Evolutionary tales of maskrays (Neotrygon, Dasyatidae), flatheads (Platycephalidae, Scorpaeniformes) and tuskfishes (Choerodon, Labridae).

by Melody Puckridge Institute for Marine and Antarctic Studies

Submitted in fulfilment of the requirements for the Degree of Doctor of Philosophy University of Tasmania October 2013

DECLARATION OF ORIGINALITY

This thesis contains no material which has been accepted for a degree or diploma by the University or any other institution, except by way of background information and duly acknowledged in the thesis, and to the best of my knowledge and belief no material previously published or written by another person except where due acknowledgement is made in the text of the thesis, nor does the thesis contain any material that infringes copyright.

Melody Puckridge

Date: 27/10/2013

STATEMENT OF ETHICAL CONDUCT

The research associated with this thesis abides by the international and Australian codes on human and animal experimentation, the guidelines by the Australian Government's Office of the Gene Technology Regulator and the rulings of the Safety, Ethics and Institutional Biosafety Committees of the University.

Melody Puckridge

Date: 27/10/2013

AUTHORITY OF ACCESS

The publishers of the papers comprising Chapters 2 and 3 hold the copyright for that content, and access to the material should be sought from the respective journals. The remaining non published content of the thesis may be made available for loan and limited copying and communication in accordance with the Copyright Act 1968.

Melody Puckridge

Date: 27/10/2013 ii

PUBLICATIONS

Chapter 2 Puckridge M, Last PR, White WT, Andreakis N (2013) Phylogeography of the Indo- West Pacific maskrays (Dasyatidae, Neotrygon): a complex example of chondrichthyan radiation in the Cenozoic. Ecology and Evolution 3, 217-232.

Chapter 3 Puckridge M, Andreakis N, Appleyard SA, Ward RD (2013) Cryptic diversity in flathead fishes (Scorpaeniformes: Platycephalidae) across the Indo-West Pacific uncovered by DNA barcoding. Molecular Ecology Resources 13, 32-42.

Chapter 4 Puckridge M, Last PR, Gledhill D, Andreakis N (2013) Revisiting latitudinal diversity gradients in the Indo-West Pacific: Phylogeography of the flathead fishes (Platycephalidae). Journal of Biogeography (submitted).

Supplementary publications Last P, White WT, Puckridge M (2010) Neotrygon ningalooensis n. sp. (Myliobatoidei: Dasyatidae), a new maskray from Australia. Aqua, International Journal of Ichthyology 16, 37-50.

White WT, Last PR, Dharmadi, Faizah R, Chodrijah U, Prisantoso BI, Pogonoski JJ, Puckridge M and Blaber SJM (2013) Market fishes of Indonesia (=Jenis-jenis ikan yang di Indonesia). ACIAR Monograph No. 155. Australian Centre for International Agricultural Research: Canberra.

iii

STATEMENT OF CO-AUTHORSHIP

The concept development, survey design, implementation, production, analysis and interpretation of data, writing and final editing of the manuscripts were the responsibility of the primary author and PhD candidate, M. Puckridge. Additional input from co-authors was as follows:

For Chapter 2: P.R. Last helped develop ideas, chose the focus group and provided editorial input to refine the manuscript. W.T. White provided the great majority of tissue samples as well as editorial input to refine the manuscript. N. Andreakis helped develop ideas, provided guidance with analyses, their interpretation and manuscript layout as well as editorial revisions.

For Chapter 3: N. Andreakis provided guidance with the analyses and editorial input to the manuscript. S.A. Appleyard offered general laboratory advice as well as editorial input to the manuscript. R.D. Ward helped develop ideas, provided guidance on interpretation of analyses and manuscript layout as well as editorial revisions.

For Chapter 4: P.R. Last helped develop ideas, chose the focus group and provided editorial input to the manuscript. D. Gledhill helped develop ideas and provided editorial input to the manuscript. N. Andreakis provided guidance with analyses and their interpretation and editorial input to the manuscript.

______

Melody Puckridge Dr. Patti Virtue Candidate Supervisor Institute for Marine & Antarctic Studies Institute for Marine & Antarctic Studies University of Tasmania University of Tasmania

iv

ACKNOWLEDGEMENTS

Nikos Andreakis and his fabulous mind coached me through the daunting world of phylogenetics (not to mention the entirety of PhD land itself) – sharing his vast understanding of science through high level, philosophical discussions that have changed the way I look at the world down to the minutiae (and frustration!!!) of software troubleshooting and back again – all delivered with great integrity, humour and patience. Being stationed ‘remotely’ (let’s face it, Townsville is the middle of nowhere) meant helping me often spilled into his evenings and weekends. To that end, I am also very grateful to his beautiful family, Gabriella, Christina and Iannis, for sharing his focus. Peter Last and his exceptional knowledge of life in the oceans is the reason I’ve had the privilege of working with such fascinating fishes. If I have managed to make any inroads into telling their wondrous stories it is because he seeded my thinking with their possibilities. Bob Ward has been a constant guide in my scientific endeavours and if it weren’t for his initial support, I may not have been able to take on this particular endeavour. His pragmatic approach and scientific clarity of thinking are something to aspire to. Sharon Appleyard graciously stepped in to mentor me through the laboratory process and schooled me in how to methodically work through the black magic of genetics for which I am incredibly grateful, as this is by no means an art that comes naturally to me. There were times I wondered if waving my pipette as a wand would’ve been a more useful next step in coaxing dormant samples to show themselves and hand over their transcripts. I am also very grateful to Guy Abel and Peter Grewe who, at the start, took time out to help me find my feet in the lab. Patti Virtue, keeper of the eternally optimistic spirit, has been invaluable. Her presence, guidance, intuition and nous form the ultimate cheering squad and an essential force in the challenging times of a PhD. William White has been a fantastic early mentor. Not only did he coach my interests in the world of fishes, but also introduced me to the wonders of fieldwork in Eastern Indonesia. Although ‘pleasant’ is light years away from describing the rotting fish markets and cramped, makeshift hotel bathroom ‘laboratories’ we got to process in for long, arduous days upon days, I always loved the adventure and learning of those trips. And armed with a better understanding of fish IDs (thanks to Will), I was equipped to walk into those fish markets and be simultaneously horrified and delighted at the incredible diversity of life (or rather – death) that lay in buckets, baskets, boxes, across tables or strewn on the ground. The conservationist and the collector in me have certainly had their battles on those Indonesian shores. The steadfast fish tax crew at large have been awesome. Specific thanks to Al Graham, John Pogonoski and Dan Gledhill for allowing me to pester at regular intervals for samples, reference materials or even just the odd bit of stationary that looked useful... And of course, thank you to the many people who collected material used in the following thesis.

v

Without their independent interest and meticulous efforts to sample and store material, I would’ve had a snowballs chance in hell of targeting work of this scope. Specifically, material has come through the hands of: William White, Peter Last, Daniel Gledhill, Alastair Graham, John Pogonoski, Gordon Yearsley, Gary Fry, Ross Daley, Allan Connell, Jenny Giles, Ian Jacobsen, Ashlee Jones, Peter Kyne, Alec Moore, Gavin Naylor, Simon Pierce, Lucy Scott, Bernard Séret, Mike Sugden, Jeremy Vaudo, Kohji Mabuchi, Ken Graham and David Fairclough. William White, Allan Connell and Gary Fry made effort to collect samples specifically for this project with greatly appreciated enthusiasm. Permission to use other material and sequences originally donated to the Barcode of Life Database was kindly granted by Martin Gomon, Mark McGrouther, Seinen Chow, Junbin Zhang, Allan Connell, Amy Driscoll, Les Knapp, Chris Meyer, Serge Planes, Jeff Williams, Phil Heemstra, Elaine Heemstra and Monica Mwale. And thank you very much to Dirk Steinke for sub-sampling and orchestrating the transfer of all of this material from the Biodiversity Institute of Ontario in Guelph. Neil Aschliman and Gavin Naylor kindly provided advice on RAG1 primers for the stingrays. Shannon Corrigan, John Pogonoski, Peter Smith, Alan Butler and Nic Bax all provided fantastic and insightful feedback that greatly helped to improve various chapters of this thesis. I would not have lasted without the mentoring and encouragement of Alan Williams. His insights, integrity, warmth and enthusiasm have been formative influences over these past years and his friendship brings to mind the words of Charles Darwin that ‘A [person’s] friendships are one of the best measures of [their] worth’. Among the jewels of my friendship treasure trove are also my fellow Block 4 roomies, particularly Jess Ford, whose companionship and student room giggles have been the daily staple. And of course, in there is Lev Bodrossy, my true blue mate, confidant and coordination doppelgänger, whose company is synonymous with almost every event of the last few years. My family has been fabulous. In addition to their eye rolling about my PhD, Dad has taken time to tutor me in the world of Adobe software. If a picture truly does speak a thousand words, my illustrator skills alone will’ve saved me years of writing, given the snails pace it moves at. Of course, no chapter of my life would be complete without Mum’s moral support down the phone to help me find humour in the less humorous. And Matti – who will likely never read this, because he’ll always have ‘better things to do’ but whose big brother support is largely why I’ve learnt to reach for the challenging fruit higher in the tree of life. And last, but in no way least, Toby Jarvis, my partner and buddy, thank you for supporting me - in all ways! - and keeping me company throughout the journey. For this, and for you, I am eternally grateful.

vi

ABSTRACT

The tropical Indo-West Pacific (IWP) is the most biologically diverse marine region on earth with a number of competing hypotheses proposed to explain the evolutionary events responsible for this area’s biotic complexity. These hypotheses are based on varying interpretations of species distributions radiating from the Indo-Australian Archipelago (IAA) at the centre of the region. The IAA represents a geologically dynamic area formed by colliding tectonics; mechanisms relating to tectonic activity are therefore commonly considered responsible for the biodiversity here. In the present study, a) maskrays of the genus Neotrygon (Dasyatidae), b) flatheads of the family Platycephalidae (Scorpaeniformes) and c) tuskfishes of the genus Choerodon (Labridae) were studied with respect to their taxonomy, phylogeny and phylogeography. These groups are characterized by having demersal life histories and a high proportion of narrow-ranging endemics. Furthermore, some of the widely distributed species across the region are suggestive of either recent jump-dispersal events or fragmentation of once pan- tropical populations. The sampling effort in this study focused on exploring diversity among species, and within selected taxa, by obtaining multiple individuals across species’ distribution ranges, where possible. Molecular phylogenies, coupled with molecular clock approximations, were employed to a) assess nominal species validity b) DNA barcode Evolutionarily Significant Units (ESUs) and c) explore the geological and evolutionary processes responsible for observed trends in diversity and species distribution in maskrays, flatheads and tuskfishes. Both mitochondrial and nuclear molecular markers were used in this study. The chosen markers amplified consistently across species, showed high content of phylogenetic signal and were able to resolve closely related species, thus allowing the inference of robust phylogenies and molecular clock dating. Parallel genealogical trajectories have been recovered within rays of the genus Neotrygon and platycephalin flatheads (the most comprehensively sampled subfamily of Platycephalidae). These congruent spatial and temporal patterns suggest that species differentiation predominantly occurred across the tropical IAA throughout the mid to late Miocene. The most widely distributed and derived forms in these groups – Neotyrgon kuhlii and Platycephalus indicus – were found to consist of cryptic species complexes with considerable lineage diversity across their IWP range. Phylogeographic comparisons with other, less well sampled platycephalid species confirm that diversification patterns are consistent across multiple species, suggesting species diversity in shallow water marine fauna may be grossly underestimated. In contrast, tuskfishes of the genus Choerodon showed unclear phylogeographic structuring. However, mixed ancestral and derived lineages, endemic to Australian waters, suggest the Australian region has acted as both a refuge for lineage survival and source of radiation in this group since the mid-Miocene. Patterns are

vii

consistent with centrifugal speciation, a process that may be common across marine groups here. In conclusion, the tectonic suture zones across the Australian and Eurasian Plates have played an essential role in triggering the area’s mega-diversity and biotic complexity. Tectonic rafting, the establishment of new habitats in the form of shallow seas, tropical coastlines and island arcs, together with glacio-eustatic sea level oscillations, have likely favoured rapid species diversification through vicariance and allopatric speciation. The imprint of these large-scale geological and climatic events has been retained within the evolutionary history of maskrays, flatheads and tuskfishes. These uncovered patterns may represent a common trend for many other marine taxa with similar ranges and geographical distributions.

viii

ABBREVIATIONS

16S Ribosomal RNA (mitochondrial marker) ANFC Australian National Fish Collection Aus Australia BBM Bayesian Binary MCMC analysis BI Bayesian inference BOLD Barcode of Life Database COI Cytochrome oxidase subunit 1 (mitochondrial marker) DNA Deoxyribonucleic acid EAC East Australian Current ENC1 A single-copy ectodermal-neural cortex I-like protein (nuclear marker) GTR General time reversible model of evolution HKY Hasegawa, Kishino and Yano model of evolution hLRTs Hierarchical likelihood ratio tests HPD High posterior density IAA Indo-Australian archipelago ILD Incongruence length difference test Indo Indonesia IWP Indo-West Pacific K2P Kimura-2 Parameter model of evolution Ma Million years ago MCMC Markov chain Monte Carlo ML Maximum likelihood MP Maximum parsimony MRCA Most recent common ancestor mtDNA Mitochondrial DNA My Million years nDNA Nuclear DNA NGS Next Generation Sequencing NSW New South Wales, Australia PCR Polymerase Chain Reaction Qld Queensland, Australia RAG 1 Recombination-activating gene 1 (nuclear marker) RAG 2 Recombination-activating gene 2 (nuclear marker) TBR Tree bisection reconnection (a branch swapping algorithm) TIMef Transition model of evolution with equal base frequencies Tmo-4c4 Titin-like protein (nuclear marker) TrN Tamura Nei model of evolution TrNef TrN model of evolution with equal base frequencies TVM Transversion model of evolution WA Western Australia, Australia

ix

TABLE OF CONTENTS

DECLARATION ii STATEMENT OF ETHICAL CONDUCT ii AUTHORITY OF ACCESS ii PUBLICATIONS iii STATEMENT OF CO-AUTHORSHIP iv ACKNOWLEDGEMENTS v ABSTRACT viii ABBREVIATIONS ix TABLE OF CONTENTS x LIST OF FIGURES xiii LIST OF TABLES xvii

CHAPTER 1 1 1.1 INTRODUCTION 2 1.1.1 Description of the study area 2 1.1.2 Current theories 3 1.1.3 Evolutionary patterns & their interpretation 4 1.1.2 Geological history 4 1.1.5 The model systems 8 1.1.5.1 The maskrays 9 1.1.5.2 The flathead fishes 9 1.1.5.3 The tuskfishes 10 1.1.6 Phylogenetics & phylogeography 10 1.1.7 Thesis summary 11

CHAPTER 2 Phylogeography of the Indo-West Pacific maskrays (Dasyatidae, Neotrygon): a complex example of chondrichthyan radiation in the Cenozoic 12 2.1 ABSTRACT 14 2.2 INTRODUCTION 15 2.3 METHODS 17 2.3.1 Specimen collection & geographical locations 17 2.3.2 DNA extraction, PCR amplification & sequencing 17 2.3.3 Sequence alignments, data exploration, model & outgroup selection 18 2.3.4 Phylogenetic analyses, clade delineation & network reconstruction 18 2.3.5 Partition of genetic diversity & barriers to gene-flow 19 2.3.6 Past demographic history 20 2.3.7 Divergence time estimates 20 2.4 RESULTS 22 2.4.1 Phylogenetic reconstructions 22 2.4.2 Species level phylogenies & clade delineations in Neotrygon 24 2.4.3 Network analysis 27 2.4.4 Barriers to gene-flow within N. kuhlii 28 2.4.5 Past population demographic history & divergence time estimates 28

x

2.5 DISCUSSION 30 2.5.1 Taxonomic considerations 30 2.5.2 Species diversity in Neotrygon 31 2.5.3 Phylogeography & cryptic speciation in the Pleistocene 32 2.5.4 Population expansion-contraction & secondary contact in Pleistocene 34 2.5.5 Phylogeography in Neotrygon ningalooensis & N. annotata 34 2.5.6 Conclusions 35

CHAPTER 3 Cryptic diversity in flathead fishes (Scorpaeniformes: Platycephalidae) across the Indo-West Pacific uncovered by DNA barcoding 36 3.1 ABSTRACT 38 3.2 INTRODUCTION 39 3.3 METHODS 41 3.4 RESULTS 43 3.4.1. Cymbacephalus staigeri 46 3.4.2. Platycephalus endrachtensis 46 3.4.3. Cymbacephalus nematophthalmus 47 3.4.4. Inegocia japonica 47 3.4.5. Thysanophrys chiltonae 47 3.4.6. Thysanophrys celebica 47 3.4.7. Sunagocia arenicola 47 3.4.8. Platycephalus indicus 48 3.5 DISCUSSION 50

CHAPTER 4 Revisiting latitudinal diversity gradients in the Indo-West Pacific: Phylogeography of the flathead fishes (Platycephalidae) 54 4.1 ABSTRACT 56 4.2 INTRODUCTION 57 4.3 METHODS 59 4.3.1 Sample collection 59 4.3.2 DNA extraction, PCR amplification, sequencing & alignments 59 4.3.3 Outgroup comparisons 60 4.3.4 Data exploration & model selection 60 4.3.5 Phylogenetic analyses & network reconstruction 60 4.3.6 Molecular clock computations 61 4.4 RESULTS 63 4.4.1 Onigociinae 65 4.4.2 Platycephalinae 66 4.4.3 Genealogical network 69 4.4.4 Molecular clock approximations 69 4.5 DISCUSSION 73 4.5.1 Latitudinal diversity gradients in temperate & tropic regions 73 4.5.2 Diversification in the tropics 74 4.5.3 Migration direction since the Eocene 74 4.5.4 Diversification in the mid-Miocene 76 4.5.5 The Platycephalus indicus complex 76 4.5.6 Systematic considerations 77 4.5.7 Conclusions 78

xi

CHAPTER 5 Centrifugal speciation promotes species diversity in the Indo-West Pacific tuskfishes (Labridae: Choerodon) 80 5.1 ABSTRACT 82 5.2 INTRODUCTION 83 5.3 METHODS 85 5.3.1 Sample collection 85 5.3.2 Sampling coverage 85 5.3.3 Outgroup selection 85 5.3.4 Marker selection 86 5.3.5 DNA extraction, PCR amplification & sequencing 86 5.3.6 Phylogenetic reconstructions 86 5.3.7 Divergence time dating 87 5.3.8 Phylogeographic relationships 87 5.3.9 Ecological partitioning 88 5.4 RESULTS 89 5.4.1 Phylogenetic reconstruction 89 5.4.2 Divergence times & phylogeography 91 5.4.2.1 Clade 1 93 5.4.2.2 Clade 2 93 5.4.2.3 Clade 3 94 5.4.2.4 Clade 4 94 5.4.3 Inferring ancestral biogeography, habitat preference & body size 96 5.5 DISCUSSION 98 5.5.1 Taxonomic & phylogenetic implications 98 5.5.2 Evolutionary origins 98 5.5.3 The geography of speciation 99 5.5.4 Evolutionary drivers 99 5.5.5 Habitat association 100 5.5.6 Conclusions 101

CHAPTER 6 102 6.1 DISCUSSION 103 6.2 CONCLUSIONS 106

REFERENCES 107

APPENDICES APPENDIX 1 Supplementary information for Chapter 2 125 APPENDIX 2 Supplementary information for Chapter 3 135 APPENDIX 3 Supplementary information for Chapter 4 153 APPENDIX 4 Supplementary information for Chapter 5 163 APPENDIX 5 Supplementary publication 1 Neotrygon ningalooensis 167 APPENDIX 6 Supplementary publication 2 Market fishes of Indonesia 181

xii

LIST OF FIGURES

Figure 1.1 3 Map of Indo-West Pacific region highlighting the tropical Indo-Australian Archipelago.

Figure 1.2 5 Paleogeographic maps showing tectonic evolution of the region from the Late Jurassic to the Middle Miocene (Scotese 2001).

Figure 1.3 7 Paleogeographic maps showing tectonic evolution of the IWP region from the Late Jurassic to the Middle Miocene (Hall 2002).

Figure 1.4 8 Compilation of Phanerozoic sea-level changes compiled from Haq & Al-Qahtani (2005) and Hardenbol et al. (1998) and adapted from Snedden & Liu (2010).

Figure 2.1 17 Known geographic distribution of Neotrygon species analysed in this study adapted from Last & Stevens (2009) and Last et al. (2010).

Figure 2.2 23 Bayesian phylogenetic hypothesis of Neotrygon species and genera of Dasyatidae inferred from: a) the partial RAG1 gene; b) the concatenated mitochondrial COI and 16S genes and c) the concatenated COI, 16S and RAG1 genes. Node support of ≥ 0.95 posterior probability and ≥ 70% bootstrap support are given respectively with ~ denoting support below these threshold values. Stars denote polyphyletic relationships within Dasyatis.

Figure 2.3 26 Genealogical relationships within the N. kuhlii complex. In a) geographical distribution of N. kuhlii ESUs 1 to 9 with sample numbers given at each location; dashed lines denote geographical barriers responsible for genetic discontinuities in descending order from 1 to 4. In b) Bayesian phylogenetic hypothesis of ESUs based on the concatenated mitochondrial and nuclear dataset; Numbers on nodes indicate posterior probabilities and bootstrap support respectively. In c) COI median-joining networks illustrating genealogical relationships among haplotypes of ESUs 1 to 9. Circles indicate haplotypes; lines denote substitution steps among haplotypes; the size of the circles is proportional to the frequency of the haplotypes; grey circles represent median vectors of either un-sampled or extinct taxa.

Figure 2.4 27 Neotrygon ningalooensis and N. annotata complexes. In a) their known geographical distributions and haplotype sampling locations; in b) and c) the genealogical relationships among haplotypes. Circles indicate haplotypes; lines denote substitution steps among haplotypes; the size of the circles is proportional to the frequency of the haplotypes; grey circles represent median vectors of either un-sampled or extinct taxa.

xiii

Figure 2.5 29 Divergence time approximations within Dasyatidae calibrated against fossil records with 95% credibility intervals in major nodes (numbered 1 to 10). The black dot denotes the calibration fossil. A time scale in My before present and a geological time scale is given below. Ages of nodes 1 to 10 are detailed in Table S4 for comparison with dates based on COI mutation rates. A Bayesian skyline plot derived from Neotrygon kuhlii COI sequences is depicted on the left. Black line denotes fluctuations of the median effective population size; the shaded area represents 95% confidence range. Time in thousands of years (Ky) is reported in the x axis.

Figure 2.6 29 Mean divergence times of nodes 1 to 10 based on the fossil calibration of this study and mitochondrial mutation rates of the spotted eagle ray Aetobatus narinari, (Richards et al. 2009) set at 0.58% per My and 0.90% per My on the basis of conflicting estimates of the final closure of the Isthmus of Panama.

Figure S2.1 131 Substitution frequencies of transitions (cross) and transversions (triangle) for: a) the 1st, b) 2nd and c) 3rd codon positions of the partial COI gene. Observed frequencies are calculated with the K2P genetic distance.

Figure S2.2 132 Substitution frequencies of transitions (cross) and transversions (triangle) for: a) the 1st, b) 2nd and c) 3rd codon positions of the partial 16S gene. Observed frequencies are calculated with the K2P genetic distance.

Figure S2.3 133 Substitution frequencies of transitions (cross) and transversions (triangle) for: a) the 1st, b) 2nd and c) 3rd codon positions of the partial RAG1 gene. Observed frequencies are calculated with the K2P genetic distance.

Figure S2.4 134 Mismatch distributions for pairwise comparisons of Neotrygon kuhlii COI mitochondrial clades. Monomorphic clades 3, 4 and 6 were excluded from the calculation. The frequencies of expected and observed differences are given as a solid and dashed line, respectively.

Figure 3.1 43 a) frequency distribution of pairwise sequence comparisons based on p-distance, K2P- corrected distance and TN model-based distance for the partial COI gene of all samples; b) frequency distribution of genetic distance estimates as above, calculated only for the barcode gap range of distances; c) ABGD outcome indicating the number of genetically distinct OTUs given each prior intraspecific divergence value.

Figure 3.2 46 Comparison of average intra-specific K2P distances between sampled regions of the Indo- West Pacific.

Figure 3.3 49 Neighbour-Joining tree of Platycephalus indicus complex highlighting distances between clades and congeneric species P. cultellatus, P. fuscus and P. westraliae. Bootstrap values >70% are given based on 2,000 pseudoreplicates. xiv

Figure S3.1 135 Neighbour-Joining tree of Platycephalidae COI sequences based on the Kimura-2-parameter model of sequence evolution. Bootstrap values >70% are given based on 2,000 pseudoreplicates.

Figure 4.1 64 Bayesian phylogenetic hypothesis of Platycephalidae inferred from the concatenated mitochondrial and nuclear datasets. Node support of ≥ 0.95 posterior probability and ≥ 70% bootstrap support from the Maximum Likelihood analysis are given. A ~ symbol is substituted for support below these threshold values.

Figure 4.2 65 Phylogeographic relationships of sister groups in Onigociinae clades a) Inegocia japonica and b) I. harisii, Ambiserrula jugosa as well as c) Cymbacephalus beauforti, C. stagier and d) C. nematophthalmus. Approximate divergence times in millions of years are given on nodes and alternative Bayesian Inference and Maximum Likelihood relationships within and between clades are highlighted.

Figure 4.3 67 Phylogeographic relationships of sister groups in Platycephalinae clades a) Platycephalus conatus, P. richardsoni, P. aurimaculatus b) P. orbitalis, P. marmoratus c) P. endrachtensis d) P. bassensis, P. longispinis e) P. speculator, P. caeruleopunctatus f) P. laevigatus. Approximate divergence times in millions of years are given on nodes. Clade positions within Platycephalinae, based on Bayesian Inference, are highlighted.

Figure 4.4 68 Relationships within the Platycephalus indicus group complex giving a) geographical distributions of Platycephalus cultellatus, P. fuscus, P. indicus and P. westraliae with colour coded sampling locations. These correspond to b) median-joining network relationships of COI haplotypes and c) their phylogenetic relationships. Approximate divergence times in millions of years are given on nodes and position of the clade within Platycephalinae, based on Bayesian Inference is highlighted.

Figure 4.5 70 Molecular clock divergence approximations within Platycephalidae based on fossil calibrations showing median node ages and their 95% highest posterior density (upper and lower) intervals in millions of years before present.

Figure 4.6 72 Relational changes for a) minimum and b) maximum depth ranges; c) hard and soft substrate type; d) average number of lateral line scales; e) Mutation rates and f) occupied bathomes across lineages. Colours and shading across phylogenies relate to character classes indicated in corresponding keys.

Figure 5.1 88 Map of partitioned regions used to classify range extent of Choerodon species across the IAA

xv

Figure 5.2 90 Bayesian phylogenetic hypothesis of Choerodon relationships within the hypsigenyini tribe based on the concatenated dataset. Internal node support >/= to 0.95 HPD and >70% based on bootstrap pseudo-replicates are given. Four major clades are highlighted.

Figure 5.3 92 Divergence time estimates for the hypsigenyini phylogeny given in millions of years (Ma) with blue bars across nodes indicating their 95% upper and lower confidence intervals. Predicted distributions for internal nodes across the Choerodon group are indicated with pie graphs. Colours correspond to regions illustrated in the map insert. Areas with <10% probability are blacked out.

Figure 5.4 93 Phylogeographic relationships across clade 1 showing a) Choerodon cf. margaritiferus, C. gomoni and C. sp A. For comparison, distributions for C. margaritiferus are also given. b) C. jordani and C. frenatus and c) C. sugillatum and Xiphocheilus typus.

Figure 5.5 94 Phylogeographic relationships across clade 2 between C. robustus, C. zamboangae, C. azurio and C. monostigma.

Figure 5.6 95 Phylogeographic relationships across clades 3 and 4 showing a) C. cauteroma, C. cephalotes, C. rubescens and C. schoenleinii. b) C. anchorago, C. cyanodus and C. oligacanthus, c) C. venustus and d) C. fasciatus and C. vitta.

Figure 5.7 96 Habitat associations across the Choerodon group classified as non-reef and reef environments. Closed circles represent endemic species and open circles represent widespread species.

Figure 5.8 97 Bar graph showing habitat associations for endemic and widespread species.

Figure 5.9 97 Maximum size for Choerodon species grouped into 25cm intervals.

xvi

LIST OF TABLES

Table 2.1 22 Alignment statistics for COI, 16S, RAG1 and combined datasets calculated from the global dataset (Dasyatidae) and only for the Neotrygon kuhlii species complex. n, number of sequences; π, nucleotide and h, haplotype diversities; PI, proportion of parsimony informative sites; g1, distribution skewness of 10,000 random trees

Table 2.2 27 Alignment statistics of the trimmed COI gene fragment of Neotrygon kuhlii clades. n, number of sequences; h, number of haplotypes (in brackets) and haplotypic diversity; π, nucleotide diversity; Fu’s FS; Ramos-Onsins and Roza’s R2 statistics.

