MICRORNA CONTROL OF NEURAL PROGENITOR MAINTENANCE AND

SPECIFICATION

by

LAURA IOANA HUDISH

B.S., University of Denver, 2008

A thesis submitted to the

Faculty of the Graduate School of the

University of Colorado in partial fulfillment

of the requirements for the degree of

Doctor of Philosophy

Molecular Biology Program

2016

This thesis for the Doctor of Philosophy degree by

Laura Ioana Hudish

has been approved for the

Molecular Biology Program

by

Kristin Artinger, Chair

Bruce Appel, Advisor

Thomas Evans

Wendy Macklin

Lee Niswander

Date: 05-20-2016

i Hudish, Laura Ioana (Ph.D., Molecular Biology) microRNA Control of Neural Progenitor Maintenance and Specification

Thesis directed by Professor Bruce Appel

ABSTRACT

During neural development, progenitors both divide to expand the neural progenitor (NP) population and differentiate as neurons and glia. This balance of proliferation and differentiation is crucial to the proper development of the central nervous system (CNS).

This balance appears to be regulated by multiple different mechanisms including apico- basal polarization by Partitioning defective proteins (Par) as well as Hedgehog signaling, which in addition to its role in dorso-ventral patterning also promotes progenitor proliferation. How both of these pathways are modulated at the end of neurogenesis remains poorly understood. Using bioinformatics we identified the polarity genes pard3 and prkci as candidate targets for microRNA-219 (miR-219). miR-219-deficient zebrafish embryos have a deficit of oligodendrocytes, the myelinating glial cells of the CNS.

Because a disruption in polarity could affect the types of cell divisions that NPs undergo, thus altering the balance of cell types that arise, we hypothesized that neural precursor maintenance is regulated by modulation of polarity cues through miR-219. We found that miR-219 inhibited expression of pard3 and prkci mRNAs via target sites in the 3’ untranslated region. These data support the role of miR-219 in downregulating expression of Par polarity proteins at the end of neurogenesis. In addition, we also found that Sonic

Hedgehog (Shh) signaling was significantly increased in miR-219 morphants, suggesting a role for miR-219 in regulating the levels of Shh. Using prkci mutant zebrafish embryos we found that reduction of apical Par proteins results in a reduction of Shh signaling.

ii These data provide evidence for a new mechanism of NP regulation, in which miR-219 downregulates apical Par proteins and Shh at the end of neurogenesis.

The form and content of this abstract are approved. I recommend its publication.

Approved: Bruce Appel

iii ACKNOWLEDGEMENTS

I dedicate this thesis to the many people that were a part of this experience and helped me throughout this process. I’d like to thank Dr. Bruce Appel, my mentor. He really encompasses the true meaning of what a mentor is. He taught me not only how to be a better researcher, but how to be a good member of the research community, how to identify good questions and how to push through moments that seemed overwhelming.

He leads by his example of hard work, resilience and creativity and I couldn’t be more thankful for all that he has taught me. Thank you to my committee, Kristin Artinger, Lee

Niswander, Thomas Evans, Wendy Macklin and James DeGregori, who always supported me and pushed me to be better and to think outside the box.

I’d also like to thank my mother, who is an extraordinarily strong, loving and resilient woman who gave up everything to move to the US for my sister and I. I could never thank her enough for all the sacrifices she has made so I could accomplish my dreams. She is a great rock I can always lean on, and one of my biggest supporters. I am truly only here because of everything she taught me. I also want to thank my sister, who always makes me laugh and listens to me. She has also given me the biggest gift, becoming an aunt to my precious and sweet nephew, Owen who always makes the hardest days better with his cute adorable smile. I am also very fortunate to have an amazing and supportive husband who is always ready to listen and help. He is also responsible for introducing me to many fun adventures. I wouldn’t be nearly as balanced and happy if he wasn’t a part of my life.

Thank you!

iv TABLE OF CONTENTS

CHAPTER

I. INTRODUCTION ...... 1

The neural Epithelium and Neural Progenitor Behaviors ...... 2

Sonic Hedgehog Signaling in the Nervous System ...... 3

The Primary Cilia and Hedgehog Signaling ...... 6

Apico-basal Polarity and the Role of Par complex Proteins ...... 9

The Polarization of the Epithelium ...... 10

Polarity and Neural Development ...... 11

Polarity and Primary Cilia Formation ...... 13

Discovery and Function of microRNAs ...... 14

microRNAs in Neural Development ...... 17

Conclusions ...... 18

II. MIR-219 REGULATES NEURAL PRECURSOR DIFFERENTIATION BY DIRECT INHIBITION OF APICAL PAR POLARITY PROTEINS ...... 20

Abstract ...... 20

Introduction ...... 21

Materials and Methods ...... 24

Zebrafish Husbandry ...... 24

Immunohistochemistry ...... 24

In situ RNA Hybridization ...... 25

Luciferase Assay ...... 26

Morpholino Injections ...... 26

BrdU and EdU Labeling ...... 27

v GFP Injections and Quantification ...... 27

Tg(hsp70l:pard3-EGFP) construction and Heat Shock Procedure ...... 28

Quantitative PCR ...... 28

Quantification and Statistical Analysis ...... 29

Results ...... 29

miR-219 Promotes Neural Precursor Exit from Proliferative Division ...... 29

miR-219 Regulates pard3 and prkci via 3’ UTR Target Sites ...... 39

Discussion ...... 46

III. MIR-219 INITIATES NEURAL PROGENITOR DIFFERENTIATION BY DAMPENING APICAL PAR PROTEIN-DEPENDENT HEDGEHOG SIGNALING ...... 54

Abstract ...... 54

Introduction ...... 55

Materials and Methods ...... 57

Zebrafish Husbandry ...... 57

Immunohistochemistry ...... 58

In situ RNA Hybridization ...... 58

Morpholino Injections ...... 59

Plasmid injections and construction ...... 59

EdU Labeling ...... 60

Heat Shock Procedure ...... 60

Quantitative PCR ...... 61

Quantification and Statistical Analysis ...... 61

Cilia Rate Formation Measurement in vivo ...... 61

vi Results ...... 62

miR-219 Dampens Hedgehog Signaling ...... 62

miR-219 Promotes Neural Progenitor Differentiation by Reducing Hedgehog Signaling ...... 63

Apical Par Proteins Mediate the Effects of miR-219 Function on Hedgehog Signaling ...... 69

Apical Par Proteins Regulate Ciliogenesis ...... 73

Discussion ...... 77

IV. CONCLUSIONS AND FUTURE DIRECTIONS ...... 82

Conclusions ...... 82

Discussion ...... 84

Future Directions ...... 91

REFERENCES ...... 96

APPENDIX

A. Unpublished Data ...... 112

B. Microarray Data ...... 115

vii LIST OF FIGURES

FIGURE

1.1 Spinal Cord Patterning ...... 4

1.2 Primary Cilium and Sonic Hedgehog Signaling ...... 8

1.3 MicroRNA Biogenesis Pathway ...... 16

1.4 Model ...... 19

2.1 Loss of Apical Polarity Correlates With Loss of Neural Precursors and Lumen Morphogenesis ...... 30

2.2 miR-219 Expression Across Developmental Stages Morphogenesis ...... 33

2.3 miR-219 Knockdown Causes Retention of Embryonic Spinal Cord Precursors into Postembryonic Stage ...... 35

2.4 miR-219 is Required for Differentiation of Glia and Late-born Neurons ...... 38

2.5 miR-219 has Single, Conserved Target Sites within prkci and pard3 3’ UTRs ...... 41

2.6 . mir-219 Regulates Reporter Gene Expression In Vivo via pard3 and prkci 3’ UTR Sequences ...... 43

2.7 pard3 and prkci are Functionally Relevant miR-219 Targets ...... 45

2.8 Blocking miR-219 access to pard3 or prkci 3’UTRs phenocopies miR-219 loss of function ...... 49

2.9 Pard3-EGFP Overexpression Phenocopies miR-219 Loss of Function ...... 52

2.10 Proposed model for the role of miR-219 in the transition of neural precursors from proliferative self-renewing divisions to differentiative ones ...... 53

3.1 miR-219 Reduction Causes Persistent Hedgehog Signaling ...... 64

3.2 miR-219 Mediated Neural Progenitor Maintenance Requires Hedgehog Signaling .... 67

3.3 Sonic Hedgehog Overexpression Phenocopies Loss of miR-219 Function ...... 70

3.4 Apical Par Proteins Mediate the Effects of miR-219 Function on Hedgehog Signaling ...... 72

viii 3.5 Apical Par Proteins Regulate Ciliogenesis ...... 75

3.6 Cilia Mutants Exhibit Normal Numbers of Neural Progenitors ...... 78

4.1 Model depicting Notch and Shh interaction to control neural progenitor differentiation and maintenance...... 89

ix

CHAPTER I

VERTEBRATE NEURAL DEVELOPMENT: PATHWAYS AND MOLECULES

Abstract

The development of the central nervous system from a highly polarized neuroepithelium is a complex process that involves a series of interdependent signals and molecules. This chapter focuses on the relationship between intrinsic and extrinsic factors that together influence the cell fate decisions of neural progenitors. An overview of molecules involved in dorsoventral patterning is given and their relation to neural progenitor cell fate decisions. Additionally, the role of apicobasal polarity in the neural epithelium and the key components of these pathways are discussed. The details of asymmetric inheritance of polarity factors during neural progenitor mitosis are examined in various organisms, with highlights of the similarities and differences observed. Additionally, this chapter establishes a connection between two main developmental pathways, apicobasal polarity and Sonic Hedgehog (Shh). Furthermore, there is a lot unknown about the role of primary cilia in Shh signaling, as well as how cilia formation is regulated. In this chapter

I discuss the connection between apicobasal polarity and primary cilia formation as well as how cilia might affect Shh signaling and subsequently influence cell fate decisions.

Lastly, microRNA mediated gene expression and the microRNA biosynthesis pathway is introduced, as well as the known roles of microRNAs in neural development.

1

Neural Epithelium and Neural Progenitor Behaviors

The central nervous system (CNS) is considered one of the most complex organ systems, controlling most of the critical functions of the body. The CNS comprises a vast array of neuronal and glial cell types that must be generated at the right time and place for proper development and function. The vertebrate nervous system develops from a single epithelial cell layer, the neuroepithelium, composed of multipotent neuroepithelial progenitors (NPs). These cells can undergo symmetric proliferative divisions initially to give rise to more NPs, asymmetric divisions to give rise to one differentiated daughter cell and one neuroepithelial cell, and symmetric differentiative to give rise to two differentiated daughter cells. The interplay between these types of divisions and their timing is thought to be the primary mechanism by which a variety of neuronal and glial cell types arise. The balance between proliferation and differentiation is crucial to the formation of the right amount of cells. If NPs exit the cell cycle too early, not enough early born neurons arise; however, if they remain in the cell cycle too long, oncogenesis can occur. Some of the cellular mechanisms involved in maintaining this balance are cell polarity, cell cycle length, cleavage plane orientation and interkinetic nuclear migration

(reviewed in (Götz and Huttner 2005)). In addition to cell biological-dependent mechanisms, signaling pathways and gene networks are required for proper neural cell fate establishment. In recent years there has been a lot of progress made in determining the molecules responsible for the patterning of the neural tube on the anterior-posterior axis, as well as the dorsal-ventral axis. The general model that emerged from many studies indicates that the position of a neural progenitor within the neural epithelium will dictate what signaling molecules and at what levels it will be subjected to, which will

2

ultimately affect gene expression and specification of cell fate (reviewed in (Le Dréau and Martí 2012; Jessell 2000)).

Various molecules have been identified as determinants on the dorsal-ventral axis and their expression patterns help to distinguish 11 domains of neural progenitors within the spinal cord (Figure 1.1A-patterning). Induction and maintenance of expression of these determinants is dependent on two main molecules secreted from the ventral pole and the dorsal pole of the neural tube. Cells in the most ventral domain, p3 and floor plate, express and secrete Sonic Hedgehog (Shh) after induction by the notochord, which is the initial Shh source. The roof plate cells (RP) in the dorsal neural tube express and secrete Bone morphogenetic protein (BMP) and Wingless-type MMTV integration site

(Wnt) pathway molecules. The interplay between the perceived levels of these morphogens by cells of the spinal cord triggers a specific expression pattern of transcription factors and thus confers a specific fate (Figure 1.1B-TFs and Shh and BMP)

(reviewed in (Le Dréau and Martí 2012; Jessell 2000)). The discovery of these molecules was a crucial step in understanding the mechanisms that determine the fate of a cell within the neuroepithelium. In this thesis I will focus on the specification of cells in the ventral spinal cord, for which Hh signaling is critical.

Sonic Hedgehog Signaling in the Nervous System

Studies in both vertebrate and invertebrate organisms provide evidence for the canonical

Hedgehog (Hh) pathway where the (Hh) ligand binds to surface receptor Patched (Ptch).

In the absence of ligand, receptor Ptch inhibits the downstream effector of the pathway,

Smoothened (Smo). Additionally, the transcription factor Gli3 undergoes proteolysis to get converted into its repressive form, Gli3R, thus maintaining the pathway in its “off”

3

Figure 1.1. Spinal Cord Patterning Transverse section through the developing spinal cord illustrating the ventral and dorsal neural precursor domains. A.The most ventral domain is the floor plate (FP). Just dorsal to it the p3 domain, pMN, p2,p1 and p0. In the dorsal spinal cord, the most dorsal domain is the roof plate (RP). dp1-dp6 are the dorsal domains with dp6 in the center of the spinal cord neighboring p0.

4

state (reviewed in (Sasai and Briscoe 2012)). Upon Shh ligand binding to Ptch, it can no longer inhibit Smo, allowing it to modify Gli1/2 transcription factors to their activator form, Gli1/2A. Gli1/2A then travel to the nucleus and bind to their targets (reviewed in

(Sasai and Briscoe 2012)). Gli/Ci are part of a family of zinc-finger transcription factors encoded by one gene in Drosophila, cubitus interruptus (Ci) and in vertebrates by three genes, gli1, gli2 and gli3. In vertebrates, the ligands that are homologous to the

Drosophila hedgehog protein are sonic hedgehog (Shh), indian hedgehog (Ihh) and desert hedgehog (Dhh) of which the first two have been implicated in neural development

(reviewed in (Fuccillo, Joyner, and Fishell 2006)). Expression of Shh by the cells in the ventral spinal and its diffusion establishes a morphogen signaling gradient along the D-V axis that is both necessary and sufficient to induce ventral cell fates. Shh is translated as a

45kD precursor protein that undergoes autocatalytic cleavage that removes the C- terminus, resulting in the mature 22kD protein which gets secreted (reviewed in (Ho and

Scott 2002)). Shh diffuses within the ventral spinal cord and binds to its receptor Ptch1, triggering the modification of Gli transcription factors and their subsequent movement into the nucleus and activation of their target genes. This cascade of events is critical for neural cell fate specification, and misregulation of this pathway has been shown to have direct effects on gene expression and neuronal patterning (reviewed in (Le Dréau and

Martí 2012)). The ability of neural progenitors to perceive and transduce the right amount of Shh signal, and then to down-regulate it is imperative to them achieving their final fate. The mechanistic details of how all of these steps occur and how they are regulated are still poorly understood.

A significant unanswered question in the field that still remains is how Shh travels

5

throughout the spinal cord from the producing cells to the receiving ones and how the morphogen gradient is achieved. Initial reports suggested a free diffusion model, however this has been recently disputed. However controversial this topic still remains, one crucial discovery that helped to better understand this pathway was the observation that reception of Shh ligand occurs on the apical membrane of neuroepithelial cells. Specifically, the localization of receptors to the primary cilium is required for signal perception. The first connection between cilia and Shh signaling in vertebrates was identified through a forward genetic screen. Mutants that exhibited defects in primary cilia formation also lacked ventral cell types (Huangfu et al. 2003).

The Primary Cilia and Hedgehog Signaling

The primary cilium is a hair-like structure found on the apical membranes of most cells (reviewed in (Drummond 2012) and (Sasai and Briscoe 2012)). After many years of being ignored, the cilium has emerged as a critical organelle implicated in many biological processes. There are two types of cilia, motile and primary. Similar to flagella found on sperm, motile cilia function in the movement of fluids across a cell, and are implicated in establishment of organ asymmetry and the directional flow of mucous and cerebrospinal fluid. Primary cilia act as antenna and play key roles in signaling and are often distinguished from motile cilia by a unique cytoskeletal architecture (reviewed in

(Ishikawa and Marshall 2011)). Both types of cilia have a microtubule-based core structure called an axoneme, but the mobile cilia have an additional pair of microtubules in the center that are missing from the primary cilia. The basal body of the cilia is formed either from pre-existing centrioles or de novo, and it migrates to the apical membrane where it establishes the location of the cilium. Another important feature of the cilia is the

6

transition zone, which is located between the basal body and the cilia body. This is an area where control of molecules entering and exiting the cilia is taking place. Even though there is a very tight association between the plasma membrane and the ciliary membrane, the contents of the cell body and the cilia are different (reviewed in (Ishikawa and Marshall 2011)). Transport of molecules within the cilia is mediated by intraflagellar transport proteins (IFTs). IFT motors are unidirectional, with Kinesin 2 responsible for anterograde transport toward the tip of the cilia and Dynein 2 for retrograde transport of molecules back towards the cell body. Defects in many of the IFT proteins have been discovered in a large variety of disorders termed ciliopathies. Defects in Shh signaling have been also been reported in many of these disorders highlighting the importance of the primary cilia for proper Shh signaling (Fliegauf, Benzing, and Omran 2007).

In vertebrates, most of the Shh signaling pathway components have been shown to localize to the primary cilia. In the absence of ligand, the receptor Ptch1 localizes to the ciliary membrane and inhibits the downstream effector of the pathway, Smo, from accumulating in the cilia (Rohatgi, Milenkovic, and Scott 2007). In addition, Gli3 transcription factor undergoes proteolysis and gets converted to the repressor form

(Gli3R), keeping the pathway in the “off” state. When Shh binds to Ptch1, Smo inhibition is released, allowing Smo to accumulate in the cilium. This also prevents processing of

Gli3R and allows for the formation of Gli2/3 activator complex (GliA). GliA travels to the nucleus and activates target genes (reviewed in (Pal and Mukhopadhyay 2014)).

7

Figure 1.2 Primary Cilium and Shh Signaling Upon Shh ligand binding to receptor Patched, Smoothened moves into the cilia and allows for the transcription factor Gli to move out of the cilia and travel to the nucleus where it binds its targets.

8

Defects in cilia formation and length have been associated to mutations in intraflagellar

(IFT) proteins as well as motor proteins such as Dynein (reviewed in Fliegauf et al 2007).

These mutations result in shortened cilia and consequently affect Hh signaling and body patterning (Rana et al., 2004; Huangfu and Anderson, 2005; May et al., 2005). IFT88 and

IFT172 mutant mouse embryos lack Hh signaling (Huangfu et al. 2003) and zebrafish

IFT88 and IFT172 mutants exhibit dampened Hh signaling (Huang and Schier 2009a),

(Lunt, Haynes, and Perkins 2009) highlighting the importance of cilia for Hh signaling in vertebrates. The discovery of the important roles of cilia for development and disease prompted the need to better understand the mechanisms important for proper cilia formation and maintenance.

Apico-basal Polarity and the Role of Par Complex Proteins

Primary cilia are located on the apical membrane of vertebrate cells. Associated with apical the membrane are a variety of proteins complexes, including the Partitioning defective (Par) complex. Par protein genes were discovered in 1988 by Kemphues and colleagues while performing an unbiased screen in C. elegans embryos. They described four genes, par-1, par-2, par-3 and par-4 required for proper cleavage and appropriate timing of cleavage and found that par mutants have abnormal localization of their mitotic spindle and partitioning of P granules. After the initial characterization of these mutants the authors proposed that the par genes are most likely required for intracellular localization in the early embryo (K. J. Kemphues et al. 1988). After cloning all six genes between 1994 and 2002, it was apparent that they were part of a novel signaling pathway.

Based on sequence analysis they found that PAR-1 and PAR-4 encode serine threonine kinases. PAR-5 is a member of the 14-3-3 family of proteins. PAR-3 and PAR-6 have

9

PDZ protein-protein interaction domains and PAR-2 has a RING finger domain

(reviewed in (K. Kemphues 2000) and (Goldstein and Macara 2007). It became apparent that PAR proteins are enriched at the cell cortex and that they form distinct asymmetric domains such that PAR-3 and PAR-6 localize at the anterior of the one cell C. elegans embryo, while PAR-1 and PAR-2 are found strictly at the posterior pole of the cell. PAR-

4 and PAR-5 did not have an asymmetric distribution (K. Kemphues 2000). By early

2000s homologues of the par genes were described in mammals where they were found to be critical in epithelial cell polarization (reviewed in (Goldstein and Macara 2007)).

The Polarization of the Epithelium

The epithelium is one of the four main types of animal tissue composed of polarized cells that line the body’s organs and glands. Epithelial cells often act as barriers and perform various functions including assimilation of nutrients, protection against pathogens and toxins and hormone secretion. Failure of epithelial cells to appropriately polarize therefore leads to a variety of diseases, including certain metastatic cancers (McConkey et al., 2009; Wilson, 1997). The current model of PAR complex-dependent initiation of epithelial cell polarity proposes that Par3 is localized to sites of contact between neighboring cells prior to polarization, and that the binding of active cell division control protein 42 homolog (Cdc42) to the pre-formed Par6/aPKC complex results in the activation of the Par3/Par6/aPKC complex (Qiu, Abo, and Steven Martin 2000; Tabuse et al. 1998) at the site of the forming apical plasma membrane domain. At this site, the PAR complex marks the apical domain of the cell and results in the formation of the tight junctions, and thereby the separation of apical and basolateral domain-initiating factors.

10

Polarity and Neural Development

During early Drosophila development, Bazooka (the fly homolog of Par-3), Par-6 and aPKC, localize to the apical membrane and help determine the neuroblast fate (reviewed in Prehoda 2009). Neuroblasts divide asymmetrically to produce two different daughter cell types, a self-renewed neuroblast, which remains apical, and a ganglion mother cell

(GMC), which is located basally. The plane of division is parallel to the neuroepithelium from which the neuroblast delaminates before it divides and the cell that is closer to it remains as the neuroblast, whereas the cell that looses contact with the neuroepithelium becomes the GMC. Using the powerful tools that Drosophila imaging and genetics, many of the cell fate determinants have been identified, along with the role of Par proteins in localizing these factors to the appropriate cellular domains. For example, the apical Par complex colocalizes with the neuroblast specific protein Inscuteable (Insc) during mitosis and recruits Partner of Inscuteable (Pins) and the G protein subunit Gαi (reviewed in (Yu et al. 2006) and (Goldstein and Macara 2007)). Another important feature of neuroblast division is that the plane of division always correlates with the type of division, such that a parallel plane results in an asymmetric division while a perpendicular plane results in a symmetric division. The Pins/ Gαi complex has been shown to be important in the spindle orientation during this process by binding to the microtubules and the dynein binding protein Mud (NuMA in mammals) (reviewed in (Atwood and Prehoda 2009)).

Early studies using confocal microscopy and live imaging showed that there is a correlation between the angle of division of mammalian neural progenitors and their fate.

At E29 in ferret brains (early in neurogenesis) 28 of 40 cells has cleavage planes of 60°-

90° and were classified as symmetric, 18% divided with horizontal cleavage plane 0° and

11

were asymmetric, and the remaining 5 of 40 cells divided at intermediate angles and some were symmetric and others asymmetric (Chenn and McConnell 1995). This study also reports an increase of horizontal divisions of approximately 50% during the course of development in correlation to an increase in neurogenesis (Chenn and McConnell

1995) however this is in contrast to previous studies using chick and mouse tissue in which horizontal plus intermediate cleavage planes only amounted to about 20% and no significant changes were observed in cleavage plane orientation (W B Huttner and Brand

1997). The observation of the low numbers of horizontal divisions in the mammalian cortex lead to the hypothesis put forth by Huttner et al in 1997 that vertical divisions could contribute to either symmetric or asymmetric divisions. This was postulated to occur due to the elongated shape of the neuroepithelial (NE) cells in which the apical membrane would only represent a small fraction of the total plasma membrane so that a vertical plane of division could still result in asymmetric inheritance of the apical plasma membrane by only one of the daughter cells (W B Huttner and Brand 1997). This was one of the first observations that the mammalian cortex, even though it uses the same conserved factors for cell fate determination, doesn’t completely reproduce the

Drosophila NB division strategies. This finding was the first to highlight the complexities of the vertebrate nervous system and the need for further investigation into the mechanism important for cell fate decisions and inheritance of determinants during cellular divisions.

Huttner followed up on their 1997 hypothesis and in 2004 published their data supporting the fact that in the mammalian central nervous system, cleavage plane orientation in not sufficient to predict whether a division will be symmetric or

12

asymmetric. They reported that at any stage they looked (E9.5-E14.5) and in any region of the brain (forebrain, midbrain or hindbrain) approximately 30% of vertical divisions resulted in an unequal distribution of the apical membrane and that this asymmetric inheritance is important for cell fate decisions such that the neuronal daughter didn’t inherit the apical membrane (Kosodo et al. 2004). This finding supports the hypothesis that the angle of the cleavage plane in mammalian NEs is an insufficient parameter for determining cell fate. A similar finding was reported in zebrafish neural precursor divisions where asymmetric inheritance of the apical footprint was possible both when a cleavage plane was perpendicular to the apical surface as well as when it was oblique or close to parallel (Alexandre et al. 2010). However, the correlation between the inheritance of the apical polarity protein Par-3 and cell fate was opposite in the two reports. In the mammalian cortex, the daughter that inherited more of apical membrane and Par-3 remained a precursor (Kosodo et al. 2004), whereas in the zebrafish neural tube, the daughter that asymmetrically inherited more Par-3 became a neuron (Alexandre et al. 2010). These contradictory findings point to the complexity of neural development and the use of the same proteins for different functions in different contexts. The basis of these contradictory results has not yet been elucidated. However, regardless of how exactly apical Par proteins might influence cell fate, what remains clear from this data is that their levels are critical and therefore must be highly regulated.

Polarity and Primary Cilia Formation

In addition to their role in establishing apico-basal polarity, apical Par proteins have recently been found to localize in the primary cilia of cultured cells (Fan et al. 2004) and to play a key role in the ability of a cell to build a proper primary cilia (Sfakianos et al.

13

2007). Stable reduction of Par3 in MDCK cells resulted in the generation of short cilia, but were unable to form elongated cilia (Sfakianos et al. 2007). Recent evidence shows that Pard3 is also necessary for cilia formation in zebrafish photoreceptors. Reduction of

Pard3 in zebrafish embryos results in very short cilia in photoreceptor cells (B.L.Krock et al 2014). These data highlight the importance of the apical proteins in cilia formation in vertebrates and raise the possibility that apical Par proteins impacts cell fate decisions by affecting primary cilia formation and downstream Shh signaling.

A significant unanswered question in the field that still remained was how apical

Par proteins are downregulated at the end of neurogenesis in order for neuroepithelial cells to exit the cell cycle and to differentiate into neurons and glia. Chapter II of this thesis provides a novel microRNA-mediated mechanism for Pard3 and Prkci downregulation in zebrafish neural tube.

Discovery and Function of microRNAs microRNAs (miRNAs) are a class of small non-coding RNA molecules generally found to negatively regulate synthesis of protein coding gene transcripts. Lin-4 was the first microRNA that was discovered in C. elegans in 1993 (R. C. Lee, Feinbaum, and Ambros

1993) and (Wightman, Ha, and Ruvkun 1993)). After a seven-year gap, B J Reinhart and colleagues described the second miRNA, let-7 (Reinhart et al. 2000). Both miRNAs are part of the heterochronic gene pathway in C. elegans and both are crucial for embryonic development. Within the last 15 years thousands of miRNAs have been reported in humans and other species with roles both during development as well as disease

(reviewed in (Almeida, Reis, and Calin 2011), (He and Hannon 2004)).

14

miRNAs are encoded by long primary transcripts called pri-miRNAs that are capped and poly-adenylated. miRNA transcription is performed by RNA Pol II. The pri- miRNA transcript is further processed by the nuclear RNase III Drosha, which crops the long pri-miRNA into a small hairpin RNA structure of 65bp called pre-miRNA. The pre- miRNA is transported out of the nucleus by the transport protein Exportin 5 (Exp5) which forms a complex with GTP binding protein RAN-GTP. Together they bind the pre- miRNA and help translocate it into the cytosol. There, GTP is hydrolysed leading to the disassembly of the complex and the release the pre-miRNA. In the cytosol, Dicer cleaves the pre-miRNA near the terminal loop and releases a small RNA duplex. This RNA duplex is further loaded onto the Argonaute (Ago) protein to form the RNA-induced silencing complex (RISC complex). The Ago protein determines which one of the strands will be the guide and it generally chooses the one that has a U in the 1st nucleotide position. The other strand is released and quickly degraded. The mature RISC complex with the guide miRNA is now able to bind to its targets and modulate their expression levels (reviewed in M. Ha and N. Kim 2014) (Figure 1.3).

miRNAs bind their targets based on complementary sequences but only a small portion of the 20-25bp long molecule physically binds, called the seed sequence. The binding can also contain loops making miRNAs capable of binding to hundreds of targets and affecting protein synthesis either through inhibition of translation or mRNA degradation. However the relative contribution of either mechanism remained unknown until 2010 when Guo et. al found that most inhibition of translation was not predominant and that most miRNA binding resulted in degradation of the target mRNA

15

Transcription Pri-microRNA By RNA Pol II

Microprocessing By Drosha/DGCR8

Pre-microRNA

Exportin 5

Pre-microRNA

Processing by Dicer

RISC

mRNA mRNA Translational deadenylation Target cleavage repression

Figure 1.3 MicroRNA Biogenesis Pathway microRNAs are transcribed by RNA Pol II to produce the pri-microRNAs (pri-miRNA) which get processed by Drosha/DGCR8 complex to produce the pre-microRNA (pre- miRNA). These molecules are transported into the cytoplasm by Exportin 5 where they undergo further processing by Dicer. The guide strand (orange) is selected and loaded into the RISC complex, while the passenger strand (blue) gets quickly degraded. The loaded RISC complex than binds to target mRNAs.

