Characterization of the Temporal Dynamics of
Wnt-mediated Posteriorization of the Vertebrate
Neural plate
A Dissertation Presented to the
Faculty of the Department of
Biology University of Houston
In Partial Fulfillment of the
Requirements for the Degree
Doctor of Philosophy
By
David Green
August, 2019 Characterization of the Temporal Dynamics of
Wnt-mediated Posteriorization of the Vertebrate
Neural plate
......
David Green APPROVED:
......
Dr. Arne C. Lekven, Chair
......
Dr. Amy K. Sater
......
Dr. Brigitte Dauwalder
......
Dr. Daniel S. Wagner Rice University
......
Dr. Dan E. Wells, Dean, College of Natural Sciences and Mathematics
ii ACKNOWLEDGEMENTS
I would first like to thank my committee Dr. Daniel Wagner, Dr. Brigitte Dauwalder and Dr. Amy Sater for their helpful comments and suggestions in writing this dissertation. I would also like to thank my Master’s thesis committee Dr. Bruce Riley, Dr. Alvin Yeh and Dr. Rene Garcia who helped in many of the early stages of my doctoral research. A special thanks to Dr. Arne Lekven for all his help in making me the scientist I am today.
Thank you to my parents for always supporting me throughout these years.
This dissertation is dedicated to Katie, without you none of this would have been possible.
iii Characterization of the Temporal Dynamics of
Wnt-mediated Posteriorization of the Vertebrate
Neural plate
An Abstract of a Dissertation
Presented to the Faculty of the
Department of Biology University
of Houston
In Partial Fulfillment of the
Requirements for the Degree
Doctor of Philosophy
By
David Green
August, 2019
iv ABSTRACT
The vertebrate central nervous system is divided into a series of functional domains along the AP axis; forebrain, midbrain, hindbrain, and spinal cord. Failure to properly pattern the AP axis has been associated with a range of neuropathologies including schizophrenia and autism. In recent years, there have been numerous findings that have challenged dogmatic beliefs in how the AP axis is established during embryogenesis.
After induction, the AP axis of the neural plate is established via several posteriorizing morphogens, including wnt8a. Wnt8a is secreted from the margin and forms a signaling gradient. The current dogma suggests that this signaling gradient is achieved by diffusion. Recent evidence supports an alternative model where Wnt8a is transported along cellular protrusions called filopodia. The filopodial model introduces several inconsistencies that must be resolved.
Here we provide evidence that primary Wnt-mediated posteriorization of the neural plate occurs in a narrow window of time between 4.6 hpf and 7 hpf. The interpretation of this signal by the neural plate is complex and outcomes of these signals are sometimes not detected until several hours later. A secondary phase of Wnt-mediated posteriorization is regulated by Wnts expressed in the neural plate. These findings provide rationale for how filopodial-mediated Wnt-signaling occurs early in epiboly while the neural plate is still in range. Additionally our findings establish new temporal elements to the Wnt-mediated posteriorization paradigm, showing that the neural plate responds dynamically to Wnt signaling both in regards to competency to Wnt as well as the time it takes for Wnt signaling to affect transcription. Together these findings provide important steps to redefining the Wnt-signaling paradigm in lieu of recent challenges to the previous model.
v Contents
1 INTRODUCTION 1
1.1 Patterning of the Anterior Posterior Axis of the Central Nervous System in Development and Disease ...... 1
1.2 Neural Induction and Patterning ...... 3
1.3 Mechanisms of Wnt Signaling ...... 4
1.4 Role of Morphogens in Patterning in the Neural Plate ...... 6
1.5 Summary of Zebrafish Development and Formation of the Nervous System ...... 7
1.6 Establishment and Early Patterning of the Midbrain Hindbrain Boundary ...... 8
1.7 Establishing the Wnt Signaling Gradient ...... 9
1.8 Defining the Temporal Elements of Wnt-Mediated Neural Posteri- orization ...... 10
1.9 Project Outline ...... 12
2 DISTINCT PHASES OF WNT REPSONSE IN THE NEURAL
vi PLATE DURING EPIBOLY 14
2.1 Introduction ...... 14
2.2 Materials and Methods ...... 17
2.2.1 Zebrafish care ...... 17
2.2.2 Heat shocks and in situ hybridizations ...... 17
2.2.3 Drug treatments ...... 18
2.2.4 Screening transgenic lines ...... 19
2.3 Results ...... 19
2.3.1 Temporal dynamics of Wnt regulation by hs:dkk1GFP and hs:wnt8aGFP ...... 19
2.3.2 A heat shock time series defines three distinct functional periods for Wnt-mediated MHB patterning...... 20
2.3.3 Early gastrula Wnt signaling regulates primary neural plate anteroposterior pattern...... 22
2.3.4 MHB formation is transiently disrupted with early-stage in- hibition of Wnt signaling...... 25
2.3.5 A Wnt overexpression assay identifies two windows of re- sponse in the neural plate to Wnt signaling ...... 25
2.3.6 otx2b positive cells become refractory to Wnt signaling by 75% epiboly ...... 26
2.3.7 Determining the mechanism of the otx2b refractory period . 28
vii 2.3.8 Fgf and Wnt signaling synergize to suppress otx2b ...... 30
2.4 Discussion ...... 32
2.4.1 Wnt-mediated neural patterning can be divided into tem- porally distinct phases...... 32
2.4.2 The dynamics of Wnt signaling response in MHB positioning 34
3 TRANSCRIPTIONAL RESPONSE OF THE NEURAL PLATE TO WNT SIGNALING IS TEMPORALLY DYNAMIC 36
3.1 Introduction ...... 36
3.2 Materials and Methods ...... 38
3.2.1 RNA-Seq analysis ...... 38
3.2.2 Cloning and injections ...... 38
3.3 Results ...... 39
3.3.1 Wnt modulation at time 1 and 2 induce a transcriptionally dynamic response in the embryos ...... 39
3.3.2 No correlation between changes in expression levels and pat- tern in neural AP patterning genes ...... 41
3.3.3 shisa2b overexpression induces morphogenetic failures in the neural tube ...... 43
3.4 Discussion ...... 47
3.4.1 Response of the neural Plate to Wnt signaling can be divided into three temporal classifications ...... 47
viii 3.4.2 Response of the neural plate to Wnt modulation is tempo- rally dynamic ...... 49
3.4.3 The role of shisa2b in patterning of the brain ...... 49
3.4.4 Conclusion ...... 50
4 GENERATING A GBX1 FLUORESCENT REPORTER LINE 51
4.1 Introduction ...... 51
4.2 Materials and Methods ...... 52
4.2.1 Modification of (CH211-89L23) to Create TgBAC(gbx1:H2b- egfp)...... 52
4.2.2 Generating Tg(TgBAC(gbx1:H2b-egfp) Transgenic Zebrafish 53
4.2.3 Antibody Staining ...... 53
4.2.4 Fluorescent Imaging ...... 54
4.3 Results ...... 54
4.3.1 In situ hybridization of TgBAC(gbx1:H2b-egfp)...... 54
4.3.2 TgBAC(gbx1:H2b-egfp) EGFP protein localization ...... 56
4.3.3 Estimating the turnover of H2B-EGFP ...... 58
4.4 Discussion ...... 59
4.4.1 The perdurance of TgBAC(gbx1:H2b-egfp)) reveals regula- tory mechanisms of gbx1 ...... 59
ix 4.4.2 Assessment of TgBAC(gbx1:H2b-egfp) as a tool to assess the resolution of the otx2b/gbx1 interface ...... 59
4.4.3 The neural plate regulatory paradox ...... 60
5 Summary 62
5.1 Wnt-Mediated Posteriorization is Established Early in Epiboly and Interpreted Over an Extended Period of Time ...... 62
5.2 Wnt Signaling: Cascades and Patterning ...... 64
5.3 The Positioning of the MHB and Disease in Humans ...... 66
6 Appendix 67
x List of Figures
1 Zebrafish brain at 24hpf...... 2
2 The activation/transformation model of neural induction. .3
3 The modified activation/transformation model of neural induction...... 4
4 The canonical Wnt signaling pathway...... 6
5 Filopodial Wnt gradient model...... 11
6 Temporal analysis of Wnt modulation by the hs:dkk1bGFP and hs:wnt8aGFP transgenes ...... 21
7 Timed overexpression of hs:dkk1GFP reveal distinct win- dows of Wnt response...... 22
8 Wnt suppression temporarily disrupts MHB establishment during epiboly ...... 23
9 MHB markers require Wnt signaling at different phases of maintenance ...... 24
10 Timed overexpression of hs:wnt8aGFP reveal two distinct windows of Wnt competency ...... 27
xi 11 otx2b positive cells become unresponsive to Wnt signaling by 75% epiboly ...... 29
12 gbx1 expansion detectable 4 h post heat shock ...... 30
13 otx2b is directly suppressed by Wnt signaling ...... 31
14 Wnt and Fgf co-overexpression suppresses midbrain fate .. 32
15 The Phases of Wnt-mediated neural patterning ...... 33
16 Schematic of wnt modulation and RNA-Seq analysis .... 39
17 PCA of RNA-Seq Analysis ...... 40
18 Temporally dynamic response of neural plate to Wnt mod- ulation ...... 42
19 Validation of hsdkk1 RNA-Seq analysis ...... 44
20 Validation of hs:wnt8aGFP RNA-Seq analysis ...... 45
21 shisa2b overexpression induces convergent extension defects 47
22 Expression pattern of TgBAC(gbx1:H2b-egfp) reporter .. 55
23 Additional views of 8 hpf TgBAC(gbx1:H2b-egfp) embryos. 56
24 EGFP localization in TgBAC(gbx1:H2b-egfp) embryos ... 57
25 gbx1BAC:h2b2gfp expression in cerebellum clears within 13 hours ...... 58
26 mir seed sequences identified in gbx1 3’ UTR ...... 60
xii 27 Comparison of Wnt diffusion and filopodial transport models 63
28 A temporally dynamic Wnt signaling cascade ...... 65
xiii List of Tables
1 Wnt suppression time 1 ...... 67
2 Wnt suppression time 2 ...... 69
3 Wnt overexpression time 1 ...... 73
4 Wnt overexpression time 2 ...... 74
xiv Chapter 1
INTRODUCTION
1.1 Patterning of the Anterior Posterior Axis
of the Central Nervous System in
Development and Disease
The vertebrate central nervous system (CNS) is divided into four distinct morphological and functional domains; the forebrain, midbrain, hindbrain, and spinal cord, along the anteroposterior (AP) axis (Fig. 1). Throughout embryogenesis, these domains are subdivided into smaller functional domains from which arise the neuronal populations that define the functional circuitry of the brain. A divergence in size and shape of these domains is an important element in the adaptation of vertebrates to specific niches [1]. Manipulations of the AP axis through modulation of signaling pathways can cause organisms to develop behaviors specific to species of different niches [2]. Failure to properly pattern the AP axis of the CNS can have major repercussions on the ability of an organism to function normally.
1 Figure 1: Zebrafish brain at 24hpf. Dorsal view, anterior to the left. Forebrain: red, Midbrain: green, Hindbrain: blue, Eyes: yellow. White arrow marks the MHB. Scale bar: 200 microns. Image taken by Dr. Holly Gibbs.
The midbrain-hindbrain boundary (MHB) is demarcated by a physical constriction which separates the mesencephalon from the cerebellum; we will refer to this entire region as the mes-r1 (Fig. 1). Patterning defects in the cerebellum have been correlated with several neurological disorders, including schizophrenia and autism [3, 4, 5, 6, 7]. Changes in the size and shape of the cerebellum are correlated with inverse changes in the posterior midbrain, suggesting that the patterning of these regions is intrinsically linked [8]. While there is a need to identify the cause of these neurological disorders, how mesencephalon-rhombomere 1 (mes-r1), and more broadly the entire CNS, is patterned during embryogenesis is still not well understood.
2 1.2 Neural Induction and Patterning
Figure 2: The activation/transformation model of neural induction. A) The Activation/Transformation model of neural induction and patterning. B) Sketch of zebrafish embryo at shield, dorsal view animal pole up. Left embryo shows cross section of the activation gradient of Bmp along the dorsal ventral (DV) axis and the transformation gradient of Wnt8a along the AP axis. forebrain (fb), midbrain (mb), hindbrain (hb), spinal cord (sc), shield (sh). Figure adapted from [9].
The development of the neural ectoderm has been described via the ”activation/transformation” model (Fig. 2A). In this model, the neural ectoderm is induced and simultaneously defined as a forebrain state in an event called ”activation” [10, 11]. A later ”transformation” signal then posteriorizes the neural plate, converting regions of the neural ectoderm into midbrain, hindbrain, and spinal cord [10, Fig. 2B]. Studies in several species have shown that the absence of Bmp signaling, which inhibits neuralization, serves as the 3 activating signal [12, 13, Fig. 2B]. The Bmp gradient is shaped by Bmp inhibitors, including chordin, and noggin, secreted from the Spemann/Mangold organizer on the dorsal side of the embryo [14, 15]. The activation phase of this model has been recently challenged by several reports. The division between presumptive spinal cord and presumptive brain is initiated before neural induction by changes in chromatin availability in these tissues [16, 17, Fig. 3] However, additional posteriorizing signals would still be required to establish the AP axis within the presumptive brain.
Figure 3: The modified activation/transformation model of neural induc- tion. Schematic representation of Nieuwkoops Activation/Transformation model modified to fit recent findings of pre-neural induction patterning of the spinal cord.
1.3 Mechanisms of Wnt Signaling
Wnts are associated with a wide range of roles in disease and development in animals [18]. First discovered in Drosophila melanogaster, wg is involved in several developmental systems including the patterning of the wing imaginal disc; mutants of wg fail to develop wings[19, 20]. The first vertebrate homolog of wg, initially called int-1 (integration site-1), was identified as an oncogenic integration of the mouse mammary tumor virus (MMTV) into the mouse ortholog of wg [21]. Wnt (wingless integration) is a portmanteau of the two names [22]. Wnts role in patterning the embryonic axis, is highly conserved in all
4 animals, including the basal clade Porifera [23]. To pattern the embryonic axis Wnt ligands must transduce their signal to the receiving cells through conserved signaling pathways.
Wnt is post-transcriptionally modified by porcupine [24, 25]. In vertebrates, Wnts are post-transcriptionally lipidated at a conserved serine residue, making them hydrophobic [26]. This modification in important for proper interaction between the Wnt ligand and its receptors in some instances, though it is not always necessary [27, 28]. The Wnt ligand transduces its signal through two distinct pathways which are both context and Wnt ligand specific. In the canonical pathway, Wnt binds to a frizzled (Frzd) and low-density lipoprotein receptor-related protein 5/6 (Lrp5/6) co-receptor complex [29, 30, Fig. 4]. In the absence of Wnt, β-catenin is ubiquitously expressed and then targeted for ubiquination and degradation by the adenomatous polyposis coli (APC) destruction complex [31, 32, Fig. 4]. When Wnt binds to its receptors, a chain of phosphorylation events leads to the sequestration of glycogen synthase kinase
3-β(GSK3-β) in multivesicular bodies [33]. This destabilizes the APC destruction complex, allowing levels of β-catenin to increase in the cytoplasm [33, Fig. 4]. As levels of β-catenin increase, it enters the nucleus [34, Fig. 3] . In the nucleus, β-catenin competes with Groucho for binding to Tcf/Lef DNA binding proteins, leading to derepression of transcription at these loci [35, Fig. 3]. One of the mechanisms that regulates Wnt signaling is the secretion of a broad family of proteins that act as Wnt inhibitors by the binding of Wnt to its receptors [36].
In contrast to the canonical β-catenin pathway, transcriptional regulation is not the primary focus of the non-canonical Wnt signaling pathway. Instead, the non-canonical pathway regulates a wide array of cellular functions including calcium levels and the planar cell polarity (PCP) pathway [37]. It is through a combination of both these pathways that Wnt signaling shapes the embryonic axes.