Table S2.1 125 Dasyatidae sample information; GenBank accession numbers of COI, 16S and RAG1 sequences and specimen collection information. Details of the COI haplotypes are also given for the specimens of Neotrygon annotata, N. kuhlii and N. ningalooensis.

Table S2.2 128 Kimura 2-Parameter (K2P) corrected Neighbour Joining distance matrix with minimum and maximum values (in brackets) for the Neotrygon kuhlii mitochondrial COI ESUs 1 to 9.

Table S2.3 129 K2P-corrected neighbour-joining distance matrix of Neotrygon species calculated from the COI alignment. Genetic distance is along the lower diagonal and standard error along the upper diagonal.

Table S2.4 130 Mean divergence times and their 95% HPD confidence intervals based on fossil calibrations and published COI mutation rates (0.58% / My and 0.9% / My) calculated in the spotted eagle ray (A. narinari) from the isthmus of panama closure for nodes 1 to 10.

Table 3.1 45 K2P-corrected genetic divergences (%) calculated across taxonomic levels from 333 sequences representing 65 OTUs.

Table 3.2 45 Species with >1% average K2P divergence. Divergent lineages are indicated by region.

Table 3.3 45 Comparison of pairwise intraspecific divergences of species in and between East and West coasts of Australia seaparated by >2,500 km.

Table S3.1 139 Collection location and sequence accession numbers for flathead samples.

xvii

Table S3.2 152 Percent K2P distance matrix of Platycephalus indicus lineages. Three congenerics P. cultellatus, P. fuscus and P. westraliae are included for comparison.

Table 4.1 63 Descriptive statistics for COI, 16S, ENC1, concatenated mitochondrial and concatenated mitochondrial and nuclear alignments giving n, number of sequences; alignment length in base pairs (bp); model of sequence evolution; PI, number of parsimony informative sites and g1, skewness of tree distributions.

Table 4.2 69 COI haplotype details for the Platycephalus indicus species complex showing n, number of sequences, number of haplotypes and corresponding haplotype labels.

Table S4.1 153 Collection location and GenBank sequence accession numbers for flathead samples.

Table S4.2 161 Character matrix of minimum and maximum depth ranges, hard or soft substrate type, bathome (E: estuarine, C: coastal, SH: shelf, SL: slope) and lateral line scale (LLS) counts.

Table 5.1 86 PCR primer details and annealing temperatures.

Table 5.2 89 Descriptive statistics for COI, 16S, RAG2, Tmo4c4, concatenated mitochondrial, concatenated nuclear and concatenated mitochondrial and nuclear alignments giving n, number of sequences; alignment length in base pairs (bp); model of sequence evolution; PI, number of parsimony informative sites and g1, skewness of tree distributions.

Table S5.1 163 Details of hypsigeyini samples including sample identification, voucher number, sequenced COI, 16S, RAG2 and Tmo4c4 markers and specimen collection location. GenBank sequence accession numbers are given for published sequences only.

xviii CHAPTER 1

“Nothing in biology makes sense unless in the light of evolution” Theodosius Dobzhansky (1973)

1 CHAPTER 1

1.1 INTRODUCTION

Identifying evolutionary mechanisms responsible for population diversification and speciation is central to understanding and preserving marine biodiversity. Species (sensu Mayr 1958) tend to make up the formal currency in biodiversity estimates (e.g. Scheffers et al. 2012), providing the basis for exploring patterns of diversity across space and time, and a framework in which to investigate the underlying evolutionary forces that pump diversity into existence. Given that the current rate of biodiversity loss has escalated to such an alarming scale (Barnosky et al. 2011), focus on understanding the primary drivers of species diversity is now vital. The present thesis makes use of molecular phylogenetic and phylogeographic tools to establish evolutionary relationships across three disparate groups of fishes. The fundamental aim is to understand the circumstances driving observed diversity and distribution patterns in these groups to further our capacity to explain the formation and spread of marine taxa distributed across the Indo-West Pacific (IWP) region.

1.1.1 Description of the study area

At the centre of the IWP lies the Indo-Australian Archipelago (IAA), host to the largest concentration of marine species in the world (Briggs 2003). This region has been shaped by a rich past of both climatic and geological processes, with its tectonic history giving rise to the highest proportion of tropical shelf area on earth (Figure 1.1). Theories surrounding the existence of high tropical diversity such as latitudinal diversity gradients (LDGs), a phenomenon that exists the world over (Mittelbach et al. 2007, with some exceptions e.g. Rivadeneira et al. 2011), are undoubtedly relevant to the diversity of the tropical IAA. However, species diversity decreases in both latitudinal and longitudinal gradients from this centre suggesting this region has unique mechanisms at play granting it its biodiversity success.

2 CHAPTER 1

40°

30° Japan Persian Gulf Red Sea Taiwan Tropic of Cancer 20° Hong Kong Philippines South 10° Andaman China Sea Gulf of Sea Paci c Ocean Thailand

Celebes Sea 0° New Guinea

Makassar Strait Banda Java Sea Sea Sunda Indonesia Torres Strait 10° Arc

Gulf of Carpentaria Tropic of Capricorn 20° Australia

30° Indian Ocean

40° Bass Strait

50° 30° 40° 50° 60° 70° 80° 90° 100° 110° 120° 130° 140° 150° 160° 170° 180° Figure 1.1 Map of Indo-West Pacific region highlighting the tropical Indo-Australian Archipelago

1.1.2 Current theories

The mechanisms responsible for the unparalleled level of biodiversity across this region remain one of the greatest enigmas in biogeography. Debate over the origins of this phenomenon has resulted in an array of hypotheses that seek to explain its existence. These fall under three broad theories; the Theory of Accumulation, the Centre of Overlap Theory, and the Centre of Origin Theory. The Theory of Accumulation (originally proposed by Ladd 1960) draws on the tectonic setting of the region, dominated by four major converging lithospheric plates; the Eurasian, Indo-Australian, Pacific and Philippine Plates, responsible for the characteristic volcanism and tectonic instability of the area. Converging plates as well as the inward flowing currents are presumed to have acted like conveyor belts, spilling their respective biota into the area from the surrounding regions. Similarly, the Centre of Overlap Theory (Woodland 1983) also relates to the greater regional influences on the archipelago with the Indian and Pacific Oceans converging along this relatively narrow tropical band, producing high levels of biodiversity by the amalgamation of biota from the two oceanic regions. The third theory is the Centre of Origin Theory (Ekman 1953), a common concept used in biogeography, that suggests species evolve or originate in this highly diverse area and migrate outwards, as indicated by the steady decline in diversity radiating from this centre.

3 CHAPTER 1

1.1.3 Evolutionary patterns & their interpretation

None of the proposed hypotheses are necessarily mutually exclusive. Differing support for these theories may reflect the varying response of different taxa to the multitude of evolutionary processes at play in the marine realm here; either working in concert or at separate times through evolutionary history. Varied evolutionary response to shared history may best be illustrated by comparisons of within species phylogeographic patterns across the central Indonesian Archipelago. Few species show congruent patterns, even when closely related (Crandall et al. 2008; Lourie et al. 2005), probably due to differences in dispersal potential, habitat availability and ecological plasticity prompting different responses to historical Pleistocene sea level lows and contemporary currents (Carpenter et al. 2011; Timm et al. 2008). Irrespective of contrasting patterns, collectively, the incredible diversifications across species within the region support a centre of origin theory, highlighting the many and varied ways speciation may be taking place here. Similar processes may have been playing out over long stretches of evolutionary time, with mirrored patterns at higher taxonomic levels (Mora et al. 2003; Reake et al. 2008; Vallejo 2005; Williams 2007; Williams & Duda 2008). However, a centre of origin theory does not find unanimous support as opposing patterns are observed that support alternative theories (Frey & Vermeij 2008; Hubert et al. 2012; Santini & Winterbottom 2002). Additional examples are also emerging with patterns that are too convoluted to champion any single theory (Barber & Bellwood 2005; Halas & Winterbottom 2009; Read et al. 2006). When moving further and further back through evolutionary time, it becomes increasingly harder to account for the influence of extinction and range shifts, factors that can completely obscure evolutionary history (e.g. Erwin 2008). Therefore, multiple comparative studies offer a means to better understand the primary evolutionary processes creating diversity patterns and their role at different times through history. Although this IAA diversity hotspot is currently unparalleled in its magnitude, it may not be historically unprecedented as successive marine diversity hotspots appear to have occurred since the Eocene (Renema et al. 2008). These have centred on regions of converging tectonic plates suggesting mechanisms relating to tectonic activity are, at least in part, responsible for the diversity here.

1.1.4 Geological history

Prior to the tectonic evolution of the IAA region and formation of the IWP, the large, ancient Tethys Sea reigned across this region. This sea lay between the Gondwanan and Laurasian supercontinents (Figure 1.2) until a successive series of fragmentation and continental rifting events along the northern Gondwanan margin spelled the end of the Tethys Sea and gave rise to the Indian Ocean (Seton et al. 2012). Before this break up of Gondwana,

4 CHAPTER 1 the Australian-Antarctic shield dominated the southern high latitudes. A continental sliver from the Kimberley region peeled off during the Jurassic and arched back to the Eastern edge of Australia through sea floor spreading, forming many of the structural features of the New Guinea basement (van Oosterzee 1997). India then broke free from Gondwana to speed north towards the Eurasian continent effectively opening the Indian Ocean in its wake and banishing the Tethys sea to subduct beneath Eurasia (Gurnis et al. 2012). Parts of Sumatra got caught up in the Indian slip stream and were cemented into south-east Asia during this process (van Oosterzee 1997). At the time, Sundaland already extended into the low latitudes, separated from Eurasia by a wide proto-South China Sea (Hall 2001). Accretion of Gondwanan fragments, making up parts of Borneo, Java and Sulawesi, was complete by the mid-Cretaceous (Hall et al. 2011). Subsequently, the region remained relatively dormant, until sedimentation began again in response to Eocene subduction, initiated by the northward migration of the Australian continent.

Late Jurassic Late Cretaceous 152 Ma 94 Ma

PACIFIC TETHYS OCEAN OCEAN

K/T Boundary Middle Eocene 66 Ma 50.2 Ma

PACIFIC PACIFIC OCEAN OCEAN

INDIAN OCEAN

Ancient Modern Subduction landmass landmass Zone

Figure 1.2 Paleogeographic maps showing tectonic evolution of the IWP region from the Late Jurassic to the Middle Miocene (Scotese 2001).

Through the Cretaceous, Australia began to divorce slowly from Antarctica (Hall 2002), first peeling along the south-western margin, opening up a shallow basin that was flooded by warm waters from the north, allowing influx of shallow water species into this new habitat (Wilson & Allen 1987). The east and west coasts were not joined until Australia finally separated from Antarctica ~45 Ma (Figure 1.3) and began to migrate north at a much more rapid rate (Hall 2002). The Eocene climate, at this time, was warm with high latitude

5 CHAPTER 1 waters measuring a tepid ~20oC (Liu et al. 2009) and sea level sitting ~200 m higher than at present day (Figure 1.4). Separation of Australia from Antarctica initiated formation of the circum-polar current, promoting a shift in ocean circulation and tipping the climate from a hothouse to an icehouse (Liu et al. 2009), dropping global sea level and locking Antarctica into frozen isolation. In concert with the separation of Australia and the dramatic shift in climate at the Eocene-Oligocene boundary, the cold psychrospheric deep waters (100-700 m depths at temperatures of ~10oC, (McKenzie 1991) formed. An incipient Leeuwin Current also has its origins in these early changes with the counter gyral circulation in the Indian Ocean being deflected down the west Australian coast (McGowran et al. 1997). On the east Australian coast, a proto-Antarctic Circumpolar Current deflected the East Australian Current (EAC) northwards, flushing the south-eastern coast of Australia with cool waters (Huber et al. 2004). As Australia rapidly migrated north, subduction along the Sundaland margin resumed. Collision of the Australian continent, particularly at the onset of the Miocene, formed many of the modern structural features: initiating the clockwise rotation of the Philippine Sea Plate, extrusion of the Sundaland block and the characteristic surface deformation and volcanic activity evident across the region (Hall 2002; Hall et al. 2011). The mosaic of island groups that now exist as a result of this complex tectonic history are host to a wealth of habitats including coral reef, mangrove, seagrass bed and tropical estuarine environments which, no doubt, facilitate the existence of high biodiversity by reducing the possibility of competitive exclusion (Carpenter 1998). Deep trenches separate many of these island masses with three main outflow passages forming the remaining connections between the Indian and Pacific Oceans; the Lombok Strait, Ombai Strait and Timor Passage, that transport an average of 15 million cubic meters / second of Pacific waters into the Indian Ocean (Sprintall et al. 2009). These now fuel the Leeuwin current, flushing warm waters into higher latitudes down the west Australian coast. This and the East Australian Current (EAC), flowing down the east Australian coast, are thought to be instrumental in flattening out the latitudinal diversity gradients that are much more evident in other parts of the world, not favoured by similar warm water currents (Valentine & Jablonski 2010).

6 CHAPTER 1

55 Ma 50 Ma 45 Ma

40 Ma 35 Ma 30 Ma

25 Ma 20 Ma 15 Ma

10 Ma 5 Ma Present

Figure 1.3 Paleogeographic maps showing tectonic evolution of the IWP region from the Late Jurassic to the Middle Miocene (Hall 2002).

7 CHAPTER 1

SEA-LEVEL EPOCH AGE CHANGE (Meters above PD) EON ERA Ma PERIOD 0 200 100 0 -100m IONIAN CALABRIAN 0.78 PLEISTOCENE 1.81 GELASIAN 2.59 PLIOCENE PIACENZIAN 3.60 ZANCLEAN 5.33 E MESSINIAN 7.25 N Present Day 10 E TORTONIAN Sea-Level 11.61 G SERRAVALLIAN MIOCENE 13.82 O LANGHIAN 15.97 E

N BURDIGALIAN 20 20.43 AQUITANIAN Long-term 23.03 Trend C CHATTIAN OLIGOCENE 28.4 30 Short-term

OZOI RUPELIAN Trend

N 33.9 E

E PRIABONIAN 37.2 C N

E BARTONIAN 40 40.4 G O LUTETIAN E EOCENE L 48.6 50 A P YPRESIAN

55.8 C THANETIAN 58.7 60 SELANDIAN PALEOCENE 61.1 OZOI DANIAN R 65.5 E MAASTRICHTIAN 70 70.6 HAN P CAMPANIAN

80 UPPER CRETACEOUS 83.5 SANTONIAN 85.8 CONIACIAN 88.6 90 TURONIAN 93.6 S

U CENOMANIAN C 99.6 100 EO C A

T ALBIAN ESOZOI E R 110 M 112.0 C

APTIAN 120 LOWER CRETACEOUS 125.0 BARREMIAN 130 130.0 HAUTERIVIAN 133.9

VALANGINIAN 140 140.2

BERRIASIAN 200 100 0 -100m 145.5

Figure 1.4 Compilation of Phanerozoic sea-level changes compiled from Haq & Al-Qahtani (2005) and Hardenbol et al. (1998) and adapted from Snedden & Liu (2010).

1.1.5 The model systems

The established taxonomic status of fishes eclipses that of any other group in the marine environment, particularly for shallow water taxa (Eschmeyer et al. 2010), making them attractive model groups for investigating evolutionary processes responsible for species diversification. The target groups are shelf demersals, with a high proportion of narrow- ranging endemics; characteristics thought to be favourable in retaining the imprint of their evolutionary history.

8 CHAPTER 1

1.1.5.1 The maskrays

The Neotrygon maskrays (Dasyatidae) are distinguishable by a dark mask-like band over their eyes (Last & Stevens 2009). Confusion around their taxonomy has been ongoing with all species once considered to be colour variants of a single, widespread species, the Blue Spotted Maskray (Neotrygon kuhlii), originally ascribed to the genus Dasyatis (Compagno & Heemstra 1984). Subsequent taxonomic revision identified a number of these colour variants as separate species and designated the group to generic level (Last & White 2008; Last et al. 2010) resulting in the recognition of five Neotrygon species. These comprise four narrow ranging endemics confined to coastal regions of northern Australia and Indonesia and one wide ranging species occupying tropical and warm temperate regions across the entire IWP. These rays inhabit sandy environments of shallow coastal and inner continental shelf waters <200 m (mostly <90 m) (Last & Stevens 2009). Females produce up to three pups annually, reaching sexual maturity anywhere from three to six years (Jacobsen & Bennett 2010). Many of the maskray species are impacted by commercial fishing; either directly targeted (Ali et al. 2004; White & Dharmadi 2007) or caught as bycatch (Stobutzki et al. 2002). Their small size (maximum Disc Width observed in N. kuhlii, the largest species, is 471 mm, White & Dharmadi 2007) means that measures to reduce this bycatch, such as Turtle Exclusion Devices are ineffective (Stobutzki et al. 2002). Recent observations of yet more colour (White & Dharmadi 2007) and genetic (Ward et al. 2008) variants within nominal species questions the established taxonomic status of these species, suggesting that possible reproductive discontinuities may make them more vulnerable to current impacts than presently thought.

1.1.5.2 The flathead fishes

The flathead fishes (Platycephalidae) have diversified across temperate and tropical continental shelves and upper slopes of the Indo-Pacific, with the exception of only one species, Solitas gruveli, found off the west coast of Africa. There has been a longstanding interest in reconstructing relationships in this group, pre-dating cladistics (Hennig 1966; Matsubara & Ochiai 1955), with early studies limited in either sample numbers (Matsubara & Ochiai 1955) or character choice (Hughes 1985). Despite more robust attempts using larger morphological and molecular based datasets (Keenan 1988 1991, Imamura 1996) consensus is yet to be reached. However, two subfamilies are currently recognised: platycephalins and onigociins, which are primarily associated with temperate and tropical regions respectively. Australia boasts a high proportion of platycephalin endemics. Many of these are prized for their quality flesh with a long history of commercial interest in the group commencing with the first trawling operations in Australia in 1915 (Fairbridge 1950). Despite this long history

9 CHAPTER 1 of interest, confusion surrounding their taxonomy has persisted through to recent times. Of the 146 species names and 32 genera proposed since the first flathead, Platycephalus indicus, was described by Linnaeus in 1978, only 77 species and 18 genera are currently valid (Eschmeyer & Fong 2012). However, several new flathead species have been recognised in recent years (e.g. Imamura 2010; Imamura & Gomon 2010; Imamura & Knapp 2009a, b) with evidence of additional cryptic species (Zemlak et al. 2009) suggesting the species boundaries within this group are yet to be resolved.

1.1.5.3 The tuskfishes

The tuskfishes (Choerodon) are a group of wrasses from the family Labridae. They inhabit tropical and warm temperate, reef and non-reef environments across the IWP with their centre of diversity coinciding with the IAA. The origins of this group date to the mid- Miocene (Alfaro et al. 2009; Cowman et al. 2009), suggesting their evolutionary history is linked to the geo-climatic profile of the IAA. The range extent of species in this group varies considerably with some wide-ranging species occupying large expanses of the IWP while other narrow-ranging endemics are confined, usually to peripheral regions either in Australian coastal waters or the north-west Pacific with a few species also observed only in the Philippines. Patterns across reef associated fishes suggest these observations may be linked to processes acting on whole suites of species as the central populations tend to occupy large expanses with endemics confined to peripheral regions in many other fishes (Allen 2008). This pattern is indicative of centrifugal speciation, the formation of peripheral endemics isolated in refugia during the contraction phase of widespread species (Brown 1957), and has been proposed as a key player in the evolution of diversity in this region (Briggs 2000).

1.1.6 Phylogenetics & phylogeography

Comparative phylogenetics and phylogeography are among the more powerful tools available for investigating evolutionary drivers. Phylogenetics, derived from the terms ‘phylon’ meaning ‘clan’, ‘tribe’ or ‘race’ and genetikos, meaning ‘origin’, is concerned with the evolutionary relationships of lineages, while phylogeography is concerned with the processes governing the geographical distributions of these lineages (Avise 2009). Together, these act as a thread to unravelling the evolutionary history of species not only by providing a blueprint of species relationships in their spatial context, but also by offering a means to backdate the time since evolutionary separation through the use of a molecular clock (Kumar 2005). The molecular clock is based on the idea that the amount of DNA sequence variation between two species is a function of the time since evolutionary separation. However, an important feature of the molecular evolutionary clock is multiplicity;

10 CHAPTER 1 in that there exists thousands of gene regions in an organism, each with an independent clock ticking at different rates, but all measuring the same events (Rodríguez-Trelles et al. 2004). Not surprisingly, marker selection is a fundamental component to phylogenetic accuracy with some findings suggesting its influence can outcompete the importance of taxonomic sampling (Rokas & Carroll 2005). Many early studies focused solely on mitochondrial markers due to their non-recombination, small effective population size, fast mutation rate and relative ease in amplification (Ballard & Whitlock 2004). However, despite their excellent ability to often distinguish between and resolve closely related species, they represent a single genome, and are prone to homoplasy (Galtier et al. 2006), particularly at deeper phylogenetic levels. Therefore, the importance of additional nuclear markers cannot be underestimated.

1.1.7 Thesis Summary

The following thesis employs both mitochondrial and nuclear markers to reconstruct phylogenetic relationships in the target groups. The markers chosen were able to amplify consistently across species, distinguish closely related species and exhibit strong phylogenetic signal. In Chapter 2: the evolutionary history of the maskrays is investigated through phylogenetic and phylogeographic methods to gain an understanding of the environmental drivers responsible for splitting lineages within the IAA centre of diversity and the greater tropical IWP. In Chapter 3: DNA barcoding is employed to assess species boundaries in the flathead fishes across the IWP. This is the most established and broadly applied method among the molecular tools available for aiding species identification (Hebert et al. 2003), particularly in fishes (Ward et al. 2009).

In Chapter 4: a comparative phylogenetic and phylogeographic approach is applied to analyse the evolutionary processes acting on sister groups in the flathead family; Platycephalinae and Onigociinae. Their unique distributions, with high proportions of endemics across latitudes, afford an opportunity to not only investigate evolutionary processes creating speciation across the region, but also insight into the role latitudinal diversity gradients may play. In Chapter 5: phylogenetic and phylogeographic relationships between widespread and narrow-ranging tuskfishes are determined to assess the role centrifugal speciation may have played on the diversification of this group across the tropical IWP.

11 CHAPTER 2

“And just as the final aim of taxonomic research is not the graduated scale per se but the unraveling of the historical (phylogenetic) relationships between the taxonomic categories and thus the history of the animal kingdom, in the same way the final aim of zoogeography is not the graduated regional system in itself but the history which this system reflects, that is the history of the faunas.” Sven Ekman (1953)

12

This chapter has been removed for copyright or proprietary reasons.

Chapter 2

Phylogeography of the Indo-West Pacific maskrays (Dasyatidae, Neotrygon): a complex example of chondrichthyan radiation in the Cenozoic.

Published in:

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3586632/

Puckridge M, Last PR, White WT, Andreakis N (2013) Phylogeography of the Indo-West Pacific maskrays (Dasyatidae, Neotrygon): a complex example of chondrichthyan radiation in the Cenozoic. Ecology and Evolution 3, 217-232.

doi: 10.1002/ece3.448

This chapter has been removed for copyright or proprietary reasons.

Chapter 3

Cryptic diversity in flathead fishes (Scorpaeniformes: Platycephalidae) across the Indo-West Pacific uncovered by DNA barcoding.

Published in:

http://www.ncbi.nlm.nih.gov/pubmed/23006488

Puckridge M, Andreakis N, Appleyard SA, Ward RD (2013) Cryptic diversity in flathead fishes (Scorpaeniformes: Platycephalidae) across the Indo-West Pacific uncovered by DNA barcoding. Molecular Ecology Resources 13, 32-42.

doi: 10.1111/1755-0998.12022 CHAPTER 4

‘‘The nearer we approach the tropics, the greater the increase in the variety of structure, grace of form, and mixture of colors, as also in perpetual youth and vigor of organic life.’’ Alexander von Humboldt (1807)

54 CHAPTER 4

Contrasting latitudinal diversity gradients in the Indo- West Pacific: Phylogeography of the flathead fishes (Platycephalidae)

55 CHAPTER 4

4.1 ABSTRACT

Latitudinal Diversity Gradients (LDGs) represent a well-established model for explaining species diversity and distribution in the Indo-West Pacific (IWP). Mechanisms and timing of speciation in flathead fishes endemic to tropical and temperate zones of the IWP are explored to understand the influence of LDGs on the evolution of this group. Nuclear and mitochondrial phylogenies were inferred from multiple specimens of Platycephalidae from 44 out of 77 nominal species representing 17 of the 18 currently recognized genera as well as 16 additional cryptic OTUs. A relaxed molecular clock approach was applied to estimate the main climatic and geological events responsible for diversification in flathead fishes. Subfamilies Onigociinae and Platycephalinae diverged in the Eocene into predominately tropical and temperate assemblages of species. Onigociins appear to have remained in the tropics and diversified across the region since the early Miocene. Platycephalins remained isolated in the temperate regions with only a few derived taxa successfully infiltrating the tropics throughout the Miocene. The subsequent introduction of platycephalins from the Australian continent into the tropical IWP was likely facilitated by tectonic rafting and subsequent dispersal throughout the shallow-water environments, which formed along the collision interface of the Australian and Eurasian Plates. An ‘out of the deep south’ evolutionary trajectory in contrast to the ‘out of the tropics’ LDG paradigm is apparent across Platycephalinae while centrifugal speciation appears to be shaping diversity in both subfamilies across tropical regions. In this context, molecular phylogenies coupled with molecular clock approximations, can be powerful tools for exploring the influence of palaeo- climatic changes and geological episodes responsible for the distribution of species in tropical and temperate regions. Given the commercial importance of flatheads and the taxonomic instability within this family, these results have considerable implications for future management and conservation strategies and provide a comprehensive framework for exploring evolutionary processes in these fishes.

56 CHAPTER 4

4.2 INTRODUCTION

Latitudinal diversity gradients (LDGs), the progressive increase of species richness from polar regions towards the equator, have been well documented in marine and terrestrial environments and remain one of the major enigmas in biogeography and macroevolution (Hillebrand 2004; Kraft et al. 2011; Smith et al. 2012; Willig et al. 2003) however, some notable exceptions to this trend exist (Kindlmann et al. 2007; Rivadeneira et al. 2011). An array of ecological, historical and evolutionary hypotheses, have been employed to explain the LDG phenomenon (reviewed in Mittelbach et al. 2007 and references therein). For example, ‘age’ and ‘area’ related hypotheses postulate that the longer history and larger geographical dimensions of the tropics facilitate greater opportunities for diversification than their temperate and boreal counterparts (Kraft et al. 2011). Additional theories consider latitudinal differences in temperature oscillations, habitat heterogeneity and impacts of glacial cycles on diversification rates through variations in population fragmentation and geographical isolation (France 1992; Gaston 2000; Stevens 1989). A recent synthesised model, known as the Tropical Niche Conservatism hypothesis (TNC), draws on some of the most ubiquitous LDG patterns and endorsed theories: a) that the vast majority of clades with high tropical species richness originated in the tropics, b) the greater geographical extent and age of the tropics has allowed greater instances of diversification possible, and c) species dispersal into temperate regions is limited as the evolution of adaptation mechanisms to temperate environments is uncommon (Pianka 1966; Smith et al. 2012; Wiens & Donoghue 2004). Diversity patterns across marine groups have likely been shaped by a combination of latitudinal differences in species survival optima and multiple environmental factors, either acting together or at separate geological periods (Floeter et al. 2004; Lappalainen & Soininen 2006; Roy et al. 2000; Smith et al. 2012; Wiens & Donoghue 2004). Large-scale biogeographical patterns, inferred from widely distributed taxa in the Indo-West Pacific region (IWP), often reveal patterns of intense species diversification associated with two main geological periods. The more recent is consistent with episodes of vicariance, dispersal and secondary contact in response to glacio-eustatic sea level oscillations during the Pleistocene, e.g. anemone and butterfly fishes (McMillan & Palumbi 1995); mantis shrimp (Barber et al. 2006; Barber et al. 2002); sea stars (Crandall et al. 2008); parrotfishes (Fitzpatrick et al. 2011). An earlier series of inter- and intraspecific diversification events throughout the Miocene, suggests that intensive tropical diversification in this region was initiated by the collision between the Australian and Eurasian tectonic plates, e.g. fishes (Read et al. 2006); gastropods (Williams & Duda 2008); squat lobsters (Poore & Andreakis 2011).

57 CHAPTER 4

The flathead fishes (Platycephalidae) are demersal, generalist and ambush predators, found in coastal environments from estuaries to the upper continental slope. The family is almost entirely endemic to the IWP with a few exceptions such as the Guinea flathead Solitas gruveli, found off the west coast of Africa, and three Lessepsian introductions to the Mediterranean Sea - Elates ransonnettii (Steindachner), Platycephalus indicus and Sorsogona prionota; (Golani 1998). Despite the lack of consensus in previous studies (e.g. Imamura 1996; Keenan 1988, 1991; Matsubara & Ochiai 1955), recent phylogenetic reconstructions have established two subfamilies in the group: the Onigociinae, consisting of species predominantly associated with low-latitude tropical regions and the Platycephalinae, comprising taxa found mainly in high-latitude temperate regions (Imamura 1996). Furthermore, platycephalid species richness appears to be largely underestimated, as suggested by a substantial number of cryptic lineages that likely exist across the tropics (Puckridge et al. 2013a). Mitochondrial and nuclear phylogenies coupled with molecular clock approximations are used to reconstruct the evolutionary and geological events responsible for shaping biotic diversity trends in flathead fishes of the IWP. Key aims of this study are to a) establish the mechanisms responsible for the presence of flatheads in high-latitude regions of the Australian continent and, b) identify the processes responsible for flathead diversification across both the temperate and tropical regions of the IWP. The inferred phylogenies are further discussed in the light of taxonomic uncertainties and ambiguous evolutionary patterns related to the history of the group.