16

(Guo et al. 2010). In the past decade microRNAs have been found to be critical to every aspect of development and disease.

microRNAs in Neural Development miRNAs have been described to play important roles in virtually all biological processes, including neural development (reviewed in (Olde Loohuis et al. 2012),(Kawahara, Imai, and Okano 2012),(Lau et al. 2008)). For example, a highly studied miRNA involved in neurogenesis is miR-9, which is important for NSC proliferation and differentiation

(Bonev, Pisco, and Papalopulu 2011; Coolen et al. 2012; Shibata et al. 2011; Tan et al.

2012; Zhang et al. 2008; C. Zhao et al. 2009). miR-137 has been shown to inhibit proliferation and promote differentiation of NSC (Silber et al. 2008; Smrt et al. 2010).

Let-7, miR-184, miR-124 and many more have been described in a comprehensive review by Lang and Shi (Lang and Shi 2012) highlighting the diverse and critical roles of these small molecules in neural development.

miR-219 is highly conserved and specifically expressed in the CNS and it was recently described in mammals to play critical roles in oligodendrocyte precursor cell

(OPC) development, the myelinating glia of the CNS (Dugas et al. 2010; X. Zhao et al.

2010). miR-219 targets oligodendrocytes (OL) development inhibitors such as PDGFRα,

Sox6 and Hes5 and inhibition of miR-219 results in a decrease of OL maturation (Dugas et al. 2010; X. Zhao et al. 2010). Additionally, miR-219 was also one of the most significantly downregulated microRNAs in human medulloblastoma samples (Ferretti et al. 2009) highlighting the importance of this specific miRNA in neural development. Our studies indicate that miR-219 can directly downregulate apical polarity proteins Pard3

17

and Prkci in the developing zebrafish spinal cord (this will be discussed in detail in

Chapter II).

The role of microRNAs in the regulation of apical Par proteins and the subsequent affect of Par proteins on cilia formation and Hh signaling discussed in the chapter above are of great importance and will serve to further our understanding of the intricate connections between developmental pathways of the CNS and potentially other major organs in which polarity plays a crucial role.

Conclusions

The CNS is crucial for most of the basic functions of the body. During CNS development, the interplay between various pathways and molecules plays an important role in achieving the variety of cell types necessary to build a proper CNS. In the next two chapters I will provide evidence that the levels of apical Par proteins can affect primary cilia formation and downstream Shh signaling. In the second chapter I will discuss how miR-219 can downregulate apical Par proteins allowing cells to exit the cell cycle and differentiate. In the third chapter I will discuss the possibility that asymmetric inheritance of apical Par proteins can contribute to the cell fate decisions by affecting ciliogenesis rates and therefore downstream Shh signaling. I propose a model by which the daughter cell that inherits more apical Par proteins builds a primary cilia faster and therefore can respond to higher levels of Shh signaling and undergoes self-renewing divisions, while the daughter that inherits less apical Par proteins, builds a smaller primary cilia and can only respond to lower levels of Shh, exiting the cell cycle to differentiate into neurons and glia (Figure 1.4).

18

Figure 1.4 Model Polarized neural progenitor cells (NPs) display a primary cilia on the apical membrane. Associated with the apical membranes are apical Par protein complexes. As the NP enters the cell cycle it retracts its cilia and divides. After division cells reform their cilia and can respond to Shh signaling. The rate of cilia formation depends on the level of apical Par protein inheritance, which subsequently affects the cell fate decision. Cells that inherit more apical Par proteins and form a long cilia remain NP and the cells with less Par proteins and short cilia differentiate into neurons and glia.

19

CHAPTER II

MIR-219 REGULATES NEURAL PRECURSOR DIFFERENTIATION BY

DIRECT INHIBITION OF APICAL PAR POLARITY PROTEINS1

Abstract

Asymmetric self-renewing division of neural precursors is essential for brain development. Partition defective (Par) proteins promote self-renewal, and their asymmetric distribution provides a mechanism for asymmetric division. Near the end of neural development, most asymmetric division ends and precursors differentiate. This correlates with Par protein disappearance, but mechanisms that cause downregulation are unknown. MicroRNAs can promote precursor differentiation, but have not been linked to

Par protein regulation. We tested a hypothesis that microRNA miR-219 promotes precursor differentiation by inhibiting Par proteins. Neural precursors in zebrafish larvae lacking miR-219 function retained apical proteins, remained in the cell cycle and failed to differentiate. miR-219 inhibited expression via target sites within the 3’ untranslated sequence of pard3 and prkci mRNAs, which encode Par proteins, and blocking miR-219 access to these sites phenocopied loss of miR-219 function. We propose that negative regulation of Par protein expression by miR-219 promotes cell cycle exit and differentiation.

1 This chapter is based on our previously published article (Hudish, Blasky, and Appel 2013) DOI 10.1016/j.devcel.2013.10.015

20

Introduction

Following neural induction in vertebrate embryos, neural precursor cells initially divide symmetrically to expand the precursor population. After a period of tissue growth, many precursors switch to asymmetric division, producing both new precursors to maintain the population and cells that differentiate as neurons or glial cells, either directly or after a limited number of transit-amplifying divisions. Near the end of embryogenesis, most precursors exit the cell cycle and differentiate, although some may become quiescent or be maintained into adulthood as stem cells. A balance of symmetric proliferative divisions, asymmetric self-renewing divisions and terminal differentiation assures production of appropriate numbers of neural cells to build a functional brain (reviewed in

(Gönczy 2008; Wieland B Huttner and Kosodo 2005)). Mechanisms that maintain that balance remain incompletely understood.

One mechanism that clearly contributes to neural precursor maintenance and differentiation involves neuroepithelial polarity (reviewed in (Fietz and Huttner 2011;

Götz and Huttner 2005; Shitamukai and Matsuzaki 2012)). After closure of the neural tube, apical membranes of neural precursors line a lumen, which subsequently forms the ventricles and central canal of the central nervous system. Associated with the apical membrane are various protein complexes, including one consisting of the Partitioning defective (Par) proteins Pard3, Pard6 and Prcki, also known as atypical Protein Kinase C

(aPKC). Experiments performed in Drosophila provide strong evidence that unequal distribution of apical Par proteins during neural precursor division determines the fate of the progeny cells. In particular, cells that inherit apical Par proteins remain as precursors

21

whereas those that do not enter a differentiation pathway (Prehoda 2009). Data from vertebrate models are generally compatible with the idea that, in asymmetric divisions, high levels of apical Par proteins are associated with neural precursor self-renewal whereas low levels lead to differentiation (Bultje et al. 2009; Costa et al. 2008; Kosodo et al. 2004), although studies performed in zebrafish indicated that Pard3 can inhibit self- renewal and promote differentiation (Alexandre et al. 2010; Dong et al. 2012). The basis for these apparently conflicting conclusions is not known. At the end of embryogenesis, the uniform disappearance of Par proteins from apical membranes of neural precursors correlates with their terminal exit from the cell cycle and differentiation (Costa et al.

2008). Although the mechanistic basis of unequal Par protein distribution to progeny cells undergoing asymmetric self-renewing division has been thoroughly investigated, no mechanism that promotes disappearance of Par proteins from precursors fated to undergo terminal differentiation has been described.

microRNAs (miRNAs) are small noncoding RNAs that in most circumstances inhibit gene expression by mediating degradation or translational inhibition of target mRNAs (reviewed in (Bartel 2009)). miRNAs regulate numerous developmental processes, but identification of authentic miRNA targets and the mechanistic functions that targeting fulfills in vivo remains daunting because most miRNAs potentially bind dozens, if not hundreds, of target mRNAs and many mRNAs have multiple sequences that could be bound by miRNAs (reviewed in (Asuelime and Shi 2012; Bartel 2009)).

Nevertheless, recent data have begun to identify some roles for miRNAs in regulating neural precursor division and differentiation. In particular, several studies using mouse, zebrafish and frog have shown that miR-9 can drive precursors from the cell cycle and

22

promote neuronal differentiation by regulating expression of multiple transcription factors, including Foxg1, Meis2, Gsh2, Hes1, Her6, Zic5 and Hairy1 (Coolen et al. 2012;

Fietz and Huttner 2011; Gönczy 2008; Götz and Huttner 2005; Wieland B Huttner and

Kosodo 2005; Shibata et al. 2011; Shitamukai and Matsuzaki 2012; Tan et al. 2012).

Neuronal differentiation also is driven by miR-9 and let-7b through inhibition of the nuclear receptor TLX (C. Zhao et al. 2009) and by miR-124, which represses expression of the RNA-binding protein PTBP (Makeyev et al. 2007) and the transcription factor

Sox9 (Cheng et al. 2009). Given the large number of miRNAs expressed by neural cells and their multitudes of potential target mRNAs, these advances likely provide only a partial understanding of the mechanisms by which miRNAs regulate neural precursor maintenance and differentiation.

Here we report evidence of a new mechanism of neural precursor regulation by miR-219, an evolutionarily conserved miRNA expressed in zebrafish brain (Kapsimali et al. 2007). We previously noted that knockdown of miR-219 in zebrafish caused a deficit of oligodendrocyte progenitor cells (OPCs) (X. Zhao et al. 2010), raising the possibility that miR-219 promotes formation of glial cells from neural precursors. Target prediction software identified potential miR-219 target sites within the 3’ untranslated (UTR) sequences of Pard3 and Prkci genes in multiple species. Therefore, we hypothesized that miR-219 promotes transition of neural precursors from self-renewal to differentiation by negatively regulating Pard3 and Prkci. Our work now shows that pard3 and prkci mRNAs are functionally relevant targets of miR-219 in zebrafish. Loss of miR-219 function results in prolonged maintenance of apically localized proteins and retention of neural precursors in the cell cycle at the expense of late-born neurons and glial cells,

23

indicating that mir-219 contributes to a microRNA-based mechanism that promotes neural cell differentiation.

Materials and Methods

Zebrafish Husbandry

Embryos were produced by pair-wise mating and kept at 28.5°C in egg water or embryo medium (15 mM NaCl, 0.5 mM KCl, 1 mM CaCl2, 1 mM MgSO4, 0.15 mM

KH2PO4, 0.05 mM NH2PO4, 0.7 mM NaHCO3). Embryos were staged to hours postfertilization (hpf) or days postfertilization (dpf) according to established zebrafish guidelines (Kimmel et al. 1995). The experiments conducted in this study used the following strains of zebrafish: AB, Tg(olig2:EGFP)vu12 (Shin et al. 2003) and

Tg(hsp70l:pard3-EGFP)co14.

Immunohistochemistry

Embryos and larvae were fixed in 4% paraformaldehyde (PFA) overnight at 4°C.

Fixed embryos were embedded in 1.5% agar with 5% sucrose and transferred to a 30% sucrose solution in scintillation vials and incubated at 4°C overnight. The blocks were then frozen and cut into 10-15 µm sections using a cryostat microtome. The sections were incubated with the following primary antibodies: rabbit anti-Sox10 (1:1,000) (Park et al.

2005), rabbit anti-phosphohistone H3 (1:1,000, #06-570, Millipore), mouse anti-BrdU

(1:100, #G3G4, Developmental Studies Hybridoma Bank [DSHB]), rabbit anti-PkC

(1:200, #sc-216, Santa Cruz Biotechnology, Inc.), mouse anti-Islet (1:1,000, clone #

39.4D5, DSHB,) mouse anti–ZO-1 (1:200, #33-9100, Invitrogen), rabbit anti-Sox2

(1:500, # ab997959, Abcam), rabbit anti-GFAP (1:100, #RB-087-A1, NeoMarkers), mouse anti– ZRF-1 (1:500, University of Oregon Monoclonal Antibody Facility). For

24

fluorescent detection of antibody labeling we used Alexafluor 568 and Alexafluor 647 goat anti-mouse and goat anti-rabbit secondary antibodies (1:200, Invitrogen). F-actin was labeled using Rhodamine Phalloidin (1:100, Invitrogen) R-415). To detect EdU incorporation, we incubated the slides in 250 µL of the EdU Detection Reaction mix

(Invitrogen) for 40 minutes at room temperature. Images were collected on a Zeiss Axio

Observer microscope equipped with a PerkinElmer UltraVIEW VoX spinning disk confocal system and Volocity imaging software (PerkinElmer). Images were contrast enhanced using either Volocity or Photoshop (Adobe CS4).

In situ RNA Hybridization

Embryos and larvae were fixed in 4% PFA overnight at 4°C and stored in methanol at -20°C. After linearizing plasmids with the appropriate restriction enzymes, antisense cRNA was transcribed using Roche digoxigenin-labeling reagents and T3, T7, or SP6 RNA polymerases (New England Biolabs). To detect miR-219 expression, we used a dre-miR-219 miRCURY LNA probes consisting of the sequence 5’

AAGAATTGCGTTTGGACAATCA 3’ (Exiqon 35172-01) (Kloosterman et al., 2006)-

CITATION_IS_EMPTY. After processing embryos for in situ RNA hybridization embryos were embedded in agar and sectioned as described above. Sections were rehydrated in 1X PBS for 30 min then covered with 75% glycerol. Images were obtained on a Zeiss Axio Observer microscope equipped with DIC optics, a Retiga Exi color camera and Volocity imaging software. Some images were contrast enhanced using

Photoshop (Adobe CS4).

25

Luciferase Assay

A 220 bp sequence containing the predicted target site was placed in the 3’ UTR of a renilla luciferase reporter gene using the commercially available plasmid, psiCHECK-2 (Promega). This construct and microRNA mimics were co-transfected into

HEK293T cells using Lipofectamine 2000 (Invitrogen) following the vendor’s protocol.

The mimics used were miRIDIAN mimic has-miR-219-5p (5’-

UGAUUGUCCAAACGCAAUUCU-3’) (Thermo Scientific CN-300575-05-0005), and miRIDIAN microRNA mimic negative control #1 list sequence (Thermo Scientific CN-

001000-01-05). Both mimics were stored at -20°C at a 20 µM stock concentration and transfected at 0.08 µM. Luciferase activity was detected using the SpectraMax L

Luminescence microplate reader (Molecular Devices).

Morpholino Injections

Antisense morpholino oligonucleotides were purchased from Gene Tools, LLC.

These included: miR-219 MO (5’-CAAGAATTGCGTTTGGACAATCA-3’) (X. Zhao et al. 2010). pard3 MO1 (5’-TCAAAGGCTCCCGTGCTCTGGTGTC-3’) (Alexandre et al. 2010; Tep et al. 2011), pard3 Target Protector MO (5’-

CTGATTGTCAGAGCATCTCTACTAC-3’), control pard3 Target Protector (TP) MO

(5’-ACAGAGTCAAAGTGACGGACTCC-3’) and prkci TP MO

(AAGCGACCGTCACACACTCCTCCGC). Morpholino oligonucleotides were dissolved in water to create stock solutions of 1 mM and diluted in 2X injection buffer (5 mg ml–1 Phenol red, 40 mM HEPES and 240 mM KCl) to create a working injection concentration of 0.25 mM. All morpholinos were co-injected with 0.09 mM dose of p53

26

MO. We injected 1-2 nl into the yolk just below the single cell of fertilized embryos. All morpholino oligonucleotide injected embryos were raised in embryo medium at 28.5°C.

BrdU and EdU Labeling

Dechorionated embryos were labeled with 5-bromo-2′-deoxyuadine (BrdU)

(Roche) by incubating them in 20 mM BrdU in Embryo Medium (EM) with 10% DMSO at room temperature for 30 min. For labeling with 5-ethynyl-2′-deoxyuridine (EdU), embryos were incubated in 2 mM EdU (Click-iT EdU Alexafluor 555 detection kit,

Invitrogen #c10338) in EM with 10% DMSO for 30 minutes at room temperature. The fish were then fixed in 4% PFA in PBS with 116 mM sucrose and 150 µM CaCl2 at 4°C overnight.

GFP Injections and Quantification

1200 bp pard3 and 800bp prkci UTRs were cloned in a EGFP containing vector, which was used as a template to transcribe mRNA with the EGFP located 5’ of the

UTRs. These mRNAs were injected with or without miR-219 at one cell stage and raised to 30 hpf. Images of 20 embryos per group were collected using a Leica M165 FC microscope equipped with a SPOT RT3 camera and SPOT imaging software (Diagnostic

Instruments Inc.). Embryos were placed in similar positions and images were collected under identical acquisition settings. After collection images were imported into ImageJ software and background readings were sampled from at least 10 images. The threshold was set to be double the background value and pixel intensity was collected in a set region of interest (ROI) of 170 x 33 pixels above the yolk extension. The experiment was performed three times and readings from 60 total embryos per group are reported.

27

Tg(hsp70l:pard3-EGFP) Construction and Heat Shock Procedure

The (hsp70l:pard3-EGFP) plasmid was constructed by first inserting pard3-

EGFP cDNA (Geldmacher-Voss et al. 2003) into the middle entry vector of the Gateway

Recombination Kit (Invitrogen). The resulting vector was recombined with p5e-HSP70I

(Tol2 Kit plasmid #222), p3E-PolyA (Tol2 Kit plasmid #302), and pDestTol2pA2 (Tol2 kit plasmid #394) through a Gateway LR recombination reaction. The (hsp70I:pard3-

GFP) plasmid was co-injected with Tol2 mRNA at 25ng/ul DNA and 25ng /ul RNA into newly fertilized eggs. Injected fish were raised to adulthood and screened for germline transmission. Founder fish were outcrossed to AB fish and F1 embryos were raised to adulthood.

53 hpf Tg(hsp70l:pard3-EGFP) and non-transgenic control embryos were placed in a

15mL conical tube in approximately 10mL of embryo medium and immersed in a 38°C water bath for one hour after which they were allowed to recover at RT for one hour.

Heat shock was repeated 2-3 times before the embryos were placed in a Petri dish and allowed to develop at 32°C overnight. Embryos were fixed at 72 hpf and processed for immunohistochemistry as described above.

Quantitative PCR

RNA was isolated from 15-20 pooled larvae for each control or experimental condition. Samples for each condition were collected in triplicate. Reverse transcription was performed using the TaqMan MicroRNA Reverse Transcription Kit (PN 4366596,

Applied Biosystems). Real time qPCR was performed in triplicate for each cDNA sample using an Applied Biosystems StepOne Plus machine and software version 2.1. TaqMan

28

microRNA Assays were used to detect miR-219 (assay ID 000522) and endogenous control U6 snRNA (assay ID 001973).

Quantification and Statistical Analysis

Cell counts were obtained by direct observation of sections using the microscopes described above. For Sox10, Sox2, PH-3 and Isl quantification, 10 sections per embryo from 15 embryos per group with two or three replicates were counted to produce the average number per section. P values were generated using an unpaired t-test using

GraphPad Prism software. Dorsally migrated OPCs were assessed based on lateral views of Tg(olig2:EGFP) embryos at 3 dpf. olig2:EGFP positive cells were counted over the entire spinal cord. Larvae classified as normal had the number of dorsally migrated OPCs typical of wild type. Larvae were classified as severe if fewer than 5 OPCs had migrated and mild in all other circumstances. P values were generated using an unpaired t-test comparing the number of normal embryos when injected with miR-219 MO alone or miR-

219 together with pard3 MO.

Results miR-219 Promotes Neural Precursor Exit from Proliferative Division

To test the hypothesis that miR-219 promotes neural precursor differentiation, we first set out to better characterize changes in precursor characteristics during zebrafish spinal cord development. In cat (Böhme 1988) and rat (Sevc, Daxnerová, and Miklosová

2009) a primitive lumen, extending across nearly the entire extent of the dorsoventral axis of the neural tube, transforms into a much smaller, ventrally positioned central canal.

Initiation of this transformation coincides with exit of neural precursors from the cell

29

1 dpf 2 dpf 3 dpf 5 dpf ABCD DAPI ZO-1/

EFGH /F-actin Sox2

IJKL BrdU

Figure 2.1. Loss of Apical Polarity Correlates With Loss of Neural Precursors and Lumen Morphogenesis All images show representative transverse sections at the level of the trunk spinal cord with dorsal up. (A and B) At 1 and 2 dpf, ZO-1 is concentrated at apical membranes of cells lining a primitive lumen, which extends across the dorsoventral axis of the spinal cord (brackets). (C and D) At 3 and 5 dpf the primitive lumen is replaced with a ventrally positioned central canal marked by apically localized ZO-1. (E-H) F-actin is similarly localized to apical membranes lining the primitive lumen and central canal. Additionally, most cells that express Sox2 are associated with F-actin localization. (I-L) A BrdU pulse labels numerous cells lining the primitive lumen at 1 and 2 dpf, but at 3 and 5 dpf few cells incorporate BrdU. Scale bar equals 10 µm.

30

cycle and completion of neurogenesis in late embryonic stage. The zebrafish spinal cord undergoes a similar transformation. At 1 and 2 days post fertilization (dpf), the tight junction-associated protein ZO-1 was enriched at the apical membranes of cells lining a primitive lumen spanning the spinal cord (Figures 2.1A and 2.1B). At 3 and 5 dpf, apical

ZO-1 enrichment was no longer evident dorsally but remained associated with a central canal in ventral spinal cord (Figures 2.1C and 2.1D). F-actin was similarly localized, lining the primitive lumen at 1 and 2 dpf (Figures 2.1E and 2.1F) but limited to the central canal at 3 and 5 dpf (Figures 2.1G and 2.1H). This loss of apical protein enrichment coincided with loss of neural precursors. Whereas numerous cells lining the primitive lumen expressed Sox2, a marker of neural precursors (Ellis et al. 2004), at 1 and 2 dpf (Figures 2.1E and 2.1F), fewer Sox2+ cells remained at 3 and 5 dpf and these were mostly restricted to the area bordering the central canal (Figures 2.1G and 2.1H).

Similarly, many cells lining the primitive lumen incorporated the thymidine analog BrdU, a marker of cells in S phase, at 1 and 2 dpf (Figures 2.1I and 2.1J), but few spinal cord cells incorporated BrdU at 3 and 5 dpf (Figures 2.1K and 2.1L). Therefore, by early larval stage most spinal cord precursors differentiate or become mitotically quiescent, concomitant with transformation of a primitive lumen to a central canal and loss of apically enriched proteins.

To investigate if miR-219 expression correlates with the morphological and neural precursor changes described above, we first performed quantitative PCR. This showed that miR-219 levels were relatively low prior to 1 dpf and then peaked at 2 dpf (Figure

2.2). We then carried out in situ hybridization using a locked nucleic acid (LNA) probe designed to detect the mature miR-219 sequence. At 1 dpf, spinal cord cells expressed

31

mir-219 very weakly (Figure 2.3A) but by 2 dpf, miR-219 expression was robust (Figure

2.3B). Notably, miR-219 expression appeared to be highest in the cells just outside the proliferative ventricular zone and somewhat lower in the neural precursors immediately adjacent to the primitive lumen. At 3 dpf, after transformation of the primitive lumen to the central canal, cells throughout the medial spinal cord expressed miR-219 at uniform levels (Figure 2.3C). At 5 dpf, following completion of embryonic neurogenesis and gliogenesis, mir-219 expression in spinal cord was no longer evident (data not shown).

Therefore, the pattern of miR-219 expression is consistent with the possibility that it regulates cell division and differentiation.

To test miR-219 function, we investigated markers of neural precursors in control larvae and larvae injected with antisense morpholino oligonucleotides (MO) (Prehoda

2009; X. Zhao et al. 2010) designed to bind the mature form of miR-219, thereby blocking function. In 3 dpf control larvae, few spinal cord cells incorporated BrdU, indicating a low level of neural precursor division (Figure 2.3D). By contrast, numerous

BrdU+ cells occupied the medial spinal cord of miR-219 MO-injected larvae (Figure

2.3E). Quantification revealed elevated number of BrdU+ cells in both dorsal and ventral spinal cord, with an approximately 2-fold greater increase in dorsal spinal cord than in ventral spinal cord (Figure 2.3F). Similarly, immunohistochemistry to detect phospho- histone H3 (PH3), which reveals cells in M phase, showed that miR-219 MO-injected larvae had substantially more PH3+ spinal cord cells than control larvae (Figure 2.3G-

2.3I). These data indicate that miR-219 drives neural precursors from the cell cycle. To determine if neural cells retain other precursor characteristics in the absence of miR-219

32

miR-219miR-219 expression expression

Relative RNA expression Relative RNA expression 16 hpf 1 dpf 2 dpf 3 dpf 4 dpf 5 dpf

Figure 2.2. miR-219 Expression Across Developmental Stages Graph showing relative miR-219 expression levels during embryonic and larval development measured by quantitative PCR (n=3 biological replicates consisting of 15- 20 larvae for each measurement).

33

function we investigated expression of Sox2 and localization of apically associated proteins. In 3 dpf control larvae, Sox2+ cells were primarily located around the central canal, revealed by F-actin labeling, in the ventral spinal cord (Figure 2.3J). In miR-219

MO-injected larvae, Sox2+ cells lined the entire dorsoventral axis of the medial spinal cord (Figure 2.3K). Quantification revealed that miR-219 MO-injected larvae had approximately 1.75-fold more Sox2+ cells than control larvae, but that the difference was limited to dorsal spinal cord (Figure 2.3L). Additionally, F-actin labeling revealed an enlarged lumen extending into dorsal spinal cord (Figures 2.3K and 2.3K’). Similarly, whereas ZO-1 was limited to membranes surrounding the central canal of 3 dpf control larvae (Figures 2.3M and 2.3M’), ZO-1 labeling was evident along the entire dorsoventral extent of an enlarged lumen of miR-219 MO-injected larvae (Figures 2.3N and 2.3N’). These phenotypic features are characteristic of early neural development.

Therefore, loss of miR-219 function results in retention of embryonic spinal cord characteristics into post-embryonic, larval stage.

Our data show that larvae lacking miR-219 function maintain excess spinal cord precursors, raising the possibility that the OPC deficit we observed previously (Bultje et al. 2009; X. Zhao et al. 2010) resulted from a failure of precursor differentiation. To test this, we examined radial glial and neuronal markers in combination with EGFP expression driven by an olig2:EGFP transgene, which marks pMN precursors, motor neurons and oligodendrocyte lineage cells (Costa et al. 2008; Shin et al. 2003). In wild- type zebrafish, radial glia appear by 1 dpf and persist throughout development and into adulthood (Park et al. 2007). Accordingly, numerous GFAP+ radial glia were evident in the spinal cords of 3 dpf control larvae (Figure 2.4A). By contrast, GFAP+ radial glia

34

1 dpf 2 dpf 3 dpf A’ AB C vz

B’ * * ** * miR-219 C’

Control miR-219 MO D E F BrdU ****

**** Control **** BrdU miR-219 MO av # cells/section

Dorsal Ventral Total G H I

PH3 * PH3

av # cells/section Control miR-219 MO

JK J’ L Sox2 ****

**** Control F-actin * / K’ miR-219 MO av # cells/section Sox2 Dorsal Ventral Total

MNM’ DAPI / N’ ZO-1

Figure 2.3. miR-219 Knockdown Causes Retention of Embryonic Spinal Cord Precursors into Postembryonic Stage

35

Figure 2.3. miR-219 Knockdown Causes Retention of Embryonic Spinal Cord Precursors into Postembryonic Stage All images show representative transverse sections through trunk spinal cord with dorsal up. (A-C) In situ hybridization to detect the mature form of miR-219 reveals low expression at 1 dpf but prominent expression at 2 dpf. Staining appears most intense in cells (asterisks) lateral to ventricular zone cells (vz, bracket) lining the primitive lumen. At 3 dpf miR-219 expression appears uniform in medial spinal cord. Boxed areas are shown in higher magnification in A’-C’. (D and E) 3 dpf miR-219 MO-injected larva has more cells that incorporate BrdU than a control larva. (F) Graph showing the number of BrdU+ cells in the ventral, dorsal and entire spinal cord at 3 dpf. Data represent the mean + s.e.m. (n=10 larvae, 5-10 sections each). **** P<0.0001, unpaired t test. (G and H) 3 dpf miR-219 MO-injected larva has more PH3+ cells than a control larva. (I) Graph showing the number of spinal cord cells labeled with anti-PH3 antibody in control and miR-219 MO-injected larvae. Data represent the mean + s.e.m. (n = 10 sections obtained from 15 larvae per group, with two replicates). *P=0.0328, unpaired t test. (J-L) 3 dpf miR-219 MO injected larvae have more Sox2+ cells than control larvae. Boxed areas are shown at higher magnification in J’ and K’. Graph showing the number of Sox2+ cells in ventral, dorsal and entire spinal cord. Data in graph represent mean + s.e.m. (n = 10 sections obtained from 15 larvae per group, with three replicates). *P=0.0369, ****P<0.0001, unpaired t test. (J, K, M and N) 3 dpf miR-219 MO injected larvae maintain a primitive lumen marked by apically localized F-actin and ZO-1 (brackets). Scale bar equals 10 µm for low magnification images and 5 µm for high magnification images.