5 Figure 4: The canonical Wnt signaling pathway. Adapted from [18].
1.4 Role of Morphogens in Patterning in the
Neural Plate
The Wnt signaling gradient is established through an interaction between the posteriorizing Wnt ligand and Wnt inhibitors secreted from the anterior neural plate [38]. Wnt acts as a major transformative signal with the ability to posteriorize the neural plate in a dose-dependent manner [39, 40]. In zebrafish, wnt8a is the primary neural transformative signal [41]. wnt8a is expressed in the margin, a region of cells at the posterior edge of the epiboly stage embryo [41, 42]. Regulation of Wnt8a transcription is split into two phases, an early phase where Nodal regulates Wnt8a expression, and a later phase where regulation is shifted to tbxta/tbxtb [43]. While Wnts serve an important function in posteriorizing the neural plate, it is not the only posteriorizing factor in the neural plate.
Fibroblast growth factor (Fgf) and retinoic acid (RA) signaling pathways also
6 govern the development of the AP axis of the neural plate, but experimental results suggest they do not act as the primary posteriorizing signal [44, 45]. Fgf mutants do not show as severe of a phenotype as loss of wnt8a and RA patterning defects are isolated to the subdivisions within the hindbrain [46, 47]. While Fgf and RA may serve to further refine the AP axis of the neural plate, wnt8a is the dominant posteriorizing agent. Fgf and RA are responsive to Wnt signaling and may be partially patterned by Wnt signaling [48]. While the role of Wnt8a as a transformative factor is clear, the mechanisms through which Wnt8a mediates posteriorization of the neural plate is still poorly understood.
1.5 Summary of Zebrafish Development and
Formation of the Nervous System
To understand how Wnt signaling is transduced to pattern, the AP axis of the neural plate, we must first discuss the morphological changes occurring to the embryo at this time. Zebrafish embryos undergo a series of synchronous, followed by asynchronous, cellular divisions to form a large mass of cells called the blastoderm [49]. The leading edge of the blastoderm spreads over the surface of the yolk cells, an event called epiboly [49]. Shortly after 50% epiboly, gastrulation begins with mesoendodermal cells involuting and migrating toward the animal pole, inducing a thickening on the dorsal side of the embryo known as the shield [49]. After epiboly, the cells of the blastoderm have completely encompassed the yolk, and this stage is marked by enlargement at the posterior end of the embryo, known as the tail bud [49]. Later developmental stages involve the extension of the tail bud and formation of the somites, as well as further development of the CNS [49]. By 24 h post fertilization (hpf), the embryo has fully established its body plan and is morphologicaly identifiable as a fish.
7 The nervous system is first established during epiboly where it is induced on the dorsal side of the embryo at shield stage. The induced nervous system forms an epithelium called the neural plate [49]. After epiboly, the yolk is fully covered by the embryo. The neural plate begins to fold into itself first establishing the neural keel, followed by the formation of the neural tube [49]. The development of the zebrafish embryo highlights the transition from a morphologically simple tissue, the neural plate, to a morphologically complex one, the mature brain. However, even in the neural plate, the AP axis that will ultimately define the morphology of the brain is already being positioned.
1.6 Establishment and Early Patterning of the
Midbrain Hindbrain Boundary
The mes-r1 is divided by a physical constriction within MHB. We define the MHB as the region of cells at the interface between anterior and posterior neural fate that express distinct neural markers such as hairy-related 5 (her5, paired box protein 2a (pax2a), and wnt1 [50]. While the constriction does not form until 20 hpf, the position of the MHB along the AP axis occurs much earlier in development. The MHB is induced at the expression interface of mutually inhibitory transcription factors orthodenticle homeobox 2 (otx2b) and gastrulation brain homeobox (gbx) which define the anterior and posterior sides of the presumptive mes-r1, respectively [51]. In mice, Gbx2 is the primary posterior marker, while in zebrafish it is gbx1 [52, 51]. In zebrafish, gbx2 is expressed more posteriorly than gbx1 during the initial positioning of the MHB, replacing its expression in the presumptive cerebellum at later stages [53]. otx2b is one of three homologs which are expressed throughout the developing neural ectoderm [54]. Loss of function of otx2b leads to a reduction in size of anterior
8 neural plate [55, 56, 57]. In addition to marking the anterior neural plate, otx2b is critical for the proper patterning of the presumptive midbrain through regulation of a range of downstream morphogens including wnt1 and cell adhesion molecules such as R-cadherin [58]. Initially, otx2b and gbx1 expression is partially overlapping but is resolved over time to form a sharp boundary between the two transcription factors marking the presumptive isthmic organizer [51]. The MHB acts as a secondary organizer in the neural plate, patterning mes-r1. At the interface of otx2b and gbx, several transcription factors and morphogens including engrailed 2a (en2a) and fibroblast growth factor 8 (fgf8 ) are expressed [59]. The organizing activity of the MHB is essential to govern the proper patterning of the mes-r1 [60, 61]. Loss of function of either fgf8 or pax2 leads to a failure to maintain the MHB and subsequent patterning defects in the mes-r1 [62]. Because of its role as a secondary organizer, it is critical that the MHB is properly positioned along the AP axis. Wnt8a positions the MHB along the AP axis through induction of gbx1 and suppression of otx2b [63]. This interaction shifts the position of the otx2b/gbx interface to the proper position along the AP axis of the neural plate. How the overlapping region is then refined into a sharp interface is not known.
1.7 Establishing the Wnt Signaling Gradient
To subdivide the neural plate along the AP axis, Wnt must establish a signaling gradient along the neural plate. The signaling gradient is created by secretion of diffusible morphogens through the extracellular environment, creating a concentration gradient through thermodynamics [64]. Evidence for this model in the context of Wnt-mediated neural posteriorization has been lacking [9]. The patterning of the wing disc in Drosophila is a classic example of a morphogen gradient established through diffusion. The ability of wg to form a concentration 9 gradient has been directly observed [65]. This has led to the prediction that those vertebrate homologs likely function in a similar way, though it should be noted that WG lacks the hydrophobic fatty acid that is functionally required in several vertebrate Wnt’s [66]. Due to this hydrophobic post-translational modification, Wnts are generally observed associated with membranes rather than in the extracellular matrix [67, 68] While WG does form a diffusion gradient, when endogenous wg is replaced by a membrane-tethered fusion the wing disc is still properly patterned [69]. Several possible alternative mechanisms for transport had been identified for wg including transportation by cytonemes, exosomes, or the ability for WG to bind to FRZD receptors on nearby cells securely enough to utilize these cells for transportation [65, 70, 71]. It is clear that the formation of a signaling gradient by WG is more complex than a simple diffusion gradient.
Similar evidence for a diverse array of morphogen transport mechanisms has arisen in vertebrate models. In chick-limb buds cellular projections, termed filopodia, were observed transporting shh [72]. These filopodia are required to transport shh [72]. In the zebrafish margin, filopodia have been observed loaded with Wnt8a [35, 73]. Inhibition of cdc42, which is required for filopodia to form, causes a loss of posterior neural fate in the embryo [73]. This evidence suggests that long-range diffusion of Wnt8a is unlikely, and instead, filopodia are important for the transportation of Wnt8a into the neural plate.
1.8 Defining the Temporal Elements of
Wnt-Mediated Neural Posteriorization
Previous research on the function of Wnt in neural AP patterning has largely focused on perturbations to Wnt signaling before or shortly after neural induction. Additionally, the effect of these perturbations on the pattern is not 10 Figure 5: Filopodial Wnt gradient model. The signaling range of Wnt ligand assuming transportation of ligand via filopodia. Schematic of zebrafish embryo during epiboly, lateral view, animal pole up. Dotted line delineates the developing neural plate. Red region shows predicted signaling range of Wnt ligand as epiboly progresses. observed until much later in development. There are many contradictions to the Wnt signaling gradient model that could be resolved through a better understanding of how timing affects Wnt-mediated neural patterning. Recent evidence supporting filopodial transportation of Wnt8a provides a new model to describe how the Wnt signaling gradient is achieved. However, the filopodial model introduces several inconsistencies that must be explained before the model could be accepted. One of the major issues with the filopodial model is that it
11 reduces the range that Wnt ligands can signal from the margin, requiring us to rethink how the Wnt signaling gradient is generated (Fig. 5).
We propose that Wnt achieves the appropriate signaling gradient to pattern the AP axis of the neural plate shortly after neural induction. Earlier in epiboly, it is reasonable to conjecture that Wnt8a would be able to reach the presumptive midbrain and hindbrain even with the limited range of the ligand from the margin (Fig. 5). In addition to positioning Wnt8a in the correct concentration within the neural plate to establish the proper AP axis, how the neural plate responds to Wnt signaling and whether this response is dynamic as epiboly progresses has not been investigated previously. There is also several other Wnts that become active in the neural ectoderm later in development. These Wnt’s likely have distinct functions but, the timing of the specific phases of Wnts role in developing the neural ectoderm is not clear. How timing integrates with Wnt-mediated neural development has been poorly studied but provides potential explanations for many of the contradictions that exist within the current models.
1.9 Project Outline
To define the role of temporality in Wnt-mediated neural patterning and how it may support the filopodial signaling model, we sought to answer two major questions. First, are there distinct windows for different roles of Wnt in neural development and, if so, what are the timings of these windows? Secondly, what are the temporal mechanics of the signaling cascade induced by Wnt that leads to AP patterning changes? To answer these questions, we took an integrated approach: observing patterning, transcriptomics analysis, and live imaging of neural markers in embryos with Wnt signaling manipulated at distinct time
12 points. Through the use of heat shock inducible transgenic lines, we define three major phases of Wnt-mediated neural development: primary AP patterning, secondary AP patterning and MHB maintenance, and MHB morphogenesis. At the transition from primary to secondary AP patterning phases, we observe that otx2b becomes refractory to Wnt-mediated suppression. These findings support our model of Wnt AP patterning occurs shortly after neural induction. Utilizing both patterning and transcriptomic techniques we expanded on the known signaling cascade of the neural plate in response to Wnt signaling. We identified that genes in the anterior neural plate are suppressed by Wnt signaling at different rates, some directly regulated by Wnt and others indirectly. It is only when all of the anterior neural markers are cleared that posterior expansion can begin. In an attempt to elucidate how the cells of the neural plate move during epiboly, we generated several transgenic reporter lines. While these lines did not recapitulate endogenous gene expression, we have created a wide array of tools that could be used to further study embryonic brain patterning. In conclusion, our findings have defined several temporal elements that are essential to understand the mechanisms behind how Wnt signaling patterns the CNS.
13 Chapter 2
DISTINCT PHASES OF WNT REPSONSE IN THE NEURAL PLATE DURING EPIBOLY
Dr. Amy Whitener contributed with data collection for Fig. 6 A-J, Fig. 7, and Fig. 8.
2.1 Introduction
The vertebrate central nervous system is partitioned along the anteroposterior (AP) axis into four gross divisions forebrain, midbrain, hindbrain, and spinal cord in a progressive process that initiates concurrently with, or immediately after, neural induction in the early gastrula [9]. The mechanism by which the neural plate is patterned along the AP axis has been of interest for over 50 years, with the prevailing model being the activation-transformation model proposed by Nieuwkoop [10]. This hypothesis states that neural induction specifies neural
14 ectoderm with anterior character (i.e. forebrain) that is subsequently posteriorized (i.e. induction of midbrain, hindbrain, and spinal cord) by signals emanating from paraxial mesoderm at the posterior aspect of the neural plate that influence cell fate in a graded fashion. While evidence has amassed that is consistent with this hypothesis, recent findings have challenged the view of a simple anterior to posterior signaling gradient with stronger signaling inputs inducing posterior CNS territories [39, 40]. For example, recent evidence has suggested that cells may be biased towards specific fates along the AP axis before neural induction [16] and that spinal cord fate is induced via a distinct signaling mechanism from other CNS territories [17].
Despite challenges to the activation-transformation model, considerable evidence implicates Wnt, Fgf, and retinoic acid (RA) signaling in the mechanism of neural plate AP patterning [48]. Of these, Wnt-signaling levels are capable of inducing neural AP fates according to concentration [39, 40]. However, exactly when these signals are interpreted by the neural plate to establish the AP axis is less clear. For example, Wnt ligands expressed in paraxial mesoderm progenitors impart polarity on the newly induced neural ectoderm by specifying posterior identity, a process termed neural posteriorization [9]. In zebrafish, this function is attributed to wnt8a [41, 42, 63]. wnt8a expression is initiated in the embryonic margin prior to neural induction and remains present throughout epiboly [41]. While wnt8a expression is maintained in the margin during epiboly, it is unclear if it serves a functional role in neural posteriorization throughout epiboly or only during a discrete portion of epiboly. Further confusing the issue is several neural AP patterning steps involving Wnt signaling are activated downstream of wnt8a. For instance, expression of wnt8b in the diencephalon, which, together with the Wnt antagonist, tlc, patterns the telencephalon, is altered by changes to wnt8a signaling [74]. In addition to activating downstream effectors, wnt8a also directly patterns the neural plate AP axis by determining the position of the interface
15 between otx2b-expressing mesencephalic progenitors and gbx-expressing hindbrain progenitors [63]. The otx/gbx interface position determines the future site of the midbrain-hindbrain boundary (MHB), a lineage restriction border located within a conserved physical constriction of the neural tube [57, 63, 75]. Wnt signaling is also necessary for specification of mes/r1, the neural domain comprising mesencephalon (mes), and the anterior hindbrain (r1) within which the MHB forms [50]. Subsequently, Wnt signaling is initiated in the MHB and integrated into the MHB gene regulatory network [76]. It is unclear if these different sources of Wnt signaling pattern the neural plate in distinct temporal phases or if they signal at the same time but with different outputs, such as through the activation of different downstream receptors [77].
How Wnt-mediated posteriorization is mechanistically linked to the specification of cell fates in the neural plate is also not well understood. While there is significant evidence that Wnt signaling can suppress anterior neural markers and induce posterior markers, many of these experiments have been performed in explants, which may not completely recapitulate specific developmental contexts [39, 40]. As recent single-cell RNA-seq methodologies have revealed unexpected transcriptional diversity among cells of a presumed restricted lineage, it is likely that much is unknown about the timeline from Wnt signal reception by neural plate cells to transcriptional changes underlying AP-specific fate [78].
We here present evidence that the response of the neural ectoderm to Wnt signaling can be divided into three distinct phases. First is the primary AP patterning phase, when wnt8a establishes the gross divisions of the presumptive brain and positions the MHB. The signaling events that occur here are interpreted by the neural plate first as transcriptional changes that ultimately lead to patterning shifts in the AP axis which take several hours to unfold. This is followed by the secondary AP patterning along with the MHB maintenance
16 phase. During this phase, Wnt signaling, likely emanating from the MHB, further refines AP patterning and integrates into the MHB gene regulatory network positive feedback loop. Subsequently, Wnt signaling plays a role in the morphogenesis of the constriction at the MHB, but no longer impacts the AP pattern of the brain. These findings provide a temporal framework in which to describe Wnt-mediated neural patterning and show that both ligand availability, as well as competency of different regions of the neural ectoderm, are dynamic and essential for the establishment of the AP axis.
2.2 Materials and Methods
2.2.1 Zebrafish care
Zebrafish were maintained as described [79]. AB, TL, and AB-TL hybrid strains serve as our wild-type stocks. The University of Houston Institutional Animal Care and Use Committee approved vertebrate animal procedures. The Tg(hsp70l:dkk-GFP)w32Tg and Tg(hsp70l:wnt8a-GFP)w34Tg lines was a kind gift from Dr. Randall Moon (University of Washington) [80, 81]. Tg(hsp70l:fgf8a) line was a gift from Dr. Bruce Riley (Texas A&M University) [82].
2.2.2 Heat shocks and in situ hybridizations
Tg(hsp70l:dkk-GFP)w32Tg (hereafter referred to as hs:dkk1GFP/+) were crossed to wild-type fish, and embryos were collected within 15 min of spawning. Heat shocks were performed by placing groups of 10 embryos in standard fish water
(zfin.org) into PCR tubes, incubating at 37 °C for 60 min, then returning embryos to 29 °C for recovery to the designated stages.
