ 44) and ER (n ¼ 41) patient promoter activity, we performed luciferase reporter assays using tumors for PKD3 expression and confirmed that increased PKD3 a PRKD3 promoter-luciferase gene reporter. Reintroduction expression is linked to loss of ER expression (Fig. 1C and of ERa into MDA-MB-231 (ER /PR /HER2 )cellsledtoa Supplementary Fig. S1). The negative correlation between ER significant decrease (approximately 40%) of PRKD3 gene pro- and PKD3 was bolstered by meta-analysis of 24 published moteractivity(Fig.2A).Thesedatawereconfirmed with BT20, studies in which we found that PRKD3 shows significantly another TNBC cell line. BT20 cells, when transfected with ERa, þ higher expression in ER versus ER breast cancers (Supple- showed an approximately 75% decrease of PRKD3 expression mentary Table S2). We next assessed the association of PRKD3 and this was further decreased, when media were supplement- expression with prognosis in breast cancer patients, and found edwithE2(Fig.2B).WeanalyzedthePRKD3 promoter that elevated PRKD3 expression levels in ER tumors (n ¼ sequence and identified two potential ER-binding sites, 780 1,353) were associated with significantly decreased distant bases (ERa site 1) or 318 bases (ERa site 2), upstream of the metastasis-free survival (Fig. 1D). transcription start site (Fig. 2C). To test whether ERa directly

www.aacrjournals.org Mol Cancer Ther; 14(6) June 2015 1309

Borges et al.

AB MDA-MB-231 BT20

α α α ER ER ER β-Estradiol 150 – – + + 125

100 100 75

* 50 promoter activity

50 (% of control) (% of control) (% of 25 * #

PRKD3 * PRKD3 promoter activity 0 0 Luciferase Assay Luciferase Assay

kDa kDa ERα ERα 80 80 WB: anti-GFP WB: anti-GFP 46 46 β β-Actin -Actin WB: anti-β-actin WB: anti-β-actin CD

PRKD3 promoter α α ER ER –785 –756 α α ERα site 1 ER -bound ER -bound PRKD3 promoter PRKD3 promoter TGGTGGTAGGGTCACATTCGCGTT TAAAGG PCR: PRKD3 PCR: PRKD3 promoter (site 1) promoter (site 2)

–324 –296 Input control Input control ERα site 2 PCR: PRKD3 PCR: PRKD3 CGGGGCAGAGACAACCCCGACCTCCCGCC promoter (site 1) promoter (site 2)

E F MDA-MB-231 BT20 HCC1954 T47D

α α α kDa ER ER ER PKD3 80 kDa WB: anti-PKD3 PKD3 80 ERα 80 WB: anti-PKD3 WB: anti-GFP 46 46 β-Actin β-Actin WB: anti-β-actin WB: anti-β-actin

Figure 2. ERa directly regulates PKD3 expression in breast cancer cells. A, MDA-MB-231 cells were transfected with PRKD3 promoter-luciferase, Renilla luciferase reporters and vector control or GFP-tagged ERa, as indicated. Forty-eight hours after transfection, reporter gene luciferase assays were performed. , P < 0.05, statistical significance. Cell lysates were also analyzed by Western blot analysis for expression of ERa (anti-GFP), or b-actin (anti-b-actin) as a loading control. B, BT20 cells were cultivated in phenol-red–free media and transfected with PRKD3 promoter-luciferase and Renilla luciferase reporters and vector control or ERa, as indicated. Forty-eight hours after transfection, BT20 cells were stimulated with 10 nmol/L E2 or vehicle (control) for 6 hours and reporter gene luciferase assays were performed. , P < 0.05, statistical significance as compared with unstimulated vector control; #, statistical significance as compared with unstimulated ERa-transfected cells. Cell lysates were also analyzed by Western blot analysis for expression of ERa (anti-GFP), or b-actin (anti-b-actin) as a loading control. C, schematic representation of potential ERa-binding sites (in grey italic) in the PRKD3 promoter region 1000 to 0. D, chromatin IP. MDA-MB-231 cells were transfected with vector control or GFP-tagged ERa.Aftercross-linking,theERa–DNA complexes were immunoprecipitated using an anti-GFP antibody. Precipitates were analyzed by PCR for the ERa-bound PRKD3 promoter. A PCR for the PRKD3 promoter using the input DNA served as a control (input control). E, ER cell lines MDA-MB-231, BT20, and HCC1954 were transfected with vector control or GFP-tagged ERa. Forty-eight hours after transfection, cell lysates were analyzed by Western blot analysis for the expression of PKD3 and ERa (anti-GFP). þ Staining for b-actin (anti-b-actin) served as a loading control. F, the ER cell line T47D was treated with 100 nmol/L fulvestrant or DMSO (control) for 24 hours and cell lysates were analyzed by Western blot analysis for the expression of PKD3 or b-actin (anti-b-actin).

binds to the PKD3 promoter at these sites, we performed ChIP whether presence of ERa translates to a decrease in PKD3 and conﬁrmed the direct binding of ERa to both of the two protein expression. Therefore, we reintroduced ERa in triple- predicted ER-binding sites (Fig. 2D). Next, we determined negative MDA-MB-231 and BT20 cells, as well as HCC1954