36

were completely absent from miR-219 MO-injected larvae, except in the most dorsal and ventral portions of the spinal cord (Figure 2.4B). Consistent with our previous results, miR-219 MO-injected larvae also had few OPCs. Expression of the radial glia marker

BLBP showed a similar pattern, marking numerous cells in control larvae (Figure 2.4C), but only a few cells in the most dorsal and ventral portions of the spinal cord of miR-219

MO-injected larvae (Figure 2.4D). To investigate neuronal differentiation, we examined expression of Elavl3, which marks newly born neurons (Marusich et al. 1994). This revealed no obvious differences in neurons in wild-type and miR-219 MO-injected larvae

(Figures 2.4E and 2.4F). To quantify a specific population of neurons we counted motor neurons, which are produced by ventral spinal cord precursors and marked by Islet (Isl) expression. Indeed, motor neuron number in miR-219 MO-injected larvae was not different from control at 3 dpf (Figure 2.4G). To investigate whether late stages of neurogenesis might be specifically affected by miR-219 loss of function, we performed a fate mapping experiment. In particular, we labeled dividing cells at 24 hours post fertilization (hpf) with a pulse of the thymidine analog EdU, waited 24 hours to permit cell differentiation and examined EdU distribution. In control embryos, many of the

EdU+ cells were also Elavl3+, representing precursors that had left the cell cycle and differentiated as neurons (Figure 2.4G). By contrast, miR-219 MO-injected embryos retained most of the EdU label within the proliferative zone and had correspondingly few

EdU+ Elav3+ neurons (Figure 2.4H). Quantification confirmed this, showing that miR-

219 MO-injected embryos had approximately half as many EdU+ Elav3+ neurons as control embryos (Figure 4J). Together with the data presented above, these results

37

Control miR-219 MO Control miR-219 MO AB C D :EGFP :EGFP * * * * *

* olig2

olig2 * / / BLBP

GFAP * EF H I f :EGFP EdU

* / ** olig2

/ * * * Elavl3 * *

Elavl3 * *

G Isl J Elavl3/EdU **** av # cells/section av # cells/section Control miR-219 MO Control miR-219 MO

Figure 2.4. miR-219 is Required for Differentiation of Glia and Late-born Neurons All images show representative transverse sections through trunk spinal cord with dorsal up. (A and B) Whereas numerous GFAP+ radial glia occupy the spinal cord of a 3 dpf control larva, a miR-219 MO-injected larva has few radial glia except for the most dorsal and ventral regions of spinal cord (brackets). Asterisks mark oligodendrocyte lineage cells. (C and D) Images showing a deficit of BLBP+ radial glia in a miR-219 MO-injected larva compared to control. (E and F) miR-219 MO-injected larvae appear to have a normal number and distribution of neurons, marked by Elavl3 expression, but fewer oligodendrocyte lineage cells (asterisks) than control larvae. (G) Graph showing number of Isl+ motor neurons in control and miR-219 MO-injected larvae. Data are presented as mean + s.e.m. (n = 10 sections obtained from 15 larvae per group, with two replicates). P>0.05, unpaired t test. (H and I) Confocal images and associated orthogonal projections of embryos pulsed with EdU at 1 dpf and fixed at 2 dpf. Numerous Edu+ cells are also Elavl3+ (arrowheads) in control larvae (H) whereas most EdU label persists within cells lining the spinal cord lumen and fewer neurons are labeled by EdU in miR-219 MO- injected larva (I). Dashed lines indicate orthogonal section planes, showing co- localization of EdU and Elavl3. (J) Graph showing number of Elav3+ EdU+ neurons in control and miR-219 MO-injected larvae. Data represent mean + s.e.m. (n = 10 sections obtained from 5 larvae per group). ****P<0.0001, unpaired t test. Scale bar equals 10 µm.

38

indicate that miR-219 promotes exit of neural precursors from the cell cycle and their differentiation as neurons and glia at late stages of development. miR-219 Regulates pard3 and prkci via 3’ UTR Target Sites

Because zebrafish larvae retain neuroepithelial precursor characteristics in the absence of miR-219 function we hypothesized that miR-219 promotes downregulation of factors necessary for maintaining precursors in an undifferentiated, dividing state. To search for such factors we used target prediction software to identify miR-219 binding sites. Strikingly, this revealed single putative target sites within the 3’ UTR sequences of the Par genes pard3 and prkci that are conserved among numerous vertebrate species

(Figure 2.5A and 2.5B). Target prediction analysis also revealed single sites within the 3’

UTR sequences of pard6b and pard6ga but not those of pard6a and pard6gb. Because apical localization of Par proteins is a hallmark feature of neuroepithelial precursors and

Par protein functions promote neural precursor self-renewal in flies and mice (Asuelime and Shi 2012; Bartel 2009; Bultje et al. 2009; Costa et al. 2008; Dong et al. 2012;

Kuchinke, Grawe, and Knust n.d.; C.-Y. Lee, Robinson, and Doe 2006; Rolls et al. 2003), we chose pard3 and prkci for further investigation.

To investigate whether Par protein localization coincides with neural precursor state, we performed immunohistochemistry using an anti-Prkci antibody (Horne-

Badovinac et al. 2001; Roberts and Appel 2009). Similar to ZO-1 and F-actin, Prkci was enriched at apical membranes along the entire spinal cord dorsoventral axis at 1 and 2 dpf, but then limited to membranes lining the central canal by 3 dpf (Figures 2.5C-2.5E).

By contrast, apical Prcki persisted throughout the spinal cord of miR-219 MO-injected larvae at 3 dpf and 5 dpf (Figures 2.5F and 2.5G). These data are consistent with the

39

possibility that miR-219 promotes the disappearance of Prkci from differentiating neuroepithelial precursors with a concomitant loss of apical membrane characteristics.

We lack an antibody that reliably detects Pard3 protein in zebrafish tissue.

Therefore, to test whether miR-219 can regulate pard3 expression, we cloned the pard3

3’ UTR sequence containing the predicted target site into a dual luciferase reporter plasmid (Figure 2.5H), co-transfected the construct into HEK293T cells with either a negative control mimic or miR-219 mimic and measured luciferase activity. The miR-219 mimic, but not the control mimic, reduced luciferase expression by 70% (Figure 2.5I).

Introduction of one and two base mutations in the target site abrogated miR-219-mediated inhibition of luciferase expression (Figure 2.5I), indicating that miR-219 regulates pard3 expression by binding the predicted target site.

We tested the ability of mir-219 to regulate target expression in vivo by fusing the pard3 and prkci 3’ UTRs to cDNA encoding EGFP and using the constructs as templates for in vitro synthesis of mRNA, which we injected into zebrafish embryos at early cleavage stage. We co-injected some embryos with miR-219 or, as a control, miR-216a, which has no predicted target sites within the pard3 and prkci 3’ UTRs. To quantify

EGFP expression, we measured fluorescence intensity within a defined region of the spinal cord. Whereas EGFP fluorescence appeared to be similar in embryos injected only with RNA including the prkci 3’ UTR and those co-injected with miR-216a, fluorescence intensity in embryos co-injected with miR-219 appeared to be less than control (Figures

2.6A-2.6C). Quantification confirmed this, revealing an approximately 30% reduction in fluorescence intensity in miR-219 injected embryos relative to the controls (Figure 2.6D).

The pard3 3’ UTR mediated a similar effect (Figures 2.6E-2.6H), although the degree to

40

ABprkci 5 UTR CODING 3 UTR pard3pard3 5 UTR CODING 3 UTR

pard3pard3 3’UTR3’U 141-174 GUAGAGAU ----U ---CUGACAAUCAACAAAUA AGCCAGACCAGUAG prkci 3’UTR 46-80 UGCAUG----G UCGGACAAACACAAUCACAAAUAUCUCACACGAA dre-mir219 5’UCUUAACGCAAACCUGUUAGUUGUUAU GGUU dre-mir219 5’ UCUUAACGCAAACCUGUUAGUUGUUGGUUUUAGUAAGGU ZebrafishZebrafish GUAGAGAU---U ------CUGA---CAAUCAGCCAGACCAGUA HHumanuman GGAUUUC----CC---ACCCU--GUGA---CAAUCAUCUGUUUGAGGU Zebrafish UGCAUGGUC G--ACAAUC ----ACACGAA---AAGUAACAAG Mouse GGACCCC—CACC---ACCC-CUGACCCCAAUAUCAAGUUCAAGGA Human UAG-CUUCCAG---ACAAUC----AUGUCAA----AAUUUAGUU ChimpanzeeChimpanzeeGGAUUUC----CC---ACCCU--GUGA---CAAUCAUCUGUUCGAGGC Mouse UAG-CUUCCUG---ACAAUC----AUGUC-G----ACCCUGCUU DDogog GGAUUUC----CC---GCCAU--CCGA---CAAUCACCUGUUCAAGGC Chimpanzee UAG-CUUCCAG---ACAAUC----AUGUCAA----AAUUUAGUU PlPlatypusatypus GGAUUUU---UCC---ACCAC--CUGA---CAAUCAUCCU------GUAAUUACA LiLizardzard GGAGUUU----CC---AUCAU--CUGA---CAAUCAU--AUCCUAGGCAAAUG— Dog UAG-UUUCCAG---ACAGUC----GUGUCAA----CACUUAGCU CChickenhicken GGAUUUU----CC---ACCAU--UUGA---CAAUCAU—AGCAGAAGUGAGCA Armadillo UAG-UUUCCAG---ACAAUC----GUGUCAA----AUUUUAGUU FFrogrog GGAUUUU----UC---ACAAU--AAGA---CAAUCA------1 dpf 2 dpf 3 dpf 3 dpf 5 dpf CDE Control Control Control F miR-219 G miR-219 MO MO Prkci

**** H I **** ****

control **** **** **** WT pard3 3‘ UTRGAUGCUCUGA CAAUCAGCCAGACCAGUAGAACUCAAACAGAACGAA 1 bp mut 3’ UTR GAUGCUCUGAUGAUCAGCCAGACCAGUAGAACUCAAACAGAACGAA 2 bp mut 3’ UTR GAUGCUCUAACGAUCAGCCAGACCAGUAGAACUCAAACAGAACGAA

Firefly LUC Renilla LUC wt 3’UTR

Firefly LUC Renilla LUC 1bp mutant 3’UTR

Relative light units Firefly LUC Renilla LUC 2bp mutant 3’UTR

mimic mimic mimic

miR-219 miR-219 miR-219 wt 3’UTR+ctrl mimic1 bp mut+ctrl mimic2 bp mut+ctrl mimic wt 3’UTR+ 1 bp mut+ 2 bp mut+

Figure 2.5. miR-219 has Single, Conserved Target Sites within prkci and pard3 3’ UTRs (A and B) Schematic representations of prkci and pard3 transcripts with predicted miR- 219 target sites conserved among various species. (C-E) In controls at 1 and 2 dpf, Prkci protein is concentrated at apical membranes lining the primitive lumen but by 3 dpf Prkci is limited to the central canal (brackets). (F and G) Prkci labeling persists along a primitive lumen extending across the spinal cord dorsoventral axis in 3 dpf and 5 dpf miR-219 MO-injected larvae. (H) 220 bp sequences from the pard3 3’ UTR containing wild-type and mutated miR-219 target sites were cloned into dual luciferase vectors. (I) Quantification of light units revealed a miR-219-mediated reduction of reporter gene expression that was abrogated by one and two basepair mutations within the target site. Data represent + s.e.m. (3 independent experiments). Brackets indicate pairwise comparisons. ****P < 0.0001, unpaired t test. Scale bar equals 10 µm.

41

which fluorescence intensity was reduced was less than that mediated by the prkci 3’

UTR. EGFP fluorescence produced by RNA having neither the pard3 nor prkci 3’ UTRs was not affected by co-injection of miR-219 (Figures 2.6I-2.6K).

We next performed a series of experiments to investigate whether pard3 and prkci are functionally relevant, in vivo targets of miR-219. First, we reasoned that if the oligodendrocyte deficit of miR-219 MO-injected larvae results from elevated levels of

Par proteins, then reduction of Par protein function should restore oligodendrocyte number. To test this prediction we assessed dorsally migrated oligodendrocytes, marked by Tg(olig2:EGFP) reporter expression, formed in larvae injected with only miR-219 MO or co-injected with miR-219 MO and MO designed to block translation of pard3 mRNA

(Alexandre et al. 2010; C. Zhao et al. 2009). Consistent with our previous observations, miR-219 MO-injected larvae had few dorsally migrated OPCs compared to control

(Figures 2.7A and 2.7B). By contrast, co-injection of miR-219 MO and pard3 MO partially restored OPC number (Figure 2.7C). To quantify this effect, we classified phenotypes as normal, mild or severe based on the number of dorsally migrated OPCs.

Whereas most larvae lacking only miR-219 function were classified as severe, significantly more larvae lacking both miR-219 and pard3 functions were classified as normal or mild, with a concomitant reduction of the severe class (Figure 2.7D).

Therefore, reducing Pard3 function partially compensates for loss of miR-219 function, providing strong evidence that miR-219 regulates OPC formation by modulating Pard3 expression in vivo.

We also predicted that preventing the binding of endogenous miR-219 to its relevant target sites should cause a deficit of OPCs, similar to miR-219 knockdown.

42

Figure 2.6. mir-219 Regulates Reporter Gene Expression In Vivo via pard3 and prkci 3’ UTR Sequences (A-C) Fluorescence images of living embryos injected with EGFP:prkci 3’ UTR mRNA alone, miR-216a control or miR-219. (D) Graph showing EGFP fluorescence intensity values. Units represent pixel intensity and are reported as percent of control values (n = 20 embryos, with three replicates). Brackets indicate pairwise comparisons. **P=0.0014, unpaired t test. (E-G) Images of living embryos injected with EGFP:pard3 3’ UTR mRNA alone, miR-216a control or miR-219. (H) EGFP fluorescence intensity values shown as in D (n=20 embryos, with three replicates). ***P=0.0001 unpaired t test. (I and J) Images of embryos injected with EGFP mRNA alone or with miR-219. (K) EGFP fluorescence intensity values shown as in D (n = 20 embryos, with two replicates). P=0.8728, unpaired t test. Error bars represent + s.e.m.

43

To test this we synthesized Target Protector (TP) MOs (Makeyev et al. 2007; Staton and

Giraldez 2011) designed to bind to and block the putative miR-219 target sites within thepard3 and prkci 3’ UTRs. We also synthesized a MO directed to a non-overlapping sequence within the pard3 3’ UTR to function as a control. Larvae injected with control

TP MO were unaffected, forming the normal number of dorsally migrated OPCs (Figure

2.7E), but a significant number of pard3 TP MO-injected larvae had few OPCs (Figures

2.7F and 2.7G). Similarly, most prkci TP MO-injected larvae formed fewer OPCs than controls (Figures 2.7H-2.7J). To investigate whether the OPC deficit is linked to changes in the neural precursor population, we examined distribution of apical membrane associated proteins in TP injected larvae. 3 dpf larvae injected with either pard3 TP MO or prkci TP MO had expanded primitive lumens along which Prkci and ZO-1 were concentrated (Figures 2.8A-2.8F), phenocopying injection of miR-219 MO. TP MO- injected larvae also had fewer radial glia than controls (Figure 2.8G-2.8I). Furthermore,

TP MO-injected larvae had more Sox2+ cells in dorsal spinal cord than controls (Figures

2.8J-2.8L) as well as more BrdU+ cells (Figures 2.8M-2.8O). Similarly to mir-219 MO, the increase in BrdU+ cells resulting from TP MO occurred mostly in dorsal spinal cord

(Figure 2.8P). Therefore, blocking interaction of miR-219 with its pard3 and prkci target sites is sufficient to maintain embryonic spinal cord precursors and prevent formation of

OPCs.

Finally, we attempted to overexpress Pard3, predicting that it, also, would phenocopy mir-219 loss of function. To do so we used a transgenic line,

Tg(hsp70l:pard3-EGFP), which expresses Pard3 fused to EGFP

44

Figure 2.7. pard3 and prkci Are Functionally Relevant miR-219 Targets (A-C) Lateral images of living 3 dpf (Tg:olig2:EGFP) larvae, focused on the trunk spinal cord. Control larva, (A), shows the normal number and distribution of dorsally migrating OPCs (arrow). Whereas miR-219 MO-injected larvae have few OPCs (B), larvae co- injected with miR-219 and pard3 MOs have an intermediate number of OPCs (C). (D) Graph showing quantification of OPC phenotypic classes. Larvae classified as normal had the number of dorsally migrated OPCs typical of wild type. Larvae were classified as severe if fewer than 5 OPCs had migrated and mild in all other circumstances. P value was calculated by comparing the number of larvae with normal numbers of OPCs in the miR-219-MO alone and miR-219 MO + pard3 MO experiments. Data represent + s.e.m. (n = 25 larvae per group, with three replicates). *P=0.0324, unpaired t test. (E and F) Larvae injected with pard3 TP MO have fewer OPCs than those injected with a control TP MO. (G) Graph showing quantification of the pard3 TP MO phenotypes. Data represent + s.e.m. (n = 35 and 55 larvae in two independent experiments) ****P<0.0001, unpaired t test (H and I) Larvae injected with prkci TP MO have fewer OPCs than those injected with a control TP MO. (J) Graph showing quantification of the prkci TP MO phenotype. (n = 45-60 larvae per experiment, with three independent experiments). **P=0.0020, unpaired t test.

45

(Cheng et al. 2009; Geldmacher-Voss et al. 2003) under control of a heat-responsive promoter. Although the fusion protein was evident in non-neural tissues following heat shock, it appeared to be rapidly degraded in the neural tube. Nevertheless, with repeated heat shocks we were able to obtain some embryos with fusion protein expression evident in the spinal cord. Notably, when present, EGFP was co-localized with ZO-1 to an expanded, primitive lumen (Figure 2.9), consistent with the idea that persistent Pard3 expression maintains spinal cord cells in a neuroepithelial precursor state. Therefore, we conclude that negative regulation of Pard3 and Prcki by miR-219 drives neural precursor differentiation at late embryonic stage.

Discussion

The progression of neural precursors from symmetric proliferative to asymmetric self- renewing division and, subsequently, to symmetric cell cycle exit and differentiation represent key transitions in neural development. Data drawn from investigations of invertebrate and vertebrate neural precursors provide the basis for a model in which symmetric or asymmetric distribution of apical Par proteins to sibling cells at mitosis influences whether each remains as a precursor or enters a differentiation pathway

(Homem and Knoblich 2012; Wieland B Huttner and Kosodo 2005; Kapsimali et al.

2007; Kimmel et al. 1995; Shin et al. 2003; Shitamukai and Matsuzaki 2012; X. Zhao et al. 2010). Still missing from this model is a mechanism that would cause both progeny of a dividing precursor to leave behind the self-renewing activity of apical Par proteins and undergo differentiation. Here we propose that miRNA-mediated downregulation of Par proteins contributes to this transition.

46

In Drosophila, neuroblasts delaminate from the neuroectoderm, retaining an apicobasal polarity evident in asymmetric localization of Par proteins (Homem and

Knoblich 2012; Park et al. 2005). Apical Par proteins, through interaction with

Inscutable, Gαi, Pins and Mud, position the mitotic spindle so that neuroblast division occurs perpendicularly to the plane of the neuroectoderm (Kloosterman et al. 2006; Siller and Doe 2009). Consequently, apical Par proteins are retained within one progeny cell, which continues as a neuroblast, and absent from the other, which undergoes differentiation, indicating that apical proteins are associated with self-renewal. Consistent with this, reduction of aPKC function resulted in failure of neuroblasts to undergo self- renewing divisions whereas aPKC overexpression caused formation of excess neuroblasts

(Haenfler, Kuang, and Lee 2012; C.-Y. Lee, Robinson, and Doe 2006; X. Zhao et al.

2010). Neuroblasts exit the cell cycle prior to adulthood, under control of a temporally regulated sequence of transcription factors (Alexandre et al. 2010; Maurange, Cheng, and

Gould 2008), but whether apical Par proteins are downregulated to help promote this transition and the mechanisms by which this might occur remain unknown.

Although the correlation of spindle orientation, cleavage plane and cell fate are not as obvious in the vertebrate CNS as in flies, several studies provided evidence that vertical cleavage planes that bisect apical membrane of neural precursors equally are generally associated with symmetric proliferative divisions whereas oblique or horizontal cleavage planes that cause unequal segregation of apical membrane to progeny cells are asymmetric with respect to cell fate (Böhme 1988; Bultje et al. 2009; Chenn and

McConnell 1995; Ellis et al. 2004; Haydar, Ang, and Rakic 2003; Kosodo et al. 2004;

Sevc, Daxnerová, and Miklosová 2009; Tep et al. 2011). Consistent with these

47

observations, Pard3 can be asymmetrically localized to the progeny of dividing radial glial cells in mice, although the mechanism of unequal distribution was not clear (Bultje et al. 2009). Notably, whereas overexpression of Pard3 promoted symmetric divisions producing progenitor fate, Pard3 knockdown caused symmetric divisions producing neurons (Bultje et al. 2009). Similarly, Pard3 knockdown reduced proliferation of mouse cortical progenitors and favored formation of neurons whereas Pard3 or Pard6α overexpression drove progenitor proliferation (Costa et al. 2008). These observations support the idea that, like invertebrates, apically localized Par complex proteins promote a self-renewing precursor state in the vertebrate nervous system.

Birthdating studies showed that the majority of dividing cells within the mouse cerebral cortex ventricular zone exit the cell cycle and differentiate by the end of embryogenesis (Takahashi, Nowakowski, and Caviness 1996). This cessation of proliferation correlates temporally with depletion of apical Par complex proteins from the ventricular surface (Costa et al. 2008). We showed here that the zebrafish spinal cord undergoes a similar transition. During early stages of neural development, a primitive lumen occupies nearly the entire dorsoventral extent of the neural tube. Apically associated proteins, including the Par complex protein Prkci, are localized to cell membranes lining the ventricular surface of the lumen. Cells that border the lumen, and thereby have apically concentrated Par proteins, have precursor characteristics in that they divide and express the precursor marker Sox2. At the end of the embryonic period, the lumen transforms to a small central canal in the ventral spinal cord. Concomitantly, the apparent concentration of apically associated proteins is reduced from all spinal cord

48

Control pard3 TP MO prkci TP MO

AB C r Prkci

D E F DAPI / ZO-1

GIH GFAP

J K L Sox2

M NO BrdU

P BrdU *** *** * ** Control pard3 TP MO ** ** prkci TP MO av # cells/section Dorsal Ventral Total

Figure 2.8. Blocking miR-219 access to pard3 or prkci 3’UTRs phenocopies miR-219 loss of function

49

Figure 2.8. Blocking miR-219 access to pard3 or prkci 3’UTRs phenocopies miR-219 loss of function All panels show representative images of spinal cord transverse sections with dorsal up. (A-C) 3 dpf larvae labeled to detect Prcki localization. In the control, Prkci is limited to a small central canal (A). By contrast, Prkci extends dorsally in pard3 TP MO and prkci TP MO injected larvae, marking a primitive lument (B and C). (D-F) Similarly to Prcki, ZO- 1 is restricted to a central canal in the control larva (D) but extends more dorsally in pard3 TP MO and prkci TP MO injected larvae (E and F). (G-I) pard3 TP MO and prkci TP MO injected larvae have fewer medial spinal cord radial glia than control. (J-L) pard3 TP MO and prkci TP MO injected larvae have more Sox2+ cells in dorsal spinal cord than control. (M-O) BrdU incorporation at 3 dpf. TP MO-injected larvae have more labeled cells than control. (P) Graph showing number of BrdU+ cells in dorsal, ventral and entire spinal cord. Data represent + s.e.m. (n = 10 larvae for each experiment, 5-10 section per larva). *P<0.05, **P<0.005, ***P<0.0005, unpaired t test. Scale bar equals 10 µm.

50

cells except those bordering the central canal and the number of dividing neural precursors is greatly diminished.

Our functional studies provide evidence that termination of neural precursor division and subsequent neuronal and glial differentiation at late embryonic stage is driven, in part, by negative regulation of Pard3 and Prkci by miR-219. We noted, though, that our functional manipulations affected primarily dorsal spinal cord. In fact, transitions in lumen morphogenesis, apical protein distribution and neural precursor characteristics during development occur predominantly in dorsal spinal cord. In ventral spinal cord, apical proteins and Sox2+, putative neural precursors that also express olig2 (Park et al.

2007) remain localized to the central canal into postembryonic stage, raising the possibility that ventral neural precursors are not subject to miR-219 regulation. However, most spinal cord OPCs arise from ventral cells that express olig2. Nevertheless, prkci mutant zebrafish larvae had excess OPCs (Roberts and Appel 2009) and mir-219 knockdown larvae had a deficit of OPCs (X. Zhao et al. 2010). One possible explanation is that OPCs originate dorsal to the central canal from precursors that are regulated by miR-219. More careful fate-mapping of OPCs origins should resolve this question.

Our data now extend current models in which, during early stages of neural development, mechanisms that influence whether the progeny cells of dividing neural precursors receive equal or unequal amounts of apical Par proteins influence whether divisions are symmetric and proliferative or asymmetric with respect to cell fate. We now propose that, near the end of embryogenesis, inhibition of new Par protein translation by miR-219 depletes Par proteins from dividing precursors below a limit necessary for their

51

hsp70l:Pard3-EGFP ZO-1 Merge

A

- Control-EGFP

B

C

Pard3-EGFP

D

lo Normal

E r tn Ectopic

oc oc ZO-1 expression Dorsal

%

ae ZO-1 expansion ***

vral

rebmuN ****

Control-EGFP- Pard3-EGFP+

Figure 2.9. Pard3-EGFP Overexpression Phenocopies miR-219 Loss of Function Representative spinal cord transverse images of 3 dpf heat-shocked control and heat- shocked Tg(hsp70l:pard3-EGFP) larvae processed for ZO-1 immunohistochemistry with dorsal to the top. (A) Control non-transgenic larva. ZO-1 is restricted to the central canal. (B and C) Examples of heat-shocked transgenic larvae showing strong Pard3-EGFP expression outside the spinal cord (outlined) and co-localized with ZO-1 to an apparent primitive lumen extending into dorsal spinal cord. (D) Example of a heat-shocked larva with an apparent double lumen (ectopic class) with co-localized Pard3-EGFP and ZO-1. (E) Graph showing number of larvae having dorsal expansion or ectopic co-localization of Pard3-EGFP (n=12 each for control and experimental) ***P=0.0002, ****P<0.0001. Scale bar equals 10 µm.

52

self-renewing functions, causing precursors to exit the cell cycle and differentiate as late born neurons and glia.

Previous work identified miR-219 as an important regulator of oligodendrocyte differentiation and myelination (Bultje et al. 2009; Costa et al. 2008; Dugas et al. 2010;

X. Zhao et al. 2010). Our study identifies an additional earlier and broader role for miR-

219 in promoting the transition of neural precursors to specified cell types, including oligodendrocyte lineage cells. Additionally, because neural precursors continue to divide in the absence of miR-219 function, our data raise the possibility that alterations of miR-

219 expression contribute to tumor formation. Consistent with this, miR-219 expression was significantly lower in childhood medulloblastoma relative to neural stem cells

(Ferretti et al. 2009; Genovesi et al. 2011).

Figure 2.10. Proposed model for the role of miR-219 in the transition of neural precursors from proliferative self-renewing divisions to differentiative ones.

53

CHAPTER III

MIR-219 INITIATES NEURAL PROGENITOR DIFFERENTIATION BY DAMPENING APICAL PAR PROTEIN-DEPENDENT HEDGEHOG SIGNALING2

Abstract

The transition of dividing neuroepithelial progenitors to differentiated neurons and glia is essential to the formation of a functional nervous system. Sonic Hedgehog (Shh) is a mitogen for spinal cord progenitors, but how cells become insensitive to the proliferative effects of Shh is not well understood. Because Shh reception occurs at primary cilia, which are positioned within the apical membrane of neuroepithelial progenitors, we hypothesized that loss of apical characteristics reduces Shh signaling response, causing cell cycle exit and differentiation. We tested this hypothesis using genetic and pharmacological manipulation, gene expression analysis and time-lapse imaging of zebrafish embryos. Blocking function of miR-219, a microRNA that down regulates apical Par polarity proteins and promotes progenitor differentiation, elevated Shh signaling. Inhibition of Shh signaling reversed the effects of miR-219 depletion and forced expression of Shh phenocopied miR-219 deficiency. Time-lapse imaging revealed that knockdown of miR-219 function accelerated the growth of primary cilia, revealing a possible mechanistic link between miR-219-mediated regulation of apical Par proteins and Shh signaling. Thus, miR-219 might initiate neural progenitor differentiation by dampening apical Par protein-dependent Shh signaling.