58 CHAPTER 4

4.3 METHODS

4.3.1 Sample collection

Specimens were obtained from direct sampling, and contributions from colleagues and fish collections. Tissue was either frozen at -20°C or preserved using 20% DMSO saturated with NaCl or 95% EtOH. Undescribed species, provisionally identified by Knapp (unpublished key to the Australian species) as Onigocia sp. C, were incorporated as well as additional operational taxonomic units (OTUs) identified in Puckridge et al. (2013a).

4.3.2 DNA extraction, PCR amplification, sequencing & alignments

Genomic DNA was isolated from ~150 mg tissue using protocols of either Aljanabi & Martinez (1997) or Doyle & Doyle (1987). The partial ribosomal 16S rDNA gene fragment was PCR amplified using primers described in Palumbi et al. (1996); a fragment of the putatively single-copy nuclear ectodermal-neural cortex I-like protein (ENCI) was amplified in a nested PCR using primers described in Li et al. (2007). PCR reaction conditions followed Puckridge et al., (2013b). Higher levels of intraspecific variation expected in mitochondrial regions were captured by sequencing up to three individuals per OTU. PCR products were purified with Agencourt CleanSEQ® magnetic beads (Beckman Coulter, Australia) according to the manufacturer’s protocol prior to sequencing on an ABI Prism 3100 Genetic Analyser (Applied Biosystems, USA). Sequencing reactions were performed in 20 µl solutions containing 1 µl of purified PCR product (at 5 – 20 ng concentration), 1.0 µl of 10 pM forward or reverse primer, 3.5 µl of 5× Sequencing Buffer and 1.0 µl of BigDye® Terminator v.1.1/v3.1 ready reaction mix (Applied Biosystems, USA) and 13.5 µl of filtered MilliQ H2O. Solutions were heated to an initial temperature of 95oC for 10 min followed by 35 cycles of 94oC denaturation for 30 s, their respective PCR annealing temperature for 5 s, and an extension at 60oC for 4 min. Annealing temperatures for COI, 16S and ENC1 were 54oC, 50oC and 53oC respectively. Electropherograms were edited manually using BioEdit v7.0.5 (Hall 1999). Additional sequences of the mitochondrial partial cytochrome oxidase subunit I (COI) gene (Puckridge et al. 2013a) were recovered from the Barcode of Life database (BOLD; www.boldsystems.org) and NCBI (www.ncbi.nlm.nih.gov; see Table S4.1 for sequence accession numbers); sequence alignments for the COI, 16S and ENC1 datasets were performed in MUSCLE (www.ebi.ac.uk/Tools/msa/muscle; Edgar 2004) and checked by eye in BioEdit. As molecular information from multiple loci and distinct genomes is expected to

59 CHAPTER 4 offer both superior statistical support for inferred genealogical relationships and a more comprehensive overview of the data, concatenated COI/16S and COI/16S/ENC1 alignments were prepared. Prior to this, congruence among datasets was confirmed with the partition homogeneity test in PAUP* 4.0b10 (Swofford 2003) based on 100 permutations with invariant sites and replicate sequences removed.

4.3.3 Outgroup comparisons

Outgroups for comparisons were selected on the basis of the phylogenetic hypothesis proposed by Imamura (1996) to include representatives from the families Bembridae (Bembras megacephala), Hoplichthyidae (Hoplichthys citrinis) and Parabembridae (Parabembras robinsoni). As conflicting theories on the phylogeny of the suborder Scorpaenoidei exist (Nelson 2006), the sensitivity of the recovered topologies to alternative outgroups was additionally assessed against the family Sebastidae (Helicolenus dactylopterus and Sebastes ruberrimus) according to Imamura (2004). Since the phylogenetic relationships were always maintained independently of the outgroup, with the exception of Elates (discussed later; data not shown), all analyses requiring outgroups for comparisons were performed against those proposed by Imamura (1996).

4.3.4 Data exploration & model selection

Hierarchical likelihood ratio tests (hLRTs) were computed in Modeltest version 3.7 (Posada & Crandall 1998) to identify the best evolutionary model and parameters (gamma distribution, proportion of invariant sites, transition-transversion ratio) given the alignment. The amount of phylogenetic signal within the data was assessed with the g1 statistic, a measure of the skewness of tree-length distributions from a subsample of 10,000 random maximum parsimony trees (Hillis & Huelsenbeck 1992) in PAUP* 4.0b10. Since this method produces false positives (it is prone to highlighting phylogenetic signal when two closely related sequences exist in a dataset that may otherwise be saturated with noise), substitution saturation was also investigated at each codon position in DAMBE (Xia & Xie 2001) against the most appropriate model of evolution.

4.3.5 Phylogenetic analyses & network reconstruction

Maximum likelihood (ML) analyses were computed in PAUP* 4.0b10 and Bayesian Inferences (BI) in MrBayes v3.1 (Ronquist & Huelsenbeck 2003). A heuristic search option was employed for ML computations. ML analyses were computed against the best fitting model identified by Modeltest given the data. Internal node support was estimated using

60 CHAPTER 4

2,000 bootstrap pseudo-replicates with the same model parameters used for estimating tree topologies and a neighbour-joining (NJ) search option. For BI, priors were set for individual gene partitions according to the Modeltest results. Two parallel Markov Chain Monte Carlo (MCMC) runs of four chains were sampled every 1,000 generations until convergence was reached. An average standard deviation of split level frequencies <0.01 was used to define convergence. Convergence was further confirmed in Tracer and 25% of each sample run was discarded as burn-in. Median-joining networks are not confined to the conventions of a bifurcating tree and therefore offer a more informative view of geographical relationships (Posada & Crandall 2001). Sequences of the partial COI gene were mined from NCBI and BOLD and median- joining networks were computed in Network v4.5.1.6 (http://www.fluxus-technology.com). The method uses the Median Joining algorithm (ε = 0, equally weighted characters) to collapse identical sequences into haplotypes, and connect them into haplogroups according to their inferred genealogical relationships through a series of median vectors. Biologically, median vectors represent extinct individuals or un-sampled haplotypes (Bandelt et al. 1999). Following network reconstructions, ambiguous relationships were resolved using an MP heuristic algorithm in the same software. Habitat traits (substrate type, minimum and maximum depth ranges and presence in estuarine, coastal, shelf and slope bathomes, CSIRO unpublished data) and one anatomical trait (number of lateral lines scales, compiled from published literature) were scored for each species and mapped on the BI molecular phylogenetic tree (see electronic supplementary Table S4.2 for character matrix); their ancestry and evolution across the phylogeny were evaluated using a maximum parsimony framework in Mesquite v2.75 (Maddison & Maddison 2011). Numbers of lateral line scales were considered for investigative purposes as these are a useful diagnostic character in some genera, and may therefore correspond to phylogenetic relationships.

4.3.6 Molecular clock computations

The oldest known platycephalid fossil dates back to the Priabonian age (Eocene, 33.9-37.2 Ma) from the Palaeo-Mediterranean (Monte Bolca) (Girone & Nolf 2009). This fossil was used to set a minimum age for this group. The utility of additional fossils available for calibration such as flathead otoliths (e.g. Steurbaut 1984) remains equivocal as they offer limited characters to identify relationships with extant species. Furthermore, a whole fossilized flathead from the Miocene has equally conflicting relationships with extant species. The specimen was initially identified as a Neoplatycephalus (Long 1982) suggesting it is most closely related to the P. aurimaculatus, P. conatus and P. richardsoni clade, however a cranial character similar to P. bassensis was later reported (Keenan 1988).

61 CHAPTER 4

Likelihood ratio tests were computed in PAUP* 4.0b10 to test for rate constancy within alignments. A relaxed uncorrelated lognormal molecular clock approach, under a Yule speciation model (Drummond et al. 2006) was implemented in BEAST v1.6.1 (Drummond & Rambaut 2007) to approximate divergence times as a strict molecular clock could not be assumed given the unequal substitution rates observed in the data (P<0.001). Four independent runs of 1 x 106 generations were calculated and combined in the software LogCombiner v1.6.1 (Drummond & Rambaut 2007) after discarding 25% of each run as burn in. Convergence of the runs was visualized in Tracer v1.5 and a maximum clade credibility tree was generated in TreeAnnotator v1.6.1 as part of the BEAST v1.6.1 package.

62 CHAPTER 4

4.4 RESULTS

Sequences were produced from 44 out of 77 nominal species representing 17 of the 18 currently recognized genera as well as 16 additional cryptic OTUs (see Table 4.1 for alignment statistics). No topological differences were observed irrespective of the outgroups used, with the exception of Elates (which is discussed later; data not shown). Substitution saturation was evident in the third codon position of the partial COI gene and was therefore left to evolve independently in the BI analyses in order to reduce its influence on the tree topology. All phylogenetic reconstruction methods produced similar topologies; however the concatenated alignment was consistently more informative than the single-marker or the combined mitochondrial phylogenies (data not shown). Two well supported clades were clearly resolved (Figure 4.1), corresponding to Platycephalinae, characterized by shorter branch lengths and composed solely of two nominal genera (Platycephalus and the monotypic Elates), and Onigociinae which included all other genera.

Table 4.1 Descriptive statistics for COI, 16S, ENC1, concatenated mitochondrial and concatenated mitochondrial and nuclear alignments giving n, number of sequences; alignment length in base pairs (bp); model of sequence evolution; PI, number of parsimony informative sites and g1, skewness of tree distributions.

Length Invariant Gamma Alignment n (bp) Model Sites (I) (α) PI g1

COI 154 651 HKY + I + Γ 1.016 0.5505 285 - 0.303802 16S 132 612 TVM + I + Γ 0.5741 0.4571 253 - 0.281282 ENC1 57 820 TrNef + I + Γ 0.7221 0.6193 116 - 0.305728 Mitochondrial 157 1263 TVM + I + Γ 0.7111 0.5183 538 - 0.241377 Concatenated 157 2083 TVM + I + Γ 0.5911 0.6136 654 - 0.276104

63 CHAPTER 4

1.0/~ A5131 A5135 Rogadius pristiger A5134 1.0/99 A5207 1.0/100 A5224 Rogadius serratus A5137 1.0/~ A5140 Rogadius patriciae A5141 1.0/100 A5741 A5742 Grammoplites scaber A5743 A5059 1.0/93 A5061 Sorsogona tuberculata A5063 1.0/~ 1.0/99 155 2 6 05 155 2 7 05 Cociella heemstrai 1.0/85 155 2 8 05 1.0/99 A5113 A5116 Suggrundus macracanthus A5118 1.0/100 ADC09 155 3 1 Sorsogona portuguesa 1.0/~ ADC08 155 3 1 ADC10 155 7 1 Sorsogona prionota 1.0/100 A3261 A5119 Kumococius rodericensis A5123 A5085 1.0/~ A5086 Onigocia grandisquama 1.0/~ A5095 1.0/82 A5081 0.95/~ A5092 Onigocia sp. C 1.0/93 A5094 A3264 1.0/~ A3265 Onigocia spinosa A3263 1.0/90 A3267 A3269 Onigocia macrocephala A3270 1.0/~ SAIAB 78067 T244 Thysanophrys chiltonae 1.0/~ SAIAB 78067 T245 1.0/~ 1.0/~ A5142 A5143 Thysanophrys chiltonae (Qld) UG0188 Sunagocia arenicola A6142 Sunagocia otaitensis 0.97/~ 1.0/86 M III A2 M Thysanophrys celebica (Africa) A5144 Thysanophrys celebica (Qld) 1.0/100 1.0/100 MFG 308 I 41084 031 Thysanophrys cirronasa 1.0/~ A5088 A5089 Onigocia sibogae A5097 1.0/~ ADC 155 4 1 1.0/95 ADC 155 4 2 Onigocia oligolepis A5238 1.0/~ A5334 UG0444 Onigocia pedimacula 1.0/96 A6113 1.0/~ A6114 Cymbacephalus beauforti 1.0/83 A489 1.0/~ Cymbacephalus staigeri 1.0/95 A490 1.0/100 ADC 155 5 1 ADC08 155 5 2 Papilloculiceps longiceps A2964 Leviprora inops 1.0/~ A9087 A9088 Inegocia cf. japonica (HK) 1.0/~ A5980 A6143 Inegocia cf. japonica (Indo) 1.0/~ A6144 A5103 1.0/88 A5104 Inegocia cf. japonica (Qld) 1.0/~ A5108 0.97/~ A5105 1.0/99 A5106 Inegocia harrisii 0.99/~ 1.0/93 A5111 1.0/95 A5124 A5125 Ambiserrula jugosa 1.0/~ A5905 A6151 Cymbacephalus sp. (cf. nematophthalmus) 1.0/100 A6152 1.0/~ A5101 A5102 Cymbacephalus nematophthalmus A484 1.0/100 A3250 A3252 Ratabulus fulviguttatus A3251 155 6 2 155 6 3 Platycephalus indicus (Africa) 1.0/~ 155 6 7 NPPF1013 1.0/100 NPPF1138 Platycephalus indicus (Persian Gulf) NPPF1044 1.0/~ A5785 1.0/~ A5786 Platycephalus indicus var 1 (Indo) A5970 Platycephalus indicus var 2 (Indo) 1.0/96 A5127 1.0/~ A5128 Platycephalus westraliae A509 A5071 1.0/100 A5073 Platycephalus indicus (Qld) A516 0.98/~ A6194 A6196 Platycephalus cultellatus (Borneo) 1.0/87 A6197 1.0/~ 1.0/100A5758 1.0/~ A6186 Platycephalus cultellatus (Java) Z711061 Z711062 Platycephalus indicus (China) 1.0/~ Z711063 1.0/100 A9089 1.0/~ A9090 Platycephalus indicus (HK) 1.0/~ KOC2 Platycephalus indicus (Japan) FSCS 59 w 1 Platycephalus sp (China) 1.0/97 A511 A512 Platycephalus fuscus A514 A5064 1.0/90 A5147 Elates ransonnettii A5067 1.0/~ A6102 A6103 Platycephalus sp. (cf. endrachtensis) 1.0/100 A6104 A491 A5075 A5076 Platycephalus endrachtensis 1.0/100 B65 A3256 Platycephalus orbitalis 1.0/100 B64 1.0/~ 1.0/100 A536 A537 Platycephalus marmoratus A538 1.0/100 A498 A499 Platycephalus bassensis 1.0/100 A500 1.0/100 B62 B63 A528 Platycephalus longispinis 1.0/100 A541 A542 Platycephalus speculator 1.0/99 1.0/99 A543 1.0/100 A501 0.95/~ A502 Platycephalus caeruleopunctatus A503 A524 1.0/100 A521 Platycephalus laevigatus A525 MFG 731 1.0/~ MFG 732 Platycephalus conatus A474 1.0/85 A479 1.0/~ A482 Platycephalus richardsoni A483 1.0/~ A471 A473 Platycephalus aurimaculatus A5581 1.0/~ Hoplichthys citrinus 1.0/99 154 1 4 154 1 5 Parabembras robinsoni A4200 Bembras megacephala

Figure 4.1 Bayesian phylogenetic hypothesis of Platycephalidae species and genera inferred from the concatenated mitochondrial and nuclear datasets. Node support of 0.95 posterior probability and 70% bootstrap support from the Maximum Likelihood analysis are given. A ~ symbol is substituted for support below these threshold values.

64 CHAPTER 4

4.4.1 Onigociinae

Onigociinae contains ~77% of the currently recognised platycephalid species grouped into 16 of the 18 recognised genera. Although only ~49% of the known onigociin species have been sampled in this study (29 of the 59), all genera except the monotypic Solitas are represented. A Bayesian phylogeny inferred from the concatenated dataset is shown in Figure 4.1. Four main species clusters were recovered with Ratabulus being consistently basal in all phylogenetic reconstructions. Geographical patterns as well as taxonomic inconsistencies were observed in more than one genera. Inegocia (Figures 4.2a,b) was recovered paraphyletic with I. harrisii sister to Ambiserrula jugosa. These two species share adjacent distributions along the northern and eastern coasts of Australia intersecting in the Torres Strait. Three genetically distinct clades, distributed in Australia, Indonesia and Hong Kong, were found within Inegocia japonica. The genus Cymbacephalus was recovered as either monophyletic or polyphyletic in ML and BI analyses respectively. Species C. beauforti and C. stagieri, distributed in Indonesia and northern Australia respectively, form a strongly supported sister relationship (Figure 4.2c). A deep intraspecific divergence was recovered within C. nematophthalmus, which was also distributed allopatrically between northern Australia and Indonesia (Figure 4.2d). Onigocia and Thysanophrys appear to be polyphyletic with two highly divergent clades observed in Onigocia: 1) O. macrolepis, O. spinosa and Knapp's O. sp. C and 2) O. pedimacula, O. oligolepis and O. sibogae.

Onigociinae 40° 0° a b 30° 10° 20° 20° 10° 30° Bayesian Inference 0° Onigociinae 40° Inegocia harrisii 10° Ambiserrula jugosa

Inegocia japonica 110° 120° 130° 140° 150° 160° 20° ( sample location) Inegocia ochiai (unsampled) 30° 80° 90° 100° 110° 120° 130° 140° 150°

Maximum Likelihood

1.7

4.9 8.4

13.2

Figure 4.2 continued over page…

65 CHAPTER 4 Onigociinae 20° 20° c Cymbacephalus d Cymbacephalus beauforti nematophthalmus ( sample location) 10° Cymbacephalus 10° staigeri Cymbacephalus bosschei (unsampled) 0° 0°

10° 10° Bayesian Inference

Onigociinae 20° 20°

30° 30° 100° 110° 120° 130° 140° 150° 160° 100° 110° 120° 130° 140° 150° 160°

Maximum Likelihood

3.4 9.7 Figure 4.2 Phylogeographic relationships of sister groups in Onigociinae clades a) Inegocia japonica and b) I. harisii, Ambiserrula jugosa as well as c) Cymbacephalus beauforti, C. stagier and d) C. nematophthalmus. Approximate divergence times in millions of years are given on nodes and alternative Bayesian Inference and Maximum Likelihood relationships within and between clades are highlighted.

4.4.2 Platycephalinae

Platycephalus is the most speciose platycephalid genus (17 of 19 currently recognised species are included in this study; only P. chauliodous, endemic to temperate Western Australia, and P. micracanthus, endemic to the Red Sea are missing. Platycephalus is paraphyletic due to the position of Elates. Platycephalus aurimaculatus, P. conatus and P. richardsoni occur sympatrically off south-eastern Australia and form a well-supported clade in all analyses (Figure 4.3a). Sister relationships were recovered between allopatric P. marmoratus and P. orbitalis from eastern and western Australia respectively (Figure 4.3b); P. bassensis and P. longispinis, sympatrically distributed across southern Australia (Figure 4.3d), and P. caeruleopunctatus and P. speculator (Figure 4.3e), from eastern and south- western Australia respectively with overlap in Bass Strait. Platycephalus laevigatus, also distributed across southern Australia (Figure 4.3f) was recovered ancestral to the sister species P. caeruleopunctatus/P. speculator and P. bassensis/P. longispinis. The more derived clades in Platycephalinae are associated with tropical regions of northern Australia and the IWP. Platycephalus endrachtensis and P. indicus showed deep intraspecific divergences with the former consisting of two genetically distinct clades distributed in Indonesia and northern Australia (Figure 4.3c), and the latter consisting of eight independent clades found across its IWP distributional range (Figure 4.4a,b,c). These clades are paraphyletic to congeners P. cultellatus, P. fuscus and P. westraliae (Figure 4.4c). This group is subsequently referred to as the P. indicus species complex (see Table 4.2 for haplotype frequencies in this group).

66 CHAPTER 4

0° 0° 0° a b c 10° 10° 10°

20° 20° 20°

30° 30° 30°

40° Platycephalus conatus 40° 40° Platycephalus richardsoni Platycephalus orbitalis Platycephalus aurimaculatus Platycephalus marmoratus Platycephalus endrachtensis ( sample location)

110° 120° 130° 140° 150° 160° 110° 120° 130° 140° 150° 160° 110° 120° 130° 140° 150° 160°

Platycephalinae Platycephalinae Platycephalinae

2.4

4.4 8.2

0° 0° 0° d e f 10° 10° 10°

20° 20° 20°

30° 30° 30°

40° 40° 40° Platycephalus bassensis Platycephalus speculator Platycephalus longispinis Platycephalus caeruleopunctatus Platycephalus laevigatus 110° 120° 130° 140° 150° 160° 110° 120° 130° 140° 150° 160° 110° 120° 130° 140° 150° 160°

Platycephalinae

6.5

6.6

Figure 4.3 Phylogeographic relationships of sister groups in Platycephalinae clades a) Platycephalus conatus, P. richardsoni, P. aurimaculatus b) P. orbitalis, P. marmoratus c) P. endrachtensis d) P. bassensis, P. longispinis e) P. speculator, P. caeruleopunctatus f) P. laevigatus. Approximate divergence times in millions of years are given on nodes. Clade positions within Platycephalinae, based on Bayesian Inference, are highlighted.

67 CHAPTER 4

40° a

30°

20°

10°

0°

10° Platycephalus cultellatus ( sample location) 20° Platycephalus fuscus ( sample location) 30° Platycephalus indicus ( sample location) 40° Platycephalus westraliae ( sample location) 50°

30° 40° 50° 60° 70° 80° 90° 100° 110° 120° 130° 140° 150° 160° 170° 180°

46 b 45 Indian Ocean 47 42 41

48 38 58 43 40 39 38 44 46 57 59 25 42 42

27 30 22

62 60 50 56 61 54 55 49 53

5 51 3 2 1 # of haplotypes 52

Platycephalinae

c

2.6 3.0 3.9 2.7

5.5 7.0 6.8

9.2 8.4

11.1

Figure 4.4 Relationships within the Platycephalus indicus group complex giving a) geographical distributions of Platycephalus cultellatus, P. fuscus, P. indicus and P. westraliae with colour coded sampling locations. These correspond to b) median-joining network relationships of COI haplotypes and c) their phylogenetic relationships. Approximate divergence times in millions of years are given on nodes and position of the clade within Platycephalinae, based on Bayesian Inference is highlighted.

68 CHAPTER 4

Table 4.2 COI haplotype details for the Platycephalus indicus species complex showing n, number of sequences, haplotype number and corresponding haplotype names.

n # of Haplotypes Haplotype name P. indicus - Africa 5 3 57-59 P. indicus - Iran 4 3 60-62 P. indicus - Japan 1 1 43 P. indicus - HK 2 2 45-46 P. indicus - China 1 1 44 P. indicus - var 1 2 1 56 P. indicus - var 2 1 1 55 P. indicus - QLD 8 4 51-54 P. cultellatus 9 5 38-42 P. fuscus 3 2 47-48 P. westraliae 6 2 49-50 Total 42 25 38-62

4.4.3 Genealogical network

A total of 25 haplotypes were recovered across the P. indicus complex; 9 common (>1 individual) and 15 singletons (Figure 4.4b). These formed 11 haplogroups separated by long branches (≥ 29 mutational steps) with smaller variation found within haplogroups (≤ 16 mutational steps). Three haplogroups corresponded to the species P. cultellatus, P. fuscus and P. westraliae while the other eight corresponded to the P. indicus clades previously identified. These P. indicus clades were recovered from allopatric geographical regions, with the exception of two highly divergent clades in Indonesia appearing to co-occur off Java (Hap55 and Hap56 separated by 55 mutational steps).

4.4.4 Molecular clock approximations

Cladogenesis events in the Onigociinae pre-date lineage divergence in the Platycephalinae by ~10 Ma, due to the apparent early diversification of Ratabulus (Figure 4.5). The origins of the four remaining onigociin clades and the platycephalin lineages coincide with the Oligocene/Miocene boundary. Temperate species of the Onigociinae, such as Thysanophrys cirronasa and Leviprora inops, diverged in the mid-Miocene when temperate platycephalins also experienced a series of divergences. East to west separation between Platycephalus marmoratus/P. orbitalis commenced at approximately 8 Ma, followed by an apparent simultaneous split between sister species P. caeruleopunctatus/P. speculator and P. bassensis/P. longispinis at ~6.5 Ma. Cladogenesis within the temperate P. richardsoni, P. conatus and P. aurimaculatus group probably occurred at ~4.4 Ma. Finally, several recurring vicariant events involving tropical platycephalin and onigociin subgroups are evident across the Indo-Australian Archipelago (IAA), either between the Australian continent and Indonesia or centred along Torres Strait. These splits indicate an initial period

69 CHAPTER 4 of diversification at ~8 to 10 Ma, followed by a second round of diversification at ~1.7 to 3.5 Ma, responsible for recent species formation. Similarly, deep divergences within species distributed across the eastern and western Indian Ocean (T. celebica, T. cirronasa, P. indicus) were established at approximately 3.9 - 4.7 Ma.

Rogadius patriciae 7.5 9.0 Rogadius serratus 17.3 Rogadius pristiger Sorsogona tuberculata 19.7 Cociella heemstrai 10.4 17.3 Suggrundus macracanthus 20.9 Kumococius rodericensis Sorsogona portuguesa 8.4 17.8 Sorsogona prionota Grammoplites scaber Thysanophrys chiltonae (Seychelles) 4.4 10.0 Thysanophrys chiltonae (QLD) Sunagocia arenicola 25.6 15.7 6.7 Sunagocia otaitensis 4.7 Thysanophrys celebica (Africa) 16.7 Thysanophrys celebica (QLD) Thysanophrys cirronasa ONIGOCIINAE 19.8 Onigocia grandisquama 7.0 Onigocia sp C 10.8 Onigocia macrocephala 8.1 Onigocia spinosa 24.3 Inegocia cf japonica (QLD) 1.7 4.9 Inegocia cf japonica (Indo) Inegocia japonica (HK) 26.5 13.2 Inegocia harrisii 8.4 21.6 Ambiserrula jugosa Onigocia sibogae 6.1 8.3 Onigocia oligolepis Onigocia pedimacula Cymbacephalus nematophthalmus 3.4 33.6 Cymbacephalus sp (cf nematophthalmus) 16.7 Cymbacephalus staigeri 9.7 19.7 Cymbacephalus beauforti Papilloculiceps longiceps 15.1 Leviprora inops Ratabulus fulviguttatus Platycephalus indicus (China) 0.5 1.1 Platycephalus cultellatus (Borneo) Platycephalus cultellatus (Java) 6.8 Platycephalus indicus (HK) 2.7 8.4 5.5 Platycephalus indicus (Japan) Platycephalus sp (China) Platycephalus fuscus Platycephalus indicus (Africa) 35.5 11.1 2.6 Platycephalus indicus (Iran) 3.9 Platycephalus indicus var 1 (Indo) 3.0 7.0 Platycephalus indicus var 2 (Indo) 16.5 9.2 Platycephalus westraliae P L

A Platycephalus indicus (QLD) T Y

CEPHALINAE Platycephalus endrachtensis 2.4 Platycephalus sp (cf endrachtensis) Platycephalus speculator 18.7 6.6 13.3 Platycephalus caeruleopunctatus Platycephalus laevigatus 36.8 14.4 Platycephalus longispinis 6.5 16.1 Platycephalus bassensis 22.1 Platycephalus marmoratus 17.1 8.2 Platycephalus orbitalis Elates ransonnettii Platycephalus richardsoni 3.3 4.4 Platycephalus conatus Platycephalus aurimaculatus Parabembras robinsoni 21.0 26.4 Bembras megacephala Hoplichthys citrinus 40.0 30.0 20.0 10.0 0.0 Warm Eocene Oligocene Miocene Plio Pleist Outgroup Temperate Temperate Tropical Fossil

Figure 4.5 Molecular clock divergence approximations within Platycephalidae based on fossil calibrations showing median node ages and their 95% highest posterior density (upper and lower) intervals in millions of years before present.

70 CHAPTER 4

Most extant flatheads occupy shallow, inner continental shelf habitats, but the ancestral lineages to both subfamilies occur in deep (shelf and slope) environments (Figure 4.6b). Temperate platycephalins generally occupy deeper environments than their low-latitude counterparts, while onigociin species predominantly straddle coastal and shelf bathomes from between <15 m to 100 m depths. Sister species P. speculator and P. caeruleopunctatus exhibit non-overlapping depth preferences (Figure 4.6a, b, f) while depth ranges for sister species P. bassensis and P. longispinis overlap in coastal and shelf bathomes. There is a correlation between decreased number of lateral line scales (given as an average) with decreasing latitude and depth in the Platycephalin group (Figure 4.6d). Overall, mutation rates within the Onigociinae were slightly higher than for the Platycephalinae (Figure 4.6e). Platycephalin taxa from warmer environments appear to also have generally higher mutation rates.