1310 Mol Cancer Ther; 14(6) June 2015 Molecular Cancer Therapeutics

Targeting of ER Breast Cancer with CRT0066101

þ (ER /PR /HER2 ) cells. As expected, the presence of ERa led HER2 ), which express high levels of PKD3, low levels of PKD2, to a significant decrease in PKD3 expression, and this was and no PKD1 (Supplementary Fig. S2; Supplementary Table S3; independentoftheHER2amplification status (Fig. 2E). Even- ref. 11). A knockdown of basal PKD3 expression using two þ tually, we treated the ER cell line T47D with fulvestrant, a different PKD3-specific shRNA sequences significantly decreased compound that leads to nuclear export and degradation of MDA-MB-231 cell numbers over a time period of 60 hours ER (31, 32). As expected, treatment of T47D cells with fulves- (Fig. 3A and B and Supplementary Fig. S3). Similar results were trant increased PKD3 expression further indicating a role for observed in another ER cell line, HCC1954, which show a ER as a regulator of PKD3 expression (Fig. 2F). similar PKD expression pattern (Supplementary Fig. S2; data not shown). Next, we tested the role of PKD3 on the invasive The knockdown of PKD3 decreases cancer cell proliferation, phenotype. The knockdown of PKD3 in MDA-MB-231 cells led migration, and invasion in vitro and in vivo to a dramatic decrease in directed cell migration (Fig. 3C and To test the impact of PKD3 on breast cancer cell behavior, we Supplementary Fig. S4), and similar effects were observed for used the invasive breast cancer cells MDA-MB-231 (ER ,PR , cell invasion through extracellular matrix (Fig. 3D). This confirms

scr-shRNA Figure 3. AB5 PKD3-shRNA#1 Knockdown of PKD3 decreases cancer cell PKD3-shRNA#2 proliferation, migration, and invasion in vitro and in vivo.A–E, MDA-MB-231 cells 4 were infected with lentivirus harboring kDa * * control shRNA (scr-shRNA) or two PKD3 80 3 fi Cells different shRNAs speci cally targeting WB: anti-PKD3 PKD3 (PKD3-shRNA#1 and PKD3- 46 shRNA#2). A, 48 hours after initial β-Actin 2 infection, a fraction of the cells was lysed WB: anti-β-actin Δ Normalized cell index fi and PKD3 knockdown was veri ed by 1 Western blot analysis. B, cells were seeded 0102030405060 in E-plates and numbers of attached Time (h) cells were continuously monitored in real time for 60 hours using an xCELLigence RTCA DP instrument. Error bars (gray) C DEScr-shRNA represent three experiments. C, cells scr-shRNA 4.0 were seeded in CIM-plates and (after PKD3-shRNA#1 attachment) directed cell migration was 3.5 PKD3-shRNA#2 continuously monitored in real time for 120 10 hours using an xCELLigence RTCA DP 3.0 100 instrument. Error bars (gray) represent three experiments. D, cells were seeded on 2.5 * * 80 Matrigel-coated Transwell filters and 60 PKD3-shRNA#1 2.0 Transwell invasion assays were performed Cell migration *

normalized cell index 40 (% of control)(% of as described in Materials and Methods. E, Δ 1.5 Cell invasion cells were fixed and stained with DAPI 20 * (blue) and phalloidin (red). Bars, 10 mm. 1.0 0 Transwell Invasion Assay Representative pictures from each group 246810 are depicted. The cell area (graph) was Time (h) measured and analyzed using the ImageJ software. In B–E, the results presented are PKD3-shRNA#2 the mean SEM. P values were calculated FG using a two-tailed Student t test. Lymph nodes Lungs , P < 0.05, statistical significance. F and G, c-hN K3sRA1PKD3-shRNA#2 PKD3-shRNA#1 Scr-shRNA MDA-MB-231.Luc cells stably expressing 50,000 ) control shRNA (scr-shRNA) or two 2 40,000 different shRNAs specifically targeting μ m PKD3 (PKD3-shRNA#1 and PKD3- 30,000 shRNA#2) were injected into the mfp of 20,000 *

scid Metastasis * female NOD mice. In F, the presence 10,000 of metastasis in lymph nodes and lungs Average size ( 0 25,000 was detected by immunostaining with an n = 5 n = 5 n = 5 antibody speciﬁc for human vimentin * 20,000

(detects human cancer cells). ) 15 2 * Representative pictures from each group * 15,000 are depicted. Bars, 200 mm for lymph 10 * nodes; 1 mm for lungs. In G, the number of 10,000 Cell area (square pixel) 2 5 pulmonary metastases per mm ,orthe 5,000 average size of pulmonary metastases in 2 0 0 mm was quantified from five fields each Metastases (mm n = 5 n = 5 n = 5 lung. , P < 0.05, statistical significance.

www.aacrjournals.org Mol Cancer Ther; 14(6) June 2015 1311

Borges et al.