17 Tg(hsp70l:wnt8a-GFP)w34Tg (hereafter, hs:wnt8aGFP/+) were collected and
heat shocked in groups of 10 in PCR tubes at 39 °C for 30 min, then returned to 29 °C for recovery to the designated stage. Embryos were fixed in 4% paraformaldehyde overnight at 4 °C. In situ hybridizations were performed a minimum of two times, with at least 25 embryos per sample. Unless otherwise indicated, heat shock transgenic embryos were unambiguously identified after heat shock by morphological criteria and represented 50% of offspring. In situ hybridization were performed as described previously [83]. Embryos were imaged with a Nikon SMZ745T.
2.2.3 Drug treatments
Wild-type embryos were collected within 15 min of spawning. 6-bromoindirubin-3-oxime (BIO) was dissolved in DMSO to make a stock concentration of 10 mM. The BIO stock solution was diluted to 10 µM in fish water for incubation. 15 embryos were placed in each well of a 9 well plate and incubated in 1 ml of 10 µM BIO for 30 min. Embryos were subsequently washed
three times in fish water and grown to the designated stage at 29 °C.
Cycloheximide (CHX) was dissolved in ETOH to a stock concentration of 10 mg/ml. The CHX stock solution was then diluted in fish water to 10 µg/ml for incubation. 15 embryos were placed in each well of a 9 well plate with either 1 ml of 10 µg/ml CHX or 1ml of 10 µg/ml CHX & 10 µM BIO. Controls were incubated in either 0.1% ETOH, 0.1% DMSO or a combination of the two. Embryos were kept in CHX from the designated stage until 10 hpf. Embryos were treated with 10uM BIO for 30 min then washed in 10 g/ml CHX three times and shifted to 10 g/ml CHX solution until 10 hpf.
18 2.2.4 Screening transgenic lines
To screen potential hs:wnt8aGFP and hs:dkk1GFP 3-month old adults were fin-clipped. Genomic DNA was extracted from fin clips following standard extraction protocols [79]. PCR genotyping was performed using EGFP Fwd primer 5’-(ATGGTGAGCAAGGGCGAGGAG)-3’ with MM5GFP Rev primer 5’-(GGACAGGTAAGGTTGTCTGG)-3’ Which produce a 300 bp band in the presence of GFP.
2.3 Results
2.3.1 Temporal dynamics of Wnt regulation by
hs:dkk1GFP and hs:wnt8aGFP
To dissect the effects of stage-associated Wnt signals on neural patterning, we took advantage of zebrafish lines bearing either a heat shock inducible Wnt antagonist hs:dkk1GFP or agonist hs:wnt aGFP transgene. We crossed transgenic adults with wild-type (Wt) adults and heat shocked offspring embryos at specific developmental intervals, with wild-type embryos serving as the control for their transgenic siblings. Because the duration of Wnt antagonism or overexpression after standard heat shock regimens in this line had not been previously well characterized, we assayed the transcript dynamics of dkk1b, wnt8a, and the Wnt response gene, axin2 (Fig. 6).
With hs:dkk1GFP, after a 1 h heat shock (see Materials and Methods), dkk1b transcripts are present at high levels in transgenic embryos, which is easily observable above the low level of endogenous transcripts seen in wild-type sibling embryos (not shown). This high level of expression continues to be observed 2 h
19 after the heat shock is terminated (Fig. 6A-C). dkk1b transcript levels then decline, such that transgenic embryos show slightly elevated expression at 3 h post heat shock, barely detectable elevation at 4 h post heat shock, and by 5 h, wild-type embryos can no longer be distinguished from transgenic siblings (Fig. 6D, F). This pattern of hs:dkk1b activation is correlated with an observed decrease in axin2 levels, a commonly used measure of Wnt β-catenin signaling [84]. At the end of a 1 h heat shock, axin2 levels are strongly reduced in transgenic embryos and this reduction continues at 2 h post heat shock (Fig. 6F, G). By 4 h post heat shock, the expression of axin2 is more difficult to ascertain because of broad expression in the neural plate that may not be directly Wnt regulated (data not shown), but an examination of expression in the tailbud shows slightly reduced staining in transgenic embryos (Fig. 6H, I). By 5 h post heat shock, axin2 staining in the tailbud of transgenic embryos is not visibly different from that of wild-types (Fig. 6J). From these data, we deduce that a 1 h heat shock pulse interferes with Wnt signaling for a duration of at least 4 h after the heat shock, with recovery by 5 h post heat shock (Fig. 6A-J). In a similar analysis of Wnt pathway activation by hs:wnt8aGFP, we found that a 0.5 h heat shock pulse leads to an induction of Wnt response genes by 0.5 h post heat shock, with a return to normal conditions within 1.5 h (Fig. 6K-R).
2.3.2 A heat shock time series defines three distinct
functional periods for Wnt-mediated MHB
patterning.
Hs:dkk1GFP/+ was induced at six time-points during development which produces four distinguishable phenotypic categories that correlate with the time of heat shock (Fig. 7A-G). Wnt antagonism, at 3 hpf produces strongly dorsoanteriorized embryos falling into the C3-C5 dorsalization categories [85, 20 Figure 6: Temporal analysis of Wnt modulation by the hs:dkk1bGFP and hs:wnt8aGFP transgenes In situ hybridizations to dkk1b (A-E) or axin2 (F-J) in hs:dkk1bGFP. Time of fixation after heat shock (hours post heat shock, hph) is indicated in the lower right. The white dashed line separates wild type embryos (left of line) from transgenic embryos (right of line). dkk1b staining is strong up to 2 hph (A-C), declines by 3.5 hph (D), and is similar to wild type by 4 hph (E). axin2 is visibly reduced up to 3.5 hph (F-H), and recovers to normal levels between 4 hph and 5 hph (I,J). Note that the reduced staining in I is due to a reduction in neural plate staining that is a consequence of mispatterning, rather than a direct effect of the hs:dkk1bGFP transgene.In situ hybridization to egfp (K-N) in hs:wnt8aGFP. egfp staining is detectable 0.5 hph and is significantly reduced at 1 hph (K-M). egfp is not detectable by 1.5 hph (N). In situ hybridization of axin2 (O-R) in hs:wnt8aGFP.axin2 staining is strong at 0.5 hph and visibly expanded into the anterior neural plate at 1 hph (O-Q). axin2 levels are no longer noticeably increased by 1.5 hph (R).
Fig. 7B], thus recapitulating the previously described wnt8a loss of function phenotype [41, 86]. Initiating the antagonism at 4.6 hpf results in axis truncation and enlarged eyes reflective of neural anteriorization, but not dorsalization (Fig. 7C). Wnt antagonization at 7 hpf results in the loss of midbrain and MHB with minor body truncation, while antagonization at 14 hpf results in a strong reduction in the MHB constriction, though brain morphology appears otherwise normal (Fig. 7D-F). Wnt antagonism at 11 hpf and 14 hpf led to a loss of the MHB (Fig. 7E, F) Heat shock at 16 hpf produced no visible 21 morphological defects (Fig. 7G).
Figure 7: Timed overexpression of hs:dkk1bGFP reveal distinct windows of Wnt response. Brightfield (A-G), in situ hybridization to eph4a (H-N), fgf8a (O-U), and pax2a (V-B’) in hs:dkk1GFP. 24hpf,Lateral view, dorsal up, anterior left.Live imaging in hs:dkk1bGFP/+, lateral view, anterior left (V-B’). Embryo is truncated at 3 hpf overexpression (C). Strong anteriorization of the neural late and failure to form the MHB constriction at 7 hpf (E).At 14 hpf and 16 hpf embryo is similar to Wt (F,G).The posterior midbrain is reduced less severely than previous time points (H-L). The posterior midbrain is unaffected(M,N).fgf8a expression is absent from the MHB at 7 hpf and 11 hpf and is restricted to a small ventral region but is not affected at other times (O-U) pax2a expression is restricted to a small ventral region at 7 hpf and 8 hpf but is unaffected at all other treatments (V-B’).
2.3.3 Early gastrula Wnt signaling regulates primary
neural plate anteroposterior pattern.
To complement our morphological assessment, we assayed forebrain, midbrain, MHB, and hindbrain cell populations by in situ hybridization in Wnt-antagonized embryos. Only Wnt antagonism at 7 hpf, 11 hpf, and 14 hpf lead to loss of MHB expression of pax2a and fgf8a (Fig. 7O-B’). Initiating Wnt antagonism at 3 hpf and 4.7 hpf resulted in a reduction in the posterior midbrain at 24 hpf (Fig. 7I, J). This reduction is less severe at 7 hpf and 11 hpf and the posterior midbrain is not affected at 14 hpf and 16 hpf (Fig. 7 K-N). To
22 determine whether this observed shift in the AP axis could be observed closer to the time of Wnt antagonism, we performed heat shocks at 4.7 hpf and fixed embryos at 9 hpf and 10 hpf. Wnt antagonism at 3 hpf and 4.7 hpf produce an expansion of otx2b across the neural plate at both of these time points (Fig. 8I-L).
Figure 8: Wnt suppression temporarily disrupts MHB establishment during epiboly In situ hybridization to fgf8a (A-D), pax2a (E-H), and otx2b (I- L).Embryos fixed at 9 hpf (A,B,E,F,I,J) or 10.5hpf (C,D,G,H,K,L). hs:dkk1GFP embryos heat shocked at 4.7hpf. Dorsal view, animal pole up.fgf8a expression in the MHB is suppressed at 9 hpf but returns by 10.5 hpf (A-D). pax2a expression is decreased at 9 hpf but returns to normal by 10.5 hpf (E-H).otx2b expression is expanded posteriorly (I-L)
23 Figure 9: MHB markers require Wnt signaling at different phases of maintenance In situ hybridization to eng2a (A-F), pax2a (G-L), fgf8a (M-R), and wnt1 (S-X). Dorsal view of embryos 10.5hpf (A,B,G,H,M,N,S,T). eng2a ex- pression in the MHB is absent (A,B). fgf8a and pax2a expression is shifted pos- teriorly (G,H,M,N). wnt1 expression is absent (S,T). Lateral view, anterior right (C-F,I-L,O-R,U-X). eng2a expression in the MHB is absent (C-F). pax2a expres- sion in the MHB is absent and optic stalk expression is expanded posteriorly (I-L). fgf8a expression in the MHB is absent (*) while telecephalon expression is expanded posteriorly (*) (O-R). wnt1 expression in the MHB and dorsal midbrain is reduced (U-X).
24 2.3.4 MHB formation is transiently disrupted with
early-stage inhibition of Wnt signaling.
Wnt signaling was antagonized at 7 hpf and embryos and was observed at 10.5 hpf, 14 hpf, and 16.5 hpf (Fig. 9). At all time points eng2a and wnt1 MHB expression is suppressed (Fig. 9A-F; S-X). In contrast, fgf8a and pax2a is expressed in the MHB after Wnt antagonism (Fig. 9G-R). The lack of response in the MHB to suppression of Wnt signaling during epiboly was unexpected as previous work has shown that Wnt plays an important role in the establishment of the MHB [76]. To better observe the temporal dynamics of the MHB in response to the disruption of Wnt signaling, we performed heat shocks at 3 hpf and 4.7 hpf and fixed embryos at 9 hpf and 10 hpf. Heat shock at 4.7 hpf produce embryos with no fgf8a or pax2a expression in the presumptive MHB region at 9 hpf (Fig. 8A, B, E, and F). The expression of both fgf8a and pax2a is recovered in the presumptive MHB by 10.5 hpf (Fig. 8C, D, G, and H). While disruption of Wnt signaling during epiboly does inhibit MHB establishment, the MHB can recover from this perturbation.
2.3.5 A Wnt overexpression assay identifies two windows
of response in the neural plate to Wnt signaling
Having identified three distinct phases of Wnt signaling with hs:dkk1GFP-mediated Wnt inhibition, we next assayed if changes in the response of the neural plate to Wnt-posteriorizing signals may serve to identify additional phases of response. We performed heat shocks on hs:wnt8aGFP/+ embryos at four timepoints during epiboly; 4.6 hpf, 6 hpf, 8 hpf, and 9 hpf (Fig. 10). Overexpression at all time points induced loss of eyes in the embryo, indicative of a loss of forebrain neural fate [87, Fig. 10]. The telencephalic
25 domain of zic1 is absent under Wnt overexpression at all time points (Fig. 10B-F). otx2b is absent when Wnt overexpression is initiated at 4.6 hpf or 6 hpf (Fig. 10B’-D’). Overexpression at 8 hpf shifts the otx2b domain to the anterior margin of the neural tube and expression is expanded ventrally (Fig 10E’). Overexpression at 9 hpf causes otx2b to shift anteriorly and expand ventrally, but a small region of otx2b negative cells is present at the anterior edge of the neural tube (Fig 10F’). egr2b, which marks the 3rd and 5th rhombomeres of the hindbrain, is shifted anteriorly with all overexpression timepoints (Fig 10B”-F”). With the 4.6 hpf treatment, egr2b is shifted the furthest anteriorly, leaving only a small region of the neural tube anterior to r3 (Fig 5C”). Each subsequent overexpression has a progressively weaker anterior shift of egr2b (Fig B”-F”).
2.3.6 otx2b positive cells become refractory to Wnt
signaling by 75% epiboly
We focused on the change in the ability of the midbrain to be suppressed in response to Wnt overexpression at 6 hpf compared to 8 hpf. To determine whether this was indicative of a change in response to Wnt signaling in the neural plate during epiboly or due to downstream effects, we performed heat shocks at the same time points as previously described but fixed embryos at 10 hpf. With overexpression at 4.6 hpf and 6 hpf, otx2b expression is absent from the embryos but is not suppressed with 8 hpf or 9 hpf overexpression (Fig. 11A-H). gbx1 is expanded into the anterior neural plate at 4.6 hpf overexpression but is not expanded at any of the later heat shocks (Fig. 11Q-X). To ask why gbx1 does not expand anteriorly in the absence of otx2b when wnt8a was overexpressed at 6 hpf, we looked at the expression of one of the otx2b homologs, otx1, which is also expressed in the anterior neural plate [54]. At 4.6 hpf overexpression otx1 is suppressed but at 6 hpf, 8 hpf and 9 hpf the otx1 domain is not significantly
26 Figure 10: Timed overexpression of hs:wnt8aGFP reveal two distinct windows of Wnt competency. Timeline of zebrafish gastrulation with major phases of MHB establishment shown (A). In situ hybridization for zic1 (B-F), otx2b (B’-F’), and egr2b (B”-F”). 24hpf, lateral view, dorsal up, anterior left hs:wnt8aGFP embryos (B-F”). Telencephalic domain of zic1 is absent in all over- expression (B-F). Dorsal posterior expression domain is absent from the ante- rior nerual tube (F). otx2b expression is suppressed (C’-D’). otx2b is present but, shifted to the anterior edge of the brain and ventrally expanded (E’). otx2b re- mains ventrally expanded and is not shifted along the AP axis (F’).r3 and r5 are shifted anteriorly in all treatments with the degree of anterior shift decreasing as epiboly progresses (B”-F”). affected (Fig, 11I-P). her5, which is expressed in the presumptive MHB only shows a response following treatment at 4.6 hpf; all other overexpression time points fail to induce a change in her5 expression by 10 hpf (Fig. 11Y-F’).
To determine whether the length of time after heat shock initiation was a factor in the AP pattern of the neural plate we performed a series of Wnt overexpression heat shocks at 6 hpf and 8 hpf and fixed embryos at 12 hpf. We observed that overexpression induced at shield stage was sufficient to suppress otx1 by 12 hpf and gbx1 was expanded into the anterior neural tube (Fig. 12A-C). However, overexpression of wnt8a initiated at 8 hpf was still unable to
27 suppress otx2b expression, even at 12 hpf, though, otx2b is expanded to the anterior margin of the neural tube (Fig. 12E,F).