71 CHAPTER 4

Depth Range (m) Min Depth Max Depth Substrate Type Onigocia sibogae 0 - 15 a b c Onigocia oligolepis Onigocia pedimacula Inegocia japonica (HK) 16 - 40 Inegocia cf japonica (Indo) Inegocia cf japonica (QLD) 41 - 70 Inegocia harrisii Ambiserrula jugosa Onigocia sp C 70 - 100 Onigocia grandisquama Onigocia spinosa Onigocia macrocephala 101 - 119 Thysanophrys chiltonae (Seychelles) Thysanophrys chiltonae (QLD) Sunagocia arenicola 120 - 145 Sunagocia otaitensis Thysanophrys celebica (Africa) Thysanophrys celebica (QLD) Thysanophrys cirronasa 146 - 220 Rogadius patriciae Rogadius serratus Rogadius pristiger >220 Sorsogona tuberculata Cociella heemstrai Unknown Suggrundus macracanthus Kumococius rodericensis Sorsogona portuguesa Sorsogona prionota Grammoplites scaber Cymbacephalus beauforti Cymbacephalus staigeri Cymbacephalus sp (cf nematophthalmus) Cymbacephalus nematophthalmus Substrate Type Papilloculiceps longiceps Leviprora inops Ratabulus fulviguttatus Soft Platycephalus indicus (Africa) Platycephalus indicus (Iran) Platycephalus indicus var 1 (Indo) Hard Platycephalus indicus var 2 (Indo) Platycephalus westraliae Platycephalus indicus (QLD) Unknown Platycephalus indicus (China) Platycephalus cultellatus (Borneo) Platycephalus cultellatus (Java) Platycephalus indicus (HK) Platycephalus indicus (Japan) Platycephalus sp (China) Platycephalus fuscus Platycephalus sp (cf endrachtensis) Lateral Line Platycephalus endrachtensis Platycephalus speculator Scales Platycephalus caeruleopunctatus Platycephalus laevigatus >30 Platycephalus bassensis Platycephalus longispinis Platycephalus orbitalis >40 Platycephalus marmoratus Elates ransonnettii Platycephalus conatus >50 Platycephalus richardsoni Platycephalus aurimaculatus Parabembras robinsoni >60 Bembras megacephala Hoplichthys citrinus >70 >80 Lateral Line Scales Mutation Rate Bathome Onigocia sibogae d e f Onigocia oligolepis Unknown Onigocia pedimacula Inegocia japonica (HK) Inegocia cf japonica (Indo) Inegocia cf japonica (QLD) Inegocia harrisii Ambiserrula jugosa Onigocia sp C Onigocia grandisquama Mutation Rate Onigocia spinosa Onigocia macrocephala Thysanophrys chiltonae (Seychelles) Thysanophrys chiltonae (QLD) Sunagocia arenicola Sunagocia otaitensis Thysanophrys celebica (Africa) Thysanophrys celebica (QLD) Thysanophrys cirronasa Rogadius patriciae Rogadius serratus Rogadius pristiger Sorsogona tuberculata Cociella heemstrai Suggrundus macracanthus Kumococius rodericensis Sorsogona portuguesa Sorsogona prionota Grammoplites scaber Cymbacephalus beauforti Cymbacephalus staigeri Cymbacephalus sp (cf nematophthalmus) Bathome Cymbacephalus nematophthalmus Papilloculiceps longiceps Leviprora inops E,C Ratabulus fulviguttatus Platycephalus indicus (Africa) C Platycephalus indicus (Iran) Platycephalus indicus var 1 (Indo) Platycephalus indicus var 2 (Indo) Platycephalus westraliae E,C,SH Platycephalus indicus (QLD) Platycephalus indicus (China) C,SH Platycephalus cultellatus (Borneo) Platycephalus cultellatus (Java) Platycephalus indicus (HK) Platycephalus indicus (Japan) SH Platycephalus sp (China) Platycephalus fuscus Platycephalus sp (cf endrachtensis) C,SH,SL Platycephalus endrachtensis Platycephalus speculator SH,SL Platycephalus caeruleopunctatus Platycephalus laevigatus Platycephalus bassensis Unknown Platycephalus longispinis Platycephalus orbitalis Platycephalus marmoratus E - Estuarine Elates ransonnettii Platycephalus conatus C - Coastal Platycephalus richardsoni SH - Shelf Platycephalus aurimaculatus Parabembras robinsoni Bembras megacephala SL - Slope Hoplichthys citrinus

Figure 4.6 Relational changes for a) minimum and b) maximum depth ranges; c) hard and soft substrate type; d) average number of lateral line scales; e) Mutation rates and f) occupied bathomes across lineages. Colours and shading across phylogenies relate to character classes indicated in corresponding keys.

72 CHAPTER 4

4.5 DISCUSSION

This study represents the most comprehensive phylogenetic and phylogeographic treatment of the family Platycephalidae given the geographical scale and the number of species analysed. The results provide novel insights into the evolutionary relationships in the group that challenge a number of previous hypotheses proposed for this family. However, these findings agree with the subfamily split suggested by Imamura (1996) and confirm a number of intra-generic relationships proposed by Imamura (1996) and Keenan (1988, 1991).

4.5.1 Latitudinal diversity gradients in temperate & tropic regions

The increased species richness from the poles to the tropics represents one of the most pervasive biodiversity patterns (Allen & Gillooly 2006; Hillebrand 2004; Kraft et al. 2011; Smith et al. 2012; Willig et al. 2003). However, a number of cases where taxonomic groups display a converse relationship to the conventional LDG have been reported (reviewed in Kindlmann et al. 2007; Rivadeneira et al. 2011). The main division of flathead subfamilies, the Platycephalinae and Onigociinae, suggests early and long-term isolation of these two groups followed by distinct genealogical trajectories. Diversification patterns observed across the Platycephalinae, together with the greater species diversity in higher latitudes (Figure 4.3), is suggestive of a temperate origin followed by species expansion towards the tropics. This observation is not supportive of the ‘out of the tropics’ hypothesis (Jablonski et al. 2006), and is more indicative of an inverse, ‘out of the deep south’ origin (Rivadeneira et al. 2011). Furthermore, as taxa confined to southern Australia are genealogically older compared to their tropical relatives (Figures 4.3- 4.5), an age versus latitude assumption appears to have no bearing on diversity patterns (i.e. groups originating in the tropics are expected to be older with higher latitude taxa nested within lower latitude taxa). Conversely, onigociins appear to have maintained a tropical distribution throughout their evolutionary history. Furthermore, the higher accumulated species diversity in this subfamily is presumably at least partly due to their existence in tropical regions for longer periods of time (the subfamily has ~three-fold more extant species than the Platycephalinae based on current taxonomy). However, this trend is not related to the longer history of the tropics per se (i.e. the “age of the tropics” hypothesis) as the early diversification of ancestral lineages, contributing to the current diversity in both the Onigociinae and Platycephalinae, is associated with similar geological periods (30 to 20 Ma).

73 CHAPTER 4

4.5.2 Diversification in the tropics

A variety of ecological and evolutionary factors altering diversification rates and survival optima across latitudes can account for LDGs (Floeter et al. 2004; Lappalainen & Soininen 2006; Mittelbach et al. 2007; Roy et al. 2000; Smith et al. 2012; Wiens & Donoghue 2004). Faster extinction rates at high latitudes might be expected due to greater environmental variability, both seasonally and over longer timescales (Dynesius & Jansson 2000). However, disentangling these rates from low diversification rates, processes that can produce the same clade size (Ricklefs 2007), is challenging in the absence of palaeontological data. The phylogeographic patterns observed across flathead lineages at both low and high latitudes correlate well with climate-driven processes and associated exposure to vicariant barriers. The majority of flathead species occupy relatively homogenous sand or muddy coastal environments and coastline length positively correlates to coastal diversity (Tittensor et al. 2010). Given that the tropical belt (20o N to 20o S) represents the largest eco-climatic zone globally (Gaston 2000), under favourable environmental conditions, dispersal across this region not only offers opportunities for expanding the ranges of species, but also increases their access to additional refugia during glacial coastline contractions. The periodic exposure of the Sunda Arc and the Torres Strait land bridges represent some of the most conspicuous examples of vicariant barriers splitting lineages and clearly play a crucial role in species diversification across the region (Carpenter et al. 2011; Mirams et al. 2011). Higher diversification rates in the tropics may also relate to increased evolutionary speed. It has been suggested that increased temperature and/or metabolic rates may be driving faster speciation rates in tropical regions (Allen & Gillooly 2006; Fuhrman et al. 2008). However, LDGs have been observed in terrestrial endotherms (e.g. mammals and birds) suggesting the influence of temperature is not sufficient to explain latitudinal trends in species diversity (Mittelbach et al. 2007). This conclusion may not be applicable to the marine environment as warm-blooded marine mammals have greater species diversity at higher latitudes (Tittensor et al. 2010). Additionally, see Gillman et al., (2009) and Weir & Schluter (2011) for discussion on the potential of increased mutation rates for mammals in warmer environments.

4.5.3 Migration direction since the Eocene

Fossil otoliths of flatheads are first reported in the Palaeo-Mediterranean from the late Eocene along with many other extant IWP endemics (Girone & Nolf 2009). Many of these lineages, once common to Western Europe during the Eocene, are now confined to refugia in

74 CHAPTER 4 temperate Australian and New Zealand waters (Vermeij 1986). It is unclear whether these groups were already widespread at the time or subsequently migrated (en masse) to these southern waters. The uninterrupted access to the ancient Tethys Sea (Rögl 1999) and tropical global climate (~20oC at high latitudes Liu et al. 2009) for most of the Eocene suggests that favourable conditions existed for lineage dispersal between low and high latitudes. Ancestral flathead lineages, present on the Australian continent during the Eocene, would have been exposed to the dramatic shift in climate during the Eocene-Oligocene boundary (~5oC drop in ocean temperatures at high latitudes; Liu et al. 2009). This temperature shift may have provided the evolutionary impetus for their isolation and early success in temperate waters as lineages that did not adapt to this rapid shift either retreated from high latitudes to tropical climes or became extinct (Prothero 1994). The Oligocene climatic shift was also responsible for the formation of the cold psychrospheric deep waters (100–700 m depths, ~10oC; McKenzie 1991) and may have triggered formation and diversification within the two sub-families. Imamura’s (1996) hypothesis suggests the platycephalids may have evolved in deep-water environments, in the same way ancestral Bembridae and Parabembridae families (Figure 4.1) likely occupied the continental slope. In addition, basal lineages within the Platycephalidae, such as Ratabulus and the P. aurimaculatus, P. conatus and P. richardsoni group, appear to reflect deep-water origins (Figure 4.6b). Early flathead fossils are among fish assemblages that include both shallow and deep-water lineages (Girone & Nolf 2009; Long 1982) offering no definitive clarification. Collision between the Australian and Eurasian Plates from the early Miocene (~23 Ma) likely favoured colonisation and subsequent diversification of tropical IWP platycephalin lineages (Figure 4.4) due to the formation of extensive, shallow-water environments providing corridors for dispersal (Hall 2009). In contrast, phylogeographic patterns evident in the Onigociinae suggest the group mainly retreated to the tropics, prompted by the Eocene climatic shift; exceptions being isolated lineages (e.g. L. inops and T. cirronasa) that adapted and persisted in temperate conditions of southern Australia. Alternatively, these onigociin lineages may have subsequently migrated to southern Australia in the early Miocene. The latter hypothesis finds support in the molecular clock approximations (Figure 4.5). Tropical species repeatedly invaded the southern fauna through the early-Miocene climatic optimum (O'Hara & Poore 2000; Wilson & Allen 1987). The sudden mid-Miocene glaciation, responsible for a ~7oC drop off the South Tasman Rise (Zachos et al. 2001), coincided with the disappearance of flatheads and other Indo-Pacific endemics at high latitudes across northern Europe and the Palaeo-Mediterranean (Steurbaut 1984) and may have been responsible for the depauperate onigociin lineages that persist in temperate Australia.

75 CHAPTER 4

The earliest evidence of flatheads occupying southern Australia is a mid-Miocene fossil from Victoria (Long 1982). If we assume migration of a platycephalin group into southern Australia during the early Miocene climatic optimum, then we might expect tropical taxa to represent the most ancestral lineages. Given their current distributions and their molecular clock approximations, an earlier flathead presence in Australia is plausible (i.e. presence there prior to the Eocene-Oligocene climate shift) followed by subsequent movement and adaptation of derived lineages to warmer, tropical waters through the early to mid-Miocene climatic optimum.

4.5.4 Diversification in the mid-Miocene

High levels of diversification are observed in ancestral, temperate platycephalins, and within the Platycephalus indicus species complex, that coincide with the mid-Miocene glaciation (~10 Ma; Figure 4.5). Cooling throughout the mid to late-Miocene appears to have prompted ancestral P. marmoratus and P. orbitalis to retreat northwards up the eastern and western Australian coasts forming geographically isolated lineages (Figure 4.3b) that now separate along isotherms known to restrict the distributions of other marine groups (O'Hara & Poore 2000). Sister species P. speculator and P. caeruleopunctatus show adjacent distributions converging in Bass Strait that correspond to expectations of allopatric separation (Figure 4.3e). The imprint of the Bassian Isthmus as an intermittent land bridge is similarly evident across a diverse spectrum of marine groups (Waters 2008). However, the distributions of sister species P. bassensis and P. longispinis do not reflect this same vicariant pattern (Figure 4.3d) despite their synchronous divergence with P. speculator and P. caeruleopunctatus (Figure 4.5). A glacial event may have initiated separation in ancestral P. speculator and P. caeruleopunctatus through a vicariant split, with possible parapatric separation along a depth gradient in ancestral P. bassensis and P. longispinis. This form of depth-related parapatric speciation has been proposed for rockfishes (Sebastes) in the absence of any differences in life history, diet or latitudinal geographical separation (Ingram 2011). Competitive exclusion is unlikely to be maintaining postglacial separation in one group and not the other as the allopatrically distributed P. speculator and P. caeruleopunctatus sister species occupy separate depth and habitat preferences. Mode of speciation, ecological and/or oceanographic factors (Dawson 2005; Waters 2008) therefore probably account for these inconsistent postglacial distribution ranges.

4.5.5 The Platycephalus indicus complex

The Platycephalus indicus species complex represents the most comprehensively sampled flathead group across the tropical IWP. The most pronounced divergence; coinciding

76 CHAPTER 4 with the mid-Miocene climate shift, split the Indian and Pacific Ocean groups along the Sunda Arc and Torres Strait (Figure 4.5). Levels of intra-species divergence across the P. indicus complex are found in other, less well-sampled flathead species across similar geographical locations (Puckridge et al. 2013a), as well as across other, diverse marine groups (Andreakis et al. 2012; Poore & Andreakis 2011; Puckridge et al. 2013b). These observations hint at the potential magnitude of unaccounted for, cryptic diversity across this region and also suggest that processes creating diversification in the P. indicus complex may be acting on whole suites of species. Distinguishing between geographical fragmentation of widely distributed populations and profuse net speciation among narrowly distributed taxa can be difficult (Jablonski 2007). However, the repeating patterns of species divergences observed across spatial (e.g. Figures 4.2, 4.3c & 4.4) and temporal scales (e.g. Figures 4.2c, d) strongly suggest vicariant isolation and species survival across multiple refugia during glacial coastline contractions. These recovered patterns are consistent with climate-driven centrifugal speciation (Brown 1957), suggesting this process may be a key factor creating diversity in this region (Briggs 2000). As new lineages arise in peripheral and central regions, it is hypothesised that unless peripheral groups develop proper specializations, central lineages will expand and, following dispersal, out-compete peripheral lineages (Brown 1957).

4.5.6 Systematic considerations

Despite the basal position of Ratabulus in the onigociin phylogeny, as originally proposed by Imamura (1996), the subfamilial topologies of his schemes are not in agreement with those presented here. The present study and that of Imamura (1996) infer relationships across the Onigociinae in the absence of a number of its taxa. Therefore the phylogenetic accuracy of inferred relationships within this section of the phylogeny is considered partially compromised due to incomplete sampling (Rokas & Carroll 2005). However, the polyphyletic and/or paraphyletic status of several genera (e.g. Thysanophrys, Onigocia, and Inegocia) is well supported from both nuclear and mitochondrial data and is in conflict with the more recent taxonomic revisions (Imamura 1996). Additionally, equivocal relationships question the monophyly of Cymbacephalus, Sunagocia and Sorsogona. The clade containing Sorsogona has the least taxonomic coverage, yet S. prionota and S. portuguesa are not grouped with the type species of the genus S. tuberculatus, or with Rogadius, as proposed by Imamura (1996). At present, the Platycephalinae consists of two genera. Based on anatomical characters, Imamura (1996) placed the monotypic Elates basal to the Platycephalinae, a relationship that was not recovered from the molecular phylogenies. However, the position of Elates shifts according to the marker, reconstruction method and outgroup taxa used,

77 CHAPTER 4 suggesting the need for additional markers to resolve its position. The proposed relationships among Platycephalus species in this study are based on the most comprehensive sampling of the genus to date (15 nominal species and 8 additional unnamed taxa), with Imamura (1996) and Keenan (1991) basing their phylogenetic reconstructions on 7 and 12 Platycephalus species respectively. Proposed Platycephalus relationships by Keenan (1991) are more consistent with those of the present study despite differences in marker choice and reconstruction method. The decrease in LL scales with decreasing latitude and depth in the platycephalins is consistent with a phenomenon known as Jordan’s Rule (see McDowall 2008 for discussion). This is most widely recognised by number of vertebrae, however correlations with LL scales and branched anal rays have been noted (Hubbs 1922). Temperatures during early development, phyletic position, body shape and swimming mode may be determining factors (McDowall 2008). As mechanisms responsible for these correlations are poorly understood, Platycephalids could represent an ideal candidate for examining causative processes given their broad latitudinal range and their apparent, recent tropical expansion. In addition, while there is a correlation in LL scales, vertebral counts are highly conserved in flatheads (27 vertebrae; Knapp 1999).

4.5.7 Conclusions

The timing and directionality of species diversification in tropical seas represent an expanding field in modern ecology and macroevolution. However, the climatic and evolutionary processes underlying LDGs still remain controversial or cannot be determined with certainty. Molecular phylogenies coupled with molecular clock approximations, can provide a powerful tool for elucidating palaeo-climatic changes and geological events responsible for the distribution of marine taxa across temperate and tropical regions. Given the commercial importance of flatheads and taxonomic uncertainty, the present results have considerable implications for future management and conservation strategies, and provide a comprehensive framework for exploring evolutionary processes in this family.

78 CHAPTER 4

79 CHAPTER 5

‘‘the affinities of all the beings of the same class have sometimes been represented by a great tree… As buds give rise by growth to fresh buds, and these, if vigorous, branch out and overtop on all sides many a feebler branch, so by generation I believe it has been with the great Tree of Life, which fills with its dead and broken branches the crust of the earth, and covers the surface with its ever branching and beautiful ramifications.” Charles Darwin (1859)

80 CHAPTER 5

Centrifugal speciation promotes species diversity in the Indo-West Pacific tuskfishes (Labridae: Choerodon)

81 CHAPTER 5

5.1 ABSTRACT

Centrifugal speciation has been proposed as a key process driving marine diversity in the tropical Indo-Australian Archipelago, the world’s largest biodiversity hotspot. The successful evolutionary trajectory of peripheral isolates formed in refugia is dependent on their ability to specialise sufficiently to reduce competitive exclusion from any subsequent expansion phases of the parent species. Evidence of this process is investigated in the Choerodon tuskfishes, a group of labrids whose centre of diversity coincides with this region. Mitochondrial (COI and 16S) and nuclear (RAG2 and Tmo4c4) molecular phylogenetic and phylogeographic analyses, coupled with molecular clock dating, were carried out for 18 of the 23 valid Choerodon species. Two additional, undescribed, Choerodon species were also included, showing reciprocal monophyly in both genomes substantiating their designation as new species. Choerodon diverged from their ancestral sister group, the Odacines, at the onset of the Miocene, coinciding with the collision of the Australian and Eurasian Plates when extensive areas of shallow-water habitat formed. Subsequent evolutionary patterns are partially obscured by overlapping ranges with no clear evidence for climatically driven lineage divergences. However, the data support an evolutionary scenario of peripheral endemics budding from widespread species. As predicted by the centrifugal speciation hypothesis, endemics tend to occupy more specialised reef or non-reef habitats whereas widespread groups appear to generally take advantage of both reef and non-reef environments. The findings are consistent with centrifugal speciation as one of the main mechanisms driving species diversity in the tuskfishes across this biodiversity hotspot. Future studies would benefit from more detailed knowledge of habitat use and niche specialisation across individual species’ ranges.

82 CHAPTER 5

5.2 INTRODUCTION

The tropical Indo-West Pacific (IWP) hosts the world’s richest marine biodiversity hotspot, derived through a culmination of multiple climatic changes, large-scale geological events and evolutionary processes, acting at individual and population levels for millions of years (Barber et al. 2006; Williams & Duda 2008). Numerous hypotheses have been proposed to explain the observed species richness in the region on the basis of biogeographical inference and evolutionary trajectories from multiple taxa. However, three main hypotheses have persisted. One is based on the theory of accumulation (Ladd 1960). This draws on the dynamic geological and oceanographic profile of the area, stating that species initially arise peripherally and move inwards on the conveyor belt of converging tectonic plates as well as more contemporary ocean currents. A second hypothesis, known as the theory of overlap (Woodland 1983), suggests the Pacific and Indian oceans meet at this junction and unite their respective biota. Finally, a third hypothesis, based on the ‘centre of origin’ theory (Ekman 1953), proposes that species formation occurs in the central IWP with dispersal outwards (Briggs 1974). Given the complexity of the processes governing species differentiation, unanimous and conclusive support for any single hypothesis is lacking (e.g. Bellwood & Meyer 2009a; Briggs 2009). However, the ‘centre of origin’ theory appears to be the most parsimonious, capable of explaining the observed phylogeographic patterns and evolutionary trajectories of species and populations in multiples cases (Briggs 2000, 2003, 2005; Timm & Kochzius 2008; Williams & Duda 2008). In support of the latter, a process known as “centrifugal speciation” (Brown 1957) was proposed as one of the major mechanisms fuelling species diversity within the region (Briggs 2000, 2005). Briefly, centrifugal speciation depicts lineage divergence through budding of isolates from a central species; drawing on the successive expansion and contraction episodes expected of widely distributed populations over evolutionary time. Under this scenario, remnant populations are predicted to form in refugia zones during the contraction phase and diverge into species level lineages through extended isolation (Brown 1957). It is further hypothesised that unless these newly formed peripheral isolates specialise sufficiently, they will be outcompeted during subsequent expansion of the parent species (Briggs 2000; Brown 1957). The rich variety of heterogeneous habitats characteristic of the Indo-Australian Archipelago (IAA), situated at the centre of the IWP region, offer diverse ecological opportunities for niche specialisation and may be of central importance to reducing competitive exclusion between closely related lineages. Phylogeographic patterns across a number of groups accord with expectations of the centrifugal speciation hypothesis (Barber et

83 CHAPTER 5 al. 2006; Hodge et al. 2012; Winters et al. 2010). Furthermore, growing evidence suggests that widely distributed species across this region are in fact multiple, allopatrically distributed cryptic species that have most likely formed in refugia created by emergent land barriers during glacial sea level lows (Barber et al. 2006; Puckridge et al. 2013a; Puckridge et al. 2013b). Additionally, many narrow-ranging endemics in this region occupy peripheral areas to the centre of diversity (Allen 2008). Should centrifugal speciation be a primary and ongoing driver of species diversity in this region, then the origins of peripheral endemics are expected to originate at different geological times. This observation is emerging among a number of phylogeographic studies (e.g. (Bellwood & Meyer 2009b; Hodge et al. 2012; Read et al. 2006). Members of a group of wrasses (Labridae), the tuskfishes of the genus Choerodon, offer a model system to test for centrifugal speciation in fostering diversity patterns in the region. Labrids are an impressively diverse group of fishes with a very successful evolutionary trajectory dating back to as early as the Cretaceous (Cowman et al. 2009). Species of the genus Choerodon belong to the hypsigenyini labrid tribe; they occupy tropical and warm temperate regions of the IWP, and have their centre of diversity coinciding with the IAA. The great majority of Choerodon species are generalist invertebrate predators, feeding on similar diets of molluscs, crustaceans, urchins and worms (Fairclough 2005), with a few of the largest species also consuming fishes (Bellwood et al. 2006). According to the competitive exclusion principle (Harding 1960), co-occurring species need to partition resources sufficiently to avoid or at least minimize interspecific competition. Variation in size selectivity of prey could be driving this dynamic as body size differs significantly between species e.g. C. gomoni attains ~12 cm total length while C. schoenleinii reaches a maximum of ~90 cm (Allen & Erdmann 2012). However, observations of co-occurring Choerodon species in a subtropical embayment of western Australia show clear spatial partitioning with congeneric species occupying separate habitat types dominated by sandy, seagrass, rubble and reef environments to varying degrees, with a number of species found moving between each of them (Fairclough et al. 2008). The present study employs nuclear and mitochondrial markers to explore the evolutionary scenarios shaping diversity in these fishes by reconstructing their phylogenetic relationships and their phylogeographic patterns. The geographical relationships of widespread versus narrow-ranging species is used to test for evidence of historical budding and their association to habitat types is examined. It is expected that widely distributed species will generally occupy the broadest niches, affording them greater opportunities to disperse and locally adapt to differing environmental conditions across their range, compared with the majority of narrow-ranging species, which may prove to be more specialised.

84 CHAPTER 5

5.3 METHODS

5.3.1 Sample collection

Contributors to the Australian National Fish Collection (CSIRO Hobart) were responsible for the great majority of samples used in the present study. Additional sampling trips through Indonesia supplemented this as well as tissue from C. azurio and C. robustus types A and B from Mabuchi et al. (2002) collected from Japan. Where possible, three individuals per species were used to represent an operational taxonomic unit (OTU), with an emphasis on targeting separate geographical locations. Tissue samples were either frozen at -20°C or preserved using either 95% EtOH or 20% DMSO saturated with NaCl. GenBank (www.ncbi.nlm.nih.gov/genbank) and BOLD (www.barcodinglife.org) sequences were mined to supplement those generated in the present study. Specimen details including voucher numbers, GenBank accession numbers, species names and collection localities are provided in supplementary information Table S5.1.

5.3.2 Sampling coverage

Of the 23 valid Choerodon species (Eschmeyer 2012), 18 were examined in the present study; two additional OTUs, as yet to be confirmed provisional species C. cf. margaritiferus and C. sp. A, were also included in the analyses. Members of the Choerodon group not included in this study are: C. zosterophorus, found across the Philippines and eastern Indonesia, C. graphicus, endemic to eastern Australia and the Coral Sea region (Westneat 2001) and C. gymnogenys found in African, Japanese and Western Australian waters, C. margaritiferus, found in the Philippines and the south-east Pacific and the nominal species C. paynei, endemic to Dirk Hartog Island in Western Australia. No confirmed reports of this latter species are available. Furthermore, Whitley's (1945) description of C. paynei closely resembles C. rubescens, found in the same geographical area, suggesting C. paynei may not be a valid species.

5.3.3 Outgroup selection

Representative genera from the hypsigenyini labrid tribe were included for outgroup comparison following Gomon (1997). However, Lachnolaimus and Pseudodax were also included on the basis of their apparent monophyly and ancestral relationship observed in subsequent phylogenetic studies (Cowman et al. 2009; Westneat & Alfaro 2005).

85 CHAPTER 5

5.3.4 Marker selection

The nuclear recombination activating gene 2 (RAG2) and titin-like protein (Tmo4c4) as well as mitochondrial cytochrome oxidase subunit I (COI) and ribosomal 16S rDNA gene fragments were chosen for phylogenetic analyses based on their resolving power at the species level, strong phylogenetic signal at the taxonomic level investigated, and use in previous labrid phylogenetic reconstructions (Clements et al. 2004; Westneat & Alfaro 2005).

5.3.5 DNA extraction, PCR amplification & sequencing

Protocols of either Aljanabi and Martinez (1997) or Doyle and Doyle (1987) were used to extract total genomic DNA from tissue samples. Fragment amplification was carried out in 20 µl volumes containing 2 µl 10× reaction buffer, 1.5-2.5 mM MgCl2, 0.2 mM dNTPs, 10 mM of forward and reverse primers and 0.5 U of AmpliTaq using 10 – 20 ng template. Primers and annealing temperatures are given in Table 5.1. The thermal regime consisted of a denaturation step at 95°C for 10 min, followed by 35 cycles of 94°C (30 s), their respective annealing temperature (30 s) (see Table 5.1) and 72°C (1 min) with a final extension of 72°C (7 min). A 1% TAE agarose gel was used to quantify PCR products against known standards. Amplicons were purified with AMPure XP (Agencourt) following manufacturer’s recommendations and sequenced using the ABI Prism® BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems). Electropherograms were edited in BioEdit (Hall 1999) and aligned in MUSCLE (www.ebi.ac.uk/Tools/msa/muscle; (Edgar 2004).