that PKD3 is the major isoform driving motility (and prolifera- ER cancers in vivo. Therefore, we orthotopically implanted MDA- tion) in these cells. Interestingly, along with a decreased motility, MB-231 cells into the mfp of female NOD scid mice. After estab- we noticed a dramatic increase in cell spreading and altered F- lishment of primary tumors (day 14 after cell implantation), actin organization when PKD3 was knocked down (Fig. 3E). To mice were treated with 80 mg/kg CRT0066101 (oral administra- test whether the knockdown of PKD3 can affect breast tumor tion, every other day) or vehicle control. At the endpoint (10 weeks metastasis in vivo, we orthotopically implanted MDA-MB-231.Luc after cell implantation), primary tumors and tissues of potential cells either stably expressing scrambled shRNA control or two sites of metastasis were extracted. As in a previous study modeling different specific shRNA sequences for PKD3 into the mammary pancreatic cancer (33), no toxicity was detected at this dosage of fat pad (mfp) of female NOD scid mice. To exclude that PKD3 CRT0066101 and no significant changes in body weight or effects on cell proliferation affect results on metastasis, endpoints damage in tissue was observed (not shown). Treatment of mice of the experiment were set for each individual mouse at a primary with CRT0066101 did result in a significant decrease of primary tumors size of 700 100 mm3. At the endpoint, tumors and tumor size and weight (Fig. 5A and Supplementary Fig. S9), tissues of potential sites of metastasis were extracted. As a control, associated with an approximately 50% decrease in tumor cell primary tumors were analyzed by IHC with a monoclonal anti- proliferation (Fig. 5B), and an increase of apoptosis (Fig. 5C). Of body specific for PKD3 (Supplementary Fig. S5A). As predicted by note, the effects of CRT0066101 on tumor cell viability and our in vitro experiments, primary tumor growth was significantly proliferation that were observed in vivo were in line with effects slower when PKD3 expression was decreased (Supplementary Fig. observed in vitro (Fig. 4). Additional analysis of tumor edges as S5A). Analysis of expression of Ki67 and cleaved caspase-3 stain- well as the connection of tumor cells to the normal adjacent ing indicated that this was due to a decrease in cell proliferation, as mouse mammary tissue showed a reduced local invasion in well as an increase in cell death (Supplementary Fig. S5B and tumors treated with the PKD inhibitor (Fig. 5D). This decrease S5C). Interestingly, PKD3-shRNA tumors showed reduced local in invasiveness correlated with decreased expression of COX-2 invasion when compared with control (scr-shRNA) tumors (Sup- (Fig. 5E), which previously was associated with local invasion of plementary Fig. S5D). Next, we determined metastasis to distant breast cancer cells, as well as metastasis to the lungs (35). Indeed, organs by immunohistochemical staining for human vimentin as IVIS imaging of animals indicated that CRT0066101 may affect a marker for human cancer cells. We found that PKD3 down- metastasis to distant organs (Fig. 6A). Immunohistochemical regulation dramatically decreased cancer cells infiltration to analysis for human cancer cells (IHC for anti-human vimentin) lymph nodes and lungs (Fig. 3F). Furthermore, mice implanted at the endpoint indicated a dramatic decrease of infiltration of with PKD3-shRNA cells had significantly fewer and smaller tumor cells into lymph nodes in CRT0066101-treated mice (Fig. metastases to their lungs compared with controls (scr- 6B). Similarly, lung metastases were fewer in numbers and smaller shRNA; Fig. 3G). Taken together, our data indicate that PKD3 in size (Fig. 6B–D). Metastases in the lungs of the treated mice plays an important role in breast tumor growth, progression, and showed a significant lower expression of Ki67, indicating that the metastasis. decrease in average size of metastases may be due to CRT0066101 effects on the ability of tumor cells to proliferate in their new The PKD inhibitor CRT0066101 decreases cancer cell environment (Fig. 6E). proliferation, migration, and invasion in vitro Next, we tested the impact of PKD3 inhibition on cell proliferation and the invasive phenotype. Because PKD3 is upregu- Discussion lated and as such can be targeted in ER breast cancer indepen- Silencing of PKD1 and increased expression of the oncogenic dently of the HER2 status, we decided to test two different cell versions of this kinase family, PKD2 and PKD3, has been lines, MDA-MB-231 as a model for TNBC and HCC1954 as a described to contribute to progression of several epithelial can- þ model for ER , HER2 breast cancer. We used the pan-PKD cers, including breast cancer (11, 13, 16, 17, 20–22), gastric cancer inhibitor CRT0066101, which has been shown to have antican- (36), pancreatic cancer (37, 38), colorectal cancer (34), and cer activity in pancreatic, prostate, and colorectal cancer cells (33, prostate cancer (14, 39–42). We here show that the switch from 34). CRT0066101 induced a significant decrease in cell prolif- PKD1 to PKD3 expression defines the transition to an aggressive eration in both cell lines (Fig. 4A and D and Supplementary Fig. breast tumor phenotype. PKD1 previously had been shown to S6). In a similar fashion to PKD3 depletion, inhibition of PKD maintain the epithelial phenotype by preventing EMT (13, 14, 16) activity with CRT0066101 also blocked directed cell migration and to negatively regulate cell migration (12), invasion (17), and (Fig. 4B and E and Supplementary Fig. S7) and invasion (Fig. 4C metastatic progression of breast cancer (11, 19). Consequently, in and F). Similar as observed with the PKD3 knockdown in Fig. 3E, invasive breast cancers, PKD1 expression is downregulated by along with a decreased motility, we noticed increased spreading promoter hypermethylation (11, 36). The signaling mechanisms and altered F-actin organization of cells that were treated with by which other PKD isoforms are (up)regulated at the transcrip- CRT0066101 (Fig. 4G and H). Overall, data obtained with PKD3 tional levels have not been identified so far. knockdown and CRT0066101 were similar, although both cell Analysis of cell lines, TMAs from patient samples (Fig. 1), and lines also express PKD2 that may have similar functions as PKD3 annotated clinical breast cancer datasets showed significantly in regard to regulation of cell migration and invasion (Supple- higher PRKD3 gene expression in ER or TNBC biopsies (Sup- mentary Fig. S8). plementary Table S1). A detailed analysis suggested that increased PKD3 expression is mainly due to loss of ER expression and not CRT0066101 decreases primary tumor size, local invasiveness, dependent on the HER2 status of tumors (Fig. 1C and Supple- and metastasis in vivo mentary Table S2). This led to the questions whether the ER could Next, we tested whether CRT0066101 can be used as an effi- be a direct negative regulator of PRKD3 expression; or whether cient strategy for the treatment of tumor growth and metastasis of observed reverse expression between both molecules is