2 This chapter has been submitted for publication to Development.

54

Introduction

Spatial and temporal information are integrated in developing nervous systems to produce a large array of distinct types of neurons and glia. In very broad terms, spatial cues specify formation of different kinds of neurons and glia at different positions while temporal information regulates the time at which particular dividing progenitor cells differentiate. One of the major spatial cues for developing vertebrate nervous systems is the secreted morphogen Sonic hedgehog (Shh). Shh binds to the cell surface transmembrane protein Patched (Ptch), relieving Ptch inhibition of the membrane spanning protein Smoothened (Smo). This initiates proteolytic processing of Gli transcription factors, which subsequently translocate to the nucleus to control expression of Hh pathway target genes (Aza-Blanc et al. 1997; Wang et al. 2000). Secretion of Shh by notochord, a mesodermal rod underlying the ventral neural tube, and subsequently floorplate, the ventralmost cells of the neural tube, creates a signaling gradient, to which neural progenitors arrayed on the ventral-to-dorsal axis respond by expressing position- specific transcription factors and producing distinct subsets of neurons and glia (Chiang et al. 1996; Kicheva et al. 2014) (reviewed in (Le Dréau & Martí 2012; Jessell 2000)).

For example, pMN progenitors, positioned close to floorplate, express Olig2 and give rise to motor neurons and oligodendrocytes, whereas p2 progenitors, positioned slightly further from the Shh source, express Nkx6.1 and Irx3 and produce v2 interneurons and astrocytes.

Shh also functions as a mitogen, driving proliferation of neural progenitors. For instance, a recombinant NH2-terminal active fragment of Shh (Shh-N) elevated cell proliferation in cultured mouse retinas (Jensen and Wallace 1997) and mouse cerebellar

55

cell and slice cultures (Wechsler-Reya and Scott 1999). Similarly, persistent expression of Shh in developing mouse spinal cord and cerebellum caused excess proliferation

(Dahmane and Ruiz 1999; Rowitch et al. 1999). By contrast, Shh mutant mice had significantly smaller neural tubes and general growth retardation (Litingtung and Chiang

2000). Analysis of cell cycle regulation using cultured mouse cerebellar cells suggested that Shh can promote proliferation by upregulating signaling mediated by G1 cyclins

(Kenney and Rowitch 2000).

How do neural progenitors escape the mitogenic effect of Shh signaling to exit the cell cycle and differentiate? One possibility is that progenitors become less sensitive to

Shh. During early stages of neural development, progenitors have neuroepithelial characteristics, including apicobasal polarity. A prominent feature of this polarity is assembly of protein complexes at the apical membrane. For example, the Partioning- defective (Par) proteins Pard3, Pard6 and atypical protein kinase C iota (Prkci), form a complex that localizes to apical contact points between neuroepithelial cells (Afonso and

Henrique 2006; J. Chen and Zhang 2013). In Drosophila, unequal distribution of apical

Par polarity proteins maintains neuroblast fate during asymmetric divisions (C.-Y. Lee,

Robinson, and Doe 2006; Prehoda 2009). Similarly, in mice, high levels of apical Par polarity proteins generally correlate with dividing neural progenitors and low levels with differentiation (Bultje et al. 2009; Costa et al. 2008; Kosodo et al. 2004). Notably, in vertebrate epithelial cells Shh reception and signal processing occurs within primary cilia, cellular appendages positioned within apical membrane (reviewed in (Ishikawa and

Marshall 2011)). Recent evidence indicates that apical Par polarity proteins promote ciliogenesis (Fan et al. 2004; Krock and Perkins 2014; Sfakianos et al. 2007). Together,

56

these observations raised the possibility that apical Par proteins regulate Shh signaling response in neural progenitors by regulating ciliogenesis.

We recently presented evidence that microRNA miR-219 promotes differentiation of zebrafish neural progenitors at late stages of neural development by downregulating

Pard3 and Prkci (Hudish, Blasky, and Appel 2013). However, the mechanisms by which apical Par proteins maintain neuroepithelial progenitors and how their downregulation promotes differentiation have not been determined. In this study we tested a hypothesis that apical Par proteins maintain neuroepithelial progenitors by promoting their ability to respond to Hedgehog (Hh) signals. Our data show that miR-219 deficient embryos have elevated Hh signaling, which is dependent upon Par protein functions. Embryos lacking

Par protein functions have decreased Hh signaling, which is not rescued by depleting miR-219, indicating that miR-219 regulation of Hh signaling occurs through Par protein regulation. We also show that miR-219 and Par proteins regulate the length and rate of growth of primary cilia but that the absence of cilia does not cause premature progenitor differentiation, indicating that Hh signaling can still occur. We propose that miR-219 helps to initiate the transition of progenitors from proliferation to differentiation by dampening apical Par protein-dependent Hh signal transduction but that this occurs in zebrafish independently of ciliogenesis.

Materials and Methods

Zebrafish Husbandry

Embryos were produced by pair-wise mating and kept at 28.5°C in egg water or

embryo medium (15 mM NaCl, 0.5 mM KCl, 1 mM CaCl2, 1 mM MgSO4, 0.15 mM

KH2PO4, 0.05 mM NH2PO4, 0.7 mM NaHCO3). Embryos were staged to hours

57

postfertilization (hpf) or days postfertilization (dpf) according to established zebrafish guidelines (Kimmel et al. 1995). The experiments conducted in this study used the following strains of zebrafish: AB, Tg(hsp701:Shhaa:EGFP (Shen et al. 2013) and

Tg(βact::Arl13b–GFP)(Borovina et al. 2010), dzip-/- (iguanats294e) (Sekimizu et al. 2004) and prkci-/- (has) (Horne-Badovinac et al. 2001).

Immunohistochemistry

Embryos and larvae were fixed in 4% paraformaldehyde (PFA) overnight at 4°C.

Fixed embryos were embedded in 1.5% agar with 5% sucrose and transferred to a 30% sucrose solution in scintillation vials and incubated at 4°C overnight. The blocks were then frozen and cut into 10-15 µm sections using a cryostat microtome. The sections were incubated with the following primary antibodies: rabbit anti-phosphohistone H3 (1:1,000,

#06-570, Millipore), rabbit anti-PkC (1:200, #sc-216, Santa Cruz Biotechnology, Inc.), mouse anti–ZO-1 (1:200, #33-9100, Invitrogen), rabbit anti-Sox2 (1:500, # ab997959,

Abcam). For fluorescent detection of antibody labeling we used Alexafluor 568 and

Alexafluor 647 goat anti-mouse and goat anti-rabbit secondary antibodies (1:200,

Invitrogen). To detect EdU incorporation, we incubated the slides in 250 µL of the EdU

Detection Reaction mix (Invitrogen) for 40 minutes at room temperature. Images were collected on a Zeiss Axio Observer microscope equipped with a PerkinElmer UltraVIEW

VoX spinning disk confocal system and Volocity imaging software (PerkinElmer).

Images were contrast enhanced using either Volocity or Photoshop (Adobe CS4).

In situ RNA Hybridization

Embryos and larvae were fixed in 4% PFA overnight at 4°C and stored in methanol at -20°C. After linearizing plasmids with the appropriate restriction enzymes,

58

antisense cRNA was transcribed using Roche digoxigenin-labeling reagents and T3, T7, or SP6 RNA polymerases (New England Biolabs). After processing embryos for in situ

RNA hybridization embryos were embedded in agar and sectioned as described above.

Sections were rehydrated in 1X PBS for 30 min then covered with 75% glycerol. Images were obtained on a Zeiss Axio Observer microscope equipped with DIC optics, a Retiga

Exi color camera and Volocity imaging software. Some images were contrast enhanced using Photoshop (Adobe CS4).

Morpholino Injections

Antisense morpholino oligonucleotides were purchased from Gene Tools, LLC.

These included: miR-219 MO (5’-CAAGAATTGCGTTTGGACAATCA-3’) (X. Zhao et al. 2010), pard3 Target Protector MO (5’-CTGATTGTCAGAGCATCTCTACTAC-3’), control pard3 Target Protector (TP) MO (5’-ACAGAGTCAAAGTGACGGACTCC-3’) and prkci TP MO (AAGCGACCGTCACACACTCCTCCGC) (Hudish, Blasky, and

Appel 2013). Morpholino oligonucleotides were dissolved in water to create stock solutions of 1 mM and diluted in 2X injection buffer (5 mg ml–1 Phenol red, 40 mM

HEPES and 240 mM KCl) to create a working injection concentration of 0.25 mM. All morpholinos were co-injected with 0.09 mM dose of p53 MO. We injected 1-2 nl into the yolk just below the single cell of fertilized embryos. All morpholino oligonucleotide injected embryos were raised in embryo medium at 28.5°C.

Plasmid Construction and Injections

Neural progenitors were labeled using a conserved regulatory DNA element near zebrafish sox19a, which is expressed by neural cells (Okuda et al. 2006). The 1554 bp sox19a 3’ regulatory element was amplified using the primers AscI fwd 5’-

59

ggcgcgccTGTAAGCACACGGCCATTTA-3’ and FseI rev 5’- aaaggccggccTCACCTAACCCCGAGAAGAA-3’ and cloned into the Tol2 Gateway entry vector p5E-FAbasal using AscI/FseI (NEB) restriction enzyme sites as described previously (Kwan et al. 2007). Four-part Gateway cloning was used to construct the final vector pEXPR-Tol2-sox19a:mCherry-CaaXpA-pA2 using LR Clonase II Plus Enzyme

Mix (Invitrogen 12538-120) and pME-mCherry-CaaX, p3E-polyA, and pDEST-Tol2- pA2 vectors as described previously (Kwan et al. 2007). The pME-Arl13b-EGFP vector was created by subcloning Arl13b-EGFP from a pCS2-Arl13b-EGFP plasmid (gift from

B. Ciruna) by traditional cloning using the Pst-I and BamHI restriction sites. Multisite

Gateway cloning was used to create pEXPR-Tol2-sox19a:Arl13b-EGFP-pA2 as described above. Embryos were injected at the single-cell stage with 1 nL of 50 ng/uL plasmid

DNA in 0.2 M KCl and sorted for mCherry-CaaX+ neural progenitors at 24 hpf.

EdU Labeling

Dechorionated embryos were labeled with 5-ethynyl-2′-deoxyuridine (EdU).

Embryos were incubated in 2 mM EdU (Click-iT EdU Alexafluor 555 detection kit,

Invitrogen #c10338) in EM with 10% DMSO for 30 minutes at room temperature. The

fish were then fixed in 4% PFA in PBS with 116 mM sucrose and 150 µM CaCl2 at 4°C overnight.

Heat Shock Procedure

24 hpf Tg(hsp701:Shh:EGFP) and non-transgenic control embryos were placed in a 15mL conical tube in approximately 10mL of embryo medium and immersed in a 38°C water bath for 30 minutes after which they were allowed to recover at RT for one hour.

Heat shock was repeated 2-3 times before the embryos were placed in a Petri dish and

60

allowed to develop at 32°C overnight. Embryos were fixed at 72 hpf and processed for immunohistochemistry as described above.

Quantitative PCR

RNA was isolated from 15-20 pooled larvae for each control or experimental condition. Samples for each condition were collected in triplicate. Reverse transcription was performed using the iScript Reverse transcriptase supermix for RT-PCR (Biorad

1708840). Real time qPCR was performed in triplicate for each cDNA sample using an

Applied Biosystems StepOne Plus machine and software version 2.1. TaqMan Assays were used to detect patched1&2 (Dr03118687_m1), gli1 (Dr03093669_m1) and endogenous control rpl13a (Dr03101115_g1).

Quantification and Statistical Analysis

Cell counts were obtained by direct observation of sections using the microscopes described above. For Sox10, Sox2 and PH-3, 10 sections per embryo from 15 embryos per group with two or three replicates were counted to produce the average number per section. P values were generated using an unpaired t-test using GraphPad Prism software.

Quantification of Static Cilia Length and Rate of Formation in vivo

Timelapse imaging was performed on control and miR-219 injected embryos with frames captured at least every 17 minutes, for a total of 120 minutes. For both static and live cilia length measurements, primary cilia length was measured on maximum intensity projections in Volocity or in ImageJ using a custom script to automate use of the polyline tool. For live measurements, length was measured at every point after a cell divided, except for cases where the cilium reoriented along the z-axis which is difficult to measure accurately. The cilia length was binned into 17 minute intervals and averaged. The rate of

61

cilia formation was calculated between each binned time interval and significance was assessed with an unpaired t-test.

Results miR-219 Dampens Hedgehog Signaling

We previously showed that termination of neural progenitor divisions and subsequent neuronal and glial differentiation in zebrafish embryos is driven, in part, by negative regulation of Pard3 and Prkci by miR-219 (Hudish, Blasky, and Appel 2013).

Because Hh signaling is important for neural progenitor proliferation (Jensen and

Wallace 1997; Rowitch et al. 1999; Wechsler-Reya and Scott 1999), we postulated that apical Par polarity proteins maintain neural progenitors by promoting responsiveness to

Hh signals. To establish a baseline of Hh expression and response in zebrafish embryonic spinal cord, we used in situ RNA hybridization to detect expression of sonic hedgehog a

(shha) and patched1 (ptch1), which encodes a Hh receptor. ptch1 transcription is modulated by Hh signaling and ptch1 RNA can therefore be a readout for Hh pathway activity (Marigo and Tabin 1996). Floor plate cells expressed shha at 1 day post fertilization (dpf), but lacked any detectable levels by 3 dpf (Fig. 3.1A-C). At 1 and 2 dpf, cells surrounding the primitive lumen, which extends across the dorsoventral axis of the neural tube, expressed ptch1 (Fig. 3.1D,E). At 3 dpf, by which time the primitive lumen had transformed into a small, ventrally positioned central canal, only cells surrounding the central canal expressed ptch1 (Fig. 3.1F). These observations indicate that during early neural development, spinal cord cells located distantly from the floorplate are responsive to Hh signals whereas later, Hh response is limited to cells in the ventral spinal cord. Notably, this transformation of Hh response coincides with loss of

62

neuroepithelial characteristics, reduction in neural progenitor number and neuronal and glial differentiation (Hudish, Blasky, and Appel 2013).

If miR-219 promotes neural progenitor differentiation by reducing apical Par polarity proteins and, consequently, Hh signaling, then miR-219-deficient embryos should have altered levels of Hh response. To test this prediction, we injected embryos with antisense morpholino oligonucleotide designed to block miR-219 function (Zhao et al. 2010; Hudish et al. 2013) and assessed expression of ptch1 by in situ RNA hybridization. Whereas only ventral spinal cord cells of control embryos expressed ptch1

RNA at 3 dpf, more dorsally positioned cells of similarly staged miR-219 MO-injected embryos expressed ptch1 RNA (Fig. 3.1G,H). To validate this observation, we used quantitative RT-PCR (qPCR) with a probe that measures the combined levels of ptch1 and ptch2 (ptch1/2) RNA. This revealed that ptch1/2 transcripts were approximately three times more abundant in miR-219 deficient embryos than in control embryos (Fig. 3.1I).

Additionally, we assessed the levels of gli1 RNA, which is also a transcriptional target of

Hh signaling activity (Rowitch et al. 1999). Embryos lacking miR-219 function had more gli1 transcripts than control embryos (Fig. 3.1I). Thus, we conclude that spinal cords of miR-219 deficient embryos maintain elevated Hh signaling activity into a late stage of embryonic development, consistent with the possibility that miR-219 regulates neural progenitor differentiation by regulating Hh signaling response. miR-219 Promotes Neural Progenitor Differentiation by Reducing Hedgehog

Signaling

We previously showed that reduction in miR-219 function resulted in maintenance of apical Par protein expression in the dorsal spinal cord and elevated numbers of

63

Figure. 3.1. miR-219 Reduction Causes Persistent Hedgehog Signaling (A-H) All images show representative transverse sections through trunk spinal cord with dorsal up. Dashed circles outline spinal cords and brackets indicate RNA expression domains. (A-C) In situ RNA hybridization to detect shha expression in wild-type embryos reveals high levels at 1 dpf, decreased expression by 2 dpf and undetectable levels by 3 dpf. (D-F) In situ RNA hybridization to detect ptch1 transcripts in wild-type embryos reveals expression throughout the entire dorsoventral axis of the spinal cord at 1 and 2 dpf. By 3 dpf expression is confined to an area bordering the ventrally located central canal. (G and H) 3 dpf control (G) and miR-219 MO-injected (H) embryos processed to detect ptch1 RNA. ptch1 expression persists in dorsal spinal cord of the miR-219 deficient embryo. (I) Graph showing that 3 dpf miR-219 MO-injected larvae express ptch1/2 and gli1 RNA at higher levels than stage-matched controls. Data represent the mean ± SEM (n = 3 replicate experiments, consisting of 15-20 larvae, each) Significance calculated using an unpaired-t test.

64

proliferating neural progenitors (Hudish, Blasky, and Appel 2013). Do these features of the miR-219 loss of function phenotype result from elevated Hh signaling? To test this possibility, we treated miR-219 MO-injected and control embryos with Cyclopamine, a molecule that inhibits Hh pathway activation by binding to Smoothened (J. K. Chen et al.

2002). Treatment of wild-type embryos with Cyclopamine beginning at 24 hpf did not change the localization of apical proteins ZO-1 (Fig. 3.2A,B,R) or Prkci (Fig. 3.2E,F,S), which both outlined the small, ventrally positioned central canal. Consistent with our previous data (Hudish, Blasky, and Appel 2013), miR-219 deficient embryos had enlarged lumens that extended into the dorsal spinal cord and were outlined by apical

ZO-1 (Fig. 3.2C) and Prkci localization (Fig. 3.2G). By contrast, lumen size and apical protein localization in miR-219 MO-injected embryos treated with Cyclopamine were more similar to that of wild-type control embryos (Fig. 3.2D,H). To quantify these changes, we categorized the dorsal extent of ZO-1 and Prkci lumenal localization as severe, mild and normal. Similar to our previous findings (Hudish, Blasky, and Appel

2013) ZO-1 and Prkci lumenal localization extended into the dorsal spinal cords of miR-

219 MO-injected embryos, which we categorized as severe phenotypes (Fig. 3.2R,S). By contrast, miR-219 MO-injected embryos treated with Cyclopamine had milder ZO-1 and

Prkci localization phenotypes (Fig. 3.2R,S). These data raise the possibility that high levels of Hh signaling maintain neuroepithelial characteristics, including apical membrane protein localization, in the dorsal spinal cord.

To test whether or not the excess number of neural progenitors of miR-219- deficient embryos also results from elevated Hh signaling, we performed immunohistochemistry to detect expression of Sox2, a marker of neural progenitors (Ellis

65

et al. 2004). In 3 dpf wild-type embryos, Sox2+ cells surrounded the central canal and occupied intermediate positions of the spinal cord, just dorsal to the central canal (Fig.

3.2I). Wild-type embryos treated with Cyclopamine from 24 hpf had similar numbers of

Sox2+ cells (Fig. 3.2J,T). Similar to our previous report (Hudish, Blasky, and Appel

2013), miR-219 MO-injected embryos had more Sox2+ cells, and these were distributed across the dorsoventral axis of the spinal cord (Fig. 3.2K,T). Cyclopamine-treated miR-

219 MO-injected embryos had fewer Sox2+ cells than untreated miR-219 MO-injected embryos, but slightly more than control and cyclopamine-treated wild-type embryos (Fig.

3.2L,T). Furthermore, immunohistochemistry to detect phosphohistone H3 (PH3), which reveals cells in mitosis, showed that whereas miR-219 MO-injected embryos had significantly more PH3+ cells than control embryos (Fig. 3.2M-O), Cyclopamine treated, miR-219 MO-injected embryos had approximately the same number of PH3+ cells as control embryos (Fig. 3.2P,U). Thus, Hh inhibition suppresses the excess neural progenitor phenotype of miR-219 deficient embryos, consistent with the possibility that miR-219 promotes neural progenitor cell cycle exit and differentiation, at least in part, by dampening Hh signaling.

To further investigate the relationship between miR-219 function and Hh signaling, we tested the prediction that artificially elevating Shh expression would phenocopy the loss of miR-219 function. To do so, we used the transgenic line

Tg(hsp701:Shhaa:EGFP) (Shen et al. 2013), which expresses Shh fused to EGFP under control of heat-responsive DNA elements, to temporally regulate Hh signaling levels

(Shh HS). We allowed the fish to develop normally until 24 hpf at which time they were

66

Figure. 3.2. miR-219 Mediated Neural Progenitor Maintenance Requires Hedgehog Signaling

67

Figure. 3.2. miR-219 Mediated Neural Progenitor Maintenance Requires Hedgehog Signaling (A-P) All images show representative transverse sections through trunk spinal cords of 3 dpf embryos with dorsal up. Dashed circles outline spinal cords and brackets indicate central canals/primitive lumens highlighted by ZO-1 and Prkci localization. ZO-1 (A-D) and Prkci (E-H) localization at apical membranes detected by immunohistochemistry. In wild-type (A,E) and Cyclopamine-treated wild-type (B,F) embryos, ZO-1 and Prkci are localized to apical membranes surrounding a small, ventrally positioned central canal. miR-219 MO-injected embryos have primitive lumens, decorated by ZO-1 and Prkci, that extend across the dorsoventral length of the spinal cord (C,G). Cyclopamine treatment suppresses the lumenal and apical protein localization phenotype of miR-219 MO-injected embryos (D,H). (I-L) Spinal cord progenitors revealed by Sox2 immunohistochemistry. Cyclopamine treatment suppresses the excess progenitor phenotype of miR-219 MO-injected embryos. (M-P) Dividing spinal cord cells revealed by PH3 immunohistochemistry. Cyclopamine treatment suppresses the excess dividing cell phenotype of miR-219 MO-injected embryos. (R) Graph showing quantification of the ZO-1 phenotype. Embryos classified as normal had ZO-1 expression around the ventrally located central canal. Embryos were classified as severe when ZO-1 localization spanned the entire dorsoventral axis and mild when it spanned an intermediate length. Data represent the mean ± SEM (n = 15 larvae for each group).p values were calculated by comparing the numbers of larvae with severe and mild phenotypes in miR-219 MO alone and the miR-219 MO + Cyclopamine experiments. p<0.0001 for the severe group and p=0.0062 for the mild group, unpaired-t test. (S) Graph showing quantification of the Prkci phenotype. Embryos were scored as in (R). Data represent the mean ± SEM (n = 15 larvae for each group). p<0.001 for the severe group and p=0.0033 for the mild group, unpaired-t test. (T) Graph showing the number of Sox2+ progenitors. Data represent the mean ± SEM (n=15 embryos per group). Significance calculated using an unpaired-t test. (U) Graph showing the number of PH3+ cells in wild-type control, wild-type + Cyclopamine, miR-219 MO and miR-219 MO + Cyclopamine larvae. Data represent the mean ± SEM (n=15 sections obtained from 5 larvae per group, with three replicates). Significance calculated using an unpaired-t test.

68

placed at an elevated temperature for 30 min. At 3 dpf, Sox2+ cells lined the ventral central canal of control embryos (Fig. 3.3A). By contrast, Shh-overexpressing embryos had excess Sox2+ cells, which lined the entire dorso-ventral axis of the medial spinal cord

(Fig. 3.3B). Quantification of the Sox2+ cells revealed a two-fold increase in Shh- overexpressing embryos when compared to control (Fig. 3.3C). Additionally, spinal cord cells of embryos induced to express Shh-EGFP incorporated more EdU, a thymidine analog used to detect cells in S phase of the cell cycle, than control embryos (Fig. 3.3D-

F). The spinal cord lumens of embryos induced to express Shh-EGFP were enlarged and outlined by apical ZO-1 (Fig. 3.3G,H) and Prkci localization (Fig. 3.3I,J), indicating that more cells maintained apical membrane. Thus, similar to loss of miR-219 function, prolonged and elevated Shh expression maintained neuroepithelial characteristics, consistent with the possibility that miR-219 negatively regulates Hh signaling.

Apical Par Proteins Mediate the Effects of miR-219 Function on Hedgehog Signaling

Our data are consistent with an interpretation that miR-219 drives neural progenitor cell cycle exit and differentiation by dampening Hh signaling. Previously, we presented evidence the miR-219 negatively regulates the apical Par polarity proteins

Pard3 and Prkci (Hudish, Blasky, and Appel 2013). Together, these observations raise the possibility that miR-219 suppresses Hh signaling in the neural tube by suppressing Pard3 and Prkci. To investigate this possibility, we blocked access to the miR-219 target site on both pard3 and prkci 3’UTRs. To do this, we used target protector MOs (TP MOs), which bind to the miR-219 target sites on either pard3 or prkci mRNAs (Hudish, Blasky, and Appel 2013), rendering miR-219 unable to bind to pard3 or prkci mRNAs.

69

Figure.3.3 Sonic Hedgehog Overexpression Phenocopies Loss of miR-219 Function Control (A,D,G,I) and heat-shocked Tg(hsp701:Shhaa:EGFP) (Shh HS) (B,E,H,J) embryos shown in transverse section with dorsal up. Dashed circles outline the spinal cord and brackets indicate the central canal/primitive lumen. (A,B) Immunohistochemistry to detect neural progenitors, marked by Sox2 expression. (C) Graph showing the number of Sox2+ cells in control and Shh-overexpressing embryos. Data represent the mean ± SEM (n=15 embryos per group from 3 independent experiments). Significance calculated using an unpaired-t test. (D and E) Edu incorporation to detect dividing neural progenitors. (F) Graph showing the number of EdU+ cells in the spinal cord at 3 dpf. Data represent the mean ± SEM (n = 20 embryos per group). Significance calculated using an unpaired-t test. (G,H,I and J) 3 dpf Shh-overexpressing embryos maintain a primitive lumen marked by apically localized ZO-1 and Prkci.

70

pard3 TP MO-injected embryos expressed ptch1 RNA in dorsal spinal cord, in contrast to control embryos where only cells lining the central canal expressed ptch1 RNA (Fig.

3.4A,B). Although prkci TP MO had little apparent effect on the distribution of ptch1

RNA assessed by RNA in situ hybridization (Fig. 3.4C), qPCR revealed that embryos injected with pard3 TP MO and prkci TP MO had significantly elevated levels of ptch1/2 and gli1 transcripts (Fig. 3.4D). Therefore, blocking interaction of miR-219 with its pard3 or prkci target sites elevated ptch1/2 and gli1 transcript levels, supporting the hypothesis that maintenance of apical Par proteins promotes Hh signaling levels.

Our data indicate that elevated Pard3 and Prkci expression in miR-219 deficient embryos elevates Hh signaling in the spinal cord. To investigate whether or not apical Par protein functions are necessary for Hh signaling, we first compared ptch1 RNA expression in wild-type and prkci mutant (Horne-Badovinac et al., 2001) embryos. Cells along the entire dorso-ventral axis expressed ptch1 RNA in wild-type embryos at 2 dpf

(Fig. 3.4E) whereas only a few cells located in the ventral spinal cords of 2 dpf prkci mutant embryos expressed ptch1 RNA (Fig. 3.4F). By 3 dpf only cells in the ventral spinal cord of wild-type embryos expressed ptch1 RNA (Fig. 3.4G) and 3 dpf prkci mutant embryos expressed little or no ptch1 RNA (Fig. 3.4H). Thus, Prkci function is necessary for Hh signaling in the spinal cord, consistent with the possibility that modulation of apical Par protein levels by miR-219 modulates Hh signaling level. To determine whether or not the elevated Hh signaling of miR-219 deficient embryos results from elevated apical Par protein levels, we injected miR-219 MO into prkci mutant embryos. In contrast to miR-219 MO-injected wild-type embryos, which expressed ptch1 at elevated levels (Fig. 3.1H), miR-219 MO-injected prkci mutant embryos expressed

71

Figure.3.4. Apical Par Proteins Mediate the Effects of miR-219 Function on Hedgehog Signaling (A-C) in situ RNA hybridization to detect ptch1 expression in 3 dpf control, pard3 TP MO-injected and prkci TP MO-injected embryos. Dashed circles outline the spinal cord and brackets mark ptch1 expression domain. (D) Graph showing relative ptch1/2 and gli1 RNA levels measured by qPCR. Data represent the mean ± SEM (n = 3-5 experimental replicates, consisting of 15-20 pooled embryos). Significance calculated using an unpaired-t test. (E, F, G-I) in situ RNA hybridization reveals reduced ptch1 levels in 2 dpf and 3 dpf prkci mutant embryos and prkci mutant embryos injected with miR-219 MO. (J) Graph showing relative ptch1/2 and gli1 expression levels measured by qPCR. Data represent the mean ± SEM (n = 3 replicates consisting of 15-20 pooled embryos, each). Significance calculated using an unpaired-t test.

72

ptch1 similarly to non-injected prkci mutant embryos (Fig. 3.4I). To further test this hypothesis we assessed transcript levels of ptch1/2 and gli1 by qPCR. Reduction of miR-

219 in prkci mutant embryos had little to no impact on ptch1/2 or gli1 mRNA levels (Fig.

3.4J), supporting the hypothesis that miR-219 modulates Hh signaling levels through its regulation of apical Par proteins. Together with the data presented above, these results provide evidence that miR-219 dampens Hh signaling in the zebrafish spinal cord by reducing apical Par protein levels.