Table 5.1 PCR primer details and annealing temperatures.

Annealing Gene Temp Primer Reference TCA ACC AAC CAC AAA GAC ATT GGC AC COI 54oC Ward et al. (2005) TAG ACT TCT GGG TGG CCA AAG AAT CA CGC CTG TTT ATC AAA AAC AT 16S 50oC Palumbi (1996) CCG GTC TGA ACT CAG ATC ACG T GATGGCCTTCCCTCTGTGGGTAC RAG2 55oC Smith et al. (2008) GGCTCCCAGAGAGTTACCTCATHCA CCT CCG GCC TTC CTA AAA CCT CTC Tmo-4c4 55oC Streelman & Karl (1997) CAT CGT GCT CCT GGG TGA CAA AGT

5.3.6 Phylogenetic reconstructions

The evolutionary model and parameters that best describe each alignment were determined with Modeltest v3.7 (Posada & Crandall 1998). Saturation at codon positions was analysed by plotting the number of transitions and transversions against genetic distance in DAMBE (Xia & Xie 2001). Data combinability was assessed with a permutation test in PAUP* 4.0b10 (Swofford 2003) based on 100 permutations after invariant sites and replicate

86 CHAPTER 5 sequences were removed. In addition, single marker phylogenies were initially constructed in the same software constrained by the Modeltest output to assess topological differences. Phylogenetic relationships were inferred from concatenated datasets using maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference (BI). MP and ML analyses were computed in PAUP* 4.0b10 using heuristic searches with 500 random sequence additions and the tree bisection-reconnection (TBR) branch swapping algorithm. Starting trees were obtained via stepwise addition. All characters were unordered and given equal weighting for MP analyses. The Modeltest output was used for ML based on the concatenated alignment. Node support was established with 2,000 bootstrap pseudo-replicates using the ML algorithm under the neighbour-joining (NJ) search option. BI were computed in MrBayes v3.1 (Ronquist & Huelsenbeck 2003) with priors set for individual gene partitions according to their evolutionary model defined by Modeltest. Two parallel Markov Chain Monte Carlo (MCMC) runs of four chains (three hot, one cold) were sampled every 1,000 generations until convergence was reached based on average standard deviation of split level frequencies falling below 0.01. Convergence was further verified in Tracer v1.5 and 25% of each sample run was discarded as burn-in.

5.3.7 Divergence time dating

Fossil-calibrated molecular clock estimates followed that of Alfaro et al. (2009) using the fossil Phyllopharyngodon longipinnis (Bellwood 1990) to impose a minimum date on the hypsigenyini crown. First, Likelihood Ratio Tests (LRTs) were calculated in PAUP* 4.0b10 to assess rate constancy. Following rejection of rate constancy in all molecular markers (P <0.01), an uncorrelated lognormal distribution that allows branch rates to vary was used to calculate divergence times in the BEAST v.1.6.1 (Drummond & Rambaut 2007) package. Gene partitions were unlinked and separate substitution models were set for each partition. The Yule speciation model defined the tree prior. The MCMC chain was run for 5 x 106 generations sampling every 1,000th. A 25% burn in was removed after convergence was checked in Tracer v1.5 and a maximum clade credibility tree was then generated in TreeAnnotator v1.6.1. as part of the BEAST v1.6.1 package to illustrate median node ages and their 95% highest posterior density (HPD) intervals.

5.3.8 Phylogeographic relationships

To explore phylogeographic relationships, species distributional data were first amalgamated from Westneat (2001), OBIS (www.iobis.org), the IUCN redlist (http://www.iucnredlist.org) and Allen and Erdmann (2012) and adjusted to reflect additional areas where specimens have been collected for the present study outside their known

87 CHAPTER 5 distribution ranges. The most recent review of a species range extent was chosen to resolve any conflicts between reports. Therefore, C. cephalotes is considered an Australian endemic (Liu et al. 2010) despite reports of a wider distribution (Westneat 2001). Species were characterised as either endemic, with distributions covering an area less than 1.5 106 km2, or widespread, with distributions covering an area greater than 1.5 106 km2. Biogeographical inferences were further explored by reconstructing ancestral ranges using a hierarchical bayesian approach implemented in RASP (Yu et al. 2011). First, ranges of extant species were classified according to presence in six key geographical regions as follows: A) South-west Pacific, B) western Australia, C) Wallacea and the Philippines, D) the Sunda Shelf, E) the North-west Pacific and F) the Indian Ocean, west of Thailand (Figure 5.1). These regions are adapted and simplified from those in Spalding et al. (2007). For example, the western Australian region represents a single, amalgamated region rather than three separate ecoregions as defined in Spalding et al. (2007). A bayesian binary MCMC analysis (BBM) was then performed on the posterior distribution of the dated phylogeny from BEAST using 100 randomly selected trees. Ten MCMC chains were run for 50,000 generations sampling every 100th with a null root distribution.

E

D F C

B A

Figure 5.1 Map of partitioned regions used to classify range extent of Choerodon species across the IAA. A = South-west Pacific, B = western Australia, C = Wallacea and the Philippines, D = the Sunda Shelf, E = the North-west Pacific and F = the Indian Ocean, west of Thailand.

5.3.9 Ecological partitioning

Shifts in habitat association were identified by first characterising habitat type into reef versus non-reef environments. The ancestry and evolution of these characteristics were then assessed across the multilocus phylogeny in a maximum parsimony framework in Mesquite v2.75 (Maddison & Maddison 2011). This same procedure was followed for mapping bathymetric distribution ranges and body sizes for each species across the topology.

88 CHAPTER 5

5.4 RESULTS

A total of 189 sequences were assembled (92 sequenced in the present study). Alignment characteristics are given in Table 5.2. Specimens of C. robustus types A and B from Mabuchi et al. (2002) clustered with C. robustus and C. zamboangae respectively, thus confirming their taxonomic status as distinct species based on genetic differences in both mitochondrial and nuclear genomes.

Table 5.2 Descriptive statistics for COI, 16S, RAG2, Tmo4c4, concatenated mitochondrial, concatenated nuclear and concatenated mitochondrial and nuclear alignments giving n, number of sequences; alignment length in base pairs (bp); model of sequence evolution including gamma distribution (alpha shape) and Pinvar, proportion of invariant sites; PI, number of parsimony informative sites and g1, skewness of tree distributions.

lenth Gamma Alignment n (bp) Model (α) Pinvar g1 PI COI 65 651 TrN + I + Γ 0.5509 0.5811 - 0.501278 239 16S 64 570 GTR + I + Γ 0.3377 0.4218 - 0.465182 155 RAG2 31 704 TIMef + Γ 0.4925 - - 0.722893 175 Tmo4c4 29 469 GTR + I + Γ 0.8779 0.4451 - 0.709341 66 Mito 67 1221 TrN + I + Γ 0.6725 0.6128 - 0.522404 394 Nuclear 31 1173 TIM + I + Γ 0.8864 0.3121 - 0.712199 241 All 67 2394 GTR + I + Γ 0.4670 0.4900 - 0.452397 635

5.4.1 Phylogenetic reconstruction

Phylogenetic reconstructions (BI, ML and MP), based on the concatenated alignment, produced almost identical topologies with strong internal node support, highlighting four main clades in Choerodon (Figure 5.2). The genus Choerodon is paraphyletic due to the position of Xiphocheilus; which forms a basal relationship to clade 1 in all phylogenetic analyses. The only inconsistencies observed between phylogenetic reconstructive methods were: 1) placement of clade 4 (C. fasciatus and C. vitta) as sister to clades 1 and 2 in the MP analysis rather than to clade 3 observed in the ML and BI analyses (data not shown) and 2) C. sugillatum forms a sister relationship to C. jordani and C. frenatus in the ML analyses, yet is basal to C. jordani/C. frenatus and C. cf. margaritiferus/C. gomoni/C. sp. A in both BI and MP analyses (data not shown). The ML result appears to be drawing more strongly on the nuclear data as this same relationship is recovered in all nuclear based phylogenetic analyses (BI, ML and MP), however it lacks strong node support.

89 CHAPTER 5

1.0/99 A4899 Choerodon cf. margaritiferus A10619 Choerodon cf. margaritiferus 1.0/~ A6432 Choerodon gomoni A6433 Choerodon gomoni 1.0/99 A6434 Choerodon gomoni

~/87 Clade 1 A11490 Choerodon sp. A 1.0/100 A5333 Choerodon jordani A6426 Choerodon jordani 1.0/~ 1.0/~ A6463 Choerodon frenatus 1.0/100 A6464 Choerodon frenatus A6465 Choerodon frenatus 1.0/~ A6446 Choerodon sugillatum 1.0/100 A6447 Choerodon sugillatum A6448 Choerodon sugillatum A5210 Xiphocheilus typus A7795 Choerodon robustus A7796 Choerodon robustus 1.0/~ 1.0/100 A5672 Choerodon robustus A6181 Choerodon robustus

1.0/~ A6189 Choerodon robustus Clade 2 A4300 Choerodon zamboangae 1.0/100 A6140 Choerodon zamboangae 1.0/84 A7799 Choerodon zamboangae A7801 Choerodon azurio 1.0/~ 1.0/~ A7802 Choerodon azurio A7800 Choerodon azurio

1.0/100 A6427 Choerodon monostigma A6428 Choerodon monostigma A6429 Choerodon monostigma A1260 Choerodon rubescens 0.99/100 A1261 Choerodon rubescens ~/79 A1262 Choerodon rubescens 1.0/~ A1255 Choerodon cauteroma 1.0/97 A1256 Choerodon cauteroma 1.0/100 A1257 Choerodon cauteroma A1252 Choerodon schoenleinii A1253 Choerodon schoenleinii 1.0/97 A5808 Choerodon schoenleinii 1.0/97 Clade 3 A7803 Choerodon schoenleinii 1.0/100 A1229 Choerodon cephalotes 1.0/~ A1230 Choerodon cephalotes A5804 Choerodon anchorago 1.0/100 A5807 Choerodon anchorago A5902 Choerodon anchorago Choerodon oligacanthus 1.0/~ 0.98/~ 1.0/100 A6162 1.0/98 A6163 Choerodon oligacanthus 1.0/100 A5501 Choerodon cyanodus A6052 Choerodon cyanodus A6459 Choerodon venustus 1.0/100 0.97/90 A6461 Choerodon venustus A6460 Choerodon venustus

1.0/100 UG1059 Choerodon fasciatus Clade 4 UG1060 Choerodon fasciatus A6441 Choerodon vitta 1.0/~ 1.0/96 1.0/100 A6443 Choerodon vitta A6442 Choerodon vitta 1.0/78 Neoodax balteatus 1.0/~ Olisthops cyanomelas 1.0/100 Heteroscarus acroptilus Odax cyanoallix Bodianus mesothorax Bodianus rufus 1.0/97 Semicossyphus pulcher Clepticus parrae Pseudodax moluccanus Achoerodus viridis Lachnolaimus maximus

5 %

Figure 5.2 Bayesian phylogenetic hypothesis of Choerodon relationships within the hypsigenyini tribe based on the concatenated dataset. Internal node support >/= to 0.95 HPD and >70% based on bootstrap pseudo-replicates are given. Four major clades are highlighted.

90 CHAPTER 5

5.4.2 Divergence times & phylogeography

Choerodon diverged into two sister lineages (clades 1 & 2 and clades 3 & 4 respectively) from a most recent common ancestor (MRCA) in the early to mid-Miocene (~15 Ma; Figure 5.3). Species diversity across the group is distributed in approximately equal portions within these two main lineages. The mid to late Miocene appears to have fostered the greatest rate of lineage diversification, followed by a reduced rate of diversification across the climatically driven Plio-Pleistocene (Figure 5.3). Relationships within each of the four main clades are subsequently described individually.

91 CHAPTER 5

Choerodon cf. margaritiferus E 4.9 Choerodon gomoni D 0.6 F C Choerodon sp. A I 8.0 B A Choerodon jordani 8.7 4.1 Choerodon frenatus A 11.8 Choerodon sugillatum AB Xiphocheilus typus

ABC 13.8 Choerodon robustus 1.9 ABD Choerodon zamboangae 2.9 AC 9.2 Choerodon azurio

B Choerodon monostigma

BC Choerodon rubescens 0.6 BDE Choerodon cauteroma 1.7 15.5 BCE 5.4 Choerodon schoenleinii

Choerodon cephalotes 9.5 Choerodon anchorago

8.4 Choerodon oligacanthus 11.6 21.6 7.4 Choerodon cyanodus

13.5 Choerodon venustus

Choerodon fasciatus 21.9 8.3 Choerodon vitta

Heteroscarus acroptilus Olisthops cyanomelas 26.4 10.1 14.7 Neoodax balteatus Odax cyanoallix Semicossyphus pulcher 10.1 27.6 Bodianus rufus 11.0 12.1 Bodianus mesothorax 32.3 Clepticus parrae Pseudodax moluccanus 45.1 Achoerodus viridis Lachnolaimus maximus 50.0 40.0 30.0 20.0 0.0 10.0 Eocene Oligocene Miocene Plio Pleist

Figure 5.3 Divergence time estimates for the hypsigenyini phylogeny given in millions of years (Ma) with blue bars across nodes indicating their 95% upper and lower confidence intervals. Predicted distributions for internal nodes across the Choerodon group are indicated with pie graphs. Colours correspond to regions illustrated in the map insert, as indicated. Areas with <10% probability are blacked out.

92 CHAPTER 5

5.4.2.1 Clade 1

Choerodon gomoni is speculated to be a junior synonym of C. margaritiferus (Allen & Erdmann 2012). Unfortunately no sequences of C. margaritiferus are publically available or were produced here to resolve this taxonomic uncertainty. However, a morphologically similar, undescribed species was obtained; C. cf. margaritiferus, found in regions outside the known range for C. margaritiferus (Figure 5.4). Sequences from this potentially new species were highly divergent from C. gomoni at both the mitochondrial and nuclear level (Figure 5.2) suggesting the taxonomy of these species is valid. Similarly, the undescribed Choerodon sp A, showed genetic separation at the nuclear and mitochondrial level from C. gomoni (Figure 5.2). However, these differences were much smaller, yet still similar to the genetic differentiation between sister species C. cauteroma and C. rubescens in clade 3 (Figures 5.2). Information on the habitat preferences and distribution ranges for the majority of species in clade 1 is insufficient to infer phylogeographic relationships with confidence.

30° 30° 30° a Choerodon margaritiferus b c (unsampled) Choerodon cf. margaritiferus Choerodon jordani Xiphocheilus typus 20° 20° 20° Choerodon frenatus Choerodon sugillatum Choerodon gomoni 10° ( sampling location) 10° 10° Choerodon sp. A 0° 0° 0°

10° 10° 10°

20° 20° 20°

30° 30° 30° 100° 110° 120° 130° 140° 150° 160° 170° 100° 110° 120° 130° 140° 150° 160° 170° 100° 110° 120° 130° 140° 150° 160° 170°

Figure 5.4 Phylogeographic relationships across clade 1 showing a) Choerodon cf. margaritiferus, C. gomoni and C. sp A. For comparison, distributions for C. margaritiferus are also given. b) C. jordani and C. frenatus and c) C. sugillatum and Xiphocheilus typus.

5.4.2.2 Clade 2

The narrowest ranging species in this group, C. monostigma, endemic to Australian and Papua New Guinean (PNG) waters, is positioned basal to the rest of this clade, diverging from an MRCA in the mid-Miocene (~9.2 Ma) (Figures 5.3 & 5.5). Much later, throughout the Pliocene, C. azurio, endemic to the northwest Pacific, diverged from the ancestral form of the two widespread sister species, C. robustus, distributed across the entire tropical IWP and C. zamboangae, found east of the Wallace Line, northern Australia and the north Pacific.

93 CHAPTER 5

40°

30°

20°

10°

0°

Choerodon robustus Choerodon 10° Choerodon zamboangae 20° Choerodon azurio Choerodon monostigma 30°

110° 120° 130° 140° 150° 40° 50° 60° 70° 80° 90° 100°

Figure 5.5 Phylogeographic relationships across clade 2 between C. robustus, C. zamboangae, C. azurio and C. monostigma.

5.4.2.3 Clade 3

Another Australian endemic, C. venustus, distributed on the east coast, was recovered basal to the rest of the species in clade 3 (Figure 5.6c). This basal split also dates to the mid- Miocene (~11.6 Ma), followed by the formation of two sub-clades each comprising a single widespread species, C. schoenleinii and C. anchorago respectively, at ~9.5 Ma. All other species in the two sub-clades are narrower ranging. The first sub-clade (Figure 5.6a), containing C. schoenleinii, is represented by three Australian endemics with C. cephalotes first splitting from the group at the Miocene-Pliocene junction (~5.4 Ma). The widespread C. schoenleinii then diverged from sister species C. cauteroma and C. rubescens, allopatrically distributed along the west Australian coastline, during the Pliocene (~1.7Ma) followed by separation of the two sister species (~0.6 Ma). The second sub-clade comprises only three species (Figure 5.6b). The more cosmopolitan C. anchorago is sister to the clade comprising C. cyanodus, an Australian endemic, and C. oligacanthus, found across the Philippines and Sunda shelf. It is possible C. oligacanthus also occurs in New Caledonia (Cabanban et al. 2010), however this observation is not substantiated in other sources (Allen & Erdmann 2012; Westneat 2001).

5.4.2.4 Clade 4

Clade 4 comprises only C. fasciatus and the Australian endemic C. vitta (Figure 5.6d). These two species diverged in the mid- to late-Miocene (~8.3 Ma).

94 CHAPTER 5

a 40°

30° Choerodon rubescens 20° Choerodon cauteroma Choerodon schoenleinii 10° Choerodon cephalotes Choerodon 0° 10°

20° 30°

90° 100° 110° 120° 130° 140° 150° 160° 170°

b 40°

30° Choerodon anchorago 20° Choerodon oligacanthus Choerodon cyanodus 10° Choerodon 0°

10°

20°

30°

80° 90° 100° 110° 120° 130° 140° 150° 160° 170° c 0°

10°

20°

Choerodon 30°

40° Choerodon venustus

110° 120° 130° 140° 150° 160° d 40°

30°

Choerodon fasciatus 20° Choerodon vitta 10° Choerodon 0°

10°

20°

30°

90° 100° 110° 120° 130° 140° 150° 160° 170° 180° Figure 5.6 Phylogeographic relationships across clades 3 and 4 showing a) C. cauteroma, C. cephalotes, C. rubescens and C. schoenleinii. b) C. anchorago, C. cyanodus and C. oligacanthus, c) C. venustus and d) C. fasciatus and C. vitta.

95 CHAPTER 5

5.4.3 Inferring ancestral biogeography, habitat preference & body size

Predicted distributions for ancestral nodes across clades 3 and 4 predominantly centre on the Australian continent whereas clades 1 and 2 show greater probability of occupying regions of Indonesia and the North-west Pacific (Figure 5.3). Habitat associations between endemic versus more cosmopolitan groups appear to have distinct trends as fewer endemics occupy both reef and non-reef environments than widespread species (Figure 5.7 & 5.8). For example, endemics found along the Coral Sea region of Australia’s east coast (C. venustus and C. frenatus) are reef associated and C. monostigma, found predominantly in the Gulf of Carpentaria, occupies sand and weedy habitats. All species in clade 1 appear to reach a maximum body size of less than 25cm, accounting for the majority of the smaller Choerodon species (Figure 5.9).

Choerodon cf margaritiferus

Endemic Choerodon gomoni ?

Widespread Choerodon sp A

Choerodon jordani

Choerodon frenatus

Choerodon sugillatum

Xiphocheilus typus

Choerodon robustus

Choerodon zamboangae

Choerodon azurio

Choerodon monostigma

Choerodon rubescens

Choerodon cauteroma

Choerodon schoenleinii

Choerodon cephalotes Choerodon anchorago

Choerodon oligacanthus

Choerodon cyanodus

Choerodon venustus

Choerodon fasciatus

Choerodon vitta Habitat Association Non-reef Non-reef/Reef Rocky/Coral reef

Figure 5.7 Habitat associations across the Choerodon group classified as non-reef and reef environments. Closed circles represent endemic species and open circles represent widespread species.

96 CHAPTER 5

5

4

3 Endemic 2 Widespread

1

0 Non-reef Non-reef & reef Coral/Rocky Reef

Figure 5.8 Bar graph showing habitat associations for endemic and widespread species.

Choerodon cf margaritiferus

Choerodon gomoni Choerodon sp A

Choerodon jordani

Choerodon frenatus

Choerodon sugillatum Xiphocheilus typus

Choerodon robustus

Choerodon zamboangae

Choerodon azurio

Choerodon monostigma

Choerodon rubescens

Choerodon cauteroma

Choerodon schoenleinii

Choerodon cephalotes

Choerodon anchorago

Choerodon oligacanthus

Choerodon cyanodus

Choerodon venustus

Choerodon fasciatus

Choerodon vitta

Maximum Size (cm) <25 26-50 51-100 Figure 5.9 Maximum size for Choerodon species grouped into 25cm intervals.

97 CHAPTER 5

5.5 DISCUSSION

5.5.1 Taxonomic & phylogenetic implications

The present phylogenetic hypotheses and phylogeographic reconstructions build on well-supported topological relationships across the hypsigenyini tribe (Figure 5.2). The Choerodon group was not recovered as monophyletic due to the nested placement of the monotypic Xiphocheilus typus. Some Choerodon species have previously been placed in Xiphocheilus by Günther in the 1860s (or Xiphochilus; e.g. C. fasciatus, C. gymnogenys, and C. robustus, Eschmeyer 2012) suggesting this relationship may not be entirely novel. However, this could also be coincidental. The rest of the hypsigenyini topology presented is largely congruent with a hypothesis originally proposed by Westneat et al. (2005), with the exception that Achoerodus is ancestral to Pseudodax rather than sister to it.

5.5.2 Evolutionary origins

Interpreting evolutionary trajectories from phylogenetic and phylogeographic inferences can be problematic as extinct species, incomplete distribution ranges and missing data may negatively influence the evolutionary signal within the molecular data. While these uncertainties cannot be accounted for in the following interpretations, the influence of missing taxa is considered minimal given the level of taxonomic coverage across this group. Members of the family Odacidae represent the sister group to Choerodon questioning the validity of their family level status (Figure 5.2). Odacids are endemic to shallow temperate Australian and New Zealand seas, suggesting an initial ancestral split separated tropical and temperate groups at the onset of the Miocene (~21.9 Ma; Figure 5.3). This period coincides with the arrival of the Australian Plate into the region (Hall 2009), whose tectonic convergence formed extensive shallow water environments across the tropical IAA. It may be that ancestral Choerodon arrived on the Australian Plate and subsequently migrated through these newly formed dispersal pathways to invade and occupy regions of the tropical IWP while their sister group, the Odacines, remained locked in the cooler, high latitude climate. Alternatively, the converse may have occurred. This alternative scenario would have seen ancestral Odacines invading the high latitude environments as the Australian continent converged on the region along with many other tropical species that are reported to have infiltrated the southern fauna at this time (O'Hara & Poore 2000; Wilson & Allen 1987).

98 CHAPTER 5

5.5.3 The geography of speciation

The majority of widely distributed species are closely related to one or more narrow- ranging endemics (Figure 5.7), the vast majority of which occupy Australian waters (Figures 5.4-5.6). These observed patterns correspond to expectations of the centrifugal speciation hypothesis where peripheral endemics represent isolates formed during the successive contraction phases of the more widespread species. For example, ancestral C. robustus within clade 2 (Figure 5.5) may have acted as the ‘parent species’ to this clade with C. monostigma and C. azurio constituting remnant forms of earlier peripheral isolates through the mid- Miocene and Plio-Pleistocene respectively. Sister species, C. zamboangae, appears to have then separated in the more recent Pleistocene. Similar diversification patterns observed in Anampses across this region were thought to represent ‘peripheral budding’ (Hodge et al. 2012), a process analogous to the centrifugal speciation hypothesis. The same processes may also explain patterns in Macropharyngodon, where widespread, central species are sister to peripheral endemics (Read et al. 2006). Applying the same logic to the other Choerodon clades, it may be that the Australian species, where the majority of the endemics reside, represent peripheral isolates that successively split from their more widespread parent groups occupying broader regions of the IWP. The RASP analysis draws on this to infer a predominantly Austral origin for the ancestors of the group. Considering that species of the sister group to Choerodon, the odacins, occupy temperate Australian and NZ waters (Clements et al. 2004) it is feasible that their MRCA did indeed occupy the Australian continent. In addition, the ancestral relationship of the Achoerodus genus in the hypsigenyini tribe (Figure 5.1) lends some weight to a high latitude origin as this genus is endemic to southern Australian waters (Gomon et al. 2008). However, neither a high latitude nor low latitude origin for this group can be excluded.

5.5.4 Evolutionary drivers

Climate driven coastline contractions appear to be significant in the evolutionary histories of diverse groups across this region e.g. stingrays (Puckridge et al. 2013b), fishes (Fitzpatrick et al. 2011), seastars (Crandall et al. 2008). This is particularly evident in the IAA where groups exist in allopatrically separated locations either side of intermittent land barriers (Carpenter et al. 2011). In contrast to many of these studies, this form of climate driven divergence is not clearly evident across Choerodon as many species are distributed sympatrically, with ranges that often overlap entirely with closely related congeners (Figures 5.4-5.6). Range shifts often obscure the geography of speciation. Attempts to determine mode of speciation should therefore target recently diverged sister species (Barraclough & Nee

99 CHAPTER 5

2001). Comparison among the great majority of fishes suggests vicariant speciation is typical, as most recently diverged groups tend to be allopatrically distributed (Barraclough & Vogler 2000). However, parapatric speciation may also be common in reef fishes (Rocha & Bowen 2008) and there are increasing observations of sympatric speciation in the marine environment (e.g. Crow et al. 2010; Vallejo 2005). Nonetheless, vicariant process may explain some instances of diversification patterns across Choerodon. For example the sister species C. fasciatus and C. vitta probably separated due to the influence of the Torres Strait intermittent landbridge, exposed during glacial sea level lows (Figure 5.6d). This is considered responsible for diversification across an array of marine groups occupying shelf environments (Mirams et al. 2011). Additionally, the apparent infiltration of the western Australian endemic, C. rubescens, into southern waters separates from its sister species C. cauteroma around the North West Cape (Figure 5.6a). The continental shelf tapers into a narrow corridor in this region, with glacial sea level lows assumed to have limited passage of shallow water groups north and south of this barrier (Puckridge et al. 2013b). Therefore, loss of this corridor during Pliocene climatic oscillations may be responsible for their recent, allopatric separation.

5.5.5 Habitat association

Little is known of the dispersal potential of Choerodon species. The majority appear to be protogynous (undergo female to male sex inversion), with some species congregating into small spawning aggregations during the breeding season e.g. C. rubescens (Fairclough & Cornish 2004). Dispersal potential of broadcast spawners may be high, leading to high potential for range expansion and colonisation of new areas under favourable conditions. However, realised dispersal is not directly correlated to larval duration as many factors influence settlement (Jones et al. 2009). Interestingly, the present results suggest an association between range extent and the diversity of exploitable habitats with widespread Choerodon species generally utilising a broader range of habitat types (although C. robustus for example, appears to be an exception to this trend). Narrow-ranging species, on the other hand, tend towards more specialised habitats (Figure 5.8). Despite the coarse assessment of habitat associations across Choerodon species in the present study, clear partitioning between closely related species is observed. Where differences are not observed, finer scale factors that reduce competition are likely at play. For example, a detailed assessment of habitat partitioning among species in clade 4 (C. rubescens, C. cauteroma, C. schoenleinii, C. cephalotes and C. cyanodus) in Western Australia showed that congeners preferentially occupy separate environments (Fairclough et al. 2008). This is evident in the habitat partitioning of sister species C. cauteroma and C. rubescens. Both inhabit reefs, yet the two species segregate into inner versus outer reefs respectively.

100 CHAPTER 5

Similarly, the peripheral endemics C. monostigma (northern Australia) occupies sand and weedy habitats while C. azurio (northwest Pacific) occupies inner coral and rocky reefs <50 m. Both are almost entirely separate environments to that of C. robustus, found on deeper coral and rocky reefs >40 m. Interestingly, C. zamboangae, appears to overlap with sister species C. robustus in both distribution and habitat type as it too occupies deep outer reefs. Morphological differences between these two species are subtle, leading to confusion about their validity as separate species. Mabuchi et al. (2002) investigated the two species as separate colour morphs of C. robustus and Cabanban et al. (2010) suggested that C. zamboangae may simply be the misidentified male form of C. robustus. The present study establishes genetic differentiation in both the mitochondrial and nuclear genomes supporting their current taxonomy and designation as separate species.