1312 Mol Cancer Ther; 14(6) June 2015 Molecular Cancer Therapeutics

Targeting of ER Breast Cancer with CRT0066101

ABCMDA-MB-231 MDA-MB-231 MDA-MB-231

8 DMSO DMSO Figure 4. CRT0066101 CRT0066101 1.5 120 The PKD inhibitor CRT0066101 decreases the cell proliferation and the 6 * 1.4 100 invasive phenotype of ER breast cancer * 80 cells. A and D, indicated cell lines were 1.3 4 60 * seeded in E-plates and (after Cells 1.2 attachment) treated with 2.5 mmol/L

Cell migration 40 (% of control) (% of Cell invasion Cell invasion

CRT0066101 or DMSO (control). 2 normalized cell index 1.1 Δ Δ normalized cell index 20 Numbers of attached cells were 1.0 continuously monitored in real time for 0 0102030405060 4681012 Transwell indicated times using an xCELLigence Time (h) Time (h) invasion assay RTCA DP instrument. Error bars (gray) represent three experiments. B, MDA- MB-231 cells were seeded in CIM-plates DEHCC1954 HCC1954 F HCC1954 and treated with 2.5 mmol/L CRT0066101 or DMSO (control). After attachment, cell migration was continuously monitored in 14 DMSO CRT0066101 120 120 real time for indicated time using an 12 xCELLigence RTCA DP instrument. Error 100 100 10 * bars (gray) represent three experiments. 80 80 C and F, indicated cell lines were seeded 8 * on Matrigel-coated Transwell filters and 6 60 60 Cells treated with 2.5 mmol/L CRT0066101 or (% of control) (% of 4 40 control) (% of 40 * Cell invasion DMSO (control). Transwell invasion Cell migration 20 20 assays were performed as described in Δ normalized cell index 2 Materials and Methods. E, HCC1954 were 0 0 0 seeded on Transwell filters and treated 20 40 60 80 100 Transwell Transwell migration assay invasion assay with 2.5 mmol/L CRT0066101 or DMSO Time (h) (control). Transwell migration assays GH were performed as described in MDA-MB-231 HCC1954 Materials and Methods. G and H, DMSO (control) DMSO (control) indicated cell lines were treated with 2.5 mmol/L CRT0066101 or DMSO (control) for 16 hours. Cells were fixed and stained with DAPI (blue) and 30,000 25,000 phalloidin (red). Bar, 10 mm. * 25,000 * Representative pictures from each group 20,000 are depicted. The cell area was measured 20,000 CRT0066101 and analyzed using the ImageJ software. CRT0066101 15,000 – In A H, the results presented are the 15,000 mean SEM. P values were calculated Cell area

Cell area 10,000 (square pixel) using a two-tailed Student t test. 10,000 (square pixel) , P < 0.05, statistical signiﬁcance. 5,000 5,000

0 0

correlative. By reexpressing ER in ER cell lines (Fig. 2E) or shown to mediate activation of Akt, leading to prolonged acti- þ inhibiting ER expression in ER T47D cells (Fig. 2F), we clearly vation of extracellular signal–regulated kinase (ERK) 1/2 (39). demonstrate that PKD3 repression depends on ER activity. As a Furthermore, S6 kinase 1 (S6K1), a member of the mammalian mechanism of regulation, we demonstrate that ER decreases target of rapamycin complex 1 signaling cascade (mTORC1), was PKD3 expression through direct binding to the PRKD3 promoter identiﬁed as a downstream target of PKD3 to mediate its effect on at two different ER-binding sites (Fig. 2C and D). Thus, our data cell proliferation in TNBC cell lines (22). Another target involved demonstrate a direct negative regulation of a gene by this receptor. may be the G-protein–coupled receptor kinase-interacting protein Although ER is mostly known for its positive effect on gene 1 (GIT1), a key mediator of PKD3-induced cell spreading and transcription, some studies have demonstrated that it can also proliferation (46). act as a repressor of gene expression (43, 44). For example, ER can Besides describing a previously unknown regulation of PKD3 repress a cytochrome P450-encoding gene (CYP1A1) by targeting expression that can be linked to aggressiveness of breast cancers, Dnmt3B DNA methyltransferase (44). we also tested the use of PKD inhibitors in breast cancers that PKD3 has been implicated in all aspects of tumor formation mainly express PKD3. Our data and previous work implicate that and progression, such as mediating proliferation, survival, and ideal targets to test the efﬁcacy of PKD inhibitors would be ER or invasiveness, in different cancers (20, 22, 39, 45). However, triple-negative, invasive breast cancers, in which upregulation of relatively little is known about the molecular mechanisms by PKD3 is accompanied by the loss of PKD1 expression. which PKD3 may drive carcinogenesis. PKD3 previously has been CRT0066101 is a selective and potent PKD inhibitor that targets

www.aacrjournals.org Mol Cancer Ther; 14(6) June 2015 1313

Borges et al.