2.3.7 Determining the mechanism of the otx2b refractory
period
We next attempted to elucidate the mechanism that establishes the otx2b refractory period at 8 hpf. To test if the change in response to Wnt signaling was due to changes in the extracellular environment, such as increasing numbers of Wnt inhibitors or changes to receptor availability, we induced Wnt signaling intracellularly with the small molecule inhibitor of Gsk3-β, BIO. Embryos were treated with 10 µM BIO at designated stages during epiboly for 30 min and raised to 24 hpf. BIO treatment at shield stage suppressed the midbrain marker dmbx1a (Fig. 13A, B). BIO treatment at 8 hpf and 9 hpf shifted dmbx1a anteriorly, phenocopying hs:wnt8aGFP overexpression experiments (Fig. 13C, D). egr2b was also expanded anteriorly in a linear fashion, phenocopying the wnt8a overexpression experiments at those respective times (Fig. 13E-H).
To test if Wnt directly suppressed otx2b at 6 hpf, we treated embryos with BIO in combination with the translation inhibitor CHX. Embryos treated with only CHX at 6 hpf or 8 hpf did not show a change in the expression pattern of either otx2b or gbx1 at 10 hpf (Fig. 13I-K; N-P). Treatment with BIO and CHX at 6 hpf, but not 8 hpf was sufficient to suppress otx2b expression (Fig 13I-M). CHX efficacy was tested prior to experimentation (see Material and Methods). gbx1 expression was not expanded anteriorly with CHX and BIO treatment at either stage (Fig. 13N-R). These findings show that otx2b is directly suppressed by Wnt signaling at 6 hpf and that the refractory period we observe at 8 hpf is not due to intermediary factors under the regulation of Wnt signaling.
28 29
Figure 11: otx2b positive cells become unresponsive to Wnt signaling by 75% epiboly. in situ hybridization of otx2b (A-H), otx1 (I-P), gbx1 (Q-X), and her5 (Y-F’). Bud stage, dorsal view, animal pole up,hs:wnt8aGFP. otx2b is suppressed (A-D). otx2b expression is not affected (E-H). otx1 expression is suppressed (I,J). otx1 expression is unaffected at subsequent heat shocks (K-P). gbx1 is shifted into the anterior neural plate along the dorsal and ventral edges (Q,R). gbx1 is expressed at low levels in the posterior embryo (S,T) gbx1 is not significantly changed (U-X). her5 is dispersed across the presumptive mes-r1 (Y,Z). Levels of her5 are moderately reduced, but position along the AP axis is not affected (A’-F’). Figure 12: gbx1 expansion detectable 4 h post heat shock In situ hy- bridization to gbx1 (A,B), otx1 (C,D), and otx2b (E,F) in hswnt8a/+ embryos.All embryos at 12 hpf, lateral view anterior right. gbx1 is expanded anteriorly and otx1 expression has been suppressed (A-D). otx2b is shifted to the anterior margin of the neural tube (E-F)
2.3.8 Fgf and Wnt signaling synergize to suppress otx2b
To test if other morphogenic signals could synergize with Wnt signaling to suppress otx2b at 8 hpf, we crossed hs:wnt8aGFP transgenic zebrafish to hs:fgf8a. Overexpression of fgf8a did not affect the AP axis of the brain (Fig 14A). When overexpressed together, wnt8a and fgf8a were able to reduce the otx2b expression domain and shift it even more anteriorly than wnt8a alone (B,C).
30 Figure 13: otx2b is directly suppressed by Wnt signaling.in situ hybridiza- tion of dmbx1a (A-D), egr2b (E-H). 24hpf embryos anterior left, dorsal up. Em- bryos treated with 10uM BIO for 30 min. dmbx1a is suppressed at 6 hpf treatment (B). Note how dmbx1a pattern phenocopies otx2b response to hs:wnt8aGFP at 8 hpf and 9 hpf treatment (C,D). egr2b is shifted anteriorly, with a greater shift caused by 6 hpf treatment compared to 8 hpf and 9 hpf (E-H). Embryos treated with either CHX or CHX/BIO (I-R). 10 hpf embryos, dorsal view (I-R). otx2b expression is not affected by CHX treatment (I-K). otx2b expression is suppressed with CHX/BIO treatment at 6 hpf but, not 8 hpf (L,M). gbx1 is not significantly changed with either CHX or CHX/BIO treatment at any of the tested stages (N-R).
31 Figure 14: Wnt and Fgf co-overexpression suppresses midbrain fate.In situ hybridization of otx2b (A-C). 24 hpf, lateral view, anterior right. fgf8a over- expression does not affect AP pattern of 24 hpf brain and wnt8a overexpression causes a shift of the midbrain to the anterior margin of the neural tube (A,B). wnt8a and fgf8a overexpression together synthesize to suppress the midbrain even after 75% epiboly.
2.4 Discussion
2.4.1 Wnt-mediated neural patterning can be divided
into temporally distinct phases.
We have utilized heat shock inducible transgenic lines to temporally dissect the response of the neural plate to Wnt signaling and have identified three distinct phases of Wnt response.The first phase occurs from 4-9 hpf, which we define as the primary AP patterning phase. During this phase Wnt signaling is necessary for the patterning of the AP axis of the presumptive brain (Fig 15). This phase is followed by the mes/R1 phase. During this phase, which occurs from 9.5-12hpf, Wnts in the neural plate begin expression. These neural Wnts including wnt8b and wnt1/wnt10b which are expressed in the MHB [76, 88]. We show that Wnt signaling is essential for the MHB to maintain itself, with loss of several MHB markers occurring with disruption of Wnt signaling at this phase. The MHB serves as a secondary organizer, and loss of MHB maintenance leads 32 to AP patterning defects in the mes-r1 region. The mechanisms of the secondary AP patterning phase are still unclear. Several Wnts, fgf8a, as well as transcription factors such as eng2a are all expressed at the MHB and have been shown to have independent roles in patterning mes-r1 [76, 89, 90]. How these factors interact in a combinatorial fashion to properly pattern the AP axis during this phase requires further investigation.The final phase which occurs at 12-17 hpf which displays Wnts ability to affect brain development through regulation of morphogenesis (Fig 15). Loss of Wnt signaling during the morphogenetic events that lead to the constriction at the MHB cause defects in the constriction’s formation. This suggests that Wnt signaling is important to brain development not only in patterning the AP axis, but also likely serves important functions in establishing the morphology of the brain as it develops.
Figure 15: The Phases of Wnt-mediated neural patterning Numbers rep- resent time of development in hpf.
Recent work in mice has suggested that the elements of the AP axis may be patterned prior to neural induction through differing chromatin availability along the AP axis [16]. Our findings suggest that AP patterning is a dynamic process and changes in the response of neural cells to posteriorizing signals continues as development occurs and that the response to Wnt signaling is temporally dynamic. otx2b is responsive to Wnt-mediated suppression until 8 hpf. Wnt’s ability to suppress otx2b and subsequently shift the AP axis and position of the MHB, occurs between 4.6 hpf and 8 hpf. Therefore, Wnt mediated
33 posteriorization occurs during a relatively narrow window of time early in epiboly. We determined that this change in response is mediated by a direct transcriptional change, though further work must be performed to identify if changes in chromatin availability is the mechanism. These findings support the model that AP patterning of the neural plate is not only mediated by the availability and position of posteriorizing signals, but also in the competency of the cells in the neural plate to interpret those signals.
2.4.2 The dynamics of Wnt signaling response in MHB
positioning
The current model of Wnt-mediated neural patterning proposes that Wnt diffuses to create a concentration gradient that posteriorizes the neural plate in a dose dependent manner. Recent evidence has challenged the diffusion gradient model, instead proposing a filopodial transport model [73]. One of the possible challenges to the filopodial model is its difficulty in describing how Wnt8a-mediated posteriorization could occur during later phases of epiboly. Filopodial transported Wnt8a, would be limited to a relatively narrow range close to the margin due to the limited length of the filopodia observed in the wnt8a positive cells [73]. However, our findings show that Wnt8a mediated neural patterning occurs during a narrow time frame from 5.5 hpf to 7 hpf. During these earlier stages epiboly, the position of the margin compared to the neural plate would still allow the filopodia to transport Wnt8a into the presumptive midbrain. Observed patterning changes that occur later in epiboly are not caused by direct Wnt8a mediated posteriorization, but instead are the delayed response of neural plate cells to Wnt8a signaling combined with Wnt-mediated and Wnt-dependent signaling emanating from the MHB at later stages of epiboly.
34 The MHB is positioned at the interface of otx2b and gbx1 which is regulated by Wnt8a [63]. However, we show here that this model is over simplified. While it is true that Wnt signaling regulates both otx2b and gbx1, suppression of otx2b in the anterior neural plate is not sufficient for expansion of gbx1 anteriorly. Additional anterior neural markers including at least otx1 must also be suppressed. The indirect regulation of otx1 further suggests that Wnt positioning of the MHB requires both direct and indirect regulation of AP patterning genes.
In conclusion, our findings show that the response of the neural plate to Wnt-signaling is highly dynamic during embryonic development. We have identified specific phases for the role of Wnt signaling in positioning the MHB along the AP axis of the embryo. Additionally, our temporal dissection revealed that suppression of anterior neural fate in response to wnt8a overexpression continues after the overexpression pulse has ended. This suggests that the cells of the neural plate may contain a memory of the level of Wnt ligands during earlier phases of epiboly and utilize this information to make cell fate decisions after the Wnt ligand is no longer present. These findings provide important clarification for how Wnt establishes the AP signaling gradient to position the MHB and better explains the model in context of a poorly diffusing ligand. The response of the neural plate to Wnt signaling is also dynamic during epiboly and likely serves an important role in determining how the AP axis is established, though further research to determine the mechanism that drives the change in Wnt response in the anterior neural plate must be performed. The positioning of the MHB defines critical regions of the vertebrate brain. Our findings reveal important details in how timing integrates with concentration of ligands to determine the fate of cells along the AP axis of the neural plate.
35 Chapter 3
TRANSCRIPTIONAL RESPONSE OF THE NEURAL PLATE TO WNT SIGNALING IS TEMPORALLY DYNAMIC
Saurav Mohanty and Dr. Amy Whitener contributed with sample collection for RNA-Seq. Saurav Mohanty contributed data analysis of RNA-Seq results.
3.1 Introduction
Wnt signaling regulates the AP axis through both direct regulation of AP patterning genes, such as otx2b, and gbx1, and through downstream intermediaries, for example the Sp-family genes [63, 80]. The genes that are directly versus indirectly regulated by Wnt signaling is not clear and there is evidence that only a small number of genes are directly regulated by β-Catenin
36 [91].
As we have previously shown, Wnt-mediated posteriorization during epiboly can be divided into two phases, primary AP patterning and secondary AP patterning along with the MHB maintenance. These phases are associated with a loss of competency of otx2b in the anterior neural plate to Wnt-mediated suppression. With this evidence of dynamic changes in the competency of the neural plate to Wnt signaling, we became interested in investigating if these changes could be broadly attributed to a change in transcriptional response to Wnt signaling as epiboly progresses.
To determine whether there is a change in the genes under direct regulation of Wnt signaling during epiboly, we performed a series of manipulations using a Wnt agonist and antagonist. We observed that the response of genes to Wnt modulation is dependent on when during epiboly the perturbation occurs. We identified a collection of signaling pathways and neural patterning genes that respond rapidly to Wnt modulation. These findings suggest that not only is the response of the neural plate to Wnt signaling dynamic but that the genes that are responsive to Wnt signaling respond at different rates. These findings illustrate that the timing, both when Wnt is present as well as the time a gene takes to respond to Wnt signaling, is gene-dependent and may play an important role in how the neural plate interprets posteriorizing signals to establish an appropriate AP axis.
37 3.2 Materials and Methods
3.2.1 RNA-Seq analysis
hsdkk1b/+ or hswnt8a/+ were crossed to Wt siblings and were collected from multiple mating fish pairs, then embryos were homogenized at desired times in Trizol (Sigma). For each sample n=30 embryos, with three biological replicates from mixed parentage. Total RNA was isolated with Direct-zol RNA kits (Zymo). Samples were sent to Texas A&M AgriLife Research Genomics and Bioinformatics Service for library prep and Illumina sequencing. Raw fastq data were processed and analyzed with CLC Genomics Workbench 12 (Quiagen). Illumina sequencing adapters were trimmed, and reads were mapped onto the GRCz11 reference genome. The following parameters were used: mismatch cost 2, insertion cost 3, deletion cost 3, length fraction 0.8, similarity fraction 0.8, max of 10 hits for a read. Integer counts were normalized by Trimmed Means of M-values (TMM). After normalization differential gene expression was determined using EdgeR package [92]. EdgeR utilizes a generalized linear model linked to the negative binomial distribution to identify significance. The significance level of FDR adjusted p-value of 0.05 and a log2 fold change greater than or equal to 2 was used to identify differentially expressed genes.
3.2.2 Cloning and injections
A clone of shisa2b cDNA (U3044DD120-1 pBluescript SK(+)) was ordered through Genscript. The shisa2b cDNA was subcloned into CS2p+ through PCR addition of ApaI and XbaI sites. mRNA was produced using CS2p+shisa2b and the mMessage mMachine Sp6 kit (ThermoFisher Scientific AM1340). For in situ hybridizations, a labelled probe was produced by linearizing CS2p+shisa2b with
38 NotI. Probe synthesis was performed following standard protocol[83]. For overexpression analysis, embryos at 1-cell stage were injected with variable concentrations of shisa2b diluted in DEPC treated water and green food colouring.
Figure 16: Schematic of wnt modulation and RNA-Seq analysis hs:dkk1GFP and hs:wnt8aGFP transgenic embryos were crossed to WT strains. Embryos were collected and heat shocked two time points, 5/5.5 hpf (time 1) or 7/7.5hpf (time 2) for hs:dkk1GFP and hs:wnt8aGFP respectively. Embryos were screened for GFP and homogenized in Trizol at 7 hpf (time1) or 9 hpf (time2).
3.3 Results
3.3.1 Wnt modulation at time 1 and 2 induce a
transcriptionally dynamic response in the embryos
To determine exactly how the transcriptional response of the neural plate changes over time hs:dkk1GFP and hs:wnt8aGFP embryos were heat shocked at 5/5.5 hpf (Time 1) or at 7/7.5 hpf (Time 2) (Fig. 16). The heat shocks were
39 performed for different duration’s because we had determined through previous work in the lab that 37 °C for 60 min were ideal for strong activation of hs:dkk1bGFP and 39 °C for 30 min was ideal for hs:wnt8aGFP (data not shown). Embryos were sampled one hour after the completion of the heat shock to observe only rapid changes in transcription in response to Wnt signal modulations.
After our initial read mapping, we performed a principal component analysis on the data, using RPKM as the input value to determine if any of our biological replicates produced a clear outlier. One of the hswnt8a:GFP biological replicates do not cluster with the other samples (Fig. 17). Additionally, this sample does not have a significant change in expression of wnt8a, which may explain the lack of change in transcription in the sample. This biological replicate was removed from the data set and the data was reanalyzed.
Figure 17: PCA of RNA-Seq Analysis PCA was performed using prcomp function in R. Samples 1-3 refer to WT samples and samples 4-6 correspond to heat shock.
Wnt suppression at time 1 induced significant changes in expression in 18 genes compared to time 2 which affected 81 genes (Fig. 18A,C; Table 1,2). Wnt overexpression at time 1 affected the transcription of 18 genes significantly versus 52 genes at time 2 (Fig. 18B,D, Table 3,4). Only three of the affected transcripts showed an increase in transcription (Fig. 18A, Table 1). To better understand the biological relevance of these changes in transcript levels, we assigned descriptive categories to them based on gene function described in ZFIN [93]. For Wnt suppression time 1, the following categories showed changes in
40 transcription; axis patterning (2/18), mesoderm (1/18), neural development (2/18), no information (NI) (2/18), other dev process (1/18), posterior neural plate (4/18), Wnt inhibitor (2/18), and Wnt pathway (3/18) (Fig 18A, Table 1). The increase in affected genes at time 2 was largely associated with an expansion of the same categories as time 1 with axis patterning (5/80), mesoderm (6/80), neural development (3/80), NI (13/80), other dev process (12/80), posterior neural plate (18/80), Wnt inhibitor (4/80), and Wnt pathway (11/80) (Fig. 18C, Table 2). Several novel categories showed significant changes in transcription levels at time 2: anterior neural plate (2/80), midbrain-hindbrain boundary (2/80), other signaling pathway (4/80) (Fig. 18C, Table 2).