5.5.6 Conclusions

Evolutionary patterns across Choerodon, where widespread species appear to have fostered peripheral endemics, are consistent with expectations of centrifugal speciation. However, unlike the vicariant patterns observed in a number of other groups across this region that suggest sea level fluctuations have been instrumental in species formation (e.g. Barber et al. 2006; Puckridge et al. 2013a; Puckridge et al. 2013b), there is little evidence that this process is acting as a primary agent in the evolution of the tuskfishes. Either other evolutionary forces, such as sympatric speciation, are working on this group, or current distributions are the result of expansion and subsequent distributional overlap following a previous contraction phase. In addition to observed phylogeographic patterns, widespread species appear to generally exploit a broader range of habitat types while endemics tend towards more specialised environments. These characteristics are also indicative of predictions under centrifugal speciation where peripheral isolates are expected to specialise sufficiently or risk being outcompeted by expansion of the widespread sister species following speciation (Briggs 2000; Brown 1957). Current information on the habitat associations of Choerodon species likely comes from localised observations. Determining the extent by which widespread species versus narrower ranging endemics modify their habitat use during interactions with congeners and across their distributions would be an important next step to determine the role interspecific competition may play in maintaining niche conservatism within this group. This information may also lead to insights into the likelihood that sympatric versus allopatric processes are fuelling diversity in the tuskfishes.

101 CHAPTER 6

“It is that range of biodiversity that we must care for - the whole thing - rather than just one or two stars” David Attenborough

102 CHAPTER 6

6.1 DISCUSSION

The phylogeny and phylogeography of demersal fishes in the present thesis highlights key processes relevant to our continued enquiry into the evolutionary mechanisms responsible for marine biodiversity patterns across the IWP. As marine biodiversity hotspots typically centre on regions of converging tectonic plates (Renema et al. 2008), the influx of species lineages into the central IAA biodiversity hotspot may be traced back to the tectonic evolution of the area, a history dominated by the convergence of the Eurasian, Philippine and Australian Plates (Hall 2002). A common ancestral thread associated with the Australian Plate emerges in all three focus groups - the flatheads (platycephalins), maskrays (Neotrygon) and tuskfishes (Choerodon). This suggests that many ancestral lineages may have arrived to the region via tectonic rafting, highlighting the potential contribution of the Australian biota in fuelling this mega-diverse region. This Austral link is most clearly evident in the platycephalins, whose ancestral lineages appear to associate with high latitude temperate regions (Figure 4.3), suggesting tropical, low latitude colonisation. It is harder to see such clear patterns in the maskrays and tuskfishes, as both groups are primarily confined to tropical regions, with recent infiltration into higher latitudes observed in recently derived Choerodon lineages (Figure 5.6a). If we delve deeper into the ancestral relationships in the hypisgenyini labrid tribe, more similar patterns to those observed in the platycephalins emerge, as the sister group to Choerodon, the Odacidae, are endemic to southern Australian and New Zealand waters (Clements et al. 2004). The basal relationship of the blue gropers (Achoerododus) to most of the hypsigenyini (Figure 5.1) only further substantiates this as they are similarly endemic to southern Australia (Gomon et al. 2008). Ancestral relationships in the maskrays yield a different pattern with Taeniura distributed across the tropical IWP belt (Last & Stevens 2009). Despite this, the Neotrygon ancestral lineages and centre of diversity both overlap on the Australian Plate. Conflicting divergence dates either place the MRCA to this group in the Eocene or early- to mid-Miocene (Figure 2.5 and 2.6). The former might allow for an early split from a pan-Tethyan ancestral population followed by tectonic rafting, similar to what may have occurred in the flathead and tuskfishes. The latter suggests origination in the IAA at the time Australia converged on the region. A pulse in diversification following this collision is evident in other groups (Williams & Duda 2008) suggesting both scenarios are equally plausible. Tectonic convergence at the onset of the Miocene formed vast areas of shallow water habitat (Hall 2002), connecting the Australian Plate with large expanses of the IWP, offering

103 CHAPTER 6 dispersal pathways for shallow water lineages through jump-dispersal events. Subsequent lineage divergences indicate climate shifts have played a significant role in driving vicariance. This is evident at both low and high latitudes, with ancestral populations splitting along emergent barriers in both the flathead and maskrays (Figures 2.3, 4.3 & 4.4). The mosaic of island groups that make up the tropical IAA appear to offer unique structural elements that not only host a rich variety of habitats, but appear to foster multiple refugia and dispersal barriers during glacial coastline contractions (Mora et al. 2003). This is most evident in the Neotrygon kuhlii and Platycephalus indicus species complexes with major cladogenesis between the Indian and Pacific Oceans either side of the Sunda Arc and Torres Straight (Figures 2.3 & 4.4). Observed patterns are indicative of centrifugal speciation (Brown 1957); a process that would see wide ranging populations bud isolates during contraction phases like those expected during glacial low stands. The amount of lineage diversification appears to relate to the apparent distribution of ancestral populations; those that occupy larger expanses, foster greater lineage diversification (i.e. Figures 2.4, 4.2d & 4.3c versus Figures 2.3, 4.2a & 4.4). Therefore, the combination of a heterogeneous environment, offering multiple refugia, and the large area of the tropical band, allowing favourable conditions for wide ranging species, appears to be a key component to the extremely high levels of diversity across this region. Species distributions here tend to be very extensive. Coral reef fish species of the IWP cover an average of ~9,357,070 km2 (Allen 2008) with their midpoint range often overlapping with the central IAA (Mora et al 2003). In contrast, narrow-ranging endemics tend towards peripheral areas (Allen 2008; Hughes et al. 2002). Congruent divergence patterns across the tropical IWP maskrays and flathead suggest the same vicariant processes are fostering diversity across whole suites of species (e.g. Figure 3.2), a finding that gains support from a variety of additional taxa (Carpenter et al. 2011). However, vicariant events are less discernible in the Choerodon tuskfishes despite a major cladogenesis event in the group separating clades 1 & 2 from clades 3 & 4 near the mid Miocene climate shift (Figure 5.3), a period that may have been highly influential in the diversification of maskrays (Figure 2.5) and flatheads (Figures 4.2 & 4.4). Unlike observed patterns in the N. kuhlii and P. indicus complexes, this initial cladogenesis in the Choerodon does not partition clearly into Indian and Pacific Ocean groups (Figure 5.3). Most Choerodon species share overlapping ranges with congeners, suggesting they either diverged via sympatric processes or their vicariant separation has been obscured by range shifts. No Choerodon species was sampled as extensively as the P. indicus and N. kuhlii groups. However, individuals of C. schoenleinii were sampled across ~5,500 kms, showing minimal intra-specific variation in the COI marker. This finding supports their current taxonomic assignment, suggesting that the large geographical distribution in this species is

104 CHAPTER 6 unlikely to be harbouring the cryptic species diversity evident in the N. kuhlii and P. indicus complexes, despite occupying similar ranges. This may be due to higher levels of genetic connectivity, a product of different dispersal capabilities in different taxa. Little is known of larval duration or dispersal potential across Choerodon species. Nonetheless, relationships across this group bare some resemblance to expected patterns under centrifugal speciation, with widespread species related closely to a number of narrow-ranging endemics. Additionally, congruent morphological and molecular findings suggest that a portion of undescribed Choerodon species have remained undiscovered in the IAA region until recently (i.e. C. cf. margaritiferus and C. sp. A; W. White pers. comm.). Different evolutionary processes developing present day diversity patterns of the IWP have likely been dominant across different periods of geological time. For example, early tectonic convergence of the Australian Plate would have offered opportunities for tectonic rafting of austral fauna and patterns in the platycephalin flathead lineage (Figures 4.3 & 4.4) suggest they have responded to this process. These early infiltrations fit expectations of the Theory of Accumulation. However, more recent glacio-eustatic sea level oscillations appear to have played a substantial role in lineage diversifications through the mid-Miocene to Pleistocene. Signatures of lowered sea level, cultivating divergent lineages across multiple refugia, is repeatedly observed across groups in the present study and a variety of additional taxa (e.g. Carpenter et al. 2011). These fostered patterns are consistent with predictions of centrifugal speciation and support a Centre of Origin theory. In contrast to the Theory of Accumulation and Centre of Origin theory, support for the Theory of Overlap is less clear in the present study. While separation of Indian and Pacific Ocean lineages have undoubtedly developed either side of the Sunda Arc and Torres Strait regions, these are not adequately explained by this theory as multiple, additional lineages are frequently observed across the region. Studies that support the Theory of Overlap often suffer from a lack of detailed sampling. For example, Hubert et al. (2012) found divergent lineages between samples from peripheral regions of the IWP and invoked this theory to explain regional diversity patterns despite a complete absence of sampling within or around the central hotspot of diversity. Parallel patterns to those of Hubert et al. (2012) would be observed in the present datasets had all samples from the IAA and adjacent regions been removed.

105 CHAPTER 6

6.2 CONCLUSIONS

Determining whether the IAA centre of diversity is predominantly acting as a Centre of Origin, as it appears to be from the findings in the present study, could have profound implications for the potential of future evolutionary lineages across the region and is of central importance to future management efforts. This area is host to some of the most densely populated human settlements causing degradation of biologically productive habitat from nutrients and other pollutants entering the environment from terrestrial agriculture, deforestation and development as well as intense fishing pressure and practices that use dynamite and poisons (Roberts et al. 2002). All these pressures threaten the continuation of this area as a rich evolutionary source. With advances in technologies allowing access to larger datasets and more computational power, additional studies similar to those carried out in the present thesis will further efforts in building up the tree of life, increasing resolution on the generality of observed patterns and ultimately help to better resolve these long standing questions on the key evolutionary mechanisms responsible for driving diversity patterns. However, a key first step to achieving an understanding of past and future diversity drivers may be to simply map the diversity of life that exists today. Fishes are by far the most well documented marine taxa, particularly for shallow water groups, with small species such as blennies and gobies considered to be the main groups harbouring undescribed species in these environments (Eschmeyer et al. 2010). High levels of cryptic diversity were found in the present study within large, shallow water taxa, many that are of commercial interest and therefore highly conspicuous. These observations may have profound implications for our diversity estimates, implying that extraordinarily high levels of unrecognised, cryptic species await discovery across the region. Unaccounted- for diversity is a fundamental concern for our understanding of evolutionary processes, the efficacy of conservation efforts and global diversity estimates (Bickford et al. 2007). Should the findings in this study prove to be indicative of the degree to which species numbers are underestimated, we may be a long way off attaining a simple, baseline understanding of the true diversity of life at stake.

106 C

7.1 REFERENCES

Alfaro ME, Brock CD, Banbury BL, Wainwright PC (2009) Does evolutionary innovation in pharyngeal jaws lead to rapid lineage diversification in labrid fishes? BMC Evolutionary Biology 9, 255. Ali A, Hilmi AH, Gambang AC, Sade A, Razak SA (2004) Elasmobranch resources, utilization, trade and management in Malaysia. Marine Fishery Resources Development and Management Department Kuala Terengganu, Malaysia. Aljanabi SM, Martinez I (1997) Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acids Research 25, 4692- 4693. Allen AP, Gillooly JF (2006) Assessing latitudinal gradients in speciation rates and biodiversity at the global scale. Ecology Letters 9, 947-954. Allen GR (2008) Conservation hotspots of biodiversity and endemism for Indo- Pacific coral reef fishes. Aquatic Conservation: Marine and Freshwater Ecosystems 18, 541-556. Allen GR, Erdmann MV (2012) Reef fishes of the East Indies. Volumes I-III. University of Hawai'i Press, Hawaii. Almany GR, Berumen ML, Thorrold SR, Planes S, Jones GP (2007) Local replenishment of coral reef fish populations in a marine reserve. Science 316, 742-744. Andreakis N, Luter HM, Webster NS (2012) Cryptic speciation and phylogeographic relationships in the elephant ear sponge Ianthella basta (Porifera, Ianthellidae) from northern Australia. Zoological Journal of the Linnean Society 166, 225- 235. Avise JC (2009) Phylogeography: retrospect and prospect. Journal of Biogeography 36, 3-15. Ballard JWO, Whitlock MC (2004) The incomplete natural history of mitochondria. Molecular Ecology 13, 729-744. Bandelt H-J, Forster P, Röhl A (1999a) Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution 16, 37-48. Bandelt HJ, Forster P, Röhl A (1999b) Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution 16, 37-48. Barber PH, Bellwood DR (2005) Biodiveristy hotspots: evolutionary origins of biodiversity in wrasses (Halichoeres: Labridae) in the Indo-Pacific and new world tropics. Molecular Phylogenetics and Evolution 35, 235-253. Barber PH, Erdmann MV, Palumbi SR (2006) Comparative phylogeography of three codistributed stomatopods: origins and timing of regional diversification in the Coral Triangle. Evolution 60, 1825-1839.

107 C

Barber PH, Palumbi SR, Erdmann MV, Moosa MK (2002) Sharp genetic breaks among populations of Haptosquilla pulchella (Stomatopoda) indicate limits to larval transport: patterns, causes, and consequences. Molecular Ecology 11, 659-674. Barnosky AD, Matzke N, Tomiya S, et al. (2011) Has the Earth's sixth mass extinction already arrived? Nature 471, 51-57. Barraclough TG, Nee S (2001) Phylogenetics and speciation. Trends in Ecology & Evolution 16, 391-399. Barraclough TG, Vogler AP (2000) Detecting the geographical pattern of speciation from species-level phylogenies. American Naturalist 155, 419-434. Bellwood DR (1990) A new fossil fish Phyllopharyngodon longipinnis gen. et sp. nov.(family labridae) from the Eocene, Monte Bolca, Italy. . Studi e ricerche sui giacimenti terziari di Bolca 6, 149-160. Bellwood DR, Meyer CP (2009a) Endemism and evolution in the Coral Triangle: a call for clarity. Journal of Biogeography 36, 2010-2012. Bellwood DR, Meyer CP (2009b) Searching for heat in a marine biodiversity hotspot. Journal of Biogeography 36, 569-576. Bellwood DR, Wainwright PC, Fulton CJ, Hoey AS (2006) Functional versatility supports coral reef biodiversity. Proceedings of the Royal Society B: Biological Sciences 273, 101-107. Bickford D, Lohman DJ, Sodhi NS, et al. (2007) Cryptic species as a window on diversity and conservation. Trends in Ecology & Evolution 22, 148-155. Briggs JC (1974) Operation of Zoogeographic barriers. Systematic Zoology 23, 248- 256. Briggs JC (2000) Centifugal speciation and centres of origin. Journal of Biogeography 27, 1183-1188. Briggs JC (2003) Marine centres of origin as evolutionary engines. Journal of Biogeography 30, 1-18. Briggs JC (2005) The marine East Indies: diversity and speciation. Journal of Biogeography 32, 1517-1522. Briggs JC (2009) Diversity, endemism and evolution in the Coral Triangle. Journal of Biogeography 36, 2009-2010. Brown WL (1957) Centrifugal speciation. Quarterly Review of Biology 32, 247-277. Cabanban A, Pollard D, Choat JH, Russell B (2010) Choerodon zamboangae. In: IUCN Red List of Threatened Species. IUCN 2012 . Caputi L, Andreakis N, Mastrototaro F, et al. (2007) Cryptic speciation in a model invertebrate chordate. Proceedings of the National Academy of Sciences 104, 9364-9369. Carpenter KE (1998) An introduction to the oceanography, geology, biogeography, and fisheries of the tropical and subtropical Western and Central Pacific. In: FAO Species Identification Guide for Fishery Purposes. The living marine

108 C

resources of the Western Central Pacific. Volume 1. Seaweeds, corals, bivalves and gastropods (eds. Carpenter KE, Niem VH), pp. 1-17. FAO, Rome. Carpenter KE, Barber PH, Crandall ED, et al. (2011) Comparative phylogeography of the Coral Triangle and implications for marine management. Journal of Marine Biology 2011, Article ID 396982 Clements KD, Alfaro ME, Fessler JL, Westneat MW (2004) Relationships of the temperate Australasian labrid fish tribe Odacini (Perciformes; Teleostei). Molecular Phylogenetics and Evolution 32, 575-587. Colborn J, Crabtree RE, Shaklee JB, Pfeiler E, Bowen BW (2001) The evolutionary enigma of bonefishes (Albula spp.): cryptic species and ancient separations in a globally distributed shorefish. Evolution 55, 807-820. Compagno LJV (1999) General remarks: batoid fishes. In: FAO Species Identification Guide for Fishery Purposes. The Living Marine Resources of the Western Central Pacific (eds. Carpenter KE, Niem VH), pp. 1309-1400. FAO, Rome. Compagno LJV, Heemstra PC (1984a) Himantura draco, a new species of stingray (Myliobatiformes: Dasyatidae) from South Africa, with a key to the Dasyatidae and the first record of Dasyatis kuhlii (Müller & Henle, 1841) from Southern Africa. J.L.B.Smith Institute of Ichthyology, Special Publication 33, 17. Compagno LJV, Heemstra PC (1984b) Himantura draco, a new species of stingray (Myliobatiformes: Dasyatidae) from South Africa, with a key to the Dasyatidae and the first record of Dasyatis kuhlii (Müller & Henle, 1841) from southern Africa. J.L.B. Smith Institute of Ichthyology Special Publication 33, 1-17. Corrigan S, Beheregaray LB (2009) A recent shark radiation: Molecular phylogeny, biogeography and speciation of wobbegong sharks (family: Orectolobidae). Molecular Phylogenetics and Evolution 52, 205-216. Cowman PF, Bellwood DR, van Herwerden L (2009) Dating the evolutionary origins of wrasse lineages (Labridae) and the rise of trophic novelty on coral reefs. Molecular Phylogenetics and Evolution 52, 621-631. Crame JA (2001) Taxonomic diversity gradients through geological time. Diversity and Distributions 7, 175-189. Crandall ED, Jones ME, Munoz MM, et al. (2008) Comparative phylogeography of two seastars and their ectosymbionts within the Coral Triangle. Molecular Ecology 17, 5276-5290. Crawford DR, Breder CM, Jr. (1922) Notes on the preservation of the colors of fishes. Copeia, 25-30. Crow KD, Munehara H, Bernardi G (2010) Sympatric speciation in a genus of marine reef fishes. Molecular Ecology 19, 2089-2105.

109 C

Dawson MN (2005) Incipient speciation of Catostylus mosaicus (Scyphozoa, Rhizostomeae, Catostylidae), comparative phylogeography and biogeography in south-east Australia. Journal of Biogeography 32, 515-533. Dibattista JD, Feldheim KA, Thibert-Plante X, Gruber SH, Hendry AP (2008) A genetic assessment of polyandry and breeding-site fidelity in lemon sharks. Molecular Ecology 17, 3337-3351. Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry Bulletin 19, 11-15. Drummond AJ, Ho SYW, Phillips MJ, Rambaut A (2006) Relaxed phylogenetics and dating with confidence. PloS Biology 4, e88. Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7, 214. Dudgeon CL, Broderick D, Ovenden JR (2009) IUCN classification zones concord with, but underestimate, the population genetic structure of the zebra shark Stegostoma fasciatum in the Indo-West Pacific. Molecular Ecology 18, 248- 261. Dynesius M, Jansson R (2000) Evolutionary consequences of changes in species' geographical distributions driven by Milankovitch climate oscillations. Proceedings of the National Academy of Sciences 97, 9115-9120. Eastman JT, McCune AR (2000) Fishes on the Antarctic continental shelf: evolution of a marine species flock? Journal of Fish Biology 57, 84-102. Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32, 1792-1797. Edwards SV, Beerli P (2000) Perspective: gene divergence, population divergence, and the variance in coalescence time in phylogeographic studies. Evolution 54, 1839-1854. Edwards SV, Liu L, Pearl DK (2007) High-resolution species trees without concatenation. Proceedings of the National Academy of Sciences of the United States of America 104, 5936-5941. Ekman S (1953) Zoogeography of the sea Sidwick and Jackson, London. Erwin DH (2008) Extinction as the loss of evolutionary history. Proceedings of the National Academy of Sciences of the United States of America 105, 11520- 11527. Eschmeyer WN (2012) Catalog of Fishes. California Academy of Sciences. http://research.calacademy.org/research/ichthyology/catalog/fishcatmain.asp. Eschmeyer WN, Fong JD (2012) Species of fish by family/subfamily. In: Catalogue of Fishes. http://research.calacademy.org/research/ichthyology/catalog/SpeciesByFamily .asp. Eschmeyer WN, Fricke H, Fong JD, Polack A (2010) Marine fish diversity: history of knowledge and discovery (Pisces). Zootaxa 2525, 19-50.

110 C

Eschmeyer WN, Fricke R (2012) Catalog of Fishes electronic version. http://research.calacademy.org/research/ichthyology/catalog/fishcatmain.asp. Fairbridge WS (1950) The over-fishing of the East Australian trawl fishery. In: Indo- Pacific Fisheries Council Proceedings 2nd Meeting, Cronulla, N.S.W. April 1950., pp. 73-79. Fairclough D (2005) The biology of four tuskfish species (Choerodon: Labridae) in Western Australia, PhD thesis, Murdoch University. Fairclough D, Cornish A (2004) Choerodon rubescens. In: IUCN 2012. IUCN Red List of Threatened Species. IUCN 2012. Fairclough DV, Clarke KR, Valesini FJ, Potter IC (2008) Habitat partitioning by five congeneric and abundant Choerodon species (Labridae) in a large subtropical marine embayment. Estuarine Coastal and Shelf Science 77, 446-456. Felsenstein J (1981) Evolutionary trees from DNA sequences: A maximum likelihood approach. Journal of Molecular Evolution 17, 368-376. Fitzpatrick JM, Carlon DB, Lippe C, Robertson DR (2011) The West Pacific diversity hotspot as a source or sink for new species? Population genetic insights from the Indo-Pacific parrotfish Scarus rubroviolaceus. Molecular Ecology 20, 219- 234. Floeter SR, Ferreira CEL, Dominici-Arosemena A, Zalmon IR (2004) Latitudinal gradients in Atlantic reef fish communities: trophic structure and spatial use patterns. Journal of Fish Biology 64, 1680-1699. France R (1992) The north American latitudinal gradient in species richness and geographical range of freshwater crayfish and amphipods. The American Naturalist 139, 342-354. Frey MA, Vermeij GJ (2008) Molecular phylogenies and historical biogeography of a circumtropical group of gastropods (Genus: Nerita): Implications for regional diversity patterns in the marine tropics. Molecular Phylogenetics and Evolution 48, 1067-1086. Fu XY (1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147, 915-925. Fuhrman JA, Steele JA, Hewson I, et al. (2008) A latitudinal diversity gradient in planktonic marine bacteria. Proceedings of the National Academy of Sciences 105, 7774-7778. Galtier N, Enard D, Radondy Y, Bazin E, Belkhir K (2006) Mutation hot spots in mammalian mitochondrial DNA. Genome Research 16, 215-222. Gaston KJ (2000) Global patterns in biodiversity. Nature 405, 220-227. Gillman LN, Keeling DJ, Ross HA, Wright SD (2009) Latitude, elevation and the tempo of molecular evolution in mammals. Proceedings of the Royal Society B: Biological Sciences 276, 3353-3359.

111 C

Girone A, Nolf D (2009) Fish otoliths from the Priabonian (Late Eocene) of North Italy and South-East France – Their paleobiogeographical significance. Revue de Micropaléontologie 52, 195-218. Golani D (1998) Impact of Red Sea fish migrants through the Suez Canal on the aquatic environment of the Eastern Mediterranean. In: Transformations of Middle Eastern Natural Environments: Legacies and Lessons. Yale University Conference eds. Albert J, Bernhardsson M, Kenna R), pp. 375–387. Gomon M, Bray DJ, Kuiter RH (2008) Fishes of Australia’s Southern Coast New Holland Press, Sydney & Museum Victoria, Chatswood, Australia. Gomon MF (1997) Relationships of fishes of the labrid tribe Hypsigenyini. Bulletin of Marine Science 60, 789-871. Gray CA, Miskiewicz AG (2000) Larval fish assemblages in south-east Australian coastal waters: seasonal and spatial structure. Estuarine, Coastal and Shelf Science 50, 549-570. Gurnis M, Turner M, Zahirovic S, et al. (2012) Plate tectonic reconstructions with continuously closing plates. Computers & Geosciences 38, 35-42. Halas D, Winterbottom R (2009) A phylogenetic test of multiple proposals for the origins of the East Indies coral reef biota. Journal of Biogeography 36, 1847– 1860. Hall R (2001) Cenozoic reconstructions of SE Asia and the SW Pacific: changing patterns of land and sea. Faunal and Floral Migrations and Evolution in Se Asia-Australasia, 35-56. Hall R (2002) Cenozoic geological and plate tectonic evolution of SE Asia and the SW Pacific: computer-based reconstructions, model and animations. Journal of Asian Earth Sciences 20, 353-431. Hall R (2009) Southeast Asia's changing paleogeography. Blumea 54, 148-161(114). Hall R, Cottam MA, Wilson MEJ (2011) The SE Asian gateway: history and tectonics of the Australia-Asia collision. Geological Society, London, Special Publications 355, 1-6. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41, 95-98. Haq BU, Al-Qahtani AM (2005) Phanerozoic cycles of sea-level change on the Arabian Platform. GeoArabia 10, 127-160. Hardenbol J, Thierry J, Farley MB, et al. (1998) Mesozoic and Cenozoic sequence chronostratigraphic framework of European basins. In: SEPM Special Publication Series No. 60 (eds. de Graciansky PC, Hardenbol J, Jaquin T, Vail PR). Society for Sedimentary Geology, Tulsa. Harding G (1960) The competitive exclusion principle. Science 131, 1292-1297. Harpending RC (1994) Signature of ancient population growth in a low-resolution mitochondrial DNA mismatch distribution. Human Biology 66, 591-600.

112 C

Hebert PDN, Cywinska A, Ball SL, deWaard JR (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society of London. Series B: Biological Sciences 270, 313-321. Hebert PDN, Stoeckle MY, Zemlak TS, Francis CM (2004) Identification of birds through DNA barcodes. PloS Biology 2, e312. Hennig W (1966) Phylogenetic systematics University of Illinois Press, Urbana. Hillebrand H (2004) On the generality of the latitudinal diversity gradient. The American Naturalist 163, 192-211. Hillis DM, Huelsenbeck JP (1992) Signal, noise, and reliability in molecular phylogenetic analyses. Journal of Heredity 83, 189–195. Hodge JR, Read CI, van Herwerden L, Bellwood DR (2012) The role of peripheral endemism in species diversification: Evidence from the coral reef fish genus Anampses (Family: Labridae). Molecular Phylogenetics and Evolution 62, 653-663. Hubbs CL (1922) Variations in the number of vertebrae and other meristic characters of fishes correlated with the temperature of water during development. The American Naturalist 56, 360-372. Huber M, Brinkhuis H, Stickley CE, et al. (2004) Eocene circulation of the Southern Ocean: was Antarctica kept warm by subtropical waters? Paleoceanography 19, PA4026?? Hubert N, Hanner R, Holm E, et al. (2008) Identifying Canadian freshwater fishes through DNA barcodes. PLoS ONE 3, e2490. Hubert N, Meyer CP, Bruggemann HJ, et al. (2012) Cryptic diversity in Indo-Pacific coral-reef fishes revealed by DNA-Barcoding provides new support to the Centre-of-Overlap hypothesis. PLoS ONE 7. Hughes DR (1985) Scale morphology and relationships of the flatheads (Pisces: Platycephalidae), Masters thesis, University of Sydney. Hughes TP, Bellwood DR, Connolly SR (2002) Biodiversity hotspots, centres of endemicity, and the conservation of coral reefs. Ecology Letters 5, 775-784. Imamura H (1996) Phylogeny of the family Platycephalidae and related taxa (Pisces: Scorpaeniformes). Species Diversity 1, 123-233. Imamura H (2004) Phylogenetic relationships and new classification of the superfamily Scorpaenoidea (Actinopterygii: Perciformes). Species Diversity 9, 1-36. Imamura H (2007) Rogadius mcgroutheri, a new species of flathead (Teleostei: Platycephalidae) collected from eastern Australia and New Caledonia Ichthyological Research 54, 303-307. Imamura H (2008) Synonymy of two species of the genus Platycephalus and validity of Platycephalus westraliae (Teleostei: Platycephalidae). Ichthyological Research 55, 399-406.