A Vehicle CRT0066101

1,500 2.5

2.0 1,000 ) 3 1.5 Figure 5.

(g) * CRT0066101 inhibits tumor growth and (mm * 1.0 500 local tumor cell invasion in vivo. A, MDA- 0.5 MB-231.Luc cells were injected into the Tumor weight Tumor Tumor volume volume Tumor mfp of female NOD scid mice. After 0 0.0 establishment of primary tumors, at n = 6 n = 6 n = 6 n = 6 week 2, mice were treated orally with 80 mg/kg CRT0066101 or vehicle every B C other day for an additional period of 8 Ki67 Cleaved caspase-3 weeks. Tumor growth was continuously monitored using the IVIS Spectrum imaging system. Left, a representative 120 900 picture of mice from each group (n ¼ 6 800 per group) at week 7. At the endpoint Vehicle Vehicle + * 700 (week 10), tumor volume and weight 80 600 were measured. , P < 0.05, statistical 500 signiﬁcance. B and C, primary tumors of cells

+ * 400 different treatment groups were stained cells 40 300 by IHC for the expression of Ki67 (B) and

Ki67 200 cleaved caspase-3 (C). Bars, 50 mm. D, (relative percentage) (relative (relative percentage) (relative CRT0066101 CRT0066101 100 samples of primary tumor were stained Cleaved caspase-3 Cleaved 0 0 with H&E. Bar, 200 mm. Areas where tumors connect with mouse mammary gland tissue were enhanced. E, primary DEVehicle CRT0066101 tumors were stained by IHC for the expression of COX2. Bars, 50 mm. In B, COX-2 C, and E, statistical analysis was performed using Aperio positive pixel count algorithm in the Imagescope 180 software. P values were acquired with

Vehicle the Student t test using Prism v5 software. , P < 0.05, statistical 120 signiﬁcance. In B–E, representative

cells pictures from each group are depicted. +

COX-2 * (relative percentage) (relative CRT0066101

all three isoforms in a low nanomolar range (i.e., IC50 for PKD3 knockdown or inhibition of PKD3 in vivo. For example, PKD is 2 nmol/L). In a previous work, it has been shown to be active signaling previously has been implicated in angiogenesis in vivo in orthotopic animal models for pancreatic cancer and (38, 47, 48) and it is very possible that the decrease in size of colorectal cancer (33, 34). Because it can be orally administer- the primary tumors that we observed in response to CRT0066101 ed and has no side effects in mice, when used at doses that treatment is partly due to blocking of angiogenesis. inhibit PKD (33, 34), it is an inhibitor that could be developed It should be noted that for breast cancers that undergo a switch for clinical use. from PKD1 to PKD3, two strategies are possible, either to reex- Our data not only show that CRT0066101 can block all aspects press PKD1, or to inhibit PKD3 (discussed in ref. 49). We recently of the tumor phenotype in PKD1-negative/PKD3-positive breast have tested the first strategy, and shown that reverting the epige- cancer cells in vitro (Fig. 4), but also demonstrate in vivo relevance netic silencing of PKD1 with the DNA methyltransferase inhibitor by showing that CRT0066101 significantly inhibits primary decitabine can dramatically reduce the invasive and metastatic tumor growth, local invasion, and metastasis to distant organs potential of triple-negative orthotopic tumors in vivo (11, 19). in vivo (Figs. 5 and 6). It is also important to note that the same What is still ill-defined is how PKD1, once it is reexpressed in events were obtained with specific knockdown of PKD3 showing invasive breast cancers, can exert a protective effect and antagonize that this kinase is the main target in ER cancer cells (Fig. 3). PKD3 functions. Because the ESR1 gene promoters also can be Although our in vitro data using shRNA or CRT0066101 clearly silenced by DNA methylation (50), the simplest explanation for demonstrate effects on cell proliferation, migration, and invasion, this may be that decitabine treatment also upregulates ER, which it is possible that additional tumorigenic functions are affected by then decreases PKD3 expression.