Apical Par Proteins Regulate Ciliogenesis

Our data support the hypothesis that reduction of apical Par proteins near the end of embryogenesis reduces Hh signaling response, thereby triggering exit of neural progenitors from the cell cycle. What remains unclear, however, is how apical Par proteins regulate Hh signaling. Because primary cilia are known signaling centers for Hh signaling and they are located on the apical membranes of vertebrate cells, we predicted that apical Par proteins positively regulate ciliogenesis. To test this we evaluated cilia length using transgenic Tg(βact::arl13b–GFP) zebrafish, which express the ciliary protein Arl13b fused to GFP under the control of actb1 (β-actin) regulatory DNA

(Borovina et al. 2010). We injected Tg(βact::arl13b–GFP) embryos with miR-219 MO and found that cilia were significantly longer than cilia in control embryos (Fig.

3.5A,B,D). By contrast, cilia were significantly shorter in prkci mutant embryos than in control embryos (Fig. 3.5C,D). Are cilia longer in miR-219-deficient embryos because apical Par proteins are elevated? To test this possibility we injected prkci mutant embryos with miR-219 MO. Cilia length in miR-219, prkci deficient embryos was similar to that of uninjected prkci mutant embryos (Fig. 3.5D), suggesting that miR-219 modulation of cilia

73

length is mediated by apical Par protein function. To test whether or not miR-219 regulates cilia lengthening via its apical Par protein targets, we injected embryos with miR-219 target protector MOs and measured cilia length. Injections of both prkci TP MO and pard TP MO resulted in longer cilia (Fig. 3.5E), similar to loss of miR-219. These data indicate that miR-219 downregulation of apical Par polarity proteins reduces primary cilia length, which could modulate Hh signaling response.

Because the rate or timing of cilia formation relative to cell division might influence Hh signaling, we performed live imaging to directly observe cilia growth over time. To do this we created the constructs sox19a:arl13b-GFP and sox19a:mCherry-

CaaX, which use sox19a regulatory DNA to express cilia and membrane markers in neural progenitors. We co-injected these constructs into newly fertilized zebrafish eggs and screened the embryos at 24 hpf for doubly labeled spinal cord cells, which we then followed using time-lapse confocal microscopy. As cells divided, cilia were retracted

(Fig. 3.5G-I) and then quickly reformed (Fig. 3.5K). By measuring the rate of cilia regrowth following division, we found that cilia extended more rapidly in miR-219 MO- injected embryos than in control embryos (Fig. 3.5N). Consistent with the static cilia length measurements above (Fig. 3.5A,D), the cilia also were longer in miR-219 MO- injected embryos at the end of the imaging period (Fig. 3.5N).

Our data provide evidence that miR-219 downregulation of apical Par proteins reduces cilia growth rate and length, dampens Hh signaling response and promotes neural progenitor differentiation. Does modulation of cilia dynamics account for modulation of

Hh signaling and progenitor differentiation? Mouse embryos lacking cilia are nearly

74

Figure. 3.5. Apical Par Proteins Regulate Ciliogenesis

75

Figure. 3.5. Apical Par Proteins Regulate Ciliogenesis (A, B and C) Lateral images of living 3 dpf Tg(βact::Arl13b–GFP) embryos, focused on the trunk spinal cord. Scale bar equals 20 µm. Brackets mark the spinal cord (sc) and outlined boxes show digital enlargements of cilia. Scale bar equals 1 µm. (D) Graph showing cilia length. Data represent the mean ± SEM (n=30 embryos from 3 independent experiments for each group, and10-30 cilia measured in each embryo). Significance calculated using an unpaired-t test. (E) Graph showing cilia length in 3 dpf control, pard3 TP MO-injected and prkci TP MO-injected embryos. Data represent the mean ± SEM (n=30 embryos from 3 independent experiments for each group, and 10-30 cilia measured in each embryo). Significance calculated using an unpaired-t test. (F-M) Confocal images captured from timelapse movies of dividing cells in the trunk spinal cord of a control embryo, beginning at 24 hpf. Time elapsed from the start of the movie is indicated on each panel. Cilia are labeled by Arl13b-EGFP and cell membranes are marked by membrane-tethered mCherry. Scale bar equals 10 µm. Outlined boxes show digital enlargements of cilia. Scale bar equals 1 µm. (N) Graph showing average cilia length (µm) over 120 min and outlined boxes show digital enlargements of cilia. The 0 min timepoint corresponds to the 88 min timepoint in panel J. Slope shows the rate of cilia growth is greater in miR-219 MO-injected embryos than in controls. Data represent the mean ± SEM (n=7 cells from 7 embryos). Significance calculated using unpaired t-test. ** p=0.01959 and * p=0.0527

76

devoid of Hh signaling (Huangfu et al. 2003; May et al. 2005). By contrast, Hh signaling in zebrafish embryos lacking cilia show no detectable changes in levels of Hh signaling

(Lunt, Haynes, and Perki ns 2009), or slightly lower levels than in wild-type embryos

(Huang and Schier 2009b), raising the possibility that in zebrafish cilia promote efficient

Hh signaling but are not necessary for it. Consistent with this, we found that 3 and 5 dpf dzip1 mutant embryos, which have short primary cilia and reduced Hh signaling (Arnold et al. 2015; Sekimizu et al. 2004; Wolff et al. 2004) had similar numbers of Sox2+ and

PH3+ spinal cord cells as wild type (Fig. 3.6A-H). Therefore, whereas our data indicate that apical Par proteins are required for spinal cord Hh signaling, we conclude that apical

Par protein-mediated Hh signaling necessary for neural progenitor maintenance is largely independent of ciliogenesis.

Discussion

A key element of brain size and complexity is the regulated transition of dividing neural progenitors to differentiated neurons and glia. Neuroepithelial progenitors have apicobasal polarity, which can determine how progenitors respond to extracellular signals by subcellularly localizing signal reception and processing machinery. With this manuscript we provide evidence that miR-219-mediated downregulation of apical Par polarity proteins helps trigger the transition from proliferation to differentiation by diminishing progenitor response to Shh.

Because Shh reception and signal processing occur at apically positioned primary cilia of vertebrate epithelial cells, we reasoned that one way that the proliferation to differentiation transition could be controlled is through regulation of apical membrane characteristics. Consistent with this, apical Par proteins localized to and promoted

77

Figure. 3.6 Cilia Mutants Exhibit Normal Numbers of Neural Progenitors

(A-H) All images show representative transverse sections through trunk spinal cords of 3 and 5 dpf embryos with dorsal up. Dashed circles outline spinal cords. Representative images of control embryos at 3 dpf (A,B) and 5 dpf (C,D). Immunohistochemistry to detect neural progenitors marked by Sox2 expression (A,C) and phosphohistone 3 (PH3) to detect cells undergoing mitosis (B,D). dzip mutant embryos were also labeled with Sox2 at 3 dpf (E) and 5 dpf (G) and PH3 at 3 dpf (F) and 5 dpf (H) (n=5 embryos).

78

formation of cilia in cultured cells (Fan et al. 2004; Sfakianos et al. 2007) and reduction of Pard3 function reduced the length of photoreceptor cell cilia in zebrafish embryos

(Krock and Perkins 2014). In zebrafish embryos, Prkci and Pard3 localize to the apical membranes of dividing spinal cord progenitors but become depleted as the progenitors differentiate (Hudish et al. 2013; A. Ravanelli and B. Appel-in press: Genes and

Development). These observations raise the possibility that modulation of apical Par protein abundance and localization can tune Hh signaling response by modulating ciliogenesis or other apical membrane characteristics.

Following our previous work showing that miR-219 promotes spinal cord progenitor differentiation by down regulating Pard3 and Prkci (Hudish, Blasky, and

Appel 2013), we began this study by investigating whether or not miR-219 function regulates Hh signaling. Indeed, loss of miR-219 function elevated Hh signaling response, but only if Par protein functions were intact. Although miR-219 potentially targets many

RNAs, the results of our pard3 and prkci target protector MO experiments provide compelling evidence that miR-219-mediated Hh signaling is determined primarily by regulation of Pard3 and Prkci levels. miR-219-deficient embryos maintained excess spinal cord progenitors, but only if Hh signaling was intact, and forced expression of Shh phenocopied miR-219 loss of function. Our data also revealed that inhibition of Hh signaling depleted Prkci from apical membranes of dorsal spinal cord cells, raising the possibility that apical Par proteins and Hh signaling engage in a positive regulatory loop to maintain neural progenitors. Consistent with this possibility, recent data show that Gli1 promotes prkci transcription by directly binding DNA regulatory elements (Atwood et al.

2013). Altogether our observations suggest that miR-219 breaks the positive feedback

79

loop between apical Par proteins and Hh signaling to initiate neural progenitor differentiation.

A potential mechanistic link between apical Par protein function and Hh signaling was uncovered by our time-lapse imaging studies of ciliogenesis. In particular, reducing miR-219 function and blocking access of miR-219 to its target sites on pard3 and prkci mRNAs increased the length of spinal cord primary cilia and the rate at which spinal cord progenitors elongated cilia. Thus, longer and faster forming primary cilia correlated with elevated Hh signaling. By contrast, prkci mutant embryos had shorter cilia, correlating with reduced Hh signaling. These observations suggested the intriguing possibility that cilia dynamics, regulated by apical Par proteins, tunes Hh signaling strength and thereby determines progenitor fate. However, we found that dzip1 mutant embryos, which lack primary cilia (Arnold et al. 2015; Sekimizu et al. 2004; Wolff et al. 2004), had apparently normal numbers of spinal cord progenitors, suggesting that Par protein-mediated modulation of Hh signaling might occur, in part, independently of ciliogenesis.

How else might apical Par proteins promote Hh signaling? One possibility is that they do so by regulating Notch signaling, which can maintain neural progenitor fate. In support of this, depletion of Pard3 from developing mouse neocortex reduced Notch signaling and caused dividing cells to undergo neuronal differentiation (Bultje et al.

2009). Pard3 binds Numb (Nishimura and Kaibuchi 2007), which negatively regulates

Notch activity (Knoblich, Jan, and Jan 1995; Rhyu, Jan, and Jan 1994), and Numb and

Numb-like are required for Pard3 regulation of Notch in the mouse neocortex (Bultje et al. 2009). Thus, Pard3 might promote Notch signaling and progenitor fate by preventing

Numb and Numb-like from blocking Notch activity. Notably, recent data indicate that

80

Notch signaling promotes Hh signaling in the neural tube by promoting localization of

Ptch1 and Smo to cilia and cilia length (Kong et al. 2015; Stasiulewicz et al. 2015).

Additionally, studies of basal cell carcinomas revealed that Prkci can phosphorylate and activate Gli1, thereby potentiating Hh signaling (Atwood et al. 2013). Similarly, in flies, aPKC, a Prkci homolog, can phosphorylate and activate Smo and the Gli homolog Ci, leading to expression of Hh target genes expression, including aPKC (Jiang et al. 2014).

Thus, the apical Par polarity protein complex might regulate Hh signaling directly, via

Gli1 activation, and indirectly, via modulation of cilia dynamics. The role of cilia in mediating Hh signaling appears to differ in mice and zebrafish in that defective ciliogenesis significantly abrogates Hh signaling in mice (Huangfu et al. 2003; May et al.

2005) whereas it dampens, but also expands, Hh signaling in zebrafish (Glazer et al.

2010; Huang and Schier 2009b). Perhaps the relative roles of direct and indirect modulation of Hh signaling by apical Par proteins differs in mice and zebrafish, accounting for distinct cilia defect-associated phenotypes.

Altogether our data suggest that apical Par polarity proteins and Hh signaling engage in positive feedback regulation to maintain neural progenitors in a dividing, undifferentiated state. Initiation of miR-219 expression during late stages of spinal cord development (Hudish, Blasky, and Appel 2013) appears to break the feedback loop cycle by depleting apical Par proteins, which dampens Par protein-dependent Hh signaling activity. Some childhood medulloblastomas express miR-219 at abnormally low levels relative to neural stem cells (Ferretti et al. 2009; Genovesi et al. 2011), raising the possibility that failure to break a Par protein-Hh signaling feedback loop can contribute to tumor formation.

81

CHAPTER IV

CONCLUSIONS AND FUTURE DIRECTIONS

Conclusions

In early CNS development, the neural progenitor population undergoes rapid expansion to produce a large progenitor pool. After this initial period of division, progenitors exit the cell cycle and begin a unique developmental program allowing them to differentiate and give rise to highly specialized neurons and glia. In this thesis I describe mechanistic details important for this transition that were previously unknown.

In the second chapter I addressed the mechanism of apical Par proteins downregulation in neural progenitors. The intrinsic polarity of the neuroepithelium plays a crucial role during the development of the CNS. For example, apical Par proteins have been described to play critical roles in neural progenitor maintenance, such that their inheritance within a daughter cell resulted in that daughter cell remaining in a progenitor state. However, what remained unclear was how these proteins became downregulated after the initial period of neural progenitor expansion in order to allow for cells to exit the progenitor pool and differentiate into neurons and glia. In this study I described a novel mechanism by which miR-219, a CNS specific microRNA, inhibits the expression of both pard3 and prkci and I showed that this inhibition is necessary for neural progenitors to exit the cell cycle and differentiate. Reduction of miR-219 function in developing zebrafish embryos resulted in a large expansion of the neural progenitor population at the expense of differentiated cell types. My study provides a novel and important mechanism for the transition of neural progenitor from proliferation to differentiation, a transition

82

that is critical for proper development of the CNS and was poorly understood prior to this report. This finding is also relevant for human disease, because miR-219 is conserved between zebrafish and humans, and was found to be significantly downregulated in human medulloblastoma samples (Ferretti et al. 2009). My model therefore provides a mechanism of action for how loss of miR-219 results in overproliferation of neural progenitors in diseases such as medulloblastoma. Based on these findings I propose that near the end of embryogenesis, miR-219 inhibition of apical Par proteins translation depletes them from dividing neural progenitors and causes them to exit the cell cycle and differentiate. This study provides an important mechanistic detail of how apical Par protein are downregulated, which was previously not known as well as supports the self- renewing role of apical Par proteins in the developing zebrafish neural tube.

An important question that still remained was how apical Par proteins maintain neural progenitors in a proliferative state. I found that miR-219 deficient embryos had significantly higher levels of Sonic Hedgehog (Shh) signaling components, in addition to increased expression of apical Par proteins when compared to controls. Thus, my next steps were to test whether Shh signaling was downstream of miR-219 and whether this was dependent on apical Par proteins. Using prkci mutant embryos, I found that Shh signaling levels were decreased when apical Par proteins were decreased, suggesting that apical Par proteins influence Shh signaling levels. Based on these findings, I wanted to further investigate how apical Par proteins could be affecting the levels of Shh signaling.

To do this I assessed whether the primary cilia, the organelle known to have a critical role in vertebrate Shh signaling, was affected by modulation of apical Par protein levels.

Primary cilia are located at the apical membrane and recent reports have shown a

83

necessity for Par3 in cilia formation in cultured cells (Sfakianos et al. 2007) and zebrafish photoreceptors (Krock and Perkins 2014). I found that in the developing neural tube, cilia length changed upon modulation of apical Pars, with longer cilia present in miR-219 deficient embryos and shorter cilia in prkci mutant embryos. However, when I analyzed dzip mutant embryos, which lack primary cilia, I found that they retained low levels of

Hh signaling and their neural progenitor population was unaffected. These data suggest that in zebrafish cilia augment Hh signaling but might not be necessary for it to occur, at least at low levels. We propose that miR-219 helps to initiate the transition of progenitors from proliferation to differentiation by dampening apical Par protein-dependent Hh signal transduction, which might occur, at least in part, by regulating ciliogenesis.

Discussion

Despite my advances in understanding some of the mechanisms that govern the regulation of apical Par proteins and their roles in cell fate decisions, there are still many unknowns that need to be addressed. One of the main models that addresses how apical

Par proteins influence cell fate decisions is related to their asymmetric inheritance during asymmetric cell divisions of neural progenitors. This model holds true for Drosophila neuroblast divisions, where one cell inherits the entire apical domain with all apical proteins, while another inherits only the basal domain and this different inheritance pattern dictates their cell fate. When this model was tested in vertebrates, it turned out to be much more complicated. Here, cells failed to divide at an exclusively perpendicular or parallel plane, but instead divided at many other intermediate planes. This resulted in inheritance of various levels of apical and baso-lateral components and which raised the possibility that apical Par protein inheritance might not be the only cell fate determinant.

84

My observations that apical Par proteins disappear from the dorsal spinal cord after the initial period of neural progenitor expansion, correlating with the initiation of differentiation, lead to a different model of cell fate decision control. In this model, the progenitors in the dorsal spinal cord downregulate apical polarity proteins and undergo symmetric differentiative divisions, giving rise first to neurons and later to glia. The progenitors in the ventral spinal cord that maintain their polarity and line the central canal might correspond to the adult progenitor population. This idea is supported by my data showing that maintenance of apical Par protein expression in the dorsal spinal results in maintenance of highly proliferative neural progenitors, at the expense of late born neurons and glia. However, further fate-mapping of the progenitor populations from the dorsal and ventral spinal cord is necessary to support this model.

An important question that still remains is how miR-219 regulation of apical Par proteins is itself controlled within different cell types and at various times during development, since miR-219 and Par proteins are expressed throughout the spinal cord of zebrafish embryos. One possibility is that miR-219 regulation on apical Par proteins is time dependent, and during later stages of development and into adulthood, miR-219 action on apical Par proteins is inhibited. This could occur through protection of the

3’UTR site by chaperone proteins or the 3’UTR could be shortened and the miR-219 binding site could be lost. To address the cell specificity, one possibility is that different cell types could also segregate their RNAs in different areas of the cell, so that miR-219 no longer has access to the apical Par protein mRNAs. It is also possible that there are different RISC binding partners within each different cell type, which confers it specificity in order to direct miR-219 to different target mRNAs at different times within

85

development or within a cell type. The role of miRNAs in development and disease has been clearly established in the last decade, but much remains unknown about their regulation and their biologically relevant targets.

The topic of polarity and cell fate decisions has been extensively studied in many different model systems. My findings generally support the data in flies and mammals but are intriguingly opposite of the previously published zebrafish data, in which the authors observed that inheritance of apical Par proteins, specifically Pard3, resulted in differentiation of neurons (Alexandre et al. 2010), not self-renewal. This could be due to the timepoint analyzed or to the location of the cell within the developing neural tube, because as was discussed before, different cell types in different areas and at various timepoints could respond differently to the same cues. Another possibility is that the overexpression of Pard3, which was used in this study, caused different behaviors of the neural progenitors. I have found that overexpression of a similar Pard3:EGFP construct resulted in very rapid degradation of the excess Pard3 proteins in addition to strong morphological changes within the embryos when the dose was high. This indicates that the levels of Pard3 are very tightly regulated and overexpression studies should be analyzed very carefully.

When searching for possible pathways downstream of apical Par proteins or miR-

219, I found that mouse embryos which ectopically expressed Shh during embryonic stages had very similar phenotypes to my miR-219 morphants (Rowitch et al. 1999). In this study, the authors showed that ectopic Shh expression resulted in neural progenitor proliferation at levels twice as high as littermate controls. The authors also noted the decrease in differentiated neurons and glia in these animals, but no changes in Isl-1+

86

motor neurons (Rowitch et al., 1999). This was one the first studies to address the mitogenic roles of Shh during early CNS development. Intriguingly, their observations were completely in line with ours, which led me to the hypothesis that miR-219 reduction results in increased Shh signaling. My studies from chapter III now provide a new link between apical Par proteins and Shh signaling regulation and provide not only a mechanistic model for how apical Par proteins are affecting cell fates through their regulation of Shh signaling, but also how Shh signaling becomes dampened at the end of early embryonic stages. However, a big question still remains of how Shh signaling can act both as a morphogen and a mitogen during similar developmental timepoints. Studies have shown that the mitogenic capabilities of Shh are reduced after embryonic stages in mouse (Fuccillo, Joyner, and Fishell 2006; Rowitch et al. 1999) which supports the possibility that cells are only sensitive to its mitogenic effects early on but lose that sensitivity later. However, early neuronal cells, such as motor neurons, are induced by high levels of Shh signaling (Litingtung and Chiang 2000) during similar developmental timepoints when Shhs’ mitogenic effects are strong. This suggests at least a couple different possibilities: first, that the ventral neuronal progenitor pool exposed to high levels of Shh can differentially respond in a cell autonomous fashion to these signals and either give rise to motor neurons, or proliferate. A second possibility is that instead of one progenitor pool, there are multiple pools and each respond to the Shh signal in a variety of ways, such that a subset of progenitors continues to proliferate, while others give rise to motor neurons in response to a similar dose of Shh. New evidence from our lab and others now supports the possibility that instead of a common progenitor pool that gives rise to neurons and later glia, as previously thought, there are multiple progenitor pools

87

that are somewhat restricted to giving rise to neurons or glia, or continuing to be maintained as the adult progenitor pool (Grove et al. 1993; Luskin, Parnavelas, and

Barfield 1993; McCarthy et al. 2001).

One way progenitors might be capable of differentially responding to Shh signaling levels is by utilizing methods to enhance or dampen the level of signaling that they receive. In chapter III I provide evidence for a cilia dependent dampening model in which cells modulate the level of Shh signal they receive by modulating the size of their primary cilia. I show that changes in cilia length result in changes in cell fate decisions.

This is an intriguing and still controversial topic due to the little information known about cilia dynamics in vivo. More about cilia is addressed in the future directions paragraph below.

Another possibility is that cells use other pathways to dampen or enhance their ability to respond to Shh signaling. One such interaction has been described first in 2011 in the developing mouse neocortex. In this study, activation of the Shh signaling pathway in neural progenitors resulted in their increased proliferation and improper patterning.

This was rescued upon reduction of Notch signaling, suggesting that the two pathways can interact to control neural progenitor proliferation and differentiation (Dave et al.

2011). A second study reported similar findings and additionally introduced a mechanism by which Notch signaling controls Smo and Ptch1 recruitment to the cilia to affect the ability of cells to respond to Shh ligand (Kong et al. 2015). In my own unpublished work

I found that inhibition of Notch signaling in miR-219 morphants resulted in the reduction of neural precursor numbers (Figure A.1.A,B) and the presence of dorsally located apical polarity proteins (Figure A.1.C,D). These data suggested that Notch signaling could be

88

acting downstream of miR-219 to maintain neural precursors in their proliferative state.

However, at the time, using a Notch reporter fish Tg(Tp1bglob:hmgb1-mCherry)

(Parsons et al. 2009) I was unable to detect any Notch signaling changes when miR-219 was reduced (Figure A.1.E,F) which led me to conclude that Notch may play a role in this phenotype but it might be through a parallel pathway. However, together with the data presented above and my data from chapter III, it is now possible that Notch acts upstream of Shh, independent of miR-219 but still capable of influencing cell fates through Shh (Figure 4.1). New pathway analysis of microarray data from miR-219 deficient embryos shows that the most highly upregulated pathway is Notch signaling

(Figure A.2). This finding supports the possibility that miR-219 regulates

Notch

miR-219 Apical Par Shh proteins

Differentiation

Figure 4.1. Model depicting Notch and Shh interaction to control neural progenitor differentiation and maintenance.

Notch signaling, however more data is needed to determine whether this is a direct or an indirect effect. Evidence that Pard3 can bind Numb, a negative regulator of the Notch pathway (Bultje et al. 2009), raises the possibility that miR-219 could be acting through apical Par proteins to affect Notch signaling. Regardless of whether this is a direct or

89

indirect effect, it is an intriguing possibility and would support the role of miR-219 as a master regulator of neurogenesis.

In chapter III I described a mechanism by which miR-219 reduction resulted in elevated Shh signaling and I showed that this is Par dependent. I also showed that overexpression of Shh phenocopies loss of miR-219 when assessing progenitor numbers and proliferation. Intriguingly however, I found that the same was not the case when assessing differentiated cells types. For example, miR-219 MO-injected embryos showed no change in Isl1+ motor neurons, however overexpression of Shh starting 24 hpf, when many motor neurons have already been specified, resulted in a drastic 2.6 fold increase in motor neuron number (Figure A.3 A-C) and similarly a 3 fold increase in Sox10+ oligodendrocytes (Figure A.3 I-K). These different results are most likely due to the different levels of activation of Shh in miR-219 morphants versus Shh overexpression embryos and the fact that motor neurons and oligodendrocytes are specified in the presence of high levels of Shh signaling (Lu et al. 2000). Additionally I found that Zrf-1

(Figure A.3 D,E) and GFAP (data not shown) levels of expression are dramatically increased, opposite of miR-219 morphants where an entire radial glia population was missing (data in chapter II). This suggests the possibility that miR-219 acts through a parallel pathway to regulate radial glia formation and that Shh overexpression in the presence of miR-219 enhances radial glia protein expression.

Because early cell differentiation appeared to be elevated under these conditions, I assessed whether high Hh signaling might also affect later stages of neurogenesis. To do this I performed a fate-mapping experiment, whereby I labeled dividing cells at 24 hpf with a pulse of the thymidine analog EdU and allowed the embryos to develop normally

90

for the following 24 hours to allow differentiation to occur. I analyzed the embryos for

EdU distribution and Elavl3 expression. The double positive cells represent precursors that exited the cell cycle and differentiated into Elavl3+ neurons during the 24 hr recovery period. I found that increased Hh signaling results in decreased numbers of

Elavl3/EdU double positive cells (Figure A.3 F-H). The data presented thus far collectively support the possibility that downregulation of Hh signaling by neural precursors is necessary for their cell cycle exit and differentiation and that maintenance of high Hh signaling into larval stages results in many more precursors and early fated cells.

Future Directions

There are many questions my studies revealed and that warrant further investigation. For example, identifying all relevant miR-219 targets will uncover more mechanistic details about CNS development and how changes in its expression impact various human diseases, such as brain tumors. Technological advances will allow for direct observation of miRNA binding to its targets in vivo, allowing for a thorough analysis of timing and cell specificity of miRNA regulation. Another important area of study is how miR-219 itself is regulated. Frequently, miRNAs have been found to be co- regulated with the genes closest to them within the genome (Z. Wang et al. 2013). The closest gene to miR-219, which is located on chromosome 10 in zebrafish and 9 in humans, is Ubiquitin-like protein Urm1. Urm1 is located about 2.5kb from miR-219 raising the possibility that the two genes could be co-regulated. However, Urm1 expression is ubiquitous and miR-219 is not, so there might be even more complex regulatory mechanisms involved in miR-219 expression regulation. It is also highly

91

possible that miR-219 expression regulation is completely independent of Urm1 and that factors that might be involved are located far within the genome from miR-219. A quick analysis of the 1000kb upstream zebrafish promoter of miR-219 revealed binding sites for

T-box1 (Tbx1) transcription factor as well as V-Myc Avian Myelocytomatosis Viral

Oncogene Homolog (Myc) transcription factor as the top two candidates (Tfsitescan analysis) to be analyzed in the future.

My results showing that apical Par proteins levels affect Shh signaling levels point to Shh as a potential downstream effector of cell fate decisions upon apical Par protein inheritance. Together with the observation that miR-219 deficient embryos have longer cilia that form at a faster rate than controls, these findings raise the possibility that the cell that inherits apical Par proteins can ciliate faster allowing it to respond to Shh signaling and thus remain in a progenitor state. However, data from cilia mutant, dzip1 revealed that even with no primary cilia, mutant embryos still had proliferating neural progenitors within their spinal cord, suggesting some level of Shh signaling can still occur without proper primary cilia. Future studies aiming to uncover the details of the role of cilia in Shh signaling in zebrafish and the roles of apical Par proteins for cilia formation are therefore necessary. An intriguing possibility is that Shh receptors, Ptch and Smo, can still localize to the apical membrane and signal without the presence of a functioning primary cilia in zebrafish as long as there are other important factors, such as

Pard3, present at the apical membrane. The development of better antibodies for the proteins in the Shh pathway is needed in order to further analyze this possibility.

The primary cilia has received considerable attention in the past few years due to the discovery that it is involved in a variety of human diseases termed ciliopathies. The

92

variety of phenotypes associated with defects in the primary cilia point to the complexity of this organelle and the need to better understand its many features and differences between organisms. Data from mammals support a necessity for primary cilia in Shh signaling, but Drosophila doesn’t require cilia at all for Hh signaling (reviewed in

(Huangfu and Anderson 2006)) and data from zebrafish suggests cilia is important but not necessary (Huang and Schier 2009b). These types of differences in role and behavior are most likely also responsible for the variety of phenotypes observed in human disease, depending on what organ is mostly affected (Bergmann 2011; Fliegauf, Benzing, and

Omran 2007). Future in vivo studies aiming at understanding the role of cilia in different model systems and tissues are therefore of high priority.

Another important question in the field is how cilia length is controlled and its correlation to cilia function. Changes in length in either direction affect the function of the cilia (Ishikawa and Marshall 2011), however why that is remains unknown.

Interestingly, in my studies I found that longer cilia correlated with higher Shh signaling levels, and shorter cilia correlated with lower levels of Shh signaling. The length of cilia also correlated with the amount of apical Par proteins. The possibility that apical Par proteins can influence cilia length and downstream Shh signaling is an important discovery and could point to a novel mechanism of disease in ciliopathies. However, what remains unknown is the mechanism by which apical Par proteins can influence proper cilia formation. This is an important area that requires future studies. It is possible that apical Par proteins are necessary in order for transport of vesicles with cargo needed to build the cilia to occur in the right direction and at the right times. Another possibility is that inheritance of apical Par proteins, which can play a scaffolding role, results in

93

inheritance of other critical factors needed for ciliogenesis to occur. One such possibility is related to the inheritance of the mother centriole by one of the daughter cells. Recent reports support the hypothesis that inheritance of the mother centriole results in faster ciliogenesis (Paridaen, Wilsch-Bräuninger, and Huttner 2013). Additionally, inheritance of the mother centriole has been linked to maintenance of the progenitor cell fate (X.