113 C

Imamura H (2010) A new species of the flathead genus Inegocia (Teleostei: Platycephalidae) from East Asia. Bulletin of the National Museum of Nature and Science Series A Zoology, 21-29. Imamura H (2011) Taxonomic status and type specimens of Platycephalus bataviensis; Bleeker 1853 (Teleostei: Platycephalidae). Ichthyological Research 58, 393-397. Imamura H, Gomon MF (2010) Taxonomic revision of the genus Ratabulus (Teleostei: Platycephalidae), with descriptions of two new species from Australia. Memoirs of Museum Victoria 67, 19-33. Imamura H, Knapp LW (2009a) A new species of the flathead genus Onigocia (Teleostei: Platycephalidae) collected from the Coral and Tasman Seas. Zootaxa 2008, 23-28. Imamura H, Knapp LW (2009b) Platycephalus orbitalis, a new species of flathead (Teleostei: Platycephalidae) collected from western Australia. Zootaxa, 57–63. Imamura H, Knapp LW (2009c) Z new species of the flathead genus Onigocia (Teleostei: Platycephalidae) collected from the Coral and Tasman Seas. Zootaxa 1, 23-28. Imamura H, Yoshino T (2009) Authorship and validity of two flatheads, Platycephalus japonicus and Platycephalus crocodilus (Teleostei: Platycephalidae). Ichthyological Research 56, 308-313. Ingram T (2011) Speciation along a depth gradient in a marine adaptive radiation. Proceedings of the Royal Society B-Biological Sciences 278, 613-618. Ivanova NV, Dewaard JR, Hebert PDN (2006) An inexpensive, automation-friendly protocol for recovering high-quality DNA. Molecular Ecology Notes 6, 998- 1002. Ivanova NV, Zemlak TS, Hanner RH, Hebert PDN (2007) Universal primer cocktails for fish DNA barcoding. Molecular Ecology Notes 7, 544–548. Jablonski D (2007) Scale and hierarchy in macroevolution. Palaeontology 50, 87-109. Jablonski D, Roy K, Valentine JW (2006) Out of the tropics: evolutionary dynamics of the latitudinal diversity gradient. Science 314, 102-106. Jacobsen IP, Bennett MB (2010) Age and growth of Neotrygon picta, Neotrygon annotata and Neotrygon kuhlii from north-east Australia, with notes on their reproductive biology. Journal of Fish Biology 77, 2405-2422. Johnson RH, Nelson DR (1978) Copulation and possible olfaction-mediated pair formation in two species of Carcharhinid sharks. Copeia 1978, 539-542. Jones GP, Almany GR, Russ GR, et al. (2009) Larval retention and connectivity among populations of corals and reef fishes: history, advances and challenges. Coral Reefs 28, 307-325. Kajiura SM, Sebastian AP, Tricas TC (2000) Dermal bite wounds as indicators of reproductive seasonality and behaviour in the Atlantic stingray, Dasyatis sabina. Environmental Biolgoy of Fishes 58, 23-31.

114 C

Keenan CP (1988) Systematics and evolution of Australian species of flatheads (Pisces, Platycephalidae), University of Queensland. Keenan CP (1991) Phylogeny of Australian species of flathead (Teleostei, Platycephalidae) as determined by allozyme electrophoresis. Journal of Fish Biology 39, 237-249. Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotid sequences. Journal of Molecular Evolution 15, 111-120. Kimura M (1985) Back-arc rifting in the Okinawa Trough. Marine and Petroleum Geology 2, 222-240. Kindlmann P, Schödelbauerová I, Dixon AF (2007) Inverse latitudinal gradients in species diversity. In: Scaling biodiversity (eds. D. S, Marquet PA, Brown JH), pp. 246–257. Cambridge University Press, Cambridge. Knapp LW (1986) Family No. 155: Platycephalidae. In: Smith's sea fishes. (eds. Smith MM, Heemstra PC), pp. 482-486. Springer-Verlag, Macmillan. Knapp LW (1999) Family Platycephalidae. In: FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 4. Bony fishes part 2 (Mugilidae to Carangidae). eds. Carpenter KE, Niem VH), pp. 2385-2421. FOA, Rome. Knapp LW, Imamura H (2004) Sunagocia sainsburyi, a new flathead fish (Scorpaeniformes : Platycephalidae) from northwestern Australia. Proceedings of the Biological Society of Washington 117, 545-550. Knowlton N (1993) Sibling species in the sea. Annual Review of Ecology and Systematics 24, 189-216. Knowlton N (2000) Molecular genetic analyses of species boundaries in the sea. Hydrobiologia 420, 73-90. Kraft NJB, Comita LS, Chase JM, et al. (2011) Disentangling the drivers of ß diversity along latitudinal and elevational gradients. Science 333, 1755-1758. Kumar S (2005) Molecular clocks: four decades of evolution. Nature Reviews - Genetics 6, 654-662. Ladd HS (1960) Origin of the Pacific island molluscan fauna. American Journal of Science 258, 137-150. Lappalainen J, Soininen J (2006) Latitudinal gradients in niche breadth and position— regional patterns in freshwater fish. Naturwissenschaften 93, 246-250. Lara A, Ponce de León JL, Rodríguez R, et al. (2010) DNA barcoding of Cuban freshwater fishes: evidence for cryptic species and taxonomic conflicts. Molecular Ecology Resources 10, 421-430. Larmuseau MHD, Raeymaekers JAM, Hellemans B, Van Houdt JKJ, Volckaert FAM (2010) Mito-nuclear discordance in the degree of population differentiation in a marine goby. Heredity 105, 532-542.

115 C

Last PR, Stevens JD (2009) Sharks and Rays of Australia CSIRO Publishing, Melbourne. Last PR, White WT (2008) Resurrection of the genus Neotrygon Castelnau (Myliobatoidei: Dasyatidae) with the description of Neotrygon picta sp. nov., a new species from northern Australia. In: Descriptions of New Australian Chondrichthyans (eds. Last PR, White WT, Pogonoski JJ), pp. 315-325. CSIRO Marine and Atmospheric Research. Last PR, White WT, Puckridge M (2010) Neotrygon ningalooensis n. sp. (Myliobatoidei: Dasyatidae), a new maskray from Australia. Aqua, International Journal of Ichthyology 16, 37-50. Li C, Ortí G, Zhang G, Lu G (2007) A practical approach to phylogenomics: the phylogeny of ray-finned fish (Actinopterygii) as a case study. BMC Evolutionary Biology 7, 44. Librado P, Rozas J (2009) DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25, 1451-1452. Liedloff A (1999) Mantel nonparametric test calculator. Version 2.0. School of Natural Resource Sciences. Queensland University of Technology, Brisbane. Liu A, Pollard D, Russell B, Myers R, Sadovy Y (2010) Choerodon cephalotes In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2 . Liu Z, Pagani M, Zinniker D, et al. (2009) Global Cooling During the Eocene- Oligocene Climate Transition. Science 323, 1187-1190. Long JA (1982) The history of fishes on the Australian continent In: The fossil vertebrate record of Australasia (eds. Rich PV, Thompson EM). Monash University Offset Printing Unit, Clayton, Victoria. López AJ, Ryburn JA, Fedrigo O, Naylor GJP (2006) Phylogeny of sharks of the family Triakidae (Carchariniformes) and its implications for the evolution of carcharhiniform placental viviparity. Molecular Phylogenetics and Evolution 40, 50-60. Lourie SA, Green DM, Vincent ACJ (2005) Dispersal, habitat differences, and comparative phylogeography of Southeast Asian seahorses (Syngnathidae: Hippocampus). Molecular Ecology 14, 1073-1094. Lourie SA, Vincent ACJ (2004) A marine fish follows Wallace's Line: the phylogeography of the three-spot seahorse (Hippocampus trimaculatus, Sygnathidae, Teleosti) in Southeast Asia. Journal of Biogeography 31, 1975- 1985. Lovejoy NR (1996) Systematics of myliobatoid elasmobranchs: with emphasis on the phylogeny and historical biogeography of neotropical freshwater stingrays (Potamotrygonidae: Rajiformes). Zoological Journal of the Linnean Society 117, 207-257.

116 C

Lowenstein JH, Amato G, Kolokotronis S-O (2009) The real maccoyii: identifying tuna sushi with DNA barcodes - contrasting characteristic attributes and genetic distances. PLoS ONE 4, e7866. Mabuchi K, Ikeda H, Nakabo T, Nishida M (2002) Genetic comaprison of two Choerodon (Osteichthyes: Perciformes: Labridae) colour-types from the Southern Coasts of Japan. Species Diversity 7. Maddison WP, Maddison DR (2011) Mesquite: a modular system for evolutionary analysis. Version 2.75. http://mesquiteproject.org. Manceau M, Domngues VS, Linnen CR, Rosenblum EB, Hoekstra HE (2010) Convergence in pigmentation at multiple levels: mutations, genes and function. Philosophical Transactions of the Royal Society B 365, 2439–2450. Manni F, Guérard E, Heyer E (2004) Geographic patterns of (genetic, morphologic, linguistic) variation: how barriers can be detected by “Monmonier’s algorithm”. Human Biology 76, 173-190. Marmi J, Vila B, Oms O, Galobart À, Cappetta H (2010) Oldest records of stingray spines (Chondrichthyes, Myliobatiformes). Journal of Vertebrate Paleontology 30, 970-974. Matsubara K, Ochiai A (1955) A revision of the Japanese fishes of the family Platycephalidae (the flatheads). Memoirs of the College of Agriculture Kyoto University No. 68, 1-109. McDowall RM (2008) Jordan’s and other ecogeographical rules, and the vertebral number in fishes. Journal of Biogeography 35, 501-508. McGowran B, Li Q, Padley D, McKirdy DM, Shafik S (1997) Biogeographic impact of the Leeuwin Current in southern Australia since the late middle Eocene. Palaeogeography, Palaeoclimatology, Palaeoecology 136, 19-40. McKenzie KG (1991) Implications of shallow Tethys and the origin of modern oceans. Australian Journal of Systematic Botany 4, 37-40. McMillan WO, Palumbi SR (1995) Concordant evolutionary patterns among Indo- West Pacific butterflyfishes. Proceedings of the Royal Society of London Series B-Biological Sciences 260, 229-236. Meyer A, Kocher TD, Basasibwaki P, Wilson AC (1990) Monophyletic origin of Lake Victoria cichlid fishes suggested by mitochondrial DNA sequences. Nature 347, 550-553. Mirams A, Treml E, Shields J, Liggins L, Riginos C (2011) Vicariance and dispersal across an intermittent barrier: population genetic structure of marine animals across the Torres Strait land bridge. Coral Reefs 30, 1-13. Mittelbach GG, Schemske DW, Cornell HV, et al. (2007) Evolution and the latitudinal diversity gradient: speciation, extinction and biogeography. Ecology Letters 10, 315-331. Mora C, Chittaro PM, Sale PF, Kritzer JP, Ludsin SA (2003) Patterns and processes in reef fish diversity. Nature 421, 933-936.

117 C

Moritz C (1994) Defining evolutionarily significant units for conservation. Trends in Ecology & Evolution 9, 373–375. Naylor GJP, Ryburn JA, Fedrigo O, López JA (2005) Phylogenetic relationships among the major lineages of modern elasmobranches. In: Reproductive Biology and Phylogeny (eds. Hamlett WC, Jamieson BGM), pp. 1-25. Science Publishers, Inc., Enfield, NH. Nelson JS (2006) Fishes of the world. Fourth edition John Wiley & Sons, Inc. O'Hara TD, Poore GCB (2000) Patterns of Distribution for Southern Australian Marine Echinoderms and Decapods. Journal of Biogeography 27, 1321-1335. Palumbi SR (1996) Nucleic acids II: the polymerase chain reaction. In: Molecular Systematics (eds. Hills DM, Moritz C, Mable BK), pp. 205-247. Sinauer, Sunderland, Massachusetts. Paxton J, Hoese DF, Gates JE, Bray DJ (2006) Platycephalidae. In: Zoological Catalogue of Australia. Volume 35. Fishes, pp. 933-948. Pianka ER (1966) Latitudinal gradients in species diversity: a review of concepts. The American Naturalist 100, 33-46. Pierce SJ, Pardo SA, Bennett MB (2009) Reproduction of the blue-spotted maskray Neotrygon kuhlii (Myliobatoidei: Dasyatidae) in south-east Queensland, Australia. Journal of Fish Biology 74, 1291-1308. Poore GCB, Andreakis N (2011) Morphological, molecular and biogeographic evidence support two new species in the Uroptychus naso complex (Crustacea: Decapoda: Chirostylidae). Molecular Phylogenetics and Evolution 60, 152-169. Portnoy DS, McDowell JR, Heist EJ, Musick JA, Graves JE (2010) World phylogeography and male-mediated gene flow in the sandbar shark, Carcharhinus plumbeus. Molecular Ecology 19, 1994-2010. Posada D, Crandall KA (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics 14, 817-818. Posada D, Crandall KA (2001) Intraspecific gene genealogies: trees grafting into networks. Trends in Ecology & Evolution 16, 37-45. Prothero DR (1994) The late Eocene-Oligocene extinctions. Annual Review of Earth and Planetary Sciences 22, 145-165. Puckridge M (2006) DNA barcoding of Australia's marine fish, University of Tasmania, Honours Thesis. Puckridge M, Andreakis N, Appleyard SA, Ward RD (2013a) Cryptic diversity in flathead fishes (Scorpaeniformes: Platycephalidae) across the Indo-West Pacific uncovered by DNA barcoding. Molecular Ecology Resources 13, 32- 42. Puckridge M, Last PR, White WT, Andreakis N (2013b) Phylogeography of the Indo- Pacific maskrays (Dasyatidae, Neotrygon): a complex example of chondrichthyan radiation in the Cenozoic. Ecology and Evolution 3, 217-232.

118 C

Puillandre N, Lambert A, Brouillet S, Achaz G (2012a) ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Molecular Ecology 21, 1864- 1877. Puillandre N, Modica MV, Zhang Y, et al. (2012b) Large-scale species delimitation methods for hyperdiverse groups. Molecular Ecology 21, 2671-2691. Rambaut A, Drummond AJ (2007) Tracer v1.4: MCMC trace analyses tool. http://beast.bio.ed.ac.uk/Tracer. Ramos-Onsins SE, Rozas J (2002) Statistical properties of new neutrality tests against population growth. Molecular Biology and Evolution 19, 2092-2100. Read CI, Bellwood DR, van Herwerden L (2006) Ancient origins of Indo-Pacific coral reef fish biodiversity: A case study of the leopard wrasses (Labridae: Macropharyngodon). Molecular Phylogenetics and Evolution 38, 808-819. Reake ML, Rodgers PJ, Kudla AU (2008) Patterns of biodiversity and endemism on Indo-West Pacific coral reefs. Proceedings of the National Academy of Sciences of the United States of America 105, iv + 11458-11465. Renema W, Bellwood DR, Braga JC, et al. (2008a) Hopping hotspots: global shifts in marine biodiversity. Science 321, 654-657. Renema W, Bellwood DR, Braga JC, et al. (2008b) Hopping hotspots: global shifts in marine biodiversity. Science 321, 654-657. Richards VP, Henning M, Witzell W, Shivji MS (2009) Species delineation and evolutionary history of the globally distributed spotted eagle ray (Aetobatus narinari). Journal of Heredity 100, 273-283. Ricklefs RE (2007) Estimating diversification rates from phylogenetic information. Trends in Ecology & Evolution 22, 601-610. Rivadeneira MM, Thiel M, González ER, Haye PA (2011) An inverse latitudinal gradient of diversity of peracarid crustaceans along the Pacific Coast of South America: out of the deep south. Global Ecology and Biogeography 20, 437- 448. Roberts CM, McClean CJ, Veron JEN, et al. (2002) Marine Biodiversity Hotspots and Conservation Priorities for Tropical Reefs. Science 295, 1280-1284. Rocha LA, Bowen BW (2008) Speciation in coral-reef fishes. Journal of Fish Biology 72, 1101-1121. Rodríguez-Trelles F, Tarrío R, Ayala FJ (2004) Molecular clocks: whence and whither? In: Telling the evolutionary time - molecular clocks and the fossil record (eds. Donoghue PCJ, Smith MP). CRC Press, London. Rögl F (1999) Mediterranean and Paratethys, facts and hypotheses of an Oligocene to Miocene paleogeography (short overview). Geologica Carpathica 50, 339- 349. Rokas A, Carroll SB (2005) More genes or more taxa? The relative contribution of gene number and taxon number to phylogenetic accuracy. Molecular Biology and Evolution 22, 1337-1344.

119 C

Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 18, 1572-1574. Rosenblum EB, Rompler H, Schoneberg T, Hoekstra HE (2010) Molecular and functional basis of phenotypic convergence in white lizards at White Sands. Proceedings of the National Academy of Sciences of the United States of America 107, 2113-2117. Roy K, Jablonski D, Valentine JW (2000) Dissecting latitudinal diversity gradients: functional groups and clades of marine bivalves. Proceedings of the Royal Society of London. Series B: Biological Sciences 267, 293-299. Saint-Cast F, Condie SA (2006) Circulation modelling in Torres Strait Geoscience Australia, Record 2006/18, 82pp. Santini F, Winterbottom R (2002) Historical biogeography of Indo-western Pacific coral reef biota: is the Indonesian region a centre of origin? Journal of Biogeography 29, 189-205. Scheffers BR, Joppa LN, Pimm SL, Laurance WF (2012) What we know and don't know about Earth's missing biodiversity. Trends in Ecology & Evolution 27, 501-510. Schluter SF, Marchalonis JJ (2003) Cloning of shark RAG2 and characterization of the RAG1/RAG2 gene locus. The FASEB Journal 17, 470-472. Scotese CR (2001) Atlas of Earth History, Volume 1, Paleogeography. In: PALEOMAP Project, Arlington, Texas, 52 pp. Seehausen O, Mayhew PJ, van Alphen JJM (1999) Evolution of colour patterns in East African cichlid fish. Journal of Evolutionary Biology 12, 514-534. Seton M, Müller RD, Zahirovic S, et al. (2012) Global continental and ocean basin reconstructions since 2000 Ma. Earth-Science Reviews 113, 212-270. Shao KT, Chen JP (1987) Fishes of the family Platycephalidae (Teleostei, Platycephaloidei) of Taiwan with descriptions of two new species. Bulletin of the Institute of Zoology Academia Sinica 26, 77-94. Shirai S (1996) Phylogentic interrelationships of neoselachians (Chondrichthyes: Euselachii). In: Interrelationships of Fishes (eds. Stiassny MLJ, Parenti LR, Johnson GD), pp. 9-34. Academic Press, London. Smith BT, Bryson RW, Houston DD, Klicka J (2012) An asymmetry in niche conservatism contributes to the latitudinal species diversity gradient in New World vertebrates. Ecology Letters 15, 1318-1325. Smith LL, Fessler JL, Alfaro ME, Streelman JT, Westneat MW (2008) Phylogenetic relationships and the evolution of regulatory gene sequences in the parrotfishes. Molecular Phylogenetics and Evolution 49, 136-152. Smith PJ, Steinke D, McMillan PJ, et al. (2011) DNA barcoding highlights a cryptic species of grenadier Macrourus in the Southern Ocean. Journal of Fish Biology 78, 355-365.

120 C

Snedden JW, Liu C (2010) A compilation of Phanerozoic sea-level changes, coastal overlaps and recommended sequence designations. AAPG, www.searchanddiscovery.com, 3 pp. Spalding MD, Fox HE, Allen GR, et al. (2007) Marine ecoregions of the world: a bioregionalisation of coastal shelf areas. BioScience 57, 573-583. Sprintall J, Wijffels S, Molcard R, Jaya I (2009) Direct estimates of the Indonesian Throughflow entering the Indian Ocean: 2004-2006. Journal of Geophysical Research 114, C07001. Sriwattanarothai N, Steinke D, Ruenwongsa P, Hanner R, Panijpan B (2010) Molecular and morphological evidence supports the species status of the Mahachai fighter Betta sp. Mahachai and reveals new species of Betta from Thailand. Journal of Fish Biology 77, 414-424. Steurbaut E (1984) Les otolithes de Teleosteens de l'oligo-miocene d'Aquitaine (sud ouest de la France). Palaeontographica Abteilung A Palaeozoologie- Stratigraphie 186, 1-162. Stevens GC (1989) The latitudinal gradient in geographical range: how so many species coexist in the tropics. The American Naturalist 133, 240-256. Stobutzki IC, Miller MJ, Heales DS, Brewer DT (2002) Sustainability of elasmobranchs caught as bycatch in a tropical prawn (shrimp) trawl fishery. Fishery Bulletin 100, 800-821. Streelman JT, Karl SA (1997) Reconstructing labroid evolution with single-copy nuclear DNA. Proceedings of the Royal Society of London. Series B: Biological Sciences 264, 1011-1020. Swofford DL (2003) PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts. Syahailatua A, Roughan M, Suthers IM (2011) Characteristic ichthyoplankton taxa in the separation zone of the East Australian Current: Larval assemblages as tracers of coastal mixing. Deep-Sea Research II 58, 678-690. Tamura K, Nei M (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10, 512-526. Tamura K, Peterson D, Peterson N, et al. (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28, 2731- 2739. . Taylor HR, Harris WE (2012) An emergent science on the brink of irrelevance: a review of the past 8 years of DNA barcoding. Molecular Ecology Resources 12, 377-388. Theiss SM, Lisney TJ, Collin SP, Hart NS (2007) Colour vision and visual ecology of the blue-spotted maskray, Dasyatis kuhlii Müller & Henle, 1814. Journal of

121 C

Comparative Physiology a-Neuroethology Sensory Neural and Behavioral Physiology 193, 67-79. Timm J, Figiel M, Kochzius M (2008) Contrasting patterns in species boundaries and evolution of anemonefishes (Amphiprioninae, Pomacentridae) in the centre of marine biodiveristy. Molecular Phylogenetics and Evolution 49, 268-276. Timm J, Kochzius M (2008) Geological history and oceanography of the Indo-Malay Archipelago shape the genetic population structure in the false clown anemonefish (Amphiprion ocellaris). Molecular Ecology 17, 3999-4014. Tittensor DP, Mora C, Jetz W, et al. (2010) Global patterns and predictors of marine biodiversity across taxa. Nature 466, 1098-1101. Underwood CJ, Mitchell SF, Veltcamp KJ (1999) Shark and ray teeth from the Hauterivian (Lower Cretaceous) of north-east England. Palaeontology 42, 287-302. Valdez-Moreno M, Ivanova NV, Elias-Gutierrez M, Contreras-Balderas S, Hebert PDN (2009) Probing diversity in freshwater fishes from Mexico and Guatemala with DNA barcodes. Journal of Fish Biology 74, 377-402. Valentine JW, Jablonski D (2010) Origins of marine patterns of biodiversity: some correlates and applications. Palaeontology 53, 1203-1210. Vallejo B (2005) Inferring the mode of speciation in Indo-West Pacific Conus (Gastropoda: Conidae). Journal of Biogeography 32, 1429-1439. van Oosterzee P (1997) Where worlds collide: the Wallace Line Reed, Victoria, Australia. Vermeij GJ (1986) Survival during biotic crises: the properties and evolutionary significance of refuges. In: Dynamics of Extinction (ed. Elliott DK), pp. 231- 246. Wiley, New York. Voris HK (2000) Maps of Pleistocene sea levels in Southeast Asia: shorelines, river systems and time durations. Journal of Biogeography 27, 1153-1167. Ward RD (2009) DNA barcode divergence among species and genera of birds and fishes. Molecular Ecology Resources 9, 1077-1085. Ward RD, Costa FO, Holmes BH, Steinke D (2008a) DNA barcoding of shared fish species from the North Atlantic and Australasia: minimal divergence for most taxa, but Zeus faber and Lepidopus caudatus each probably constitute two species. Aquatic Biology 3, 71-78. Ward RD, Hanner RH, Hebert PDN (2009) The campaign to DNA barcode all fishes, FISH-BOL. Journal of Fish Biology 74, 329-356. Ward RD, Holmes BH, White WT, Last PR (2008b) DNA barcoding Australasian chondrichthyans: results and potential uses in conservation. Marine and Freshwater Research 59, 57-71. Ward RD, Zemlak TS, Innes BH, Last P, Hebert PDN (2005) DNA barcoding Australia's fish species. Philosophical Transactions of the Royal Society B 360, 1847-1857.

122 C

Waters JM (2008) Marine biogeographical disjunction in temperate Australia: historical landbridge, contemporary currents, or both? Diversity and Distributions 14, 692-700. Weir JT, Schluter D (2011) Are rates of molecular evolution in mammals substantially accelerated in warmer environments? Proceedings of the Royal Society B: Biological Sciences. Westneat MW (2001) Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. In: FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Volume 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles, sea turtles, sea snakes and marine mammals eds. Carpenter KE, Niem VH), pp. 3381-3467. FAO, Rome. Westneat MW, Alfaro ME (2005) Molecular phylogenetics and evolutionary history of the reef fish family Labridae. Molecular Phylogenetics and Evolution 36, 370-390. White WT, Dharmadi (2007) Species and size compositions and reproductive biology of rays (Chondrichthyes, Batoidea) caught in target and non-target fisheries in eastern Indonesia. Journal of Fish Biology 70, 1809-1837. White WT, Last PR, Stevens JD, et al. (2006) Economically important sharks and rays of Indonesia Australian Centre for International Agricultural Research, Canberra. Whitley GP (1945) New sharks and fishes from Western Australia. Part 2. Australian Zoologist v. 11 (pt 1), 1-42, Pl. 41. Wiens JJ, Donoghue MJ (2004) Historical biogeography, ecology and species richness. Trends in Ecology & Evolution 19, 639-644. Will KW, Rubinoff D (2004) Myth of the molecule: DNA barcodes for species cannot replace morphology for identificaiton and clasification. Cladistics 20, 47-55. Williams ST (2007) Origins and diversification of Indo-West Pacific marine fauna: evolutionary history and biogeography of turban shells (Gastropoda, Turbinidae). Biological Journal of the Linnean Society 92, 573-592. Williams ST, Duda TF (2008) Did tectonic activity stimulate Oligo-Miocene speciation in the Indo-West Pacific? Evolution 62, 1618-1634. Willig MR, Kaufman DM, Stevens RD (2003) Latitudinal gradients of biodiversity: pattern, process, scale, and synthesis. Annual Review of Ecology, Evolution, and Systematics 34, 273-309. Wilson BR, Allen GR (1987) Major components and distribution of marine fauna. In: Fauna of Australia (eds. Dyne GR, Walton DW). Australian Government Publishing Service, Canberra. Winters K, van Herwerden L, Choat J, Robertson D (2010) Phylogeography of the Indo-Pacific parrotfish Scarus psittacus: isolation generates distinctive peripheral populations in two oceans. Marine Biology 157, 1679-1691.

123 C

Woodland DJ (1983) Zoogeography of the Siganidae (Pisces): an interpretation of distribution and richness patterns. Bulletin of Marine Science 33, 713-717. Xia X, Xie Z (2001) DAMBE: software package for data analysis in molecular biology and evolution. Journal of Heredity 92, 371-373. Yu Y, Harris AJ, He X-J (2011) RASP (Reconstruct Ancestral State in Phylogenies) 2.0 beta. Available at http://mnh.scu.edu.cn/soft/blog/RASP. Zachos J, Pagani M, Sloan L, Thomas E, Billups K (2001) Trends, rhythms, and Aberrations in global climate 65 Ma to present. Science 292, 686-693. Zemlak TS, Ward RD, Connell AD, Holmes BH, Hebert PDN (2009) DNA barcoding reveals overlooked marine fishes. Molecular Ecology Resources 9, 237-242.