1314 Mol Cancer Ther; 14(6) June 2015 Molecular Cancer Therapeutics

Targeting of ER Breast Cancer with CRT0066101

AB C Vehicle Lymph node Lung Figure 6. CRT0066101 inhibits metastasis to distant organs. A, metastasis was 12 continuously monitored using the IVIS ) Vehicle 2 Spectrum imaging system in vivo. Mouse #1 Mouse #2 Representative pictures of mice from 8 each treatment group are depicted. B, CRT0066101 the presence of metastasis in lymph nodes and lungs was analyzed by IHC for 4 * human vimentin. Bar, 500 mm for lymph

nodes; 1 mm for lungs. C and D, the Lung metastases (numbers per mm (numbers per number of pulmonary metastases per CRT0066101 0 mm2 (C), or the average size of n = 6 n = 6 Mouse #1 Mouse #2 Staining: anti-human Vimentin pulmonary metastases in mm2 (D) was quantified from five fields each lung. , P < 0.05, statistical significance. E, DE H&E Ki67 lungs were stained with H&E and expression of Ki67 was detected by IHC. The percentage of Ki67-positive cells was determined using Aperio positive

) 20,000 pixel count algorithm in the Imagescope 2 100 Vehicle software. Bar, 50 mm. For B, D, and E, μ m 15,000 the values are mean SEM. P values 75 were acquired with the Student t test * 10,000 using Prism v5 software. , P < 0.05, 50 cells statistical signiﬁcance. In B and E, + 5,000 * representative pictures from each 25 Ki67 group are depicted. Lung metastases (relative percentage) (relative (average size in (average size 0 CRT0066101 n = 6 n = 6 0

In conclusion, our study provides a rationale that supports the Administrative, technical, or material support (i.e., reporting or organizing use of PKD inhibitors such as CRT0066101 for treatment of data, constructing databases): E.A. Perez patients diagnosed with ER or TNBC. Key for treatment with Study supervision: P. Storz PKD inhibitors is a downregulation of PKD1 and upregulation of the oncogenic version PKD3 (or PKD2). This requires devel- Acknowledgments oping reliable techniques that could be used in clinical settings The authors thank members of the Storz laboratory for helpful discussions to determine PKD1, 2, and 3 expression status before treatment and the Luther and Susie Harrison Foundation for their support. decisions are made. Grant Support ﬂ Disclosure of Potential Con icts of Interest This work was supported by the NIH (GM086435 and CA140182) to No potential conﬂicts of interest were disclosed. P. Storz, the Bankhead-Coley Program of the Florida Department of Health (1BG11) to P. Storz, the Donna Foundation (26.2 with Donna) to E.A. Perez Authors' Contributions and E.A. Thompson, and the Mayo Clinic Breast Cancer SPORE (CA116201) Conception and design: S. Borges, E.A. Perez, E.A. Thompson, P. Storz to P. Storz and D.C. Radisky. Acquisition of data (provided animals, acquired and managed patients, The costs of publication of this article were defrayed in part by the provided facilities, etc.): E.A. Perez, E.A. Thompson, X.J. Geiger payment of page charges. This article must therefore be hereby marked Analysis and interpretation of data (e.g., statistical analysis, biostatistics, advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate computational analysis): S. Borges, E.A. Perez, E.A. Thompson, D.C. Radisky, this fact. P. Storz Writing, review, and/or revision of the manuscript: S.Borges,E.A.Perez, Received October 31, 2014; revised April 2, 2015; accepted April 2, 2015; D.C. Radisky, X.J. Geiger, P. Storz published OnlineFirst April 7, 2015.

References 1. Carey LA. Directed therapy of subtypes of triple-negative breast cancer. 4. Rakha EA, El-Sayed ME, Green AR, Lee AH, Robertson JF, Ellis IO. Oncologist 2010;15(Suppl 5):49–56. Prognostic markers in triple-negative breast cancer. Cancer 2007;109: 2. Perou CM. Molecular stratiﬁcation of triple-negative breast cancers. 25–32. Oncologist 2010;15(Suppl 5):39–48. 5. Schneider BP, Winer EP, Foulkes WD, Garber J, Perou CM, Richardson A, 3. Bauer KR, Brown M, Cress RD, Parise CA, Caggiano V. Descriptive analysis et al. Triple-negative breast cancer: risk factors to potential targets. Clin of estrogen receptor (ER)-negative, progesterone receptor (PR)-negative, Cancer Res 2008;14:8010–8. and HER2-negative invasive breast cancer, the so-called triple-negative 6. Dent R, Trudeau M, Pritchard KI, Hanna WM, Kahn HK, Sawka CA, et al. phenotype: a population-based study from the California cancer Registry. Triple-negative breast cancer: clinical features and patterns of recurrence. Cancer 2007;109:1721–8. Clin Cancer Res 2007;13:4429–34.

www.aacrjournals.org Mol Cancer Ther; 14(6) June 2015 1315

Borges et al.