Wang et al. 2009). Together these data raise the possibility that the mother centriole could be shuttling various factors within one daughter cells, including apical Par proteins, which can than affect the rate of ciliogenesis and cell fate decisions. This hypothesis is also supported by a recent report showing the presence of apical ciliary membrane on the mother centriole (Paridaen, Wilsch-Bräuninger, and Huttner 2013).

My findings that shh RNA levels were not properly downregulated when miR-219 function was reduced raised the possibility that miR-219 could be a direct regulator of shh. Initial analysis of the shh 3’UTR did not reveal any direct binding sites for miR-219, however a more in depth analysis and possibly in vitro binding assays could reveal additional information not available in the bioinformatics approach used for target prediction. However, it is also possible that miR-219 doesn’t directly regulate shh expression, but instead it could regulate a stabilizer protein or a positive regulator of shh.

Any of these possibilities are exciting as not much is known about how shh is downregulated.

The data presented in this thesis adds novel findings to the field of developmental neurobiology and to the understanding of neural progenitor maintenance. It highlights the complexities of this process and the many factors involved and establishes connections between major developmental pathways. Additionally, the data presented in this thesis

94

provides mechanistic evidence for downregulation of apical Par proteins and Shh signaling sensitivities, both of which are hyperactive in a large variety of cancers.

Furthermore, establishing a mechanism by which apical Par proteins can influence cell fate is of great importance, as until recently not much was known about how Par protein inheritance lead to different cell fates. Establishing a connection between Par, Shh, and cilia also adds more to the connection of Notch and Shh through cilia or through Par3, which can bind the negative regulator Numb. All of these factors are critical for neural development and understanding more about their connections and regulation adds an important piece in the puzzle that is neurodevelopment.

95

REFERENCES

Afonso, Cristina, and Domingos Henrique. 2006. “PAR3 Acts as a Molecular Organizer to Define the Apical Domain of Chick Neuroepithelial Cells.” Journal of cell science 119(Pt 20): 4293–4304.

Alexandre, Paula et al. 2010. “Neurons Derive from the More Apical Daughter in Asymmetric Divisions in the Zebrafish Neural Tube.” Nature neuroscience 13(6): 673 79.

Almeida, Maria I, Rui M Reis, and George A Calin. 2011. “MicroRNA History: Discovery, Recent Applications, and next Frontiers.” Mutation research 717(1-2): 1–8.

Arnold, Corey R. et al. 2015. “Comparative Analysis of Genes Regulated by Dzip1/ iguana and Hedgehog in Zebrafish.” Developmental Dynamics 244(2): 211–23.

Asuelime, Grace E, and Yanhong Shi. 2012. “The Little Molecules That Could: A Story about microRNAs in Neural Stem Cells and Neurogenesis.” Frontiers in neuroscience 6(December): 176.

Atwood, Scott X et al. 2013. “GLI Activation by Atypical Protein Kinase C ι/λ Regulates the Growth of Basal Cell Carcinomas.” Nature 494(7438): 484–88.

Atwood, Scott X., and Kenneth E. Prehoda. 2009. “aPKC Phosphorylates Miranda to Polarize Fate Determinants during Neuroblast Asymmetric Cell Division.” Current Biology 19: 723–29.

Aza-Blanc, P et al. 1997. “Proteolysis That Is Inhibited by Hedgehog Targets Cubitus Interruptus Protein to the Nucleus and Converts It to a Repressor.” Cell 89(7): 1043–53.

Bartel, David P. 2009. “MicroRNAs: Target Recognition and Regulatory Functions.” Cell 136(2): 215–33.

Beachy, Philip a. et al. 2010. “Interactions between Hedgehog Proteins and Their Binding Partners Come into View.” Genes and Development 24(18): 2001–12.

Bergmann, Carsten. 2011. “Educational Paper : Ciliopathies.” European journal of pediatrics.

Böhme, G. 1988. “Formation of the Central Canal and Dorsal Glial Septum in the Spinal Cord of the Domestic Cat.” Journal of anatomy 159: 37–47.

Bonev, Boyan, Angela Pisco, and Nancy Papalopulu. 2011. “MicroRNA-9 Reveals Regional Diversity of Neural Progenitors along the Anterior-Posterior Axis.” Developmental cell 20(1): 19–32.

96

Borovina, Antonia, Simone Superina, Daniel Voskas, and Brian Ciruna. 2010. “Vangl2 Directs the Posterior Tilting and Asymmetric Localization of Motile Primary Cilia.” Nature cell biology 12(4): 407–12.

Bultje, Ronald S et al. 2009. “Mammalian Par3 Regulates Progenitor Cell Asymmetric Division via Notch Signaling in the Developing Neocortex.” Neuron 63(2): 189–202.

Chen, James K, Jussi Taipale, Michael K Cooper, and Philip A Beachy. 2002. “Inhibition of Hedgehog Signaling by Direct Binding of Cyclopamine to Smoothened.” Genes & development 16(21): 2743–48.

Chen, Jia, and Mingjie Zhang. 2013. “The Par3/Par6/aPKC Complex and Epithelial Cell Polarity.” Experimental cell research 319(10): 1357–64.

Cheng, Li-Chun, Erika Pastrana, Masoud Tavazoie, and Fiona Doetsch. 2009. “miR-124 Regulates Adult Neurogenesis in the Subventricular Zone Stem Cell Niche.” Nature neuroscience 12(4): 399–408.

Chenn, A, and S K McConnell. 1995. “Cleavage Orientation and the Asymmetric Inheritance of Notch1 Immunoreactivity in Mammalian Neurogenesis.” Cell 82(4): 631 41.

Chiang, C et al. 1996. “Cyclopia and Defective Axial Patterning in Mice Lacking Sonic Hedgehog Gene Function.” Nature 383(6599): 407–13.

Chuang, Pao Tien, and Thomas B. Kornberg. 2000. “On the Range of Hedgehog Signaling.” Current Opinion in Genetics and Development 10: 515–22.

Coolen, Marion et al. 2012. “miR-9 Controls the Timing of Neurogenesis through the Direct Inhibition of Antagonistic Factors.” Developmental cell 22(5): 1052–64.

Costa, Marcos R et al. 2008. “Par-Complex Proteins Promote Proliferative Progenitor Divisions in the Developing Mouse Cerebral Cortex.” Development (Cambridge, England) 135(1): 11–22.

Dahmane, Nadia, and Ariel Ruiz. 1999. “Sonic Hedgehog and Cerebellum Development.” Development 3100: 3089–3100.

Dave, Richa K et al. 2011. “Sonic Hedgehog and Notch Signaling Can Cooperate to Regulate Neurogenic Divisions of Neocortical Progenitors.” PloS one 6(2): e14680.

Dong, Zhiqiang et al. 2012. “Intralineage Directional Notch Signaling Regulates Self Renewal and Differentiation of Asymmetrically Dividing Radial Glia.” Neuron 74(1): 65–78.

97

Le Dréau, Gwenvael, and Elisa Martí. 2012. “Dorsal-Ventral Patterning of the Neural Tube: A Tale of Three Signals.” Developmental neurobiology 72(12): 1471–81.

Drummond, Iain A. 2012. “Cilia Functions in Development.” Current opinion in cell biology 24(1): 24–30.

Dugas, Jason C et al. 2010. “Dicer1 and miR-219 Are Required for Normal Oligodendrocyte Differentiation and Myelination.” Neuron 65(5): 597–611.

Ellis, Pam et al. 2004. “SOX2, a Persistent Marker for Multipotential Neural Stem Cells Derived from Embryonic Stem Cells, the Embryo or the Adult.” Developmental neuroscience 26(2-4): 148–65.

Fan, Shuling et al. 2004. “Polarity Proteins Control Ciliogenesis via Kinesin Motor Interactions.” Current biology : CB 14(16): 1451–61.

Ferretti, Elisabetta et al. 2009. “MicroRNA Profiling in Human Medulloblastoma.” International journal of cancer. Journal international du cancer 124(3): 568–77.

Fietz, Simone A, and Wieland B Huttner. 2011. “Cortical Progenitor Expansion, Self Renewal and Neurogenesis-a Polarized Perspective.” Current opinion in neurobiology 21(1): 23–35.

Fliegauf, Manfred, Thomas Benzing, and Heymut Omran. 2007. “When Cilia Go Bad: Cilia Defects and Ciliopathies.” Nature reviews. Molecular cell biology 8(11): 880–93.

Fuccillo, Marc, Alexandra L Joyner, and Gord Fishell. 2006. “Morphogen to Mitogen: The Multiple Roles of Hedgehog Signalling in Vertebrate Neural Development.” Nature reviews Neuroscience 7(10): 772–83.

Geldmacher-Voss, Benedikt, Alexander M Reugels, Stefan Pauls, and José A Campos Ortega. 2003. “A 90-Degree Rotation of the Mitotic Spindle Changes the Orientation of Mitoses of Zebrafish Neuroepithelial Cells.” Development (Cambridge, England) 130(16): 3767–80.

Genovesi, Laura A et al. 2011. “Integrated Analysis of miRNA and mRNA Expression in Childhood Medulloblastoma Compared with Neural Stem Cells.” PloS one 6(9): e23935.

Glazer, Andrew M. et al. 2010. “The Zn Finger Protein Iguana Impacts Hedgehog Signaling by Promoting Ciliogenesis.” Developmental Biology 337(1): 148–56.

Goldstein, Bob, and Ian G Macara. 2007. “Review The PAR Proteins : Fundamental Players in Animal Cell Polarization.” Developmental Cell 13, 609-622

Gönczy, Pierre. 2008. “Mechanisms of Asymmetric Cell Division: Flies and Worms Pave the Way.” Nature reviews Molecular cell biology 9(5): 355–66.

98

Götz, Magdalena, and Wieland B Huttner. 2005. “THE CELL BIOLOGY OF NEUROGENESIS.” 6: 777–89.

Grove, E a et al. 1993. “Multiple Restricted Lineages in the Embryonic Rat Cerebral Cortex.” Development (Cambridge, England) 117(2): 553–61.

Guerrero, Isabel, and Thomas B Kornberg. 2014. “Hedgehog and Its Circuitous Journey from Producing to Target Cells.” Seminars in cell & developmental biology 33: 52–62.

Guo, Huili, Nicholas T Ingolia, Jonathan S Weissman, and David P Bartel. 2010. “Mammalian microRNAs Predominantly Act to Decrease Target mRNA Levels.” Nature 466(7308): 835–40.

Haenfler, Jill M, Chaoyuan Kuang, and Cheng-Yu Lee. 2012. “Cortical aPKC Kinase Activity Distinguishes Neural Stem Cells from Progenitor Cells by Ensuring Asymmetric Segregation of Numb.” Developmental biology 365(1): 219–28.

Haydar, Tarik F, Eugenius Ang, and Pasko Rakic. 2003. “Mitotic Spindle Rotation and Mode of Cell Division in the Developing Telencephalon.” Proceedings of the National Academy of Sciences of the United States of America 100(5): 2890–95.

He, Lin, and Gregory J Hannon. 2004. “MicroRNAs: Small RNAs with a Big Role in Gene Regulation.” Nature reviews Genetics 5(7): 522–31.

Ho, Karen S, and Matthew P Scott. 2002. “Sonic Hedgehog in the Nervous System: Functions, Modifications and Mechanisms.” Current opinion in neurobiology 12(1): 57 63.

Homem, Catarina C F, and Juergen A Knoblich. 2012. “Drosophila Neuroblasts: A Model for Stem Cell Biology.” Development (Cambridge, England) 139(23): 4297–4310.

Horne-Badovinac, S et al. 2001. “Positional Cloning of Heart and Soul Reveals Multiple Roles for PKC Lambda in Zebrafish Organogenesis.” Current biology : CB 11(19): 1492–1502.

Huang, Peng, and Alexander F Schier. 2009a. “Dampened Hedgehog Signaling but Normal Wnt Signaling in Zebrafish without Cilia.” Development (Cambridge, England) 136(18): 3089–98.

Huangfu, Danwei et al. 2003. “Hedgehog Signalling in the Mouse Requires Intraflagellar Transport Proteins.” Nature 426(6962): 83–87.

Huangfu, Danwei, and Kathryn V Anderson. 2006. “Signaling from Smo to Ci/Gli: Conservation and Divergence of Hedgehog Pathways from Drosophila to Vertebrates.” Development (Cambridge, England) 133(1): 3–14.

99

Hudish, Laura I, Alex J Blasky, and Bruce Appel. 2013. “miR-219 Regulates Neural Precursor Differentiation by Direct Inhibition of Apical Par Polarity Proteins.” Developmental cell: 1–12.

Huttner, W B, and M Brand. 1997. “Asymmetric Division and Polarity of Neuroepithelial Cells.” Current opinion in neurobiology 7(1): 29–39.

Huttner, Wieland B, and Yoichi Kosodo. 2005. “Symmetric versus Asymmetric Cell Division during Neurogenesis in the Developing Vertebrate Central Nervous System.” Current opinion in cell biology 17(6): 648–57.

Ingham, P W, and A P McMahon. 2001. “Hedgehog Signaling in Animal Development: Paradigms and Principles.” Genes & development 15(23): 3059–87.

Ishikawa, Hiroaki, and Wallace F Marshall. 2011. “Ciliogenesis: Building the Cell’s Antenna.” Nature reviews. Molecular cell biology 12(4): 222–34.

Jensen, a M, and V a Wallace. 1997. “Expression of Sonic Hedgehog and Its Putative Role as a Precursor Cell Mitogen in the Developing Mouse Retina.” Development (Cambridge, England) 124(2): 363–71.

Jessell, T M. 2000. “Neuronal Specification in the Spinal Cord: Inductive Signals and Transcriptional Codes.” Nature reviews Genetics 1(1): 20–29.

Jiang, Kai et al. 2014. “Hedgehog-Regulated Atypical PKC Promotes Phosphorylation and Activation of Smoothened and Cubitus Interruptus in Drosophila.” Proceedings of the National Academy of Sciences of the United States of America. 111(45) E4842-50

Kamachi, Yusuke, Masanori Uchikawa, Hisato Kondoh, and Cellular Biology. 2000. “Pairing SOX off.” 9525(99): 2–7.

Kapsimali, Marika et al. 2007. “MicroRNAs Show a Wide Diversity of Expression Profiles in the Developing and Mature Central Nervous System.” Genome biology 8(8): R173.

Kawahara, Hironori, Takao Imai, and Hideyuki Okano. 2012. “MicroRNAs in Neural Stem Cells and Neurogenesis.” Frontiers in neuroscience 6(March): 30.

Kemphues, K. 2000. “PARsing Embryonic Polarity.” Cell 101(4): 345–48.

Kemphues, K J, J R Priess, D G Morton, and N S Cheng. 1988. “Identification of Genes Required for Cytoplasmic Localization in Early C. Elegans Embryos.” Cell 52(3): 311 20.

100

Kenney, a M, and D H Rowitch. 2000. “Sonic Hedgehog Promotes G(1) Cyclin Expression and Sustained Cell Cycle Progression in Mammalian Neuronal Precursors.” Molecular and cellular biology 20(31): 9055–67.

Kicheva, Anna et al. 2014. “Coordination of Progenitor Specification and Growth in Mouse and Chick Spinal Cord.” Science (New York, NY) 345(6204): 1254927.

Kimmel, C B et al. 1995. “Stages of Embryonic Development of the Zebrafish.” Developmental dynamics : an official publication of the American Association of Anatomists 203(3): 253–310.

Kloosterman, Wigard P et al. 2006. “In Situ Detection of miRNAs in Animal Embryos Using LNA-Modified Oligonucleotide Probes.” Nature methods 3(1): 27–29.

Knoblich, J a, L Y Jan, and Y N Jan. 1995. “Asymmetric Segregation of Numb and Prospero during Cell Division.” Nature 377(6550): 624–27.

Kong, Jennifer H et al. 2015. “Notch Activity Modulates the Responsiveness of Neural Progenitors to Sonic Hedgehog Signaling.” Developmental cell 33(4): 373–87.

Kosodo, Yoichi et al. 2004. “Asymmetric Distribution of the Apical Plasma Membrane during Neurogenic Divisions of Mammalian Neuroepithelial Cells.” The EMBO journal 23(11): 2314–24.

Krock, Bryan L, and Brian D Perkins. 2014. “The Par-PrkC Polarity Complex Is Required for Cilia Growth in Zebrafish Photoreceptors.” PloS one 9(8): e104661.

Kuchinke, U, F Grawe, and E Knust. “Control of Spindle Orientation in Drosophila by the Par-3-Related PDZ-Domain Protein Bazooka.” Current biology : CB 8(25): 1357–65.

Kwan, Kristen M. et al. 2007. “The Tol2kit: A Multisite Gateway-Based Construction Kit forTol2 Transposon Transgenesis Constructs.” Developmental Dynamics 236(11): 3088 99.

Lang, Ming-Fei, and Yanhong Shi. 2012. “Dynamic Roles of microRNAs in Neurogenesis.” Frontiers in neuroscience 6(May): 71.

Lau, Pierre et al. 2008. “Identification of Dynamically Regulated microRNA and mRNA Networks in Developing Oligodendrocytes.” The Journal of neuroscience : the official journal of the Society for Neuroscience 28(45): 11720–30.

Lee, Cheng-Yu, Kristin J Robinson, and Chris Q Doe. 2006. “Lgl, Pins and aPKC Regulate Neuroblast Self-Renewal versus Differentiation.” Nature 439(7076): 594–98.

101

Lee, R C, R L Feinbaum, and V Ambros. 1993. “The C. Elegans Heterochronic Gene Lin-4 Encodes Small RNAs with Antisense Complementarity to Lin-14.” Cell 75(5): 843–54.

Litingtung, Y, and C Chiang. 2000. “Specification of Ventral Neuron Types Is Mediated by an Antagonistic Interaction between Shh and Gli3.” Nature neuroscience 3(10): 979 85.

Lu, Q R et al. 2000. “Sonic Hedgehog--Regulated Oligodendrocyte Lineage Genes Encoding bHLH Proteins in the Mammalian Central Nervous System.” Neuron 25(2): 317–29.

Lunt, Shannon C., Tony Haynes, and Brian D. Perkins. 2009. “Zebrafish ift57, ift88, and ift172 Intraflagellar Transport Mutants Disrupt Cilia but Do Not Affect Hedgehog Signaling.” Developmental Dynamics 238(7): 1744–59.

Luskin, M B, J G Parnavelas, and J a Barfield. 1993. “Neurons, Astrocytes, and Oligodendrocytes of the Rat Cerebral Cortex Originate from Separate Progenitor Cells: An Ultrastructural Analysis of Clonally Related Cells.” The Journal of neuroscience : the official journal of the Society for Neuroscience 13(4): 1730–50.

Makeyev, Eugene V, Jiangwen Zhang, Monica a Carrasco, and Tom Maniatis. 2007. “The MicroRNA miR-124 Promotes Neuronal Differentiation by Triggering Brain Specific Alternative Pre-mRNA Splicing.” Molecular cell 27(3): 435–48.

Marigo, V, and C J Tabin. 1996. “Regulation of Patched by Sonic Hedgehog in the Developing Neural Tube.” Proceedings of the National Academy of Sciences of the United States of America 93(18): 9346–51.

Marusich, M F, H M Furneaux, P D Henion, and J A Weston. 1994. “Hu Neuronal Proteins Are Expressed in Proliferating Neurogenic Cells.” Journal of neurobiology 25(2): 143–55.

Maurange, Cédric, Louise Cheng, and Alex P Gould. 2008. “Temporal Transcription Factors and Their Targets Schedule the End of Neural Proliferation in Drosophila.” Cell 133(5): 891–902.

May, Scott R. et al. 2005. “Loss of the Retrograde Motor for IFT Disrupts Localization of Smo to Cilia and Prevents the Expression of Both Activator and Repressor Functions of Gli.” Developmental Biology 287(2): 378–89.

McCarthy, M, D H Turnbull, C a Walsh, and G Fishell. 2001. “Telencephalic Neural Progenitors Appear to Be Restricted to Regional and Glial Fates before the Onset of Neurogenesis.” The Journal of Neuroscience 21(17): 6772–81.

102

Nishimura, Takashi, and Kozo Kaibuchi. 2007. “Numb Controls Integrin Endocytosis for Directional Cell Migration with aPKC and PAR-3.” Developmental Cell 13(1): 15–28.

Ogden, Stacey K et al. 2006. “Smoothened Regulates Activator and Repressor Functions of Hedgehog Signaling via Two Distinct Mechanisms.” The Journal of biological chemistry 281(11): 7237–43.

Okuda, Yuich et al. 2006. “Comparative Genomic and Expression Analysis of Group B1 sox Genes in Zebrafish Indicates Their Diversification during Vertebrate Evolution.” Developmental Dynamics 235(3): 811–25.

Olde Loohuis, N F M et al. 2012. “MicroRNA Networks Direct Neuronal Development and Plasticity.” Cellular and molecular life sciences : CMLS 69(1): 89–102.

Pal, Kasturi, and Saikat Mukhopadhyay. 2014. “Primary Cilium and Sonic Hedgehog Signaling during Neural Tube Patterning: Role of GPCRs and Second Messengers.” Developmental neurobiology. 75 (4): 337-348.

Paridaen, Judith T M L, Michaela Wilsch-Bräuninger, and Wieland B Huttner. 2013. “Asymmetric Inheritance of Centrosome-Associated Primary Cilium Membrane Directs Ciliogenesis after Cell Division.” Cell 155(2): 333–44.

Park, Hae-Chul, Janene Boyce, Jimann Shin, and Bruce Appel. 2005. “Oligodendrocyte Specification in Zebrafish Requires Notch-Regulated Cyclin-Dependent Kinase Inhibitor Function.” The Journal of neuroscience : the official journal of the Society for Neuroscience 25(29): 6836–44.

Park, Hae-Chul, Jimann Shin, Randolph K Roberts, and Bruce Appel. 2007. “An olig2 Reporter Gene Marks Oligodendrocyte Precursors in the Postembryonic Spinal Cord of Zebrafish.” Developmental dynamics : an official publication of the American Association of Anatomists 236(12): 3402–7.

Parsons, Michael J. et al. 2009. “Notch-Responsive Cells Initiate the Secondary Transition in Larval Zebrafish Pancreas.” Mechanisms of Development 126(10): 898 912.

Prehoda, Kenneth E. 2009. “Polarization of Drosophila Neuroblasts during Asymmetric Division.” Cold Spring Harbor perspectives in biology 1(2): a001388.

Qiu, R G, A Abo, and G Steven Martin. 2000. “A Human Homolog of the C. Elegans Polarity Determinant Par-6 Links Rac and Cdc42 to PKCzeta Signaling and Cell Transformation.” Current biology : CB 10(12): 697–707.

Reinhart, B J et al. 2000. “The 21-Nucleotide Let-7 RNA Regulates Developmental Timing in Caenorhabditis Elegans.” Nature 403(6772): 901–6.

103

Rhyu, M S, L Y Jan, and Y N Jan. 1994. “Asymmetric Distribution of Numb Protein during Division of the Sensory Organ Precursor Cell Confers Distinct Fates to Daughter Cells.” Cell 76(3): 477–91.

Roberts, Randolph K, and Bruce Appel. 2009. “Apical Polarity Protein PrkCi Is Necessary for Maintenance of Spinal Cord Precursors in Zebrafish.” Developmental dynamics : an official publication of the American Association of Anatomists 238(7): 1638–48.

Rohatgi, Rajat, Ljiljana Milenkovic, and Matthew P Scott. 2007. “Patched1 Regulates Hedgehog Signaling at the Primary Cilium.” Science (New York, NY) 317(5836): 372–76.

Rolls, Melissa M et al. 2003. “Drosophila aPKC Regulates Cell Polarity and Cell Proliferation in Neuroblasts and Epithelia.” The Journal of cell biology 163(5): 1089–98.

Rowitch, D H et al. 1999. “Sonic Hedgehog Regulates Proliferation and Inhibits Differentiation of CNS Precursor Cells.” The Journal of neuroscience : the official journal of the Society for Neuroscience 19(20): 8954–65.

Sasai, Noriaki, and James Briscoe. 2012. “Primary Cilia and Graded Sonic Hedgehog Signaling.” Wiley Interdisciplinary Reviews: Developmental Biology 1(5): 753–72.

Sekimizu, Kohshin et al. 2004. “The Zebrafish Iguana Locus Encodes Dzip1, a Novel Zinc-Finger Protein Required for Proper Regulation of Hedgehog Signaling.” Development (Cambridge, England) 131(11): 2521–32.

Sevc, Juraj, Zuzana Daxnerová, and Mária Miklosová. 2009. “Role of Radial Glia in Transformation of the Primitive Lumen to the Central Canal in the Developing Rat Spinal Cord.” Cellular and molecular neurobiology 29(6-7): 927–36.

Sfakianos, Jeff et al. 2007. “Par3 Functions in the Biogenesis of the Primary Cilium in Polarized Epithelial Cells.” The Journal of cell biology 179(6): 1133–40.

Shen, Meng-Chieh et al. 2013. “Heat-Shock-Mediated Conditional Regulation of Hedgehog/gli Signaling in Zebrafish.” Developmental dynamics : an official publication of the American Association of Anatomists 242(5): 539–49.

Shibata, Mikihito et al. 2011. “MicroRNA-9 Regulates Neurogenesis in Mouse Telencephalon by Targeting Multiple Transcription Factors.” The Journal of neuroscience : the official journal of the Society for Neuroscience 31(9): 3407–22.

Shin, Jimann et al. 2003. “Neural Cell Fate Analysis in Zebrafish Using olig2 BAC Transgenics.” Methods in cell science : an official journal of the Society for In Vitro Biology 25(1-2): 7–14.

104

Shitamukai, Atsunori, and Fumio Matsuzaki. 2012. “Control of Asymmetric Cell Division of Mammalian Neural Progenitors.” Development, growth & differentiation 54(3): 277–86.

Silber, Joachim et al. 2008. “miR-124 and miR-137 Inhibit Proliferation of Glioblastoma Multiforme Cells and Induce Differentiation of Brain Tumor Stem Cells.” BMC medicine 6: 14.

Siller, Karsten H, and Chris Q Doe. 2009. “Spindle Orientation during Asymmetric Cell Division.” Nature cell biology 11(4): 365–74.

Smrt, Richard D et al. 2010. “MicroRNA miR-137 Regulates Neuronal Maturation by Targeting Ubiquitin Ligase Mind Bomb-1.” Stem cells (Dayton, Ohio) 28(6): 1060–70.

Stasiulewicz, M. et al. 2015. “A Conserved Role for Notch in Priming the Cellular Response to Shh through Ciliary Localisation of the Key Shh Transducer, Smoothened.” Development: 2291–2303.

Staton, Alison A, and Antonio J Giraldez. 2011. “Use of Target Protector Morpholinos to Analyze the Physiological Roles of Specific miRNA-mRNA Pairs in Vivo.” Nature protocols 6(12): 2035–49.

Tabuse, Y et al. 1998. “Atypical Protein Kinase C Cooperates with PAR-3 to Establish Embryonic Polarity in Caenorhabditis Elegans.” Development (Cambridge, England) 125(18): 3607–14.

Takahashi, T, R S Nowakowski, and V S Caviness. 1996. “The Leaving or Q Fraction of the Murine Cerebral Proliferative Epithelium: A General Model of Neocortical Neuronogenesis.” The Journal of neuroscience : the official journal of the Society for Neuroscience 16(19): 6183–96.

Tan, Siok-Lay, Toshiyuki Ohtsuka, Aitor González, and Ryoichiro Kageyama. 2012. “MicroRNA9 Regulates Neural Stem Cell Differentiation by Controlling Hes1 Expression Dynamics in the Developing Brain.” Genes to cells : devoted to molecular & cellular mechanisms 17(12): 952–61.

Tep, Chhavy et al. 2011. “BDNF Induces Polarized Signaling of Small GTPase (Rac1) at the Onset of Schwann Cell Myelination through Partitioning-Defective 3 (Par3).” The Journal of biological chemistry. 287 (2): 1600-8

Varjosalo, Markku, and Jussi Taipale. 2008. “Hedgehog: Functions and Mechanisms.” Genes & development 22(18): 2454–72.

Wang, Baolin, John F Fallon, and Philip A Beachy. 2000. “Hedgehog-Regulated Processing of Gli3 Produces an Anterior/Posterior Repressor Gradient in the Developing Vertebrate Limb.” Cell 100(4): 423–34.

105

Wang, Xiaoqun et al. 2009. “Asymmetric Centrosome Inheritance Maintains Neural Progenitors in the Neocortex.” Nature 461(7266): 947–55.

Wang, Zifeng et al. 2013. “Transcriptional and Epigenetic Regulation of Human microRNAs.” Cancer letters 331(1): 1–10.

Wechsler-Reya, Robert J, and Matthew P Scott. 1999. “Control of Neuronal Precursor Proliferation in the Cerebellum by Sonic Hedgehog.” Neuron 22(1): 103–14.