Wnt overexpression at time 1 enriched 7 transcripts and depleted 11 (Fig. 18D, Table 4). These genes were categorized as anterior neural plate (5/18), axis patterning (1/18), NI (6/18), other dev process (3/18), Wnt inhibitor (1/18), and Wnt pathway (1/18) (Fig. 18D, Table 4). Wnt overexpression at time 2 affected similar classes of genes compared to the Wnt suppression with: anterior neural plate (17/50), NI (9/50), other dev process (13/50), Wnt inhibitor (3/50), and Wnt pathway (2/50) (Fig. 18D, Table 4). In addition to these categories: mesoderm (1/50), midbrain-hindbrain boundary (3/50), other signaling pathway (2/50) were also affected (Fig. 18D, Table 4). These findings show that the transcriptional response of the neural plate to Wnt modulation is dependent on the time of modulation during epiboly.
3.3.2 No correlation between changes in expression levels
and pattern in neural AP patterning genes
To validate the RNA-Seq findings and to observe the relationship between changes in transcription and the AP pattern of the neural plate, we performed in situ hybridization against five Wnt pathway and AP marker genes that were 41 Figure 18: Temporally dynamic response of neural plate to Wnt mod- ulation Genes were assigned categories based on gene function listed on ZFIN (A-C). All genes have a FDR corrected pvalue ≤ 0.05. Complete list of genes can be seen in Table 1-4 in the Appendix.
42 affected in at least one of the treatment conditions. Across all treatment groups our in situ hybridization results correlated with our RNA-Seq findings in 19/20 cases. tpbga expression in the margin is reduced in response to Wnt suppression (Fig. 19A,B). This matches the RNA-Seq analysis which showed a 2.1-fold decrease in transcript levels (Table 1). lef1, her5, and otx2b in transgenic embryos were indistinguishable from Wt siblings (Fig. 19C-F). We did not detect a significant difference in gbx1 expression between transgenic and WT siblings, though our RNA-Seq detected a 4-fold change in transcription levels. Wnt suppression at time 2 caused a decrease in expression of tbga and lef1 (Fig 19G-J).In the MHB, her5 is decreased but not shifted in the AP axis (Fig. 19K-L). otx2b and gbx1 were not affected (Fig 19M,N). Wnt overexpression at time 1 caused noticeable patterning changes in lef1 and her5 that appear to be caused by developmental delay in transgenic embryos instead of actual patterning defects (Fig. 20B-E). Neither tpbga or gbx1 showed a change in expression in response to Wnt overexpression at time 1 (Fig. 20A, F). otx2b is mildly downregulated in response to Wnt overexpression (Fig. 20G, H). At time 2 tpbga staining intensity is increased (Fig. 20I, J). lef1, gbx1, and otx2b expression was not detectably changed (Fig. 20K, N, and O). her5 was expanded into the anterior neural plate with Wnt overexpression at time 2 (Fig. 20L, M). While we identify the RNA-Seq fold change for gbx1 could not be validated through in situ, it appears that this is an isolated case. The cause of this difference in response should be further studied.
3.3.3 shisa2b overexpression induces morphogenetic
failures in the neural tube
We initially mapped our RNA-Seq results to the Zv9/danRer7 version of the zebrafish genome. This analysis had mapped several significant changes in
43 Figure 19: Validation of hs:dkk1GFP RNA-Seq analysis hs:dkk1GFP heat shocked at 5 hpf and fixed at 7 hpf (time 1) (A-F) or heat shocked at 7 hpf and fixed at 9 hpf (time 2) (G-N). In situ hybridization to tpbga (A,B,G,H), lef1 (C,I,J), her5 (D,K,L), gbx1 (E,M) and otx2b (F,N). Embryos were phenotypically sorted into Wt and transgenic categories, if there was no detectable difference between transgenic and WT siblings one panel is shown. Dorsal view, animal pole up. Fold change determined through RNA-Seq analysis (See Table 1-4). tbpga expression is decreased in the margin with time 1 suppression (A-B). lef1, her5, gbx1, and otx2b did not show detectable patterning change at time 1 suppression (C-F). tbpga is decreased across its expression domain at time 2 suppression (G,H). lef1 is decreased in the margin (I,J). her5 expression is decreased, but its position along the AP axis is not changed (K,L). Neither gbx1 or otx2b show a change in patterning at time 2 suppression (M,N). A minimum of 30 embryos were assayed for each experiment and all experiments replicated at least two times. transcription to shisa2, which was mapped to Chr24. Recently, we remapped our experiment to the latest version of the zebrafish genome GRCz11. In addition to identifying several previously unknown genes fom our RNA-seq list of differentially expressed genes, shisa2 is now identified as being a duplicate pair, shisa2a and shisa2b. Strangely, while our approach initially identified shisa2b as being upregulated in response to Wnt overexpression, the mapping to the newest 44 Figure 20: Validation of hs:wnt8aGFP RNA-Seq analysis hs:wnt8aGFP heat shocked at 5.5 hpf and fixed at 7 hpf (time 1) (A-H) or heat shocked at 7.5 hpf and fixed at 9 hpf (time 2) (I-O). in situ hybridization of tpbga (A,I,J), lef1 (B,C,K), her5 (D,E,L,M), gbx1 (F,N), and otx2b (G,H,O). Embryos were phenotypically sorted into WT and transgenic categories, if there was no detectable difference between transgenic and WT siblings one panel is shown. Dorsal view, animal pole up. Fold change determined through RNA-Seq analysis (See Table 1-3). tbpga expression was not affected by time 1 activation (A). We observe minor developmental delay in all transgenic embryos at time 1 treatment which we believe may be the cause of patterning changes in her5 in situs (D,E). gbx1 is not affected by time 1 activation (F). tpbga, lef1, gbx1 and otx2b are not affected by time 2 Wnt activation (K,N,O). her5 is expanded into the anterior neural plate at time 2 activation (L,M). A minimum of thirty embryos were assayed for each experiment and all experiments were replicated at least two times. version of the genome instead identifies an increase of transcription with shisa2a. However, the function of shisa2b still may be relevant to the patterning of the neural plate, and so we leave our results regarding the cloning of this gene for
45 posterity. shisa2b is a novel potential Wnt inhibitor that is downregulated at time 2 in response to Wnt overexpression (Table 3). shisa2b expression is first detected by in situ hybridization at 90% epiboly in the margin (Fig. 21A,B). shisa2b is not expressed at bud stage (Fig. 21C). At the 14-somite stage shisa2b is expressed strongly in the tail bud and posterior somites (Fig. 21D). By 24hpf the expression of shisa2b is at low levels throughout the organism (Fig. 21E).
To test whether shisa2b might function as a Wnt inhibitor, we injected shisa2b mRNA into 1-cell stage embryos and examined the effects by morphology and in situ hybridization. Doses of shisa2b mRNA that induced phenotypic effects were lethal by mid somitogenesis (data not shown). At 1-3s, 100 pg injections of shisa2b induced minor morphological defects, particularly in the anterior margin of the neural tube, which is malformed (Fig 21F,G;K-M). Embryos injected with 200 pg shisa2b showed morphological defects in the neural tube, and examination of egr2b shows disorganization on either side of the hindbrain ventricle (Fig. 21H-J). 200 pg injection of shisa2b mRNA induces a complete bifurcation of the neural tube in 3/15 embryos (Fig. 21H). Both 100 pg and 200 pg injections of shisa2b induced a decrease in the zic1 expression domain in some embryos but not an anterior expansion of hoxb1b (Fig. 21K-P). In addition to suppressing forebrain neural fate, the neural tube is also disorganized and does not close properly (Fig. 21N-P). hoxb1b expression is expanded along the lateral axis, suggesting an expansion of the segmental plate mesoderm (Fig. 21N).
46 Figure 21: shisa2b overexpression induces convergent extension defects in situ hybridization to shisa2b (A-E). Dorsal view, animal pole up (A-C). Lateral view, anterior left, dorsal up (D,E). shisa2b is expressed in at low levels in the head at 24 hpf (A). At 14ss shisa2b expression is restricted to the tail bud and the posterior somites (B). Expression of shisa2b is not detected at bud or shield stage but, is expressed in the margin transiently at 90% epiboly (C-E). Overexpression assay of shisa2b mRNA (F-P). Embryos injected with either 100pg (G,L,M) or 200pg (H-J;N-P) of shisa2b mRNA and raised to 1-3ss. In situ hybridization to egr2b (F-J) and zic/hoxb1b (K-P).
3.4 Discussion
3.4.1 Response of the neural Plate to Wnt signaling can
be divided into three temporal classifications
Previous work has illustrated the ability of Wnt to posteriorize the neural plate by manipulating Wnt-signaling levels and observing the embryos at a single time point [39, 48]. This method of testing the role of Wnt in neural patterning lacks the ability to determine the temporal dynamics that may underlie Wnt-mediated posteriorization. We categorized Wnt response genes into three groups depending on the speed and perdurance of their response to Wnt signaling.
47 Rapid response/short duration genes such as axin2, responds rapidly to changes in Wnt signaling but return to baseline levels quickly. These genes are induced immediately upon Wnt overexpression but begin returning to decreasing back to baseline levels by 2 h, shortly after ectopic wnt8a mRNA is no longer detected. Rapid response/long duration genes show changes in transcription within 2 h post-treatment. This category includes the genes detected in our RNA-Seq analysis and includes both AP patterning genes as well as Wnt intermediaries. Slow response genes take several hours to show a transcriptional change and include pattering genes such as otx2b, which show transcriptional changes in response to Wnt signaling later in development but were not detected by our Wnt manipulations. These findings show that the response of the neural plate to Wnt is more complex than direct versus indirect regulation. We propose that genes that are directly regulated by Wnt signaling still show a diverse range of response speed, with some genes responding much faster than others. Additionally, rapid response to Wnt signaling appears to show the downregulation of target genes, suggesting a previously unreported inhibitory role for Wnt. Further work should be performed to more finely temporally dissect epiboly to generate a complete categorization of Wnt response genes.
The pattern of the AP axis does not immediately shift in response to transcriptional changes of AP patterning genes. 2 h post-treatment, suppression of AP patterning genes is detectable, but with no subsequent shift in the pattern of the neural plate. This allows us to construct a temporal map of the neural plates response to Wnt signaling. First, Wnt signaling suppresses the transcription of anterior neural markers, then induces posterior neural markers, and ultimately leads to a shift in the pattern of the expression domains of anterior and posterior neural markers. The exact timing of these phases of response is still unknown and a more refined temporal screen will need to be performed to determine this.
48 3.4.2 Response of the neural plate to Wnt modulation is
temporally dynamic
The accessibility of enhancers to transcription factors plays an important role in priming regions of the embryo to take on specific neural fates [16]. To determine if the neural plate responds to Wnt signaling in the same way as epiboly progresses, we performed Wnt manipulation at two timepoints during epiboly. Wnt suppression affected a larger number of genes at time 2 than at time 1. We hypothesize that this is caused by two factors. First, at time 2, additional Wnt’s in the neural plate such as wnt8b are expressed in the neural plate itself [88]. At time 2, dkk1-mediated Wnt suppression is not only inhibiting the ability for Wnt8a to transduce its posteriorizing signal but is also disrupting other neural expressed Wnt’s. Wnt signaling from the MHB is essential for the maintenance of the secondary organizer at this site [94]. Secondly, elements of the anterior neural plate, such as otx2b are changing their competency to Wnt at this time, leading to different responses to the loss of Wnt signaling.
Wnt overexpression also induced a stronger response at time 2 than time 1. While Wnt overexpression at 5.5 hpf only affected a small number of genes by 7 hpf, we have shown that this treatment significantly posteriorized the neural plate at 10 hpf. This suggests that the transcriptional changes in response to Wnt signaling occur faster during later epiboly.
3.4.3 The role of shisa2b in patterning of the brain
shisa2b is a predicted variant of shisa2a that has not been previously described (Genebank Accession # CT707770). shisa2a is a Wnt/Fgf inhibitor and is important for patterning of the somites [95, 96]. The expression pattern of shisa2b diverges from shisa2a during epiboly, with expression of shisa2b limited 49 to the margin during a short period of time around 90% epiboly. Comparatively, shisa2a is expressed across the neural plate [97]. Overexpression of shisa2b induces brain morphology defects in the embryos leading to disorganization of the neural tube. shisa2b may serve a role in the morphogenesis of the neural tube, but due to its expression late in epiboly is not a likely inhibitor of canonical signaling of endogenous wnt8a. Wnts that signal non-canonically such as Wnt11 and Wnt5 serve an important role in regulating convergent extension during epiboly [98, 99]. We hypothesize that shisa2b may serve a function in regulating late stages of convergent extension. The expression pattern of shisa2b in the posterior somites support its function at later stages like those of Xenopus shisa2 in regulating somitogensis as a Wnt/Fgf inhibitor.
3.4.4 Conclusion
In conclusion, we have shown that the neural plate displays a high amount of dynamism in its temporal response to Wnt signaling. Anterior and posterior neural regions respond to changes in Wnt signaling at different speeds. This may be due to different chromatin availability at Wnt-responsive enhancers. Even within a region of the neural plate, not all genes that define anterior versus posterior are affected at the same rate. The rate at which these AP patterning genes that are directly regulated by Wnt signaling respond is also dynamic. These findings reveal that how the neural plate interprets Wnt signaling to establish the AP axis of the embryo is a poorly understood but critical element in Wnt-mediated neural posteriorization.
50 Chapter 4
GENERATING A GBX1 FLUORESCENT REPORTER LINE
Dr. Jo-Ann Fleming contributed recombination cloning to generate TgBAC(gbx1:H2b-egfp).
4.1 Introduction
Our investigation so far has largely focused on the ability of morphogens to pattern the neural plate AP axis. As we have previously shown, the positioning of the MHB is essential for the proper patterning of the neural plate due to its role as a secondary organizer [50]. However, to understand the positioning of the MHB in the AP axis, we must not only be able to describe how it responds to extrinsic effects but also how the MHB is intrinsically organized. The MHB is positioned at the interface of two mutually inhibitive transcription factors,
51 otx2bb on the anterior side and gbx1 on the posterior [63]. otx2b and gbx1 initially form an overlapping region of expression, which refines over time to a sharp interface [50]. The resolution of this interface acts as an intrinsic mechanism through which the MHB refines its position along the AP axis. The interface has been proposed to resolve in two different fashions. Either the cells in the overlapping region migrate to organize themselves on their ”proper” side of the interface, or cells selectively inhibit expression of the incorrect marker depending on which side of the interface they reside.
To test these hypotheses, we generated a series of transgenic reporter lines for gbx1, otx2b, and eng2a. Neither the otx2b or eng2a reporters were expressed in the neural plate during epiboly and were based on previously reported transgenic lines [100, 101]. Discussion of these transgenic lines can be found in my previously published thesis [102]. A gbx1 fluorescent reporter line has not been previously described. In this chapter, we discuss the creation of a novel gbx1 BAC reporter line and our validation of the line as a potentially useful tool in understanding the fate of gbx1 positive cells.