7. Irshad S, Ellis P, Tutt A. Molecular heterogeneity of triple-negative breast breast cancer prognosis using microarray data of 1,809 patients. Breast cancer and its clinical implications. Curr Opin Oncol 2011;23:566–77. Cancer Res Treat 2010;123:725–31. 8. Karihtala P, Auvinen P, Kauppila S, Haapasaari KM, Jukkola-Vuorinen A, 29. Neve RM, Chin K, Fridlyand J, Yeh J, Baehner FL, Fevr T, et al. A collection of Soini Y. Vimentin, zeb1 and Sip1 are up-regulated in triple-negative and breast cancer cell lines for the study of functionally distinct cancer subtypes. basal-like breast cancers: association with an aggressive tumour phenotype. Cancer Cell 2006;10:515–27. Breast Cancer Res Treat 2013;138:81–90. 30. Ringner M, Fredlund E, Hakkinen J, Borg A, Staaf J. GOBO: gene expression- 9. Sarrio D, Rodriguez-Pinilla SM, Hardisson D, Cano A, Moreno-Bueno G, based outcome for breast cancer online. PLoS ONE 2011;6:e17911. Palacios J. Epithelial–mesenchymal transition in breast cancer relates to the 31. Fawell SE, White R, Hoare S, Sydenham M, Page M, Parker MG. Inhibition basal-like phenotype. Cancer Res 2008;68:989–97. of estrogen receptor-DNA binding by the "pure" antiestrogen ICI 164,384 10. Karam M, Legay C, Auclair C, Ricort JM. Protein kinase D1 stimulates appears to be mediated by impaired receptor dimerization. Proc Natl Acad proliferation and enhances tumorigenesis of MCF-7 human breast cancer Sci U S A 1990;87:6883–7. cells through a MEK/ERK-dependent signaling pathway. Exp Cell Res 32. Kumar V, Chambon P. The estrogen receptor binds tightly to its re- 2012;318:558–69. sponsive element as a ligand-induced homodimer. Cell 1988;55:145–56. 11. Borges S, Doppler H, Perez EA, Andorfer CA, Sun Z, Anastasiadis PZ, et al. 33. Harikumar KB, Kunnumakkara AB, Ochi N, Tong Z, Deorukhkar A, Sung Pharmacologic reversion of epigenetic silencing of the PRKD1 promoter B, et al. A novel small-molecule inhibitor of protein kinase D blocks blocks breast tumor cell invasion and metastasis. Breast Cancer Res pancreatic cancer growth in vitro and in vivo. Mol Cancer Ther 2010; 2013;15:R66. 9:1136–46. 12. Eiseler T, Doppler H, Yan IK, Kitatani K, Mizuno K, Storz P. Protein kinase 34. Wei N, Chu E, Wipf P, Schmitz JC. Protein kinase d as a potential D1 regulates cofilin-mediated F-actin reorganization and cell motility chemotherapeutic target for colorectal cancer. Mol Cancer Ther 2014; through slingshot. Nat Cell Biol 2009;11:545–56. 13:1130–41. 13. Bastea LI, Doppler H, Balogun B, Storz P. Protein kinase D1 maintains the 35. Minn AJ, Gupta GP, Siegel PM, Bos PD, Shu W, Giri DD, et al. Genes that epithelial phenotype by inducing a DNA-bound, inactive SNAI1 transcrip- mediate breast cancer metastasis to lung. Nature 2005;436:518–24. tional repressor complex. PLoS ONE 2012;7:e30459. 36. Kim M, Jang HR, Kim JH, Noh SM, Song KS, Cho JS, et al. Epigenetic 14. Du C, Zhang C, Hassan S, Biswas MH, Balaji KC. Protein kinase D1 inactivation of protein kinase D1 in gastric cancer and its role in gastric suppresses epithelial-to-mesenchymal transition through phosphoryla- cancer cell migration and invasion. Carcinogenesis 2008;29:629–37. tion of snail. Cancer Res 2010;70:7810–9. 37. Wille C, Kohler C, Armacki M, Jamali A, Gossele U, Pfizenmaier K, et al. 15. Eiseler T, Kohler C, Nimmagadda SC, Jamali A, Funk N, Joodi G, et al. Protein kinase D2 induces invasion of pancreatic cancer cells by regulating Protein kinase D1 mediates anchorage-dependent and -independent matrix metalloproteinases. Mol Biol Cell 2014;25:324–36. growth of tumor cells via the zinc finger transcription factor Snail1. J Biol 38. Azoitei N, Pusapati GV, Kleger A, Moller P, Kufer R, Genze F, et al. Protein Chem 2012;287:32367–80. kinase D2 is a crucial regulator of tumour cell-endothelial cell communi- 16. Zheng H, Shen M, Zha YL, Li W, Wei Y, Blanco MA, et al. PKD1 phos- cation in gastrointestinal tumours. Gut 2010;59:1316–30. phorylation-dependent degradation of SNAIL by SCF-FBXO11 regulates 39. Chen J, Deng F, Singh SV, Wang QJ. Protein kinase D3 (PKD3) contributes epithelial-mesenchymal transition and metastasis. Cancer Cell 2014;26: to prostate cancer cell growth and survival through a PKCepsilon/PKD3 358–73. pathway downstream of Akt and ERK 1/2. Cancer Res 2008;68:3844–53. 