Wightman, B, I Ha, and G Ruvkun. 1993. “Posttranscriptional Regulation of the Heterochronic Gene Lin-14 by Lin-4 Mediates Temporal Pattern Formation in C. Elegans.” Cell 75(5): 855–62.

Wolff, Christian et al. 2004. “Iguana Encodes a Novel Zinc-Finger Protein with Coiled Coil Domains Essential for Hedgehog Signal Transduction in the Zebrafish Embryo.” Genes and Development 18(13): 1565–76.

Yu, Fengwei et al. 2006. “Drosophila Neuroblast Asymmetric Cell Division: Recent Advances and Implications for Stem Cell Biology.” Neuron 51(1): 13–20.

Zhang, Man Cang et al. 2008. “[Knockdown and Overexpression of miR-219 Lead to Embryonic Defects in Zebrafish Development].” Fen zi xi bao sheng wu xue bao = Journal of molecular cell biology / Zhongguo xi bao sheng wu xue xue hui zhu ban 41(5): 341–48.

Zhao, Chunnian, GuoQiang Sun, Shengxiu Li, and Yanhong Shi. 2009. “A Feedback Regulatory Loop Involving microRNA-9 and Nuclear Receptor TLX in Neural Stem Cell Fate Determination.” Nature structural & molecular biology 16(4): 365–71.

Zhao, Xianghui et al. 2010. “MicroRNA-Mediated Control of Oligodendrocyte Differentiation.” Neuron 65(5): 612–26.

106

APPENDIX A

Figure A.1. Notch inhibition reduces progenitor phenotypes in miR-219 deficient embryos. All panels show transverse sections through the spinal cord at 3 dpf. Immunohistochemistry to detect Sox2+ cells (A,B) and ZO-1 (C,D). Tg(Tp1bglob:hmgb1-mCherry) Notch reporter control embryos (E) and miR-219 MO injected embryos (F).

107

Figure A.2. Notch signaling pathway is most upregulated upon miR-219 reduction. Pathway analysis performed on microarray data obtained by comparing 4 samples of control and 4 samples of miR-219 MO- injected fish at 3dpf.

108

Figure A.3. Sonic Hedgehog overexpression results in increased numbers of differentiated cells. All images show transverse sections through the spinal cord at 3dpf. Immunohistochemistry for Ils1 to detect motor neurons shows increased numbers in Shh HS embryos (A‐C). Quantification was performed an 3 separate experiments, where 10 sections from 15 embryos were counted and averaged. P‐values were obtained by unpaired t‐test. Radial glia were visualized by Zrf‐1 (D,E) and neurons by Elavl3 (F,G). EdU incorporation was performed at 24 hpf. Double positive cells were counted from 15 embryos, 10 sections each and averaged. Data represent SEM.

109

APPENDIX B

Feature Accession Gene Name ConAVG 219AVG Con/219 219/Con 14895 gb|AL715209|tc|TC4 wu:fc25e12 3315.2562 4.564301 726.3446659 0.001376757 03823 3 75 14640 gb|XM_001342519|tc LOC1000028 1546.5531 2.926284 528.5039827 0.001892133 |TC424587 85 45 75 324 ref|NM_131253|ens|E opn1mw1 10268.384 41.75477 245.9212193 0.004066343 NSDART000000020 75 325 46|gb|BC060896|tc|T C423849 38472 ref|NM_131567|ens|E prph2b 1124.2716 5.800520 193.8225374 0.005159359 NSDART000000206 5 75 71|gb|BC059645|gb|B C155196 28763 ref|NM_131253|ens|E opn1mw1 11261.069 61.56836 182.9035061 0.005467364 NSDART000000020 05 46|gb|BC060896|gb| AF109369 16622 ref|NM_131319|ens|E opn1sw1 4384.2575 24.88128 176.2070633 0.005675141 NSDART000001284 125 47|ens|ENSDART00 000067160|gb|BC083 459 30086 ref|NM_001017711|e grk1b 798.40237 5.183115 154.0390787 0.006491859 ns|ENSDART000000 5 75 02730|ens|ENSDAR T00000124014|gb|A B212994 25988 ens|ENSDART00000 ENSDART0 19630.965 135.5442 144.8307252 0.006904612 145610|tc|TC414939| 0000145610 015 ref|XM_003199054 12339 ref|NM_213202|ens|E gnb3b 212.95695 1.532033 139.0027798 0.007194101 NSDART000000055 75 47|ens|ENSDART00 000132642|gb|BC059 436 2644 ref|NM_213202|ens|E gnb3b 2601.9802 19.69446 132.1173293 0.00756903 NSDART000000055 5 6 47|ens|ENSDART00 000132642|gb|BC059 436 6805 ref|NM_001002443|e opn1lw2 5175.7032 47.38823 109.2191721 0.009155902 ns|ENSDART000001 5 32277|ens|ENSDAR T00000065940|gb|B C076120 30014 ref|NM_213202|ens|E gnb3b 181.83287 1.676580 108.4546045 0.009220448 NSDART000000055 5 5 47|ens|ENSDART00 000132642|gb|BC059 436 34510 ref|NM_001123311|e si:dkey- 3637.7732 33.93081 107.2114944 0.009327358 ns|ENSDART000000 57a22.15 5 375 91013|gb|EH593171|t

110

c|TC392453 27986 ref|NM_212618|ens|E ctrb1 154.35791 1.449525 106.4885785 0.009390678 NSDART000000373 5 46|gb|BC055574|ens| ENSDART00000109 691 44894 ref|NM_001017711|e grk1b 211.07657 2.044171 103.2577876 0.0096845 ns|ENSDART000000 5 02730|ens|ENSDAR T00000124014|gb|A Y900003 15387 ref|NM_213202|ens|E gnb3b 12441.584 125.9647 98.77034085 0.010124497 NSDART000000055 75 85 47|ens|ENSDART00 000132642|gb|BC059 436 4647 ref|NM_200792|gb|B arr3b 1641.8625 18.80814 87.29527209 0.011455374 C059650|gb|BC1526 5 975 55|tc|TC377207 6838 ref|NM_212618|ens|E ctrb1 1288.4867 14.79739 87.07521357 0.011484324 NSDART000000373 925 46|gb|BC055574|ens| ENSDART00000109 691 10444 ref|NM_131192|ens|E opn1sw2 6821.3625 82.34608 82.83772941 0.012071794 NSDART000000111 25 78|gb|BC059418|gb| AF109372 8766 ens|ENSDART00000 ENSDART0 5577.9365 69.64949 80.08581972 0.012486605 114673|gb|BC086847 0000114673 |gb|BM181126|gb|CO 801140 44295 ref|NM_131084|ens|E rho 11962.945 151.6529 78.88366955 0.012676895 NSDART000000270 983 00|gb|BC045288|gb| AF109368 40218 ref|NM_001002443|e opn1lw2 21293.275 276.9980 76.87156795 0.013008711 ns|ENSDART000001 575 32277|ens|ENSDAR T00000065940|gb|B C076120 42189 ref|NM_200792|gb|B arr3b 1029.7187 13.64729 75.45219522 0.013253425 C152655|gb|BC0596 25 975 50|tc|TC377207 1154 ref|NM_131084|ens|E rho 3254.1695 43.31209 75.13304613 0.013309723 NSDART000000270 325 00|gb|AF105152|gb|L 11014 34631 ref|NM_131084|gb|A rho 34367.032 465.8499 73.77274377 0.013555142 F109368|gb|AF10515 5 975 2|gb|L11014 41324 gb|BC045288|gb|AF1 rho 7512.7562 102.8297 73.06016104 0.01368735 09368|gb|DY550587| 5 248 tc|TC456563 43713 ref|NM_131084|ens|E rho 38187.19 526.7547 72.49519303 0.013794018

111

NSDART000000270 875 00|gb|AF109368|gb|A F105152 41232 ref|NM_131084|ens|E rho 38177.077 530.9717 71.90038691 0.013908131 NSDART000000270 5 95 00|gb|AF109368|gb|B C063938 34276 ref|NM_131084|ens|E rho 40476.417 581.3188 69.62860059 0.014361914 NSDART000000270 5 425 00|gb|BC045288|gb| AF109368 40215 ref|NM_001204332|g gngt2b 52600.932 774.7146 67.89716808 0.014728155 b|BC122293|gb|BC15 5 75 0393|gb|BC134193 39242 ref|NM_001204332|e gngt2b 51076.872 770.6117 66.28094173 0.015087293 ns|ENSDART000001 5 5 22684|gb|BC134193| gb|BC122293 6062 ref|NM_213202|ens|E gnb3b 112.10038 1.736290 64.56314272 0.015488713 NSDART000000055 75 75 47|ens|ENSDART00 000132642|gb|BC059 436 44870 ref|NM_001031841|e grk7a 312.49447 4.863108 64.25817128 0.015562223 ns|ENSDART000001 5 75 00287|gb|BC163587| gb|AB212995 41167 ref|NM_001017724|e zgc:112160 239.6853 3.860782 62.08205604 0.016107714 ns|ENSDART000000 25 58067|gb|BC093233| gb|BC076035 10989 ref|NM_001145243|e odam 151.09984 2.471260 61.14282367 0.016355149 ns|ENSDART000001 5 5 37646|ens|ENSDAR T00000114345|gb|E U642608 21139 ref|NM_131869|ens|E gnat2 1195.5119 19.81364 60.33781724 0.016573354 NSDART000000623 25 225 63|gb|BC059498|gb| AY050500 14492 ref|NM_001031841|e grk7a 1195.1240 19.87037 60.14602518 0.016626203 ns|ENSDART000001 75 5 00287|gb|AB212995|t c|TC366748 27612 tc|TC384302 TC384302 85.73774 1.460467 58.70570167 0.017034121 13876 ref|NM_200794|ens|E zgc:73336 508.2866 8.885835 57.2018901 0.01748194 NSDART000000112 75 95|gb|BC066562|tc|T C376577 22260 ens|ENSDART00000 ENSDART0 1664.2745 29.55039 56.3198737 0.017755722 052556|ens|ENSDAR 0000052556 475 T00000128196|gb|B C115202|gb|AY8609 77 31668 ref|NM_200792|gb|B arr3b 1020.3092 18.24101 55.93488302 0.017877931

112

C152655|gb|BC0596 5 875 50|tc|TC452362 7465 ref|NM_182891|ens|E opn1mw2 1102.1571 21.25027 51.86555137 0.01928062 NSDART000000252 25 41|gb|BC164163|gb|B C055605 6242 ref|NM_001004582|e ctrl 615.33262 12.49144 49.26032574 0.020300312 ns|ENSDART000000 5 45 99425|gb|BC081638| gb|BC153573 31266 ref|NM_131869|ens|E gnat2 7504.6835 158.4700 47.35712288 0.021116148 NSDART000000623 05 63|gb|BC059498|tc|T C417051 810 ref|NM_200794|ens|E zgc:73336 832.5569 17.72740 46.96440705 0.021292721 NSDART000000112 15 95|gb|BC066562|tc|T C374732 8013 gb|CK126531 pde6h 4869.5552 105.1366 46.31643142 0.02159061 5 675 14364 ref|NM_200785|ens|E pde6h 4733.845 104.4507 45.32132474 0.022064668 NSDART000001033 2 73|gb|BC059633|gb|B C154316 36313 ref|NM_001128787|e zgc:194993 154.84778 3.526637 43.90804953 0.022774867 ns|ENSDART000000 5 75 73806|gb|BC163490| gb|BC163473 17502 ref|NM_001114899|e si:ch211- 193.23162 4.424814 43.66999946 0.022899016 ns|ENSDART000000 119o8.7 5 56577|gb|BC155566|t c|TC379287 33935 ref|NM_001002076|e fabp6 74.369715 1.732485 42.92660169 0.023295578 ns|ENSDART000000 5 65448|gb|BC072553| gb|EU665309 24004 gb|CN504677|tc|TC3 wu:fk57f03 126.02400 2.980081 42.28878594 0.023646931 87531|ref|XM_00133 75 6435 2250 ref|NM_201014|ens|E zgc:56548 1709.484 40.92650 41.7696027 0.023940855 NSDART000001054 85 61|gb|BC049482|tc|T C377414 998 ref|NM_001099740|e matn1 2236.6837 53.70865 41.64475834 0.024012626 ns|ENSDART000001 5 33158|ens|ENSDAR T00000049045|ens|E NSDART000000517 19 14554 ref|NM_001017581|e zgc:110075 2235.0934 54.85276 40.74714551 0.024541596 ns|ENSDART000001 95 25 03410|gb|BC092719|t c|TC404307 25057 ref|NM_131566|ens|E prph2a 115.25508 2.830095 40.72480057 0.024555062 NSDART000000554 5 75

113

15|gb|BC081641|tc|T C423048 36592 ref|NM_200785|ens|E pde6h 2018.1146 51.13565 39.46589716 0.025338332 NSDART000001033 75 73|gb|BC163030|gb|B C154316 3921 ref|NM_001166211|e ca4b 84.5922 2.178871 38.82385459 0.02575736 ns|ENSDART000000 75 62024|gb|BC109405| gb|BC078387 7931 ref|NM_001166211|e ca4b 76.3226 1.984648 38.45648719 0.026003415 ns|ENSDART000000 25 62024|gb|BC078387| gb|BC109405 39902 ref|NM_200731|ens|E gabra6a 122.25777 3.218249 37.9889022 0.026323477 NSDART000000826 5 75 97|ens|ENSDART00 000054982|gb|BC059 508 6992 ref|NM_001099740|e matn1 2003.2677 53.42006 37.5002884 0.026666462 ns|ENSDART000001 5 25 33158|ens|ENSDAR T00000049045|ens|E NSDART000000517 19 17621 ref|NM_001128717|e zgc:193593 50.587862 1.36148 37.15652268 0.026913175 ns|ENSDART000001 5 15335|gb|BC162485| gb|BC162492 41291 ref|NM_001029952|g aldoca 122.28333 3.311369 36.928324 0.027079485 b|BC098624|tc|TC37 5 75 1379 39356 ref|NM_001080182|e aqp8a.2 247.03302 7.009006 35.24508431 0.028372751 ns|ENSDART000001 5 5 05952|gb|EU341834| gb|BC165508 38297 ens|ENSDART00000 ENSDART0 60.507892 1.724280 35.09168101 0.028496782 080377|tc|TC426704 0000080377 5 25 3658 ref|NM_182891|ens|E opn1mw2 276.1134 7.915406 34.88303695 0.028667229 NSDART000001268 30|ens|ENSDART00 000025241|gb|BC055 605 34508 gb|BC081488|gb|CN ttr 76.748032 2.254955 34.03527209 0.029381284 173753|tc|TC385436 5 75 24135 ens|ENSDART00000 ENSDART0 266.76985 8.403270 31.7459544 0.031500077 062749|ens|ENSDAR 0000062749 75 T00000137497|ens|E NSDART000001474 09|gb|XM_690333 2688 ref|NM_001002405|e arr3a 4077.46 129.2522 31.54653441 0.031699203 ns|ENSDART000001 325 05733|ens|ENSDAR T00000078996|gb|A Y900006

114

6892 ref|NM_131319|ens|E opn1sw1 395.30295 12.57843 31.42703263 0.03181974 NSDART000000671 7 60|gb|BC067683|gb|B C153466 22492 ref|NM_001029952|g aldoca 89.339417 2.875592 31.06817995 0.032187273 b|BC098624|tc|TC37 5 25 1379 21858 ref|NM_200825|ens|E zgc:73075 2510.7357 81.74285 30.71504749 0.032557332 NSDART000001287 5 75 21|gb|BC060902|tc|T C366938 8009 ref|NM_001076642|g zgc:153118 50.217602 1.654296 30.35586577 0.032942562 b|BC124253|tc|TC37 5 5 5122 25359 ref|NM_131868|ens|E gnat1 595.59835 19.81647 30.05571247 0.033271545 NSDART000000648 75 96|gb|AY050499|gb| BC059464 1855 ens|ENSDART00000 ENSDART0 59.66067 1.987228 30.02205585 0.033308845 137976|ens|ENSDAR 0000137976 T00000132386|gb|C O931756|tc|NP94944 44 41358 tc|TC383973|tc|TC41 TC383973 381.4753 12.70878 30.01667174 0.033314819 4311 075 18845 ref|NM_200724|ens|E guk1 468.6258 15.66646 29.91266633 0.033430654 NSDART000001478 7 41|ens|ENSDART00 000022959|ens|ENS DART00000079989 33712 ens|ENSDART00000 ENSDART0 43.477926 1.525422 28.50221922 0.035084987 006248|gb|XM_0013 0000006248 5 5 45227|gb|XM_69094 9|tc|NP9853596 31592 ref|NM_001020536|e lrit2 139.49334 4.904634 28.44112857 0.035160349 ns|ENSDART000000 75 75 28417|gb|BC095086|t c|TC369710 6772 ref|NM_001102616|e tdo2a 289.04377 10.17701 28.40162612 0.035209252 ns|ENSDART000001 5 5 05590|gb|BC151920| gb|BC150376 3097 ref|NM_001002405|e arr3a 11471.500 406.5622 28.21585082 0.035441072 ns|ENSDART000001 5 75 05733|ens|ENSDAR T00000078996|gb|B C076177 23408 gb|CK353663|tc|TC3 CK353663 633.79657 22.58573 28.06180932 0.035635621 92304|tc|TC393753|t 5 45 c|TC392758 9298 ref|NM_001076577|e rgs9 98.588837 3.528457 27.94106248 0.03578962 ns|ENSDART000001 5 30128|ens|ENSDAR T00000123630|ens|E NSDART000001310

115

18 31646 ens|ENSDART00000 ENSDART0 41.293855 1.533605 26.92600441 0.037138819 132386|gb|CO931756 0000132386 |tc|TC384594|ref|XM _003201028 22720 ref|NM_001099740|e matn1 44299.597 1661.386 26.66422904 0.037503428 ns|ENSDART000000 5 775 49045|ens|ENSDAR T00000051719|gb|B C045465 38768 ens|ENSDART00000 ENSDART0 2238.9052 85.00694 26.33791135 0.037968083 026257|gb|EE693570 0000026257 5 |tc|TC378973|ref|XM _001339170 35338 ref|NM_200724|ens|E guk1 734.79792 27.93089 26.30770858 0.038011672 NSDART000001478 5 8 41|ens|ENSDART00 000022959|ens|ENS DART00000079989 16742 ref|NM_201014|ens|E zgc:56548 260.536 9.972192 26.12625188 0.038275678 NSDART000001054 61|gb|BC049482|gb|E H436285 35073 ref|NM_001045351|e zgc:153414 136.19967 5.258846 25.89915544 0.038611298 ns|ENSDART000000 86646|gb|BC122279|t c|TC376699 36234 gb|BC091979|tc|TC3 im:7145503 126.82793 5.036529 25.18161341 0.039711514 66759|tc|TC399299|r 25 25 ef|XM_002666682 29046 ref|NM_194393|ens|E guca1c 184.84838 7.347997 25.1562936 0.039751484 NSDART000000432 25 5 26|gb|BC044346|gb| AY044457 6493 ens|ENSDART00000 ENSDART0 245.22335 9.879684 24.82097037 0.040288514 093000|ens|ENSDAR 0000093000 25 T00000123508|gb|B C124814|tc|TC39624 5 9271 ref|NM_001007058|e crygm5 177.80882 7.249109 24.52836878 0.04076912 ns|ENSDART000000 5 25 60361|gb|AY738754| gb|BC083443 41716 gb|XM_685802|tc|TC LOC562414 119.53483 4.877203 24.50888888 0.040801523 373400 25 25 3125 gb|BC059654|tc|TC3 zgc:73336 263.33862 10.75776 24.47893509 0.04085145 85189 5 475 11463 ref|NM_200871|ens|E pde6c 3770.5407 154.1487 24.46041225 0.040882385 NSDART000001065 5 01|gb|BC063318|tc|T C417227 4666 tc|TC378973|ref|XM TC378973 7019.5052 290.8982 24.13045268 0.041441411 _001339170 5 38810 ref|NM_199970|ens|E nme2a 1215.2944 51.04303 23.80921235 0.042000549 NSDART000000643 25

116

39|gb|BC059486|ens| ENSDART00000121 731 35909 ens|ENSDART00000 ENSDART0 504.52075 21.68123 23.26992405 0.042973926 144107|gb|CN500738 0000144107 75 |tc|TC404076|tc|TC40 3368 29589 gb|DT871739|tc|TC3 DT871739 36.458122 1.583056 23.03020928 0.043421229 97464 5 5 35202 ref|NM_001110031|g zgc:136903 40.882427 1.777879 22.99505295 0.043487615 b|BC115322|tc|TC36 5 25 8903 29639 ref|NM_001128267|e il2rb 39.97553 1.769169 22.59565047 0.044256305 ns|ENSDART000001 25 12338|ens|ENSDAR T00000122985|tc|TC 434402 9190 ref|NM_200719|gb|B arl3l2 337.77507 14.97050 22.56271054 0.044320916 C059480|tc|TC37626 5 075 5 10868 ref|NM_131567|ens|E prph2b 38.589075 1.715255 22.49757325 0.044449239 NSDART000000206 71|gb|BC059645|gb|B C155196 12421 gb|BC150415 myhb 1356.8081 61.30668 22.13148697 0.045184492 5 14438 ref|NM_001076577|e rgs9 51.131402 2.329202 21.95231931 0.045553273 ns|ENSDART000001 5 75 30128|ens|ENSDAR T00000123630|ens|E NSDART000001310 18 41342 ref|NM_001002399|e pdha1b 201.40575 9.198522 21.89544511 0.045671599 ns|ENSDART000001 75 23299|ens|ENSDAR T00000018420|gb|B C076185 13287 ref|NM_194393|ens|E guca1c 255.1372 11.76524 21.68566457 0.046113413 NSDART000000432 7 26|gb|BC044346|gb| AY044457 32565 ref|NM_001089510|e zgc:163064 36.680344 1.692162 21.67661533 0.046132663 ns|ENSDART000001 75 02750|gb|BC134212| ens|ENSDART00000 128442 9218 ref|NM_001025514|e zgc:112285 112.08584 5.238078 21.39827563 0.046732738 ns|ENSDART000000 75 5 75351|gb|BC096881|t c|TC426504 14522 ref|NM_001033749|e sagb 1987.6495 94.44394 21.045813 0.047515389 ns|ENSDART000000 55995|gb|BC080258| gb|BC097245 33806 gb|EB763977 wu:fb82e04 37.995493 1.814982 20.93436354 0.04776835

117

29677 ref|NM_131871|gb|A guca1b 32.689665 1.565014 20.88777466 0.047874894 Y050502 25 15792 ref|NR_015620|gb|B LOC568900 31.061033 1.50094 20.69438702 0.048322282 C122330|gb|BC0971 25 13|gb|BC116604 5535 ref|NM_131566|ens|E prph2a 38.14773 1.895505 20.12535705 0.049688559 NSDART000000554 75 15|gb|BC081641|tc|T C368432 35959 gb|BC124371|tc|TC4 lenepl 272.44537 13.61892 20.00491595 0.049987713 26399 5 125 14502 ref|NM_201014|ens|E zgc:56548 905.52765 45.37050 19.95850829 0.050103945 NSDART000001054 75 61|gb|BC049482|tc|T C445257 35051 gb|CA470325 wu:fe49a10 39.077282 1.967483 19.86156018 0.050348512 7575 ref|NM_001033749|e sagb 1926.9715 97.33482 19.79734849 0.050511815 ns|ENSDART000000 75 55995|gb|BC080258| gb|BC097245 33535 ref|NM_199967|ens|E gngt1 2475.706 125.0910 19.79122811 0.050527435 NSDART000001390 75 83|ens|ENSDART00 000130874|ens|ENS DART00000051950 43001 ref|NM_001024408|e ela3l 298.41013 15.10578 19.75469363 0.050620881 ns|ENSDART000000 375 78932|ens|ENSDAR T00000009028|gb|A Y583322 1141 ref|NM_001004112|e zgc:92375 157.33106 7.994432 19.68007892 0.050812804 ns|ENSDART000000 25 5 10496|gb|BC079524|t c|TC375859 945 ref|NM_200715|ens|E slc25a3a 2573.332 134.0675 19.19430102 0.052098797 NSDART000000379 025 49|ens|ENSDART00 000125743|gb|BC059 476 43817 gb|CT664799 wu:fc58c10 37.213225 1.946503 19.11798308 0.052306773 75 75 41801 ref|NM_131566|ens|E prph2a 48.31844 2.564679 18.83995068 0.053078695 NSDART000000554 75 15|gb|AF210643|gb|B C081641 16409 ens|ENSDART00000 ENSDART0 76.963952 4.094050 18.79897373 0.053194393 138830|ens|ENSDAR 0000138830 5 75 T00000011519|tc|TC 398625|tc|TC381417 11045 ref|NM_001077453|e cyp2x9 82.627115 4.405217 18.75664716 0.053314433 ns|ENSDART000001 75 04216|gb|BC124413|t c|TC402964 33754 ref|NM_199816|ens|E zgc:56085 12856.602 687.9499 18.68828275 0.053509464 NSDART000001014 25

118

49|gb|BC164873|gb|B C047826 25872 gb|EH449120|tc|TC3 wu:fj44c04 1329.8191 71.97466 18.47621144 0.05412365 92018|tc|TC413251|r 75 75 ef|XM_001922857 8472 ref|NM_001145236|e scpp5 1092.9573 59.99377 18.21784381 0.054891238 ns|ENSDART000001 925 37271|ens|ENSDAR T00000113673|gb|E U642611 29646 ref|NM_199970|ens|E nme2a 900.12885 49.53000 18.17340611 0.055025458 NSDART000000643 25 39|gb|BC059486|gb|C N510304 38394 ens|ENSDART00000 ENSDART0 305.62505 16.95098 18.02993396 0.05546332 145150|tc|TC379879| 0000145150 ref|XM_683705 24264 ref|NM_199816|ens|E zgc:56085 1332.0654 73.95096 18.012821 0.055516013 NSDART000001014 5 25 49|gb|BC047826|tc|T C383720 1560 ens|ENSDART00000 ENSDART0 43.804688 2.444802 17.91747524 0.055811435 084517 0000084517 25 5 10682 ref|NM_131868|ens|E gnat1 278.58642 15.75718 17.67995875 0.056561218 NSDART000000648 5 75 96|gb|AY050499|gb| BC059464 22054 ens|ENSDART00000 ENSDART0 636.20707 36.16032 17.59406407 0.056837351 134727|ens|ENSDAR 0000134727 5 5 T00000145755|gb|X M_001339095|tc|TC4 16475 5097 ens|ENSDART00000 ENSDART0 32.301686 1.851736 17.44399494 0.057326318 146090|tc|TC377111| 0000146090 5 75 tc|TC377106|ref|XM _001345921 2028 ens|ENSDART00000 ENSDART0 1191.6292 68.35130 17.43389098 0.057359542 134017|gb|CK396210 0000134017 5 |tc|TC418126|ref|XM _001333459 10524 ref|NM_001042753|e lrit1b 175.79612 10.08473 17.43190932 0.057366063 ns|ENSDART000001 5 15 27706|gb|BC117586|t c|TC368027 13875 ref|NM_001110031|e zgc:136903 25.51879 1.466148 17.40532422 0.057453684 ns|ENSDART000001 5 03973|gb|BC115322|t c|TC368903 33995 ens|ENSDART00000 ENSDART0 49.113015 2.842423 17.27857208 0.057875153 134925|ens|ENSDAR 0000134925 25 T00000132049|gb|EE 715147|tc|TC427513 14605 ref|NM_001007365|e tnni2a.1 111.30120 6.525603 17.05607972 0.05863012 ns|ENSDART000000 5 33872|gb|BC164874|

119

gb|BC085574 4927 ref|NM_199964|ens|E rcv1 3133.9347 184.0536 17.02729303 0.058729241 NSDART000000235 5 1 43|gb|BC059485|tc|T C371171 16067 gb|EH449120|tc|TC3 wu:fj44c04 1527.7708 90.36637 16.90640896 0.059149167 92018|tc|TC413251|r 5 25 ef|XM_001922857 39340 ref|NM_131700|ens|E vent 29.907947 1.773012 16.86843802 0.059282312 NSDART000000174 25 25 56|gb|AF255044|gb|C V486054 37030 ref|NM_001077300|e cplx4a 247.73699 14.82490 16.71086555 0.059841305 ns|ENSDART000000 475 84011|gb|GU174499| gb|BC124673 3029 gb|BI706802|gb|EH4 BI706802 31.986978 1.928969 16.58241784 0.060304837 52192|tc|TC416903|r 25 5 ef|XM_002667858 9941 ens|ENSDART00000 ENSDART0 42.41823 2.565477 16.53424685 0.060480529 143503|ens|ENSDAR 0000143503 T00000136525|gb|CF 348649|tc|TC391497 31209 ref|NM_001003737|e zgc:92041 1888.6993 114.6829 16.46888305 0.060720572 ns|ENSDART000000 5 05 21594|gb|BC078376|t c|TC407482 27365 ref|NM_199271|ens|E cpa5 234.51112 14.29530 16.40476369 0.060957903 NSDART000000343 5 65 77|gb|BC056300|gb|B C065991 24894 ref|NM_001007058|e crygm5 604.24767 37.40515 16.15412965 0.061903676 ns|ENSDART000001 5 2 15384|ens|ENSDAR T00000060361|gb|B C164872 29674 ref|NM_199964|ens|E rcv1 2156.0572 134.5256 16.02710538 0.062394299 NSDART000000235 5 8 43|gb|BC059485|tc|T C371171 14553 ref|NM_001040249|e zgc:136875 1670.8826 104.3720 16.00891328 0.062465202 ns|ENSDART000001 18 2 26311|ens|ENSDAR T00000009838|gb|B C164676 36072 ref|NM_001025514|e zgc:112285 353.57625 22.09883 15.99976877 0.062500903 ns|ENSDART000000 5 75351|gb|BC096881| gb|CT706847 14347 ref|NM_001080698|e zgc:158628 73.381357 4.611707 15.91197046 0.062845768 ns|ENSDART000001 5 75 14115|ens|ENSDAR T00000064904|gb|B C129332 25960 ref|NM_201048|ens|E pdia2 702.81555 44.37732 15.83726801 0.063142204