4.2 Materials and Methods
4.2.1 Modification of (CH211-89L23) to Create
TgBAC(gbx1:H2b-egfp)
CH211-89L23 BAC was modified following an adaptation of Suster, et al., 2009 methods [103] Tol2 sites were cloned following the protocol and primers included in Suster, et al, 2009 [103]. gbx1 exon1 was targeted for recombination with galk replacement constructs using gbx-galkinsert-F 5’- (AAGGCCAGTACAGCACGGGATTTATACGACCAGACCGCGCTCAGTTCACC
52 CCTGTTGACAATTAATCATCGGCA) And gbx-galkinsert-R (GCTCCTAATTAAACCACCTGTCAGCGAGAGAGTTGGTCTCCGGTGCTCACTCAGCACTGTCCTGCTCCTT)- 3’ [103]. Galk was replaced with H2B-EGFP-frt-kanR-FRT cassette using the following primers; gbx-rec-h2b-fwd 5’- (AAGGCCAGTACAGCACGGGATTTATACGACCAGACCGCGCTCAGTTCACC ATGCCAGAGCCAGCGAAGTC)-3’ and gbx-rec-FP-rev 5’- (GCGCTCCTAATTAAACCACCTGTCAGCGAGAGAGTTGGTCTCCGGTGCTC CGTGTAGGCTGGAGCTGCTTCG)-3’. After selection the kanR cassette was removed through FRT mediated deletion. Construct validity was confirmed through a number of sequencing reactions around recombination sites.
4.2.2 Generating Tg(TgBAC(gbx1:H2b-egfp) Transgenic
Zebrafish
AB/TL zebrafish embryos were injected at the 1-cell stage with 5 ng of TgBAC(gbx1:H2b-egfp) and screened for fluorescence at 24 hpf. GFP+ embryos were raised to sexual maturity and outcrossed to AB/TL strains. A minimum of 400 embryos were screened per cross to determine if the integration of the transgene had occurred. GFP+ embryos from these crosses were raised as stable heterozygotes. Heterozygous individuals were intercrossed to generate stable homozygous stocks.
4.2.3 Antibody Staining
Antibody staining was performed following and adaption of standard zebrafish methods [79]. Embryos were fixed in 4% paraformaldehyde at desired stages. Embryos were then washed in phosphate buffered saline with Triton X-100 (PBT) 15 min 4 times. Embryos were then transferred to PBT+10% goat serum 53 (GS). If embryos were older than 12 hpf, Triton X-100 levels were raised to 0.5% if 24 hpf or older Triton levels were raised to 1%. Incubated for 2 h. Embryos were then transferred to the same solution with 1/1000 dilution of rabbit
α − EGF P (Thermofisher Scientific A11122) overnight at 4 °C. Embryos were then washed in PBT 15 min 4 times. They were then shifted to PBT+10% GS with 1/400 dilution of α − rabbit Alexa Fluor 488 antibody (Thermofisher scientific (A21206)) overnight at 4 °C. Embryos were washed in PBT 15 min 4 times and imaged in PBT.
4.2.4 Fluorescent Imaging
Live embryos were anesthetized with tricaine and mounted in methylcellulose. Imaging was performed on a Nikon SMZ25. For fixed samples, embryos were mounted in either PBT or low melt agarose for imaging.
4.3 Results
4.3.1 In situ hybridization of TgBAC(gbx1:H2b-egfp)
After generating stable homozygous stocks of TgBAC(gbx1:H2b-egfp), we first determined whether the expression pattern of our transgenic reporter matched endogenous gbx1. At 8 hpf egfp is expressed broadly in the margin and mesoendoderm, excluding a large gap at the dorsal midline (Fig. 22A,Fig. 23B). In addition to mesoendodermal expression egfp is also expressed in the ectoderm (Fig 23A). This expression pattern is similar to wnt8a [41]. Endogenous gbx1 is expressed in a chevron pattern in the ectoderm at 8 hpf (Fig. 22F).
After epiboly, expression of the transgenic reporter and endogenous gbx1 is
54 Figure 22: Expression pattern of TgBAC(gbx1:H2b-egfp) reporter In situ hybridization to egfp (A-E;K,L) and gbx1 (F-J;M,N).Dorsal view, anterior up (A- C;F-H) or lateral view, anterior right (C-E;H-N). Scale bar 100 microns.
55 consistent. Both egfp and gbx1 were detected in the presumptive hindbrain at 10 hpf and 12 hpf, with a slight expansion of expression of both transcripts into the spinal cord at 12 hpf (Fig. 22B,G). Staining intensity of egfp in the spinal cord remained high at 19.5 hpf, while endogenous gbx1 showed a significant reduction in expression (Fig. 22D,I). Both genes expressed at high levels in the hindbrain at 19.5 hpf (Fig 22D,I). At 24 hpf, 48 hpf, and 72 hpf, egfp and gbx1 were expressed starting in r3 and progressing posteriorly into the hindbrain and spinal cord, though at higher staining intensity for egfp compared to gbx1.
Figure 23: Additional views of 8 hpf TgBAC(gbx1:H2b-egfp) embryos. In situ hybridization to egfp. Lateral view, dorsal left (A). Animal view, dorsal right. egfp is expressed in both the mesoendoderm and ectoderm on dorsal side of the embryo (A). Expression is excluded in the dorsal midline (B).
4.3.2 TgBAC(gbx1:H2b-egfp) EGFP protein localization
To both confirm our in situ hybridization results as well as determine whether EGFP+ cells migrate away from their original positions as the brain continued to develop we performed a time series of antibody staining against EGFP. At 8 hpf EGFP was detected along the margin and sporadically migrating cells moving towards the animal pole (Fig. 24A). By 10 hpf EGFP was detected in the neural
56 plate in similar expression pattern to both egfp and gbx1 in situs, though the expression domain was much broader along the AP axis (Fig. 23B). From 12 hpf to 72 hpf EGFP expression remains relatively stable, matching in situ hybridization’s with high levels of expression in the posterior hindbrain and along the spinal cord (Fig. 24C-H). At 48 hpf EGFP+ cells were detected along the lateral line, but this expression appears to be transient and was not matched with detectable mRNA expression, leading us to believe that this was an artifact (Fig. 24G.).
Figure 24: EGFP localization in TgBAC(gbx1:H2b-egfp) α−GF P staining with Alex 488 Fluor secondary antibody (A-H). Dorsal view, anterior up (A,B). Lateral view, anterior right (C-H). Scale bar 100 microns.
57 4.3.3 Estimating the turnover of H2B-EGFP
The TgBAC(gbx1:H2b-egfp) reporter was a protein fusion to histone H2B to localize the EGFP into the nucleus and aid in possible future cell tracking experiments. Because histones are rapidly turned over in non-mammalian organisms, we wanted to determine what effect this fusion would have on the perdurance of EGFP in our transgenic line [104]. To test this, we utilized a phenomenon of endogenous gbx1 expression, which was originally expressed in the cerebellum but was downregulated in this region at 5 ss (11.5 hpf) [51]. We performed live fluorescent imaging of TgBAC(gbx1:H2b-egfp) embryos at 24 hpf and 48 hpf (Fig. 25). By 24 hpf there was no detectable fluorescence in the cerebellum, showing that H2B-EGFP was degraded within 13 h, much faster than EGFP would be degraded in the cytoplasm.
Figure 25: gbx1BAC:h2b2gfp expression in cerebellum clears within 13 hours. Live imaging of TgBAC(gbx1:H2b-egfp) embryos (A-F). Dorsal view, an- terior right,Scale bar 100 microns (A-F).Black arrow marks MHB.
58 4.4 Discussion
4.4.1 The perdurance of TgBAC(gbx1:H2b-egfp)) reveals
regulatory mechanisms of gbx1
TgBAC(gbx1:H2b-egfp) egfp mRNA perdures for significantly longer duration than endogenous gbx1. Staining intensity of egfp in the spinal cord increases during somitogenesis, while expression of endogenous gbx1 remains at a stable, low level. We also observe this at 7 hpf, where egfp was detectable within the mesoendoderm. At 6 hpf gbx1 was expressed in the margin but was rapidly turned over and was not detected within the mesoendoderm by 8 hpf [51]. One possible explanation for the longer perdurance of H2b-Egfp compared to endogenous Gbx1 was that gbx1 may be regulated post transcriptionally.
The expression pattern of TgBAC(gbx1:H2b-egfp) was similar to wnt8a mRNA in embryos that had been treated with a target protector morpholino to block the mir-430 seed in the wnt8a 3’ UTR which targets the mRNA for degradation, though with a larger clearing around the dorsal midline [105]. The zebrafish gbx1 3’ UTR 7 conserved miRNA binding sites (Fig. 26). Further studies should be performed to determine if gbx1 was post transcriptionally regulated by miRNA or other regulatory elements.
4.4.2 Assessment of TgBAC(gbx1:H2b-egfp) as a tool to
assess the resolution of the otx2b/gbx1 interface
The initial intention of this project was to design a series of fluorescent neural reporters marking otx2b, eng2a, and gbx1 during epiboly to allow us to trace the resolution of the otx2b/gbx1 interface. Our previous attempts to generate otx2b
59 Figure 26: mir seed sequences identified in gbx1 3’ UTR. gbx1 3’ UTR was analyzed using TargetScanFish. We identify 7 conserved miRNA seeds and 6 poorly conserved miRNA seeds. and eng2a reporters which were based on previously identified enhancers failed to express in the neural plate during epiboly [100, 101, 102]. To attempt to capture as much of the regulatory elements for gbx1 as possible, we generated TgBAC(gbx1:H2b-egfp). Even with this large construct, we were still unable to capture the complete regulatory elements of gbx1 during epiboly making this line unsuitable for resolving the otx2b/gbx1 interface question.
4.4.3 The neural plate regulatory paradox
In this chapter, we have discussed the generation of several different novel reporters in an attempt to generate reporter constructs for key AP neural markers during epiboly. Previous screens of regulatory elements have struggled to identify active neural plate regulatory elements. Though many elements have been identified, such as for otx2b, which has had over 8 identified regulatory 60 elements, none of these accurately recapitulate early embryonic patterning [100]. It remains unclear why it has been so difficult to identify regulatory mechanisms of these genes during epiboly, while identifying a large number of accurate reporters for later stages. Future work should utilize new high throughput enhancer identifying techniques such as ATAC-Seq to attempt to elucidate the location of the epiboly stage enhancer elements in a more targeted manner.
61 Chapter 5
Summary
5.1 Wnt-Mediated Posteriorization is
Established Early in Epiboly and
Interpreted Over an Extended Period of
Time
Wnt ligands are delivered to cells to posteriorize the neural plate from 5 hpf to 7 hpf. This signal is interpreted by the neural plate throughout the rest of epiboly. While some genes, such as axin2 responded rapidly to changes in Wnt signaling, other genes including several AP patterning genes responded much slower. The speed of target genes transcriptional response cannot be simply attributed to whether the locus is directly or indirectly regulated by Wnt. For example, genes such as otx2 which are directly regulated by Wnt signaling require several hours to become enriched/depleted in response to Wnt antagonism/activation, respectively. Wnt signaling may provide the initiation of posteriorization early during epiboly while the presumptive midbrain is still responsive, but the effect
62 Figure 27: Comparison of Wnt diffusion and filopodial transport models Schematic of zebrafish embryos, lateral view, dorsal right. Solid red shows ex- pression range of wnt8a, gradient colouring displays predicted diffusion range of Wnt8a.
63 of these signals is not apparent for several hours. It has been proposed that the AP axis of the neural plate is established before neural induction [16]. Our findings suggest that while the specification of presumptive spinal cord versus brain may occur prior to neural induction, it is unlikely to be true for patterning within the presumptive brain itself. Instead, we propose that the response of the neural plate to posteriorizing signals could be explained by a series of priming steps. Prior to neural induction, regions of the ectoderm are primed to take on brain versus spinal cord neural fates. The regions within the presumptive brain are further posteriorized to take on specific AP fates through Wnt8a-mediated signaling. As the initial Wnt-mediated posteriorizing signals are being interpreted, additional morphogens may further refine the AP axis. We see evidence that Fgf signaling may allow Wnt to posteriorize the neural plate after this refractory period, suggesting that these regions have not fully committed to their fates at this time. In conclusion, the posteriorization of the neural plate is achieved through several waves of regulation that prime and refine the neural plate in temporally distinct periods to achieve the proper size and shape of the CNS.
5.2 Wnt Signaling: Cascades and Patterning
Wnt signaling regulates the transcription of a wide variety of genes that can be separated into distinct categories. Traditionally, these genes have been sorted into functional categories based on their role as Wnt signaling mediators, inhibitors, AP patterning genes, etc. We take a novel approach to not only apply functional but also temporal categorization to these genes. We have shown that there is a diversity in the rate at which Wnt signaling can change the transcription of Wnt responsive genes (Fig. 28). While some of these genes’ response may be explained by requiring several downstream intermediaries, this 64 Figure 28: A temporally dynamic Wnt signaling cascade. 50% epiboly is at 5 hpf and 75% epiboly occurs at 8 hpf. is not always sufficient. For example, otx2, which is critical to define the anterior edge of the MHB, responds very slowly to changes in Wnt concentration, taking between 3 and 4 h to show a reduction in transcription in response to Wnt overexpression (Fig. 27). This finding provides a heretofore unexplored element in how Wnt signaling, is transduced to pattern the AP axis of the neural ectoderm. While our findings support the hypothesis that the genes that pattern the neural plate display a diverse temporal response to Wnt signaling, we have only scratched the surface of this phenomenon. To better understand it, a temporal dissection of the embryo during epiboly utilizing RNA-Seq, ATAC-Seq, and CHIP-Seq should be performed to observe how β-catenin binding, transcription, and chromatin availability change as the embryo responds to Wnt signaling.
65 5.3 The Positioning of the MHB and Disease in
Humans
Defects in the mes-r1 region have become an increasingly apparent category of patterning defect in humans and have been associated with several neuropathologies. The causes of these defects remain unclear, as they often represent subtle shifts in the AP axis of the CNS rather than full-blown loss of posteriorization expected from mutations in the major posteriorizing signaling pathways. Our findings illustrate that timing plays an important role in positioning the MHB along the AP axis of the neural plate. For example, changes in the Wnt-responsive and refractory periods may cause the position of the MHB to shift without mutations in any of the classically understood AP patterning genes. More investigation will need to be performed to first dissect the mechanisms behind these temporal elements. Once a more complete map of the temporal mechanisms has been established, we can begin to observe if human patients with neuropathologies have mutations that may disrupt the temporal patterning mechanisms.