17. Eiseler T, Doppler H, Yan IK, Goodison S, Storz P. Protein kinase D1 40. Zou Z, Zeng F, Xu W, Wang C, Ke Z, Wang QJ, et al. PKD2 and PKD3 regulates matrix metalloproteinase expression and inhibits breast cancer promote prostate cancer cell invasion by modulating NF-kappaB- and cell invasion. Breast Cancer Res 2009;11:R13. HDAC1-mediated expression and activation of uPA. J Cell Sci 2012; 18. Peterburs P, Heering J, Link G, Pfizenmaier K, Olayioye MA, Hausser A. 125:4800–11. Protein kinase D regulates cell migration by direct phosphorylation of the 41. Jaggi M, Rao PS, Smith DJ, Hemstreet GP, Balaji KC. Protein kinase C mu is cofilin phosphatase slingshot 1 like. Cancer Res 2009;69:5634–8. down-regulated in androgen-independent prostate cancer. Biochem Bio- 19. Borges S, Doppler HR, Storz P. A combination treatment with DNA phys Res Commun 2003;307:254–60. methyltransferase inhibitors and suramin decreases invasiveness of breast 42. Jaggi M, Rao PS, Smith DJ, Wheelock MJ, Johnson KR, Hemstreet GP, et al. cancer cells. Breast Cancer Res Treat 2014;144:79–91. E-cadherin phosphorylation by protein kinase D1/protein kinase C{mu} 20. Hao Q, McKenzie R, Gan H, Tang H. Protein kinases D2 and D3 are novel is associated with altered cellular aggregation and motility in prostate growth regulators in HCC1806 triple-negative breast cancer cells. Antican- cancer. Cancer Res 2005;65:483–92. cer Res 2013;33:393–9. 43. Gevry N, Hardy S, Jacques PE, Laflamme L, Svotelis A, Robert F, et al. 21. Chen J, Lu L, Feng Y, Wang H, Dai L, Li Y, et al. PKD2 mediates multi-drug Histone H2A.Z is essential for estrogen receptor signaling. Genes Dev resistance in breast cancer cells through modulation of P-glycoprotein 2009;23:1522–33. expression. Cancer Lett 2011;300:48–56. 44. Marques M, Laflamme L, Gaudreau L. Estrogen receptor alpha can selec- 22. Huck B, Duss S, Hausser A, Olayioye MA. Elevated protein kinase D3 tively repress dioxin receptor-mediated gene expression by targeting DNA (PKD3) expression supports proliferation of triple-negative breast cancer methylation. Nucleic Acids Res 2013;41:8094–106. cells and contributes to mTORC1-S6K1 pathway activation. J Biol Chem 45. Lavalle CR, Bravo-Altamirano K, Giridhar KV, Chen J, Sharlow E, Lazo JS, 2014;289:3138–47. et al. Novel protein kinase D inhibitors cause potent arrest in prostate 23. Chin YR, Toker A. Akt isoform-specific signaling in breast cancer: uncover- cancer cell growth and motility. BMC Chem Biol 2010;10:5. ing an anti-migratory role for palladin. Cell Adh Migr 2011;5:211–4. 46. Huck B, Kemkemer R, Franz-Wachtel M, Macek B, Hausser A, Olayioye MA. 24. Yoeli-Lerner M, Yiu GK, Rabinovitz I, Erhardt P, Jauliac S, Toker A. Akt GIT1 phosphorylation on serine 46 by PKD3 regulates paxillin trafficking blocks breast cancer cell motility and invasion through the transcription and cellular protrusive activity. J Biol Chem 2012;287:34604–13. factor NFAT. Mol Cell 2005;20:539–50. 47. Ochi N, Tanasanvimon S, Matsuo Y, Tong Z, Sung B, Aggarwal BB, et al. 25. Doppler H, Bastea LI, Borges S, Spratley SJ, Pearce SE, Storz P. Protein Protein kinase D1 promotes anchorage-independent growth, invasion, kinase d isoforms differentially modulate cofilin-driven directed cell and angiogenesis by human pancreatic cancer cells. J Cell Physiol migration. PLoS ONE 2014;9:e98090. 2011;226:1074–81. 26. Liou GY, Doppler H, Necela B, Krishna M, Crawford HC, Raimondo M, 48. Rozengurt E. Protein kinase D signaling: multiple biological functions in et al. Macrophage-secreted cytokines drive pancreatic acinar-to-ductal health and disease. Physiology. (Bethesda) 2011;26:23–33. metaplasia through NF-kappaB and MMPs. J Cell Biol 2013;202:563–77. 49. Borges S, Storz P. Protein kinase D isoforms: new targets for therapy in 27. Kupershmidt I, Su QJ, Grewal A, Sundaresh S, Halperin I, Flynn J, et al. invasive breast cancers? Expert Rev Anticancer Ther 2013;13:895–8. Ontology-based meta-analysis of global collections of high-throughput 50. Ottaviano YL, Issa JP, Parl FF, Smith HS, Baylin SB, Davidson NE. Meth- public data. PLoS ONE 2010;5:e13066. ylation of the estrogen receptor gene CpG island marks loss of estrogen 28. Gyorffy B, Lanczky A, Eklund AC, Denkert C, Budczies J, Li Q, et al. An receptor expression in human breast cancer cells. Cancer Res 1994;54: online survival analysis tool to rapidly assess the effect of 22,277 genes on 2552–5.

1316 Mol Cancer Ther; 14(6) June 2015 Molecular Cancer Therapeutics

Effective Targeting of Estrogen Receptor−Negative Breast Cancers with the Protein Kinase D Inhibitor CRT0066101

Sahra Borges, Edith A. Perez, E. Aubrey Thompson, et al.

Mol Cancer Ther 2015;14:1306-1316. Published OnlineFirst April 7, 2015.

Updated version Access the most recent version of this article at: doi:10.1158/1535-7163.MCT-14-0945

Supplementary Access the most recent supplemental material at: Material http://mct.aacrjournals.org/content/suppl/2015/04/07/1535-7163.MCT-14-0945.DC1

Cited articles This article cites 50 articles, 22 of which you can access for free at: http://mct.aacrjournals.org/content/14/6/1306.full#ref-list-1

Citing articles This article has been cited by 4 HighWire-hosted articles. Access the articles at: http://mct.aacrjournals.org/content/14/6/1306.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mct.aacrjournals.org/content/14/6/1306. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.