120

NSDART000000058 25 95|gb|BC045330|tc|T C371211 12749 ref|NM_200559|ens|E saga 546.24145 34.67955 15.75110784 0.063487598 NSDART000001450 75 35|gb|BC056570|gb|B C068418 40468 ref|NM_001018128|e crybb2 86.990737 5.531114 15.72752426 0.063582798 ns|ENSDART000000 5 5 75553|gb|DQ000467| gb|BC154625 24109 ref|NM_131567|ens|E prph2b 29.628922 1.889889 15.67759517 0.063785293 NSDART000000206 5 5 71|gb|AF210644|gb|B C059645 7616 ref|NM_001083023|e zgc:158846 64.711137 4.267465 15.16383378 0.065946384 ns|ENSDART000001 5 5 04074|gb|BC154249| gb|BC133171 11548 gb|BC164628|tc|TC3 pdia2 110.43888 7.425294 14.87333465 0.067234418 90715 25 7498 gb|XM_685802|tc|TC LOC562414 377.5453 25.61482 14.73932915 0.067845693 373400 25 15118 ref|NM_001130625|e zgc:194737 26.464172 1.808390 14.63410483 0.068333527 ns|ENSDART000001 5 25 25864|gb|BC163077|t c|TC410136 21001 ens|ENSDART00000 ENSDART0 95.641225 6.579999 14.53514223 0.068798776 041444|ens|ENSDAR 0000041444 25 T00000134262|gb|EB 956423|tc|TC369031 6960 ref|NM_200818|ens|E arl13a 951.52992 65.88543 14.44218876 0.069241582 NSDART000001382 5 75 32|ens|ENSDART00 000074455|gb|BC059 702 42925 DarkCorner 25.303008 1.756835 14.40260352 0.069431891 75 75 40904 ens|ENSDART00000 ENSDART0 41.172692 2.876911 14.31142378 0.06987425 135376|ens|ENSDAR 0000135376 5 T00000132690|ens|E NSDART000001482 11|ens|ENSDART00 000143198 43416 ref|NM_001045351|e zgc:153414 45.7642 3.209422 14.25932769 0.070129534 ns|ENSDART000000 86646|gb|BC122279|t c|TC376699 40102 tc|TC403556 TC403556 32.036435 2.254271 14.21143909 0.070365851 5437 ref|NM_001045425|e adipoql 56.242887 3.971007 14.16337982 0.070604616 ns|ENSDART000000 5 5 78901|ens|ENSDAR T00000058105|gb|B C122338 8351 ens|ENSDART00000 ENSDART0 35.09889 2.525500 13.89779433 0.071953864

121

086031|tc|TC368977| 0000086031 75 ref|XM_001919683 30455 ref|NM_152960|ens|E fabp10a 3414.3635 247.0542 13.82029718 0.072357344 NSDART000000560 75 95|gb|AF254642|gb|B C076219 13297 ref|NM_200559|ens|E saga 358.12915 25.96892 13.79068325 0.072512723 NSDART000000257 88|ens|ENSDART00 000145035|gb|BC068 418 23986 ref|NM_152960|ens|E fabp10a 2046.5772 148.5324 13.77865873 0.072576005 NSDART000000560 5 95|gb|BC164928|gb| AF254642 30997 ref|NM_001038009|r epo 20.256642 1.477171 13.7131281 0.072922822 ef|NM_001115127|re 5 f|NM_001115128|ens |ENSDART00000111 066 37625 gb|EH594340|tc|TC3 EH594340 43.311882 3.164241 13.68792153 0.073057111 79238|ref|XM_00320 5 0277 38455 gb|AF273876|gb|AF2 ighv4-6 27.735086 2.053054 13.50918169 0.074023729 73884|gb|AF273877|t 25 5 c|TC425720 35000 ref|NM_001002372|e tm4sf5 28.594662 2.127992 13.43738876 0.074419221 ns|ENSDART000000 5 5 77503|gb|BC075884|t c|TC372431 10448 ens|ENSDART00000 ENSDART0 164.8201 12.32084 13.37733219 0.07475332 078030|tc|TC381314| 0000078030 975 ref|XM_680654 44675 ref|NM_001020543|e zgc:109982 33.262217 2.489284 13.36216257 0.074838185 ns|ENSDART000000 5 74512|gb|BC164344| gb|BC095105 8090 ref|NM_001025474|e zgc:112368 45.998195 3.466997 13.2674449 0.075372463 ns|ENSDART000001 25 06082|gb|BC095787| gb|BC079519 42649 ens|ENSDART00000 ENSDART0 27.24958 2.086062 13.06268628 0.076553932 055973|ens|ENSDAR 0000055973 5 T00000122597|gb|B C081666|tc|TC36647 0 11149 ref|NM_001003737|e zgc:92041 614.64632 47.12963 13.04161012 0.076677649 ns|ENSDART000000 5 5 21594|ens|ENSDAR T00000063389|gb|B C165698 29873 ref|NM_201334|ens|E zgc:64065 50.414935 3.870769 13.02452607 0.076778226 NSDART000001049 25 84|gb|BC054605|tc|T C367287

122

45053 DarkCorner 24.524539 1.901715 12.89601019 0.077543363 25 25 2750 ref|NM_201173|ens|E cyp7a1a 37.56414 2.925877 12.83858945 0.077890177 NSDART000001000 5 69|ens|ENSDART00 000145188|gb|BC054 571 39096 ref|NM_001201348|r si:dkey- 1203.6786 94.27119 12.7682556 0.078319234 ef|NM_001201349|re 52k20.7 5 f|NM_001201350|ref| NM_001201351 23278 ens|ENSDART00000 ENSDART0 138.7847 10.88730 12.74738292 0.078447475 007654|gb|BC060908 0000007654 925 |tc|TC379721|tc|TC38 3933 862 ref|NM_001045425|e adipoql 45.333825 3.565317 12.71522714 0.078645862 ns|ENSDART000000 75 78901|gb|EU139314| gb|BC165538 41035 ref|NM_001030268|e zgc:112300 453.18525 35.68379 12.70003041 0.078739969 ns|ENSDART000000 25 73742|gb|BC096884|t c|TC451055 33324 ens|ENSDART00000 ENSDART0 21.734277 1.720155 12.63506555 0.079144821 074557|tc|TC378810 0000074557 5 5 376 ref|NM_001128539|e zbtb10 757.90954 60.34356 12.55990716 0.079618423 ns|ENSDART000001 25 25 13797|tc|TC371789 27693 ens|ENSDART00000 ENSDART0 135.96612 10.97782 12.38552389 0.080739419 145503|ens|ENSDAR 0000145503 55 T00000131824|ens|E NSDART000000175 93|gb|XM_680251 29634 ens|ENSDART00000 ENSDART0 17.22429 1.398358 12.31750436 0.081185277 081270|ref|XM_0019 0000081270 75 19281 20743 tc|NP13320863 NP13320863 18.008215 1.469139 12.2576638 0.081581614 25 1723 gb|EV561039|tc|TC3 EV561039 202.99352 16.58639 12.23855569 0.081708988 91708 5 55 25362 A_15_P1906 16.12099 1.331373 12.10854509 0.082586305 56 41854 ref|NM_001025187|e zgc:112302 75.868595 6.272566 12.09530341 0.082676719 ns|ENSDART000001 5 47073|ens|ENSDAR T00000034586|gb|B C096885 39548 ens|ENSDART00000 ENSDART0 53932.822 4461.032 12.08976309 0.082714607 125433|ens|ENSDAR 0000125433 75 225 T00000127411|ens|E NSDART000001305 01|ens|ENSDART00 000123459 31254 ref|NM_001004018|e gipc1 844.91292 70.47763 11.98838362 0.083414081 ns|ENSDART000001 5 5

123

38481|gb|AY989813| gb|AY690668 34023 gb|XM_001333666|tc LOC795026 188.84105 15.82060 11.93639688 0.083777375 |NP13321235|tc|NP1 75 3321234|tc|TC38856 5 24719 ref|NM_001103137|e syt5a 800.44067 67.68479 11.82600384 0.084559418 ns|ENSDART000001 5 75 33035|gb|BC076166| gb|BC152174 31277 ref|NM_001002395|e zgc:92712 474.63157 40.33723 11.76658748 0.084986408 ns|ENSDART000000 5 25 12023|gb|BC076192| gb|CN502629 36135 ens|ENSDART00000 ENSDART0 82.739852 7.068665 11.70515843 0.085432419 129365|tc|TC371461| 0000129365 5 75 ref|XM_678581 20901 ens|ENSDART00000 ENSDART0 21.01006 1.818881 11.55108785 0.086571933 093000|gb|BC124814 0000093000 5 |tc|TC396245|ref|XM _003199372 3542 ref|NM_001114918|e si:dkey- 54.544337 4.729648 11.53243064 0.086711989 ns|ENSDART000000 94e7.2 5 99052|gb|BC154524|t c|NP13324381 38617 ens|ENSDART00000 ENSDART0 24.683417 2.152276 11.46851468 0.08719525 076300|gb|BC154540 0000076300 5 75 |tc|TC370963|ref|XM _003198909 8223 ref|NM_001083023|e zgc:158846 627.4134 54.80559 11.44798081 0.087351649 ns|ENSDART000001 5 04074|gb|BC133171| gb|BC154249 18296 ref|NM_200733|ens|E pp 207.3767 18.21705 11.38365981 0.087845211 NSDART000001282 41|gb|BC059512|ens| ENSDART00000041 813 40569 ref|NM_001018164|e lrit1a 137.81406 12.13872 11.35325265 0.088080485 ns|ENSDART000000 925 05957|ens|ENSDAR T00000147903|gb|B C095674 35676 ref|NM_001077300|e cplx4a 65.551847 5.776476 11.34806887 0.08812072 ns|ENSDART000000 5 84011|gb|BC124673|t c|TC410336 35434 ref|NM_001005598|e ttr 22.427712 1.979198 11.33171315 0.08824791 ns|ENSDART000000 5 75 54084|ens|ENSDAR T00000136986|gb|B C164894 42839 DarkCorner 19.907035 1.76298 11.29169687 0.088560649 75 19173 ens|ENSDART00000 ENSDART0 94.198045 8.376481 11.24553814 0.088924157

124

129365|tc|TC371461| 0000129365 75 ref|XM_678581 44883 DarkCorner 27.464365 2.464507 11.14395562 0.089734744 75 38176 tc|NP13320206|tc|NP NP13320206 21.131971 1.900799 11.11741523 0.089948966 13320207|ref|XM_00 75 1333261|ref|XM_001 333170 29039 gb|BC142812 LOC567242 531.79902 48.03527 11.07100974 0.090325998 5 75 9848 ref|NM_212881|ens|E zgc:73371 39.71565 3.604617 11.01799213 0.090760638 NSDART000000120 75 39|gb|BC066779|tc|T C366797 24212 ref|NM_001130644|e si:dkeyp- 104.95104 9.582858 10.95195601 0.09130789 ns|ENSDART000001 73d8.6 75 75 12797|gb|BC163820| gb|BC163841 34641 ref|NM_199607|ens|E cel.1 28.74084 2.625760 10.94571925 0.091359917 NSDART000000277 75 84|ens|ENSDART00 000143952|gb|BC055 668 22992 ref|NM_001110123|e oscp1 56.5601 5.177365 10.92449485 0.091537413 ns|ENSDART000001 25 14725|ens|ENSDAR T00000108603|ens|E NSDART000001372 33 12439 ref|NM_200837|gb|B zgc:73359 1861.2722 170.3772 10.92441773 0.09153806 C060940|gb|CN5112 5 5 51|gb|EH478932 2477 ref|NM_001114704|e zgc:174260 85.41247 7.849333 10.88149366 0.091899148 ns|ENSDART000001 25 10532|gb|BC154263 27068 A_15_P1386 17.51083 1.610092 10.87566539 0.091948397 21 75 24700 ens|ENSDART00000 ENSDART0 328.86127 30.30398 10.85207928 0.092148239 122749|ens|ENSDAR 0000122749 5 75 T00000017593|gb|B C142898|gb|XM_680 251 35810 ref|NM_001114412|e zgc:172352 19.324055 1.782952 10.83823197 0.092265971 ns|ENSDART000000 5 75 86166|gb|BC155665|t c|TC366107 36169 ens|ENSDART00000 ENSDART0 352.96787 32.56878 10.83761344 0.092271237 126737|gb|BC135074 0000126737 5 25 |gb|BC153928|gb|BC 124622 12867 ref|NM_200794|ens|E zgc:73336 15.797275 1.465077 10.78255062 0.092742435 NSDART000000112 75 95|gb|BC066562|tc|T C376577 19107 ref|NM_200238|ens|E vil1l 463.97027 43.13338 10.75663955 0.092965837

125

NSDART000000592 5 5 28|gb|BC165692|gb|B C047186 19033 ref|NM_001103137|e syt5a 202.03947 18.7966 10.7487245 0.093034294 ns|ENSDART000000 5 55292|ens|ENSDAR T00000059197|ens|E NSDART000001330 35 44834 ens|ENSDART00000 ENSDART0 32.962235 3.069984 10.73693945 0.093136411 082511|tc|TC387004| 0000082511 25 ref|XM_001922269 20663 ref|NM_199271|ens|E cpa5 428.71875 39.94744 10.73206868 0.093178681 NSDART000000343 75 77|gb|AF376130|gb|B C056300 29560 ref|NM_001003438|e rs1 7534.077 704.4273 10.69532191 0.093498822 ns|ENSDART000000 25 36050|gb|BC076183|t c|TC375064 29874 ens|ENSDART00000 ENSDART0 21.918099 2.051745 10.68266102 0.093609635 115040|tc|NP133241 0000115040 25 23 24803 A_15_P7596 27.478407 2.588405 10.61595932 0.094197799 06 5 5 10235 ens|ENSDART00000 ENSDART0 26.36866 2.487283 10.60138796 0.094327271 111903|ens|ENSDAR 0000111903 75 T00000137427|gb|EE 705781|ref|XM_0031 99919 21848 ens|ENSDART00000 ENSDART0 27735.312 2619.129 10.58951744 0.094433009 101147|gb|BC134870 0000101147 5 025 |gb|BC151864|gb|BC 124740 13709 ref|NM_001004663|e zgc:103671 84.276795 7.980121 10.56084175 0.094689422 ns|ENSDART000001 35408|gb|BC081506| gb|CN331231 18814 ref|NM_001101803|e mapkapk2b 62.401162 5.936306 10.5117829 0.095131341 ns|ENSDART000000 5 25 03954|gb|AB292795|t c|TC375131 31567 ens|ENSDART00000 ENSDART0 15.646695 1.488505 10.51168295 0.095132245 112819|tc|TC367638| 0000112819 25 25 ref|XM_001340798 29473 ens|ENSDART00000 ENSDART0 190.68472 18.19999 10.47718715 0.095445465 135295|tc|TC368379| 0000135295 75 25 ref|XR_117946 14637 ref|NM_001005602|e phyhiplb 368.54957 35.17849 10.47655951 0.095451183 ns|ENSDART000001 25 03536|gb|BC139549|t c|TC372347 39182 ref|NM_001025180|e c6ast4 18.414764 1.761773 10.45240314 0.095671779 ns|ENSDART000000 25 25 74463|ens|ENSDAR

126

T00000144341|gb|B C097232 18825 ref|NM_200238|ens|E vil1l 1417.9892 135.6809 10.45090699 0.095685475 NSDART000000592 5 75 28|gb|BC047186|tc|T C444036 12272 ref|NM_001077310|r zgc:153102 43.796935 4.201562 10.4239637 0.095932798 ef|NM_001111180|en 5 s|ENSDART0000008 3582|gb|BC124639 3151 ref|NM_001111208|r zgc:174259 45.52645 4.369136 10.4200121 0.095969178 ef|NM_001030107|en s|ENSDART0000007 9090|gb|BC155142 31502 tc|TC388422 TC388422 318.57112 30.67529 10.38526603 0.096290263 5 75 3797 tc|NP13325028 NP13325028 43.582572 4.211154 10.3493182 0.096624723 75 19810 ref|NM_001110451|g stk24a 15.557252 1.504817 10.33830193 0.096727684 b|BC134216|tc|TC37 5 3602 12842 ens|ENSDART00000 ENSDART0 15.926187 1.541477 10.33176774 0.096788858 078843|tc|NP133246 0000078843 5 5 27|ref|XM_00134030 4 4616 ref|NM_200733|ens|E pp 989.1177 96.16814 10.28529457 0.09722619 NSDART000001282 5 41|gb|BC059512|tc|T C430237 17028 ref|NM_194361|ref|N mpz 280.7892 27.48374 10.21655528 0.097880349 M_001004287|ens|E 5 NSDART000001092 51|gb|BC085603 20215 ref|NM_001145245|e scpp9 17.565488 1.71947 10.21564101 0.097889109 ns|ENSDART000001 25 29813|gb|EU642615 36302 ref|NM_200358|ens|E slc10a2 31.550462 3.101228 10.17353605 0.098294241 NSDART000000118 5 75 22|gb|BC165330|gb|B C053189 34513 gb|EE690470 EE690470 20.444047 2.020446 10.11857911 0.098828105 75 5 37157 ref|NM_001008599|e zgc:103559 36.986155 3.676405 10.06041159 0.099399512 ns|ENSDART000000 75 55848|gb|BC086832|t c|TC372494 42505 ref|NM_001202511|e glra4b 111.49897 11.10661 10.03897002 0.099611813 ns|ENSDART000000 75 525 06474|gb|AJ308517|g b|FJ915068 23852 ens|ENSDART00000 ENSDART0 1.4207135 14.41153 0.098581705 10.14386996 058699|gb|XM_6811 0000058699 3 47|tc|TC392778 25683 ref|NM_001113639|g LOC798811 1.9403995 20.07386 0.096662978 10.34522234 b|AB331777|gb|AB3 425

127

31750|tc|NP1295945 0 14455 ref|NM_194425|gb|B mhc1ze 1.628646 16.88621 0.096448261 10.36825329 C165786|gb|AJ42095 425 3|gb|BC124481 9936 ref|NM_194425|gb|A mhc1ze 1.8650387 19.36435 0.096312982 10.38281631 J420953|gb|BC12448 5 475 1|gb|BC076561 33181 gb|AL725679|tc|TC4 sb:cb25 8.055779 85.83318 0.093853904 10.65485784 43356 2313 gb|EG578768|tc|TC4 wu:fi04f09 15.173647 162.9293 0.093130214 10.73765388 10352|ref|XM_68288 5 75 8 23188 E1A_r60_a1 2.437273 26.24920 0.092851306 10.7699077 04 525 3329 ref|NM_001114705|e hspb9 637.35667 7059.491 0.090283649 11.07620274 ns|ENSDART000001 5 75 14023|gb|EF583630|g b|EH439736 23608 ens|ENSDART00000 ENSDART0 1.4561582 16.12962 0.090278499 11.07683454 058600 0000058600 5 4 9405 ref|NM_001017853|e zgc:110152 10.249612 114.0083 0.089902288 11.12318739 ns|ENSDART000000 55 55428|gb|BC165555| gb|BC092758 45055 DarkCorner 2.3764355 27.13266 0.087585776 11.41737899 475 10794 ens|ENSDART00000 ENSDART0 111.22450 1273.542 0.087334771 11.4501932 141550|ens|ENSDAR 0000141550 75 1 T00000146058|gb|B C090774|tc|TC44203 0 32299 ref|NM_001105705|r zgc:173548 30.802875 352.813 0.087306519 11.45389838 ef|NM_001114478|gb |BC150429|gb|BC100 002 12303 tc|TC419839 TC419839 75.139077 867.2830 0.086637318 11.54237021 5 5 26055 ref|NM_213123|ens|E mmp9 422.9195 4891.660 0.086457243 11.56641098 NSDART000000628 75 45|gb|AY151254|gb| BC053292 3022 ref|NM_001136248|g zgc:194112 2.031414 23.60993 0.086040628 11.62241633 b|EH443168|tc|TC42 925 8297 16794 ref|NM_001115069|e LOC1000038 2.7889742 32.45300 0.08593886 11.6361795 ns|ENSDART000001 96 5 5 45782|gb|AB331772| gb|CO913970 9080 tc|TC410352|tc|TC45 TC410352 300.0594 3493.402 0.085893172 11.64236898 2781|ref|XM_682888 25 8108 ref|NM_001008652|e ch25h 1.9756357 23.03732 0.085758055 11.66071225 ns|ENSDART000000 5 66439|gb|BC165116| gb|BC086721

128

38356 ref|NM_131397|ref|N hsp70 624.48932 7322.992 0.085277889 11.72636906 M_001127518|ref|N 5 3 M_001113589|ens|E NSDART000001110 42 5847 gb|EH488833|tc|TC4 si:ch73- 102.09822 1210.230 0.084362622 11.85359075 00019|tc|TC404345 6k14.1 5 575 5934 gb|BI885686 BI885686 7.1338445 85.98125 0.082969767 12.05258294 25 15791 ref|NM_131879|ens|E cyp1a 411.32477 4976.951 0.082645933 12.09980896 NSDART000000382 5 2 00|gb|AB078927|gb| AF210727 43585 tc|TC416744|ref|XM TC416744 65.705435 798.7134 0.082264087 12.15597271 _003200388 75 14274 ref|NM_001127518|r zgc:174006 616.09675 7570.094 0.081385606 12.28718497 ef|NM_001113589|en 725 s|ENSDART0000007 8671|ens|ENSDART 00000045767 31167 ens|ENSDART00000 ENSDART0 25.33297 312.8076 0.080985782 12.3478465 123943|gb|BC134121 0000123943 25 |gb|BC153905|gb|BC 095862 28735 gb|CN509479 wu:fc41f11 2.7338725 33.78149 0.080928111 12.35664575 4 45139 DarkCorner 2.124392 26.81781 0.079215708 12.62375894 25 29078 ref|NM_001005599|e zgc:103580 3.1840807 40.26563 0.079076884 12.64592065 ns|ENSDART000000 5 25 67629|gb|BC164922| gb|BC081487 42356 ref|NM_001113651|g LOC1000039 4.7782612 60.73460 0.078674444 12.71060786 b|AB331766|tc|TC40 11 5 5 3361 11116 ref|NM_001044945|e sin3b 14.634834 186.4524 0.078490976 12.7403181 ns|ENSDART000000 75 5 90371|gb|BC171496| gb|BC171498 26453 gb|CK693995|tc|TC3 CK693995 23.67424 307.6362 0.076955304 12.9945559 87867 35 40009 ref|NM_131560|ens|E mxtx1 1.8836955 24.58555 0.07661797 13.05176845 NSDART000001009 75 25|gb|AB034245|gb| BC127384 7760 ref|NM_131020|ref|N ba1 27.27759 360.1047 0.075749053 13.20148518 M_001005403|ens|E NSDART000001017 13|gb|BC162261 22318 ref|NM_001103122|r zgc:174855 1003.9773 13382.88 0.075019512 13.32986546 ef|NM_001105680|en 5 3 s|ENSDART0000011 3078|ens|ENSDART 00000109968 37537 ref|NM_001044848|e zgc:136551 102.81724 1386.555 0.074152993 13.48563237

129

ns|ENSDART000000 5 87624|gb|BC117615|t c|TC413769 10766 ens|ENSDART00000 ENSDART0 1.6999177 24.06715 0.070632268 14.15783499 081440|ens|ENSDAR 0000081440 5 5 T00000123461|ref|X M_003200549 35027 ref|NM_001013027|e ba1l 43.503412 619.3221 0.070243589 14.23617458 ns|ENSDART000001 5 75 30869|ens|ENSDAR T00000128981|gb|D N891219 26026 ref|NM_001169147|e cplx4b 1.9265832 27.68478 0.069589978 14.36988526 ns|ENSDART000000 5 025 82748|ens|ENSDAR T00000134186|gb|G U174500 44024 ref|NM_131879|ens|E cyp1a 9.5939797 138.0956 0.069473454 14.39398699 NSDART000000382 5 198 00|gb|AF057713|gb|B C165188 2348 ref|NM_001185071|e fp 2.0897385 30.50005 0.068515898 14.59515269 ns|ENSDART000000 25 81625|gb|HM043790| ens|ENSDART00000 108968 36767 ref|NM_001113589|r hsp70l 441.4898 6510.235 0.067814724 14.7460601 ef|NM_001127518|en 125 s|ENSDART0000003 1650|ens|ENSDART 00000045767 38633 tc|TC406546|ref|XM TC406546 2.05466 31.10776 0.066049747 15.14010347 _001922529 5 26418 ens|ENSDART00000 ENSDART0 1.7838912 27.41608 0.065067317 15.3686989 134180|gb|CN021274 0000134180 5 75 |tc|TC388405|tc|TC38 9563 8886 ref|NM_001013027|r ba1l 30.255 492.4036 0.061443493 16.27511651 ef|NM_001005403|en 5 s|ENSDART0000013 0869|ens|ENSDART 00000128981 38954 ref|NM_001030173|e si:dkeyp- 3.71426 65.05556 0.05709366 17.51507972 ns|ENSDART000000 59a8.2 61311|tc|TC399857 32240 ens|ENSDART00000 ENSDART0 65.600342 1152.003 0.056944549 17.56094337 128763|gb|XM_0019 0000128763 5 9 20878|tc|TC370090 29591 ref|NM_001033093|r si:xx- 8.8946377 165.9614 0.053594599 18.65859658 ef|NM_131257|ens|E by187g17.1 5 575 NSDART000001108 48|ens|ENSDART00 000113098 11505 gb|CF550113 hbaa1 10.240508 200.1995 0.051151494 19.54977114 5 975

130

23798 ens|ENSDART00000 ENSDART0 1.7721985 36.35066 0.048752853 20.51162017 114099|tc|NP133205 0000114099 25 32 8685 ref|NM_001128576|e lepa 10.690754 225.9907 0.047306153 21.13889906 ns|ENSDART000001 25 75 26441|gb|AM920658| tc|NP13315079 26283 gb|XM_001343513|tc LOC1000041 2.0586892 47.27455 0.04354751 22.96342527 |TC402658 86 5 675 21307 gb|U50379 ba2 2.2486105 53.20699 0.04226156 23.66216492 25 14844 ref|NM_001015058|e hbbe3 2717.6734 70256.51 0.038682156 25.85171335 ns|ENSDART000000 5 5 55623|gb|BC090459|t c|TC411599 13397 ref|NM_001130655|e si:ch211- 35.491767 970.3190 0.036577419 27.33927171 ns|ENSDART000001 122l24.4 5 75 13901|ens|ENSDAR T00000124897|ens|E NSDART000001401 71 23946 ens|ENSDART00000 ENSDART0 1.5767502 46.28547 0.034065769 29.3549806 040180|gb|XM_6880 0000040180 5 3 29|tc|TC438876 15486 ref|NM_001080092|e ghrh 3.3616665 101.7572 0.033036137 30.26988326 ns|ENSDART000001 525 01175|gb|DQ991246| gb|DQ832172 8074 ref|NM_001080092|e ghrh 6.7240035 222.2812 0.030249987 33.05786501 ns|ENSDART000001 01175|gb|DQ832172| tc|TC376915 43016 ref|NM_001017578|e zgc:110088 115.75760 4280.558 0.027042641 36.9786368 ns|ENSDART000000 75 525 41335|gb|BC164239| gb|BC092727 33516 gb|AY329628 hbbe3 1836.3233 68946.72 0.026633948 37.54606725 5 13944 ref|NM_001204169|e isg15 37.79253 1421.415 0.026587959 37.61101003 ns|ENSDART000001 225 30554|gb|BC151911|t c|TC405060 41542 ref|NM_131020|ref|N ba1 3.3856637 127.6909 0.026514514 37.71519322 M_001005403|ens|E 5 625 NSDART000001017 13|gb|BC107513 1310 ref|NM_001030186|e lepb 2.0425695 81.22783 0.025146178 39.76747425 ns|ENSDART000000 66972|ens|ENSDAR T00000133203|gb|A M901009 367 tc|NP13322800 NP13322800 3.3669377 143.5503 0.023454753 42.63528105 5 373 38773 ref|NM_212950|ens|E pth1a 25.183317 1323.465 0.019028318 52.55325276 NSDART000001468 5 25

131

45|gb|BC095580|gb| AY275669 3257 ref|NM_212950|ens|E pth1a 6.9828737 443.6472 0.015739697 63.53362396 NSDART000001468 5 75 45|gb|BC163919|gb|B C095580

132