66 Chapter 6
Appendix
Table 1: Wnt suppression time 1
Gene Name Fold Change Functional Category
blf -3.17 Axis Patterning eve1 -2.41 Axis Patterning tbx16l -1.93 Mesoderm msx1b -4.89 Neural Development msx1a -3.37 Neural Development RF00002 4 3.77 NI znf1156 3.82 NI nradd -2.08 Other Dev Process znf703 -4.38 Posterior Neural Plate gbx1 -4.02 Posterior Neural Plate znf503 -2.93 Posterior Neural Plate znfl1h -1.89 Posterior Neural Plate nkd1 -2.79 Wnt Inhibitor tpbga -2.12 Wnt Inhibitor
Continued on next page 67 Table 1 – continued from previous page
Gene Name Fold Change Functional Category dkk1b 98.94 Wnt Inhibitor sp5a -4.65 Wnt Pathway sp8b -3.49 Wnt Pathway axin2 -2.81 Wnt Pathway
68 Table 2: Wnt suppression time 2
Gene Name Fold Change Functional Category sox2 1.58 Anterior Neural Plate fezf2 1.65 Anterior Neural Plate sox21a -12.47 Axis Patterning blf -5.81 Axis Patterning eve1 -2.88 Axis Patterning lnx2b -1.79 Axis Patterning tob1a -1.73 Axis Patterning tbxta -3.09 Mesoderm noto -2.98 Mesoderm tbx16l -2.23 Mesoderm tbx16 -1.72 Mesoderm her7 -1.72 Mesoderm meox1 1.80 Mesoderm en2a -20.01 Midbrain Hindbrain Boundary her5 -2.48 Midbrain Hindbrain Boundary irx1a -3.39 Neural Development msx1a -2.85 Neural Development neurog1 -2.45 Neural Development RF00002 4 -6.29 NI si:dkey-27i16.2 -2.71 NI slc43a3b -2.44 NI gabrp -2.07 NI mid1ip1b -1.98 NI si:dkey-253d23.9 -1.90 NI
Continued on next page
69 Table 2 – continued from previous page
Gene Name Fold Change Functional Category hyal2b -1.76 NI eef2a.2 -1.65 NI sulf1 1.55 NI dbx1a 1.70 NI krt96 2.16 NI znf1156 2.88 NI cntnap2b 3.64 NI prrx1b -15.64 Other Dev Process msx1b -4.41 Other Dev Process mnx2b -3.62 Other Dev Process ism1 -3.01 Other Dev Process gdf3 -2.44 Other Dev Process pax3a -2.21 Other Dev Process meis2b -2.14 Other Dev Process nradd -1.93 Other Dev Process cdkn1cb -1.86 Other Dev Process pim2 -1.62 Other Dev Process gata2a 1.63 Other Dev Process nkx2.7 2.34 Other Dev Process fgf4 -29.04 Other Signaling Pathway crabp2a -3.95 Other Signaling Pathway fgf24 -2.84 Other Signaling Pathway foxh1 1.72 Other Signaling Pathway znf503 -3.04 Posterior Neural Plate gbx1 -2.79 Posterior Neural Plate
Continued on next page
70 Table 2 – continued from previous page
Gene Name Fold Change Functional Category lmo4a -2.77 Posterior Neural Plate foxb1b -2.71 Posterior Neural Plate znf703 -2.71 Posterior Neural Plate msx3 -2.51 Posterior Neural Plate hoxb1b -2.29 Posterior Neural Plate cdx4 -2.13 Posterior Neural Plate znfl1 -2.02 Posterior Neural Plate znfl1b -1.88 Posterior Neural Plate irx7 -1.86 Posterior Neural Plate znfl1k -1.82 Posterior Neural Plate meis3 -1.75 Posterior Neural Plate znfl1c -1.71 Posterior Neural Plate foxb1a -1.70 Posterior Neural Plate znfl1i -1.70 Posterior Neural Plate znfl1g -1.69 Posterior Neural Plate lmo4b -1.64 Posterior Neural Plate notum1b -4.72 Wnt Inhibitor notum1a -3.98 Wnt Inhibitor nkd1 -3.78 Wnt Inhibitor tpbga -3.05 Wnt Inhibitor dkk1b 211.55 Wnt Inhibitor sp5a -7.94 Wnt Pathway wnt8b -7.75 Wnt Pathway axin2 -5.41 Wnt Pathway sp8b -3.74 Wnt Pathway
Continued on next page
71 Table 2 – continued from previous page
Gene Name Fold Change Functional Category lypd6 -3.26 Wnt Pathway fzd10 -2.41 Wnt Pathway lef1 -2.35 Wnt Pathway fzd9b -2.24 Wnt Pathway sp5l -2.09 Wnt Pathway dact1 -1.75 Wnt Pathway wnt11 -1.73 Wnt Pathway
72 Table 3: Wnt overexpression time 1
Gene Name Fold Change Functional Category otx2b -4.54 Anterior Neural Plate otx1 -2.53 Anterior Neural Plate shisa2a -1.93 Anterior Neural Plate lhx5 -1.89 Anterior Neural Plate otx2a -1.70 Anterior Neural Plate her3 -1.94 Axis Patterning odf3l2a -82.45 NI slc6a16a -39.10 NI CR407594.1 -3.20 NI si:dkey-7i4.21 -2.72 NI shroom3 -2.32 NI si:dkey-4p15.3 1.92 NI tent5ba 1.84 Other Dev Process hsp70.1 2.19 Other Dev Process he1.1 67.73 Other Dev Process dkk1b 2.09 Wnt Inhibitor axin2 1.60 Wnt Pathway wnt8a 1 5.37 Wnt Pathway
73 Table 4: Wnt overexpression time 2
Gene Name Fold Change Functional Category lhx2b -146.04 Anterior Neural Plate fezf2 -98.10 Anterior Neural Plate six7 -44.59 Anterior Neural Plate rx3 -26.51 Anterior Neural Plate dmbx1b -17.27 Anterior Neural Plate six3b -12.75 Anterior Neural Plate pax6b -8.14 Anterior Neural Plate arr3b -7.11 Anterior Neural Plate pitx3 -4.95 Anterior Neural Plate six3a -4.21 Anterior Neural Plate nr2f5 -4.02 Anterior Neural Plate zic1 -3.54 Anterior Neural Plate dmbx1a -3.24 Anterior Neural Plate otx1 -2.60 Anterior Neural Plate sox2 -2.59 Anterior Neural Plate hesx1 -2.23 Anterior Neural Plate otx2a -2.14 Anterior Neural Plate shisa2a -1.99 Anterior Neural Plate gsc -3.82 Mesoderm her11 1.87 Midbrain Hindbrain Boundary her5 1.97 Midbrain Hindbrain Boundary en2a 3.81 Midbrain Hindbrain Boundary dbx1a -4.28 NI lhx5 -3.25 NI
Continued on next page
74 Table 4 – continued from previous page
Gene Name Fold Change Functional Category si:dkey-239j18.3 -3.20 NI zgc:77158 -1.88 NI zgc:158463 2.67 NI CT583728.23 2.89 NI AL935186.6 2.91 NI AL935186.9 3.12 NI RF00002 4 4.21 NI nkx2.4b -30.63 Other Dev Process nkx2.7 -8.11 Other Dev Process sox1a -6.93 Other Dev Process he1.1 -6.34 Other Dev Process lingo1b -5.47 Other Dev Process foxi3a -4.47 Other Dev Process olig2 -3.78 Other Dev Process sema3aa -2.17 Other Dev Process six4b -1.99 Other Dev Process her9 -1.89 Other Dev Process pax3a 2.08 Other Dev Process atoh1c 4.97 Other Dev Process prrx1b 5.22 Other Dev Process cyp26c1 -7.75 Other Signaling Pathway hs3st3b1b -2.34 Other Signaling Pathway nkd1 1.73 Wnt Inhibitor tpbga 1.80 Wnt Inhibitor dkk1b 3.39 Wnt Inhibitor
Continued on next page
75 Table 4 – continued from previous page
Gene Name Fold Change Functional Category fzd8a -3.39 Wnt Pathway wnt8b 2.21 Wnt Pathway wnt8a 1 55.79 Wnt Pathway
76 Bibliography
[1] Robert K Naumann, Janie M Ondracek, Samuel Reiter, Mark Shein-Idelson, Maria Antonietta Tosches, Tracy M Yamawaki, and Gilles Laurent. The reptilian brain. Current Biology, 25(8):R317–R321, 2015.
[2] Jonathan B Sylvester, Constance A Rich, Yong-Hwee E Loh, Moira J van Staaden, Gareth J Fraser, and J Todd Streelman. Brain diversity evolves via differences in patterning. Proceedings of the National Academy of Sciences, 107(21):9718–9723, 2010.
[3] S Hossein Fatemi, Kimberly A Aldinger, Paul Ashwood, Margaret L Bauman, Charles D Blaha, Gene J Blatt, Abha Chauhan, Ved Chauhan, Stephen R Dager, Price E Dickson, et al. Consensus paper: pathological role of the cerebellum in autism. The Cerebellum, 11(3):777–807, 2012.
[4] Joseph Piven, Khalil Saliba, James Bailey, and Stephan Arndt. An mri study of autism: the cerebellum revisited. Neurology, 49(2):546–551, 1997.
[5] Ruth A Carper and Eric Courchesne. Inverse correlation between frontal lobe and cerebellum sizes in children with autism. Brain, 123(4):836–844, 2000.
[6] James W Murakami, Eric Courchesne, Gary A Press, Rachel Yeung-Courchesne, and John R Hesselink. Reduced cerebellar hemisphere
77 size and its relationship to vermal hypoplasia in autism. Archives of Neurology, 46(6):689–694, 1989.
[7] Nancy C Andreasen and Ronald Pierson. The role of the cerebellum in schizophrenia. Biological Psychiatry, 64(2):81–88, 2008.
[8] A James Barkovich, Kathleen J Millen, and William B Dobyns. A developmental and genetic classification for midbrain-hindbrain malformations. Brain, 132(12):3199–3230, 2009.
[9] David Green, Amy E Whitener, Saurav Mohanty, and Arne C Lekven. Vertebrate nervous system posteriorization: Grading the function of wnt signaling. Developmental Dynamics, 244(3):507–512, 2015.
[10] Pieter Dirk Nieuwkoop. Activation and organization of the central nervous system in amphibians. part i. induction and activation. Journal of Experimental Zoology, 120(1):1–31, 1952.
[11] Pieter Dirk Nieuwkoop and G v Nigtevecht. Neural activation and transformation in explants of competent ectoderm under the influence of fragments of anterior notochord in urodeles. Development, 2(3):175–193, 1954.
[12] Jennifer E Schmidt, Atsushi Suzuki, Naoto Ueno, and David Kimelman. Localized bmp-4 mediates dorsal/ventral patterning in the early xenopus embryo. Developmental Biology, 169(1):37–50, 1995.
[13] Sara I Wilson and Thomas Edlund. Neural induction: toward a unifying mechanism. Nature Neuroscience, 4(11s):1161–1168, 2001.
[14] Lyle B Zimmerman, Jos´eM De Jes´us-Escobar,and Richard M Harland. The spemann organizer signal noggin binds and inactivates bone morphogenetic protein 4. Cell, 86(4):599–606, 1996.
78 [15] Stefano Piccolo, Yoshiki Sasai, Bin Lu, and Eddy M De Robertis. Dorsoventral patterning in xenopus: inhibition of ventral signals by direct binding of chordin to bmp-4. Cell, 86(4):589–598, 1996.
[16] Vicki Metzis, Sebastian Steinhauser, Edvinas Pakanavicius, Mina Gouti, Despina Stamataki, Kenzo Ivanovitch, Thomas Watson, Teresa Rayon, S Neda Mousavy Gharavy, Robin Lovell-Badge, et al. Nervous system regionalization entails axial allocation before neural differentiation. Cell, 175(4):1105–1118, 2018.
[17] Hanna Polevoy, Yoni E Gutkovich, Ariel Michaelov, Yael Volovik, Yaniv M Elkouby, and Dale Frank. New roles for wnt and bmp signaling in neural anteroposterior patterning. EMBO Reports, page e45842, 2019.
[18] Roel Nusse. Wnt signaling in disease and in development. Cell Research, 15(1):28–32, 2005.
[19] RP Sharma and VL Chopra. Effect of the wingless (wg1) mutation on wing and haltere development in drosophila melanogaster. Developmental Biology, 48(2):461–465, 1976.
[20] Christiane N¨usslein-Volhard and Eric Wieschaus. Mutations affecting segment number and polarity in drosophila. Nature, 287(5785):795–801, 1980.
[21] Roel Nusse and Harold E Varmus. Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell, 31(1):99–109, 1982.
[22] Frans Rijsewijk, Marcus Schuermann, Els Wagenaar, Paul Parren, Detlef Weigel, and Roel Nusse. The drosophila homology of the mouse mammary oncogene int-1 is identical to the segment polarity gene wingless. Cell, 50(4):649–657, 1987. 79 [23] Pascal Lap´ebie,Eve Gazave, Alexander Ereskovsky, Romain Derelle, Chantal B´ezac,Emmanuelle Renard, Evelyn Houliston, and Carole Borchiellini. Wnt/β-catenin signalling and epithelial patterning in the homoscleromorph sponge oscarella. PloS One, 4(6):e5823, 2009.
[24] M Van den Heuvel, Cynthia Harryman-Samos, John Klingensmith, Norbert Perrimon, and Roel Nusse. Mutations in the segment polarity genes wingless and porcupine impair secretion of the wingless protein. The EMBO Journal, 12(13):5293–5302, 1993.
[25] Kimiko Tanaka, Yasuo Kitagawa, and Tatsuhiko Kadowaki. Drosophila segment polarity gene product porcupine stimulates the posttranslational n-glycosylation of wingless in the endoplasmic reticulum. Journal of Biological Chemistry, 277(15):12816–12823, 2002.
[26] Karl Willert, Jeffrey D Brown, Esther Danenberg, Andrew W Duncan, Irving L Weissman, Tannishtha Reya, John R Yates III, and Roel Nusse. Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature, 423(6938):448–45, 2003.
[27] Claudia Y Janda, Deepa Waghray, Aron M Levin, Christoph Thomas, and K Christopher Garcia. Structural basis of wnt recognition by frizzled. Science, 337(6090):59–64, 2012.
[28] Kelsey F. Speer, Anselm Sommer, Benjamin Tajer, Mary C. Mullins, Peter S. Klein, and Mark A. Lemmon. Non-acylated wnts can promote signaling. Cell Reports, 26(4):875 – 883.e5, 2019.
[29] Julia Yang-Snyder, Jeffrey R Miller, Jeffrey D Brown, Cheng-Jung Lai, and Randall T Moon. A frizzled homolog functions in a vertebrate wnt signaling pathway. Current Biology, 6(10):1302–1306, 1996.
80 [30] Yanshu Wang, Jennifer P Macke, Benjamin S Abella, Katrin Andreasson, Paul Worley, Debra J Gilbert, Neal G Copeland, Nancy A Jenkins, and Jeremy Nathans. A large family of putative transmembrane receptors homologous to the product of the drosophila tissue polarity gene frizzled. Journal of Biological Chemistry, 271(8):4468–4476, 1996.
[31] Bonnee Rubinfeld, Iris Albert, Emilio Porfiri, Carol Fiol, Susan Munemitsu, and Paul Polakis. Binding of gsk3β to the apc-β-catenin complex and regulation of complex assembly. Science, 272(5264):1023–1026, 1996.
[32] Cynthia Yost, Monica Torres, Jeffrey R Miller, Eugene Huang, David Kimelman, and Randall T Moon. The axis-inducing activity, stability, and subcellular distribution of beta-catenin is regulated in xenopus embryos by glycogen synthase kinase 3. Genes & Development, 10(12):1443–1454, 1996.
[33] Meritxell Vinyoles, Beatriz Del Valle-P´erez,Josu´eCurto, Rosa Vi˜nas-Castells,Lorena Alba-Castell´on,Antonio Garc´ıade Herreros, and Mireia Du˜nach. Multivesicular gsk3 sequestration upon wnt signaling is controlled by p120-catenin/cadherin interaction with lrp5/6. Molecular Cell, 53(3):444–457, 2014.
[34] Beric R Henderson and Francois Fagotto. The ins and outs of apc and β-catenin nuclear transport. EMBO Reports, 3(9):834–839, 2002.
[35] Robert A Cavallo, Rachel T Cox, Melissa M Moline, Jeroen Roose, Gordon A Polevoy, Hans Clevers, Mark Peifer, and Amy Bejsovec. Drosophila tcf and groucho interact to repress wingless signalling activity. Nature, 395(6702):604–608, 1998.
[36] Cristina-Maria Cruciat and Christof Niehrs. Secreted and transmembrane
81 wnt inhibitors and activators. Cold Spring Harbor Perspectives in Biology, 5(3):a015081, 2013.
[37] Michael T Veeman, Jeffrey D Axelrod, and Randall T Moon. A second canon: functions and mechanisms of β-catenin-independent wnt signaling. Developmental Cell, 5(3):367–377, 2003.
[38] Terry P Yamaguchi. Heads or tails: Wnts and anterior–posterior patterning. Current Biology, 11(17):R713–R724, 2001.
[39] Clemens Kiecker and Christof Niehrs. A morphogen gradient of wnt/β-catenin signalling regulates anteroposterior neural patterning in xenopus. Development, 128(21):4189–4201, 2001.
[40] Ulrika Nordstr¨om,Thomas M Jessell, and Thomas Edlund. Progressive induction of caudal neural character by graded wnt signaling. Nature Neuroscience, 5(6):525–532, 2002.
[41] Arne C Lekven, Christopher J Thorpe, Joshua S Waxman, and Randall T Moon. Zebrafish wnt8 encodes two wnt8 proteins on a bicistronic transcript and is required for mesoderm and neurectoderm patterning. Developmental Cell, 1(1):103–114, 2001.
[42] Caroline E Erter, Thomas P Wilm, Nathan Basler, Christopher VE Wright, and Lilianna Solnica-Krezel. Wnt8 is required in lateral mesendodermal precursors for neural posteriorization in vivo. Development, 128(18):3571–3583, 2001.
[43] Anand Narayanan, Sarah A Thompson, Jared J Lee, and Arne C Lekven. A transgenic wnt8a: Pac reporter reveals biphasic regulation of vertebrate mesoderm development. Developmental Dynamics, 240(4):898–907, 2011.
[44] Wm Gregory Cox and Ali Hemmati-Brivanlou. Caudalization of neural fate by tissue recombination and bfgf. Development, 121(12):4349–4358, 1995. 82 [45] Bruce Blumberg, J Bolado, Tanya Ann Moreno, Chris Kintner, Ronald M Evans, and Nancy Papalopulu. An essential role for retinoid signaling in anteroposterior neural patterning. Development, 124(2):373–379, 1997.
[46] L Lynn McGrew, Stefan Hoppler, and Randall T Moon. Wnt and fgf pathways cooperatively pattern anteroposterior neural ectoderm in xenopus. Mechanisms of Development, 69(1-2):105–114, 1997.
[47] Victoria E Prince, Cecilia B Moens, Charles B Kimmel, and Robert K Ho. Zebrafish hox genes: expression in the hindbrain region of wild-type and mutants of the segmentation gene, valentino. Development, 125(3):393–406, 1998.
[48] Tetsuhiro Kudoh, Stephen W Wilson, and Igor B Dawid. Distinct roles for fgf, wnt and retinoic acid in posteriorizing the neural ectoderm. Development, 129(18):4335–4346, 2002.
[49] Charles B Kimmel, William W Ballard, Seth R Kimmel, Bonnie Ullmann, and Thomas F Schilling. Stages of embryonic development of the zebrafish. Developmental Dynamics, 203(3):253–310, 1995.
[50] Florian Raible and Michael Brand. Divide et impera–the midbrain–hindbrain boundary and its organizer. Trends in Neurosciences, 27(12):727–734, 2004.
[51] Muriel Rhinn, Klaus Lun, Angel Amores, Yi-Lin Yan, John H Postlethwait, and Michael Brand. Cloning, expression and relationship of zebrafish gbx1 and gbx2 genes to fgf signaling. Mechanisms of Development, 120(8):919–936, 2003.
[52] Sandrine Millet, Kenneth Campbell, Douglas J Epstein, Kasia Losos, Esther Harris, and Alexandra L Joyner. A role for gbx2 in repression of
83 otx2 and positioning the mid/hindbrain organizer. Nature, 401(6749):161–164, 1999.
[53] Hiroshi Kikuta, Maiko Kanai, Yukiko Ito, and Kyo Yamasu. gbx2 homeobox gene is required for the maintenance of the isthmic region in the zebrafish embryonic brain. Developmental Dynamics, 228(3):433–450, 2003.
[54] Hisashi Mori, Yoshitaka Miyazaki, Takao Morita, Hiroyuki Nitta, and Masayoshi Mishina. Different spatio-temporal expressions of three otx homeoprotein transcripts during zebrafish embryogenesis. Molecular Brain Research, 27(2):221–231, 1994.
[55] Siew-Lan Ang, Ou Jin, Muriel Rhinn, Nathalie Daigle, Lois Stevenson, and Janet Rossant. A targeted mouse otx2 mutation leads to severe defects in gastrulation and formation of axial mesoderm and to deletion of rostral brain. Development, 122(1):243–252, 1996.
[56] Dario Acampora, Sylvie Mazan, Yvan Lallemand, Virginia Avantaggiato, Martine Maury, Antonio Simeone, and Philippe Brˆulet.Forebrain and midbrain regions are deleted in otx2-/- mutants due to a defective anterior neuroectoderm specification during gastrulation. Development, 121(10):3279–3290, 1995.
[57] Isao Matsuo, Shigeru Kuratani, Chiharu Kimura, Naoki Takeda, and Shinichi Aizawa. Mouse otx2 functions in the formation and patterning of rostral head. Genes & Development, 9(21):2646–2658, 1995.
[58] Muriel Rhinn, Andr´eeDierich, Marianne Le Meur, and S Ang. Cell autonomous and non-cell autonomous functions of otx2 in patterning the rostral brain. Development, 126(19):4295–4304, 1999.
[59] Mat´ıasHidalgo-S´anchez, Antonio Simeone, and Rosa-Magda Alvarado-Mallart. Fgf8 and gbx2 induction concomitant with otx2 84 repression is correlated with midbrain-hindbrain fate of caudal prosencephalon. Development, 126(14):3191–3203, 1999.
[60] Clemens Kiecker and Andrew Lumsden. Compartments and their boundaries in vertebrate brain development. Nature Reviews Neuroscience, 6(7):553–564, 2005.
[61] Alexandra L Joyner, Aimin Liu, and Sandrine Millet. Otx2, gbx2 and fgf8 interact to position and maintain a mid–hindbrain organizer. Current Opinion in Cell Biology, 12(6):736–741, 2000.
[62] Michael Brand, Carl-Philipp Heisenberg, Yun-Jin Jiang, Dirk Beuchle, Klaus Lun, Makoto Furutani-Seiki, Michael Granato, Pascal Haffter, Matthias Hammerschmidt, Donald A Kane, et al. Mutations in zebrafish genes affecting the formation of the boundary between midbrain and hindbrain. Development, 123(1):179–190, 1996.
[63] Muriel Rhinn, Klaus Lun, Reiner Ahrendt, Michaela Geffarth, and Michael Brand. Zebrafish gbx1 refines the midbrain-hindbrain boundary border and mediates the wnt8 posteriorization signal. Neural Development, 4(1):12–29, 2009.
[64] Lewis Wolpert. The french flag problem: a contribution to the discussion on pattern development and regulation. Towards a Theoretical Biology, 1:125–133, 1968.
[65] Maura Strigini and Stephen M Cohen. Wingless gradient formation in the drosophila wing. Current Biology, 10(6):293–300, 2000.
[66] Ritsuko Takada, Yoshinori Satomi, Tomoko Kurata, Naoto Ueno, Shigemi Norioka, Hisato Kondoh, Toshifumi Takao, and Shinji Takada. Monounsaturated fatty acid modification of wnt protein: its role in wnt secretion. Developmental Cell, 11(6):791–801, 2006. 85 [67] Beverly D Smolich, Jill A McMahon, Andrew P McMahon, and J Papkoff. Wnt family proteins are secreted and associated with the cell surface. Molecular Biology of the Cell, 4(12):1267–1275, 1993.
[68] Neil T Parkin, Jan Kitajewski, and Harold E Varmus. Activity of wnt-1 as a transmembrane protein. Genes & Development, 7(11):2181–2193, 1993.
[69] Cyrille Alexandre, Alberto Baena-Lopez, and Jean-Paul Vincent. Patterning and growth control by membrane-tethered wingless. Nature, 505(7482):180–185, 2014.
[70] Karen Beckett, Solange Monier, Lucy Palmer, Cyrille Alexandre, Hannah Green, Eric Bonneil, Graca Raposo, Pierre Thibault, Roland Le Borgne, and Jean-Paul Vincent. Drosophila s2 cells secrete wingless on exosome-like vesicles but the wingless gradient forms independently of exosomes. Traffic, 14(1):82–96, 2013.
[71] Olivier Serralbo and Christophe Marcelle. Migrating cells mediate long-range wnt signaling. Development, 141(10):2057–2063, 2014.
[72] Timothy A Sanders, Esther Llagostera, and Maria Barna. Specialized filopodia direct long-range transport of shh during vertebrate tissue patterning. Nature, 497(7451):628–632, 2013.
[73] Eliana Stanganello, Anja IH Hagemann, Benjamin Mattes, Claude Sinner, Dana Meyen, Sabrina Weber, Alexander Schug, Erez Raz, and Steffen Scholpp. Filopodia-based wnt transport during vertebrate tissue patterning. Nature Communications, 6:5846, 2015.
[74] Corinne Houart, Luca Caneparo, Carl-Philipp Heisenberg, K Anukampa Barth, Masaya Take-Uchi, and Stephen W Wilson. Establishment of the telencephalon during gastrulation by local antagonism of wnt signaling. Neuron, 35(2):255–265, 2002. 86 [75] Tobias Langenberg and Michael Brand. Lineage restriction maintains a stable organizer cell population at the zebrafish midbrain-hindbrain boundary. Development, 132(14):3209–3216, 2005.
[76] Gerri R Buckles, Christopher J Thorpe, Marie-Christine Ramel, and Arne C Lekven. Combinatorial wnt control of zebrafish midbrain–hindbrain boundary formation. Mechanisms of Development, 121(5):437–447, 2004.
[77] Claudia Y Janda, Luke T Dang, Changjiang You, Junlei Chang, Wim de Lau, Zhendong A Zhong, Kelley S Yan, Owen Marecic, Dirk Siepe, Xingnan Li, et al. Surrogate wnt agonists that phenocopy canonical wnt and β-catenin signalling. Nature, 545(7653):234–237, 2017.
[78] Jeffrey A Farrell, Yiqun Wang, Samantha J Riesenfeld, Karthik Shekhar, Aviv Regev, and Alexander F Schier. Single-cell reconstruction of developmental trajectories during zebrafish embryogenesis. Science, 360(6392):eaar3131, 2018.
[79] Monte Westerfield. The zebrafish book: a guide for the laboratory use of zebrafish (Danio rerio). University of Oregon press, 2007.
[80] Gilbert Weidinger, Chris J Thorpe, Katrin Wuennenberg-Stapleton, John Ngai, and Randall T Moon. The sp1-related transcription factors sp5 and sp5-like act downstream of wnt/β-catenin signaling in mesoderm and neuroectoderm patterning. Current Biology, 15(6):489–500, 2005.
[81] Cristi L Stoick-Cooper, Gilbert Weidinger, Kimberly J Riehle, Charlotte Hubbert, Michael B Major, Nelson Fausto, and Randall T Moon. Distinct wnt signaling pathways have opposing roles in appendage regeneration. Development, 134(3):479–489, 2007.
[82] Stefan Hans, Joe Christison, Dong Liu, and Monte Westerfield.
87 Fgf-dependent otic induction requires competence provided by foxi1 and dlx3b. BMC developmental biology, 7(1):5, 2007.
[83] Christine Thisse and Bernard Thisse. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nature Protocols, 3(1):59–69, 2008.
[84] Eek-hoon Jho, Tong Zhang, Claire Domon, Choun-Ki Joo, Jean-Noel Freund, and Frank Costantini. Wnt/β-catenin/tcf signaling induces the transcription of axin2, a negative regulator of the signaling pathway. Molecular and Cellular Biology, 22(4):1172–1183, 2002.
[85] Pascal Haffter, Michael Granato, Michael Brand, Mary C Mullins, Matthias Hammerschmidt, Donald A Kane, J¨orgOdenthal, FJ Van Eeden, Yun-Jin Jiang, Carl-Philipp Heisenberg, et al. The identification of genes with unique and essential functions in the development of the zebrafish, danio rerio. Development, 123(1):1–36, 1996.
[86] Marie-Christine Ramel and Arne C Lekven. Repression of the vertebrate organizer by wnt8 is mediated by vent and vox. Development, 131(16):3991–4000, 2004.
[87] Juan Ramon Martinez-Morales and Joachim Wittbrodt. Shaping the vertebrate eye. Current Opinion in Genetics & Development, 19(5):511–517, 2009.
[88] Gregory M Kelly, Penny Greenstein, Deniz F Erezyilmaz, and Randall T Moon. Zebrafish wnt8 and wnt8b share a common activity but are involved in distinct developmental pathways. Development, 121(6):1787–1799, 1995.
[89] Timothy Erickson, Steffen Scholpp, Michael Brand, Cecilia B Moens, and Andrew Jan Waskiewicz. Pbx proteins cooperate with engrailed to pattern the midbrain–hindbrain and diencephalic–mesencephalic boundaries. Developmental Biology, 301(2):504–517, 2007. 88 [90] Frank Reifers, H Bohli, Emily C Walsh, Phillip H Crossley, DY Stainier, and Michael Brand. Fgf8 is mutated in zebrafish acerebellar (ace) mutants and is required for maintenance of midbrain-hindbrain boundary development and somitogenesis. Development, 125(13):2381–2395, 1998.
[91] Yukio Nakamura, Eduardo de Paiva Alves, Gert Jan C Veenstra, and Stefan Hoppler. Tissue-and stage-specific wnt target gene expression is controlled subsequent to β-catenin recruitment to cis-regulatory modules. Development, 143(11):1914–1925, 2016.
[92] Mark D Robinson and Alicia Oshlack. A scaling normalization method for differential expression analysis of rna-seq data. Genome biology, 11(3):R25, 2010.
[93] Conlin T Eagle AE Fashena D Frazer K Knight J Mani P Martin R Moxon SA Paddock H Pich C Ramachandran S Ruef BJ Ruzicka L Schaper K Shao X Singer A Sprunger B Van Slyke CE Westerfield M. Howe DG, Bradford YM. Zfin the zebrafish information network, 2007.
[94] Claire A Canning, Lily Lee, Carol Irving, Ivor Mason, and C Michael Jones. Sustained interactive wnt and fgf signaling is required to maintain isthmic identity. Developmental Biology, 305(1):276–286, 2007.
[95] Akihito Yamamoto, Takashi Nagano, Shoko Takehara, Masahiko Hibi, and Shinichi Aizawa. Shisa promotes head formation through the inhibition of receptor protein maturation for the caudalizing factors, wnt and fgf. Cell, 120(2):223–235, 2005.
[96] Takashi Nagano, Shoko Takehara, Maiko Takahashi, Shinichi Aizawa, and Akihito Yamamoto. Shisa2 promotes the maturation of somitic precursors and transition to the segmental fate in xenopus embryos. Development, 133(23):4643–4654, 2006.
89 [97] B Thisse, S Pflumio, M F¨urthauer, B Loppin, V Heyer, A Degrave, R Woehl, A Lux, T Steffan, XQ Charbonnier, et al. Expression of the zebrafish genome during embryogenesis. ZFIN direct data submission, 2001.
[98] Carl-Philipp Heisenberg, Masazumi Tada, Gerd-JoErg` Rauch, Leonor Sa´ude,Miguel L Concha, Robert Geisler, Derek L Stemple, James C Smith, and Stephen W Wilson. Silberblick/wnt11 mediates convergent extension movements during zebrafish gastrulation. Nature, 405(6782):76–81, 2000.
[99] Beate Kilian, Hannu Mansukoski, Filipa Carreira Barbosa, Florian Ulrich, Masazumi Tada, and Carl-Philipp Heisenberg. The role of ppt/wnt5 in regulating cell shape and movement during zebrafish gastrulation. Mechanisms of Development, 120(4):467–476, 2003.
[100] Daisuke Kurokawa, Hiroshi Kiyonari, Rika Nakayama, Chiharu Kimura-Yoshida, Isao Matsuo, and Shinichi Aizawa. Regulation of otx2 expression and its functions in mouse forebrain and midbrain. Development, 131(14):3319–3331, 2004.
[101] Ashish K Maurya, Haihan Tan, Marcel Souren, Xingang Wang, Joachim Wittbrodt, and Philip W Ingham. Integration of hedgehog and bmp signalling by the engrailed2a gene in the zebrafish myotome. Development, 138(4):755–765, 2011.
[102] David Green. Testing the Role of Wnt8a Diffusion in Wnt Mediated Neural Posteriorization. PhD thesis, Texas A&M University, 2017.
[103] Maximiliano L Suster, Kenta Sumiyama, and Koichi Kawakami. Transposon-mediated bac transgenesis in zebrafish and mice. Bmc Genomics, 10(1):477, 2009.
90 [104] Barry M Zee, Rebecca S Levin, Peter A DiMaggio, and Benjamin A Garcia. Global turnover of histone post-translational modifications and variants in human cells. Epigenetics & Chromatin, 3(1):22, 2010.
[105] Annika D Wylie, Jo-Ann GW Fleming, Amy E Whitener, and Arne C Lekven. Post-transcriptional regulation of wnt8a is essential to zebrafish axis development. Developmental Biology, 386(1):53–63, 2014.
91