124 APPENDIX 1

f

o e

s

6 5 5 7 6 6 6 6 0 yp 6 4 8 2 9 7 9 5 1 3 1 1 1 1 1 2 5 1 5 il t

a o - - t ap ap ap ap ap ap ap ap ap ap ap ap ap ap

ap ap ap ap ap l ap3 ap3 ap3 ap3 ap3 ap3 ap3 ap3 ap1 I e H H H H H H H H H H H H H H H H H H H H H H H H H H H H ap D CO H . on

g 5 1 8 8 8 8 4 4 4 4 8 8 6 8 8 8 5 5 5 5 5 5 5 8 4 9 4 4 4 0 ti ...... a 1 9 on 1 m L 106 106 106 106 142 142 142 142 106 106 106 106 106 106 119 119 119 119 119 119 119 11 1 106 100 110 100 100 100 112 r o f n i

t 5 1 1 1 1 1 1 1 7 1 1 1 1 5 5 5 5 8 5 2 2 2 5 5 5 2 5 5 5 0 a ...... on 6 6 6 6 6 6 8 6 6 6 2 6 2 9 9 9 9 3 L ti ------10 10 10 10 23 23 23 23 23 23 23 23 - - - - ec ll o c

t

n

e e e e e e e e e e e

ke s r i m a i n ngk ngk ngk ngk ngk ngk ngk ngk ngk ngk a m

ec A A A A A A A A A A

M h p

it it it it a a a a a a a a a a s s r r r r r r r r r r a a a a

a fi a a a a a a a a a h tr tr tr tr

d u u u u u u u u u u a ung

S S S S n j

s s s s s s s s a M M M M M M M M M M s s s s n

uk

and e e e e

, a , , , , , , , , ,

l s . nd nd nd nd nd nd nd nd t t t t a a a a a a a a a a s M T rr rr rr rr s s s s s a a a a a a a a I

v v v v v v v v v v l l l l l l l l i

o o o o a a a a ce n k k k s o o o o Is Is Is Is Is Is Is Is n T T T T Ja Ja Ja Ja Ja Ja Ja Ja Ja Ja a a a o

n on e , , , , t t t t t t t t t t C C C C ti e w w w

S

f f f f D D D D a a a es es es es es es es es es es l l l l ca r r r qu L L L L oo u u u u a a a o e on l nghu nghu nghu nghu nghu nghu nghu nghu l W W W W W W W W W W s

Q Q Q Q S S S G G G G e e e e e e e e C

, , , , , , , , , , n , , , , , , , , , , , P P P P P P P P , a a a a a a a a a a 1 a a a a a a a o i i i i i i i i i i , , , , , , , , i i i nga m li li li li ti i s s s nd nd nd nd n n n n n n n n es es es es es es es es es es a a a a a a a a y y y a a a a a a a a n AG ec na a a a tr tr tr tr il il il il . t l l l w w w w w w w w s s s s ll a a a a i i i i i i i i R e a a a N

u u u i u o a h h h a a a h a a a a

ndon ndon ndon ndon ndon ndon ndon ndon ndon ndon A A A I I T T V M I I I T M T C A I I T T T T T T T T I I I M nd nd a a

i S

li 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 16 , uh

I k 1 . O 24976 24976 24976 24977 24977 24977 24977 24977 24977 24977 24977 24977 24977 24978 24978 N C

C C C C C C C C C C C C C C C

, f RAG K K K K K K K K K K K K K K K a o t

a t rs e

b 7 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 8 9 0 3 m anno 8

nu

24981 24981 24981 24981 24981 24981 24981 24982 24982 24982 24982 24982 24982 24982 24982 24982 24982 24983 24983 24983 24983 24983 24983 24983 249 24983 24983 24984 gon S on C C C C C C C C C C C C C C C C C C C C C C C C C C C C i ry 16 K K K K K K K K K K K K K K K K K K K K K K K K K K K K t ss o e N

acce f

o

6 7 1 2 0 0 9 9 8 2 3 0 2 4 5 1 0 9 8 7 5 4 1 0 9 8 7 3 s ank n 73 e B 8 m

90248 90248 en i 67343 67343 67342 67343 67370 67342 I 25062 25062 25062 25064 24990 24990 24990 39873 39873 39872 39872 39872 39873 39873 39 39874 39874 39873 39873 39873 G C C C C M M C C C U U U U U U U U U U U U U ec

; p CO K K K E E E E E E E E K GU GU GU H H K E E E E E GU GU K K GU n s

o e i t h a

t #

r

m

9 0 1 o e r 9 4 3 l 5 5 3 4 6 7 4 6 7 8 9 6 7 8 9 0 5 6 7 8 9 1 7 0 f o

0 2 7 p 4 8 f 4 4 4 n 6 n m e i 1122 1123 1123 264 264 2 264 264 258 25 258 258 621 621 627 781 781 781 782 257 257 257 257 257 622 773 622 a

v i S A A A A A A A A A A A A A A A A A A A BO A A A A A A A BO BO A e l g

p o m s l a

a s

1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 3

e

r e e e e e e e e e e e e e e e e e e e e e e a a a a a t t t t t a d d d d d d d d d d d d d d d d d d d d d d

dae

a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a s l l l l l l l l l l l l l l l l l l l l l l t t t t t ti t t t c c c c c c c c c c c c c c c c c c c c c c e a a

a t t t ya o o lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii yp s t anno anno anno anno anno h h h h h h h h h h h h h h h h h h h h h a

o f f f f f uh l D ann ann c c c c c ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku k anno

p 1 n n n n n n n n n n n n n n n n n n n n n n n n n n n n a . h

2

go go go go go go go go go go go go go go go go go go go go go go go go go go go go gon gon s I y y y y y y y y y y y y y y y y y y y y y y y y y y y y y S e

i r ry O tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr t t e l o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o ec C e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e

b p e a S N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N h t T

125 APPENDIX 1

7 7 8 7 1 7 2 4 7 7 7 7 7 4 2 3 7 7 7 9 1 4 6 6 4 0 0 0 4 0 4 5 5 5 5 1 p1 ap1 ap1 ap1 ap1 ap2 ap1 ap1 ap1 ap1 a ap1 ap1 ap1 ap1 ap1 ap1 ap1 ap1 ap1 ap2 ap1 ap1 ap1 ap1 ap ap2 ap2 ap2 ap2 ap1 ap1 ap1 ap2 ap2 ap2 H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H

0 0 0 0 1 2 3 2 3 3 3 3 0 1 1 2 2 2 2 3 3 3 4 2 2 2 2 5 2 5 5 2 5 1 4 ...... 9 7 7 7 7 7 9 9 9 3 3 3 39 9 77 9 9 9 9 115 115 124 10 141 115 115 115 142 141 115 115 10 10 10 115 141 116 116 141 166 112 142 113 15 15 15 113

8 8 5 8 8 8 4 5 5 8 4 8 8 5 2 3 8 8 5 2 2 2 2 9 5 5 3 3 3 5 4 5 0 3 5 ...... 8 8 7 8 8 8 7 7 8 8 8 7 5 8 8 2 5 9 8 9 9 9 9 9 9 9 5 ------24 12 10 2 12 12 12 22 2 2 2 10 2 ------

a

s s ri r I r i

a a a

n t u u h a g g g g

L L n n n n ead s

M a a a a pen

it eac n n n n n n n n

H

r d d d d

a a

s a a a a a a a a a

B a a a a I e b t t t t

t n n n n n n n n tr ung ung y y C S S S S i j j s s s s pa pa pa a a a a a a a a a ung

a a S i i i m rtl t j a a a a as , , , , k n

n f e e e a u s n B B a a a a a a a o o o o o o

e a

v v v v g T Y T T C C C C C k k

W W W

i

lf

T r r rr , , dong dong dong dong dong dong dong dong a

h agen Ja Ja Ja Ja n n n n u ff n l ff o e e e e e e e e ff ff ff s k l l l l a a a a a a ha o ha I o o G O T o M

a r a a a a K K K K K K K K

, , S S bok bok r r r r a m m m m , , , , , , m e , t t t t w a , , a a a a a a D D D D D D a li, li, n li, li, li, n n li, li, m m li, n K i W W W ng w r A A a a e a a a e e a a a e o o L L S L L L L S S a nd nd nd nd nd a a i, B B C B B B C C B B L L B C n h W Q Q T N Q Q Q W Q N N S A A A A A i , , , , , , , , , , , , , , c , , , , , , , , , , , , , , , , , , edon k a a a a a a a a a a a a a a o l a a a a a a a a a a a a a i i i i i i i i i i i i i i d i i a O li li li li li li li li li li li s nd n nd nd nd K n es es es es es es es es es es es es es es , a a a a a a a a a a a C a a a a a y ,

n tr tr a tr tr tr tr tr tr tr tr tr a za il il il il il l a i s s s s s s s s s s s w a a a a a n a p u u u u u e u u u u u u a h h h h h ndon ndon ndon ndon ndon ndon ndon ndon ndon ndon ndon ndon ndon ndon nd Ja I I I A A I I I T A I I I A A I T T T N M A A I I A A I I T T A A I

8 3 3 4 6 7 9 5 2 5 0 1 2 4 24978 24978 24979 24978 24978 24978 24978 24979 24978 24978 24979 24979 24979 24979 C C C C C C C C C C C C C C

K K K K K K K K K K K K K K

0 0 1 7 2 3 6 7 1 3 4 5 6 9 0 5 7 8 9 1 9 0 1 2 8 4 2 3 4 5 6 8 4986 46780 24985 24984 24985 24985 24985 24986 24984 24984 24984 24984 24984 24984 24985 24985 24985 24985 24985 2 24986 24986 24987 24987 24984 24984 24985 24986 24986 24986 24986 24986 24986 C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C M K

K K K K K K K K K K K K K K K K K K K K K K K K K K K K K K H

8 1 5 6 7 9 4 1 7 8 5 6 3 4 6 5 3 2 5 6 2 7 5 9 0 4 9 7 5 4 3 2 6 2 990 4 90246 90248 90246 90246 90246 46779 10818 67344 67342 67342 67342 67342 67342 67343 48568 24990 25064 25064 25062 25063 25062 25063 25062 25063 25063 25063 25063 2 39874 39874 39874 39874 39873 B C C C C C C C M C C C C C M C M M M M U U U U F60934 U A E K DQ K K K K GU K K H E E E E K E K K K K H GU GU GU GU GU K GU H H H H

6

8 5

3 1

1 9 0 0 1 8 9 9 0 4 2 3 4 0 2 3 1 7 8 9 2 2 3 4 5 6 7 1 2 3

1 2 8 4 9185 257 20 564 565 596 596 619 619 684 685 779 257 257 257 258 258 258 573 573 573 573 781 622 622 622 622 622 621 779 779 779 - A BO P A A A A A A A A A A A A A A A A A A A A A A A A A A CHN 8061 A A A A

6 3 4 5 5 5 5 5 5 5 5 5 5 6 6 6 6 6 6 6 6 6 6 6 7 7 7 7 7 8 8 9 9 9 9

e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c

i i lii lii lii lii l lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii lii h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h h uh k ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku ku

n n n n n n n n n n n n n n n n n n n n n n n n n n n n n n n n n n on go go go go go go go go go go go go g go go go go go go go go go go go go go go go go go go go go go go y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y y tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N

126 APPENDIX 1

5 7 5 5 3 8 5 6 4 4 2 0 9 2 1 1 3

ap2 ap2 ap2 ap2 ap2 ap2 ap2 ap2 ap3 ap3 ap3 ap3 ap2 ap3 ap3 ap3 ap3 H H H H H H H H H H H H H H H H H

0 1 1 1 1 1 1 1 1 5 4 4 4 4 3 4 4 4 4 4 4 3 3 3 ...... 4 145 151 151 151 151 11 113 142 142 142 113 113 113 113 113 113 113 113 113 113 153 153 153 153

0 7 4 4 4 4 4 4 4 4 8 1 5 5 8 8 8 2 5 1 1 2 2 2 ...... 2 5 5 5 5 5 5 5 5 14 23 23 10 10 23 23 23 27 2 10 23 23 27 27 27 2 2 2 2 2 2 2 2 ------

d y y y y t t i it i a a a a

a a a an

B B B B r e e e e l

tr tr t y y y y y y y y

y y y s a a a a a a a a I S S S h a a a on on on

on t on on on on t t t t s s B B B B B B B B t t t t d B B B

s s s s

r e e es e e e e l l l ou k k k k k k k k d r r r r a r r r r r r r r rr rr a a rr ad ad ad a za o o o o r r r m l l l l o o i o o o o x ha ha ha ha ha ha ha ha G M T T G G M M M L T G C E S C C S S S S S S S , , , , , , , , , , , , , , , , , , , , , , , , D D D D D D D D D D D D A A A A A A A A A A A A L L L L L L L L L L L L Q Q W W Q Q W W W Q Q Q Q Q Q W W W W W W W Q Q , , , , , , , , , , , , , , , , , , , , , , , , a a a a a a a a a a a a a a a a a a a a a a a a li li li li li li li li li li li li li li li li li li li li li li li li a a a a a a a a a a a a a a a a a a a a a a a a r r t t tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr s s s s s s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u u u u u u A A A A A A A A A A A A A A A A A A A A A A A A

6 7 8 9 0 1 2 3 4 5 6 7 8 24979 24979 24979 24979 24980 24980 24980 24980 24980 24980 24980 24980 24980 C C C C C C C C C C C C C K K K K K K K K K K K K K

8 2 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 3 4 5 6 8 23965 24989 24987 24987 24987 24987 24987 24987 24987 24987 24988 24988 24988 24988 24988 24988 24988 24988 24988 24988 24989 24989 24989 24989 24989 24989 84842 C C C C C C C C C C C C C C C C C C C C C C C C C M U K K K K K K K K K K K K K K K K K K K E K K K K K K H

8 9 0 2 3 4 5 1 8 0 6 3 9 7 8 5 1 3 8 4 1 5 4 8 7 6 2 3 9 8 6 0 90247 90247 90248 90248 90248 90248 90248 23967 95593 67344 67343 67343 67343 67343 67343 67343 10817 25064 25063 25062 25064 25062 25064 39874 39874 39872 39873 39875 39875 39875 39887 39897 M M M M M M M C C C C C C M U U U U U U U U U H H H H H H H K E E K K K K HQ K GU GU GU GU GU GU GU E E E E E DQ E E H

1

6 8

8 9 0 1 3 4 5 6 7 5 5 3 9 1 3 4 5 5 6 4 6 7 2 5 5 6 1 00 217 5 - 23967 780 780 781 781 781 781 781 781 291 293 623 565 565 566 623 623 620 621 621 620 620 620 621 375 376 376 22 216 M W

A A A A A A A A UGA A A A A A A A A A A A A A A A A B A A A A H

a

s s s s s s s s s 9 9 9 9 9 9 9 9 9 i

ce

si si si si si si si si s e e e e e e e e e a a n n n n n n n n n l

t d d d d d d d d d e e e e e e e e e o a a a a a a a a a a

i l l l l l l l l l i i i r

v oo oo oo oo oo oo oo oo oo c c c c c c c c c g

s l l l l l l l l l

i a

u a a a a a a a a a

g a a a lii and and and lii lii lii lii lii lii lii lii r

i cauda r l g g g g g g g g t t t l l l t on i i i t h h h h h h h h h e gon a nga c c c n n n n n n n n a i s i i i i i i i i i i i i

rv ey ey ey ev h a w s ry ku ku ku ku ku ku ku ku ku l l l p p p n n n n n n n n n

r s

t uge uge a a s y pa b u z z n n n n n n n n n n n n n n n n n n n n n n n n hu

r r t s s s s s c u u a go go go go go go go go go go go go go go go go go go go go go go go go t t l ti ti ti ti ti oup y y y y y y y y y y y y y y y y y y y y y y y y na r an an op tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr tr ya ya ya ya ya g ti t s s s s s o o o o o o o o o o o o o o o o o o o o o o o o s m m er u a a a a a i i e e e e e e e e e e e e e e e e e e e e e e e e a t N N N N N N N N N N N N N N N N N N N N N N N N O D D D D D H H P P

127 APPENDIX 1

) gon y 93 . r t 0 - o

0

e 9 0 . N 0

(

e 3 . h 0 r t o

)

) ) f 56 s 32 . . t 1 4 - - 6

2

5 8 0 . . acke 1 0 ( r (

b

8

. 56 . n 3 1 (i s

) ) ) e u 31 32 08 l . . . a 0 4 2 - - - v

- Axxxx 2 0 1

7 0 1 7 . . . m 3 0 1 u ( ( (

7 m 16 0 58 i . . . x 0 4 1 a

m

) )

) 1 77 23 . . . nd 2

1 4 - a ) - -

7 0 9 6

- 7

5 . 7 m 6 0 . . ( 0 u

1 3 ( (

( 0

m 9 i 41 . 6 97 . . n 1 i 1 3 m

) ) ) ) h

it ) 96 07 81 15 . . . . 4 . w 2 3 4 5

- - - - 1 - 9 0 1 2 0 6 8 7 x

0 3 4 8 9 5 (

. . . .

tri 2 2 1 3 5 ( ( ( ( a

53 . 8 4 3 3 0 m 24980 24981 24981 24981 6 8 5 5

. . . . C C C C 6264 2 2 2 4 ce K K K K U n

) ) ) ) ) a t s 86 27 34 69 84 i . . . . .

3 3 3 3 3 d

- - - - - 7 8 9 0 1

4 7 3 6 5

g A

/ 3 1 2 3 6 4 . . . . . n i N 3 3 3 3 2 ( ( ( ( ( n

i 24989 24989 24989 24990 24990 7 7 1 7 o 4 1 3 17 5 C C C C C . . . . . J 3 3 3 3 3 K K K K K r

) ) ) ) ) ) 48 23 59 36 68 15 ......

2 3 2 2 2 4 ghbou ) 4 ------

i

0 0 2 8 2 4 4

1 3 6 - e 7 8

0 8 4 5 2 0 3 0 ...... ( N

3 3 2 2 2 2

( ( ( ( ( ( 0

d 0 0 e 48 1 53 33 36 0 673742 t 25063 25063 25063 39900 39900 ...... 2 3 2 2 2 4 C C C U U ec K K GU K E E rr

) ) ) ) ) ) ) o

) c 56 83 57 93 68 34 48

...... ) 93 1 2 3 2 2 3 4

.

9 ------

0 6 2 3 0 6 4 9 1 8 5

-

2P

o 3 0 0 3 7 8 6 2 0 7 3 0 5 t ...... (

K

2 2 1 2 2 1 3 001 071 ( ( ( ( ( ( ( 1

58 r ( 1 5 622 456 238 292 s . e 33 54 16 6 3 56 05 0 ...... t UG UG A A A A 147011 1 2 3 2 2 2 4 e ade l m

c

a ) ) ) ) ) ) ) )

) r 0 I

4 a . 89 46 19 16 72 49 56 9 e e ......

O 2 P 0 2 3 3 3 3 3 4 a a s ------C 1 u li li

9 6 6 2 7 8 0 9

2 7 l a a

. 8 1 1 2 6 1 0 9 m 1

...... r r a i a a 1 i t t i 1 3 3 3 2 4 0 2 ( r c s s

( ( ( ( ( ( ( ( n r

u u 7 err 3 7 9 2 9 2 e a a 0 au au l p . 11 0 11 4 2 4 2 6 m

......

eye s i 2 s s s 0 2 3 3 3 3 3 4 a m u u u

mm mm K

t t

s y y n s

i 2 l l ochond e . h nu a a op

r it 2 r r r ad 1 2 3 4 5 6 7 8 9 m hoba hoba a l u u u S y m c c i i i

C

n n ch e n n n l r y y og e e e lii r a h h b a a a a T T T U R R C *All Axxxx numbers refer to corresponding Barcode of Life Database specimen BW uh k T

128 APPENDIX 1

6 7 8 9 8 1 2 9 7 4 9 6 3 1 5 5 3 3 3 8 7 6 7 7 6 7 7 3 ...... 1 1 1 1 1 0 0 0 0 0 0 0 0 1

1 1 6 7 9 1 7 5 9 6 0 7 0 1

6 6 3 3 2 8 6 5 6 5 4 5 4 3 ...... r 1 1 1 1 1 3 0 0 0 0 0 0 0 1 e w

o l

e 4 4 8 5 2 7 4 5 8 4 5 0 8 2 h 6 6 3 3 4 0 7 5 5 7 6 6 4 3 ...... t 1 1 1 1 1 4 0 0 1 0 0 0 0 1

ong l

a

5 4 8 8 2 7 5 2 9 1 5 6 4 2 s 6 6 3 3 3 9 7 6 6 4 7 6 6 3 i ...... 1 1 1 1 1 3 0 0 1 1 0 0 0 1 ce

n a t

s i 1 2 3 9 1 3 2 6 8 4 3 6 8 9 d 6 6 4 4 3 5 7 6 6 8 5 7 6 2

...... c 1 1 1 1 1 4 0 0 2 2 2 0 0 1 ti

e n e

6 5 0 2 7 7 3 0 7 7 1 7 1 3 G 5 5 5 5 3 5 7 6 4 1 3 1 6 3 ...... t. 1 1 1 1 1 3 0 0 3 3 3 3 0 1 n e

m

0 1 8 7 9 0 5 2 8 0 3 3 6 4 gn 5 5 3 3 2 0 5 4 4 1 5 3 3 2 li ...... a 1 1 1 1 1 4 0 0 2 3 2 2 2 1

I

CO

1 3 7 4 3 3 5 1 4 6 1 5 6 8 e 5 5 3 3 3 3 0 5 5 1 6 3 5 2 h ...... t 1 1 1 1 1 1 4 0 2 3 2 2 2 1 m

o

fr

9 0 7 0 1 3 2 7 1 7 9 2 9 0 d 4 5 4 5 3 0 6 0 1 4 2 4 2 3 e ...... t 1 1 1 1 1 2 4 2 3 3 3 3 3 1 a l

u c l

5 6 8 2 3 4 2 1 5 4 0 9 7 9 ca

5 5 3 5 6 9 8 3 2 6 3 6 5 6 ...... s 1 1 1 1 0 9 9 e i 10 10 10 10 10 10 10 ec

p s

n 9 1 8 7 3 8 9 8 5 6 5 4 6 0 4 5 3 4 7 0 3 0 6 0 4 8 2 2 ...... go 1 1 1 1 2 y 10 10 10 10 10 10 10 10 10 r t

o e

N

4 6 2 9 4 4 7 4 9 5 7 0 8 8 f 2 1 5 6 8 9 0 8 6 6 6 8 5 5 o ......

1 0 1 1 x i 12 12 13 11 11 12 13 1 11 11 11 r t

a m

5 7 9 5 4 8 2 6 6 1 7 1 7 4 . l 7 5 4 2 8 9 2 9 3 2 1 8 5 5 ce ...... a n 4 1 1 a t 11 11 12 10 10 12 11 11 11 11 10 s gon i

a d i

d

r 0 5 4 2 3 3 8 2 3 6 0 1 0 6 ng i e 2 0 9 9 3 8 5 3 6 3 5 6 2 8 ...... n i 0 o 13 13 12 13 12 12 12 12 13 13 13 13 12 j upp

- r

e h t

6 2 4 2 3 7 4 9 7 8 3 5 3 3 4 7 1 7 1 7 6 3 9 4 8 9 5 9 ...... ghbou ong i 0 l e a 12 14 12 13 12 12 12 12 13 13 13 13 12

n r

o d e rr t e

ec

d r s rr i a

o s

s c n 9 2 3 5 6 8 4 7 1 i - nd

e s a e e e e e e e e e P a t n t d d d d d d d d d 2 s

e oo

a a a a a a a a a a l

a l l l l l l l l l K t i t

oo c c c c c c c c c nd

a l

3

t . a nga a 2 i lii lii and lii lii lii lii lii lii lii l t l anno n a h S nga c

i i uh f f uh uh uh uh uh u uh uh ey e anno c n c l p k k k k k k k k k l ...... gon b a a N N N N N N N N N N N N N N N i d T

129 APPENDIX 1

Table S2.4 Mean divergence times and their 95% HPD confidence intervals based on fossil calibrations and published COI mutation rates (0.58% / My and 0.9% / My) calculated in the spotted eagle ray (A. narinari) from the isthmus of panama closure for nodes 1 to 10.

Fossil Mutation rate 0.58% / My 0.9% / My Node Age (95% CI) Age (95% CI) Age (95% CI) 1 69.9 (51.5-93.2) 7.9 (12.6-24.3) 11.6 (8.0-16.0) 2 54.2 (38.6-71.8) 3.9 (9.8-19.2) 9.0 (6.1-12.5) 3 46.7 (32.8-62.3) 1.2 (7.7-15.6) 7.3 (5.0-10.1) 4 35.4 (23.5-49.3) 8.9 (5.9-12.6) 5.8 (4.0-8.2) 5 15.7 (9.45-23.7) 2.9 (1.9-4.4) 1.9 (1.2-3.0) 6 10.2 (4.1-12.3) 2.0 (1.2-3.2) 1.4 (0.8-2.1) 7 10.7 (6.2-16.7) 2.3 (1.3-3.4) 1.5 (0.9-2.3) 8 11.4 (5.4-18.3) 2.9 (1.3-5.1) 1.9 (0.9-3.3) 9 10.7 (4.5-18.3) 3.0 (1.3-5.8) 2.0 (0.8-3.9) 10 4.7 (1.9-8.3) 0.8 (0.2-1.8) 0.5 (0.2-1.2)

130 APPENDIX 1

Figure S2.1 Substitution frequencies of transitions (cross) and transversions (triangle) for: a) the 1st, b) 2nd and c) 3rd codon positions of the partial COI gene. Observed frequencies are calculated with the K2P genetic distance.

131 APPENDIX 1

Figure S2.2 Substitution frequencies of transitions (cross) and transversions (triangle) for: a) the 1st, b) 2nd and c) 3rd codon positions of the partial 16s gene. Observed frequencies are calculated with the K2P genetic distance.

13 2 APPENDIX 1

Figure S2.3 Substitution frequencies of transitions (cross) and transversions (triangle) for: a) the 1st, b) 2nd and c) 3rd codon positions of the partial RAG1 gene. Observed frequencies are calculated with the K2P genetic distance.

133 APPENDIX 1

Figure S2.4 Mismatch distributions for pairwise comparisons of Neotrygon kuhlii COI mitochondrial clades. Monomorphic clades 3, 4 and 6 were excluded from the calculation. The frequencies of expected and observed differences are given as a solid and dashed line, respectively.

Figure: Ts-Tv_ratio C1 C7 Substitution frequencies of transitions (cross) and transversions (triangle) for the 1st, 2nd and 3rd codon positions for the COI, 16s and RAG1 gene. Observed frequencies are calculated with the K2P genetic distance. = 0.556 = 1.000

C2 C8

= 2.949 = 10.00

C5 C9

= 0.553 = 0.553

134 APPENDIX 2

Figure S3.1: Neighbour-Joining tree of Platycephalidae COI sequences based on the Kimura-2-parameter model of sequence evolution. Bootstrap values >70% are given based on 2,000 pseudoreplicates

100

97

100

99

100

100 97

100

100

100

100

100 100 100 85

100

91 100 # #

100

100 100

100

2 %

135 APPENDIX 2

87 100 98 76 91 100 100 100

100 #

100

73

100 99

100 #

100

100

# # # # 100 #

75

100

100 # 86 # #

87 100

93 100

89 100

100

100

2 %

136 APPENDIX 2

100

100

100

100

100

99

100

# # #

100

#

100

98 #

100

100

97 #

#

100 #

100 89 100 # 100 # # 100

2 %

137 APPENDIX 2

100

100

100

#

100

88

100 100

100 71

76

100 82

84 100

79 94

93 100 100

99

100 100

100 94

# 100

#

100

2 %

138 APPENDIX 2

l l l

n

a a a r o d t t t t a a a a u an N N N

l

res L - - -

a R R R R P Is u u u g

n n

l l l k B B B B e a a a a a a o u u u

u

un n n n n s n n ll G G G G a a a a j Z Z Z

ap l l l e o r

- - - lli lli lli lli n n n n n ga ga a k a a a C B n a a a a a

ge ge ge

o n n li o f er er er er e B B B B i u u u T o o o t

o t Y h h h h

, T T T Kw Kw Kw t t t t a , T ff ff ff ff

k ed ed , , , , , , c on o , d d d W o t O O O O l l l o r K K ca ca ca ca ca ca b , , , , M N a l Sou Sou Sou Sou i i i i i i , , Q Q Q , an c ,

r r r r r r , , , , m li li s t t t f f f f f f W W W W on d d d d A A o a a K s s s i l l l l S S S S A A A A A A t , a a a

L B B e e e Q Q Q Q N N N N W W , , , h h h h h h ec , , , , , , , , , , , , , t t t t t t o o o s s s s s s s s s s s s s ll u u u u u u adaga o u u u u u u u u u u u u u o o o o o o nd nd nd C A A A A A A A A A A A Japan S S S M S S S I I I A A

r e b m

nu

8 9

4 6 8 1 9 7 8 1 3 0 9 0 2 6 4 2 k 5 n on a ssi B 10800 10800 673146 673175 n 48819 48828 48819 48828 48825 48825 4882 48827 48816 48829 48822 48819 48820 48818 95270 493229 493230 493231 49323 493228 e U U Q Q cce X X X X X X X X X F F F F X X F F X X X G a J J G G J J J J J J J J J J J J J J J J J J D D

2 * 2 1 2 0 0 0 0 - - - -

er 2 7 7 b

5 m

2 2 2 2 4012 652 673 673

nu

00 00 00 00 H H H H 9803

- - - -

er 0 0 0 0

O O O O B h g c R R R R A I I I I I re ou S S S S 4477 4477 4477 4477 A . . . .

I I C un C C C I I V

S

s s u u m m l l a a h h t t

h h i i i t t t r r r

op op o o o t t n f f f a a o u u

i m m au t

a a a a a a a a a a a

i i i i i i i e e e a s s s s s s s s s s s a a a a a a a a c b n n bea bea

r i r r r r r r il t go go go go go go go go go go go t t t t t t f s s s s s i s s s s s s s u u u u u u u u u u u u u u u u t l l l l l j j j j j j j j j j j m m m m m m m n a a a a a a a a a a a a a a a a e ocod l l l l l l l l l l l h h h h h ee ee ee ee ee ee ee r d u u u u u u u u u u u h c h h h h h h i

t rr rr rr rr rr rr rr rr rr rr rr a a a a a a a a e e n e e e e e e e e e ll ll ll ll ll ll ll ll s s s s s s s s s s s i i i i i i i i i i i e bacep bacep bacep e e e e bacep bacep e e e i i i i i i i i b b b b b b b b b b b rre c m m m m m u m m oc o oc oc oc y y y m m m m m m m m m y y oc oc oc A A C C C C C C C C C A A A A A A A A A C C C C C

5 5 5 5

4 e

l #6_0 #7_0 #8_0 # #5_0

a b d p 0 5

2 2 2 2 2 2

. . . . . 4 5 6 7 8 9 7 3 4 - r m 17 4 5 - e 00 002 002 002 a - 5 - - - - s b 0

155 155 155 155 155

512 512 512 516 516 516 531 1151 611 611 48 48 0 0 0 0

A 1 - m D A A A A A A A A A A A A h h h h h I ------t t t t t 201 L i i i i i nu II GO V - O W W W W W W W W W W W W 4477 4477 4477 4477 m m m m m . . . . B B B B B B B B I I I I Y S S S A L S S B B B B B Table S3.1 : Collection location and sequence accession numbers for flathead samples

139 APPENDIX 2

y a

B

n n l a r r r r r r o o o i t t a a a a a a r k u u u u u u c a i t

res res L L L L L L

n

N

P P

R R R e g g g g g g

n f d d d d t t t i i i e e p B B B a o

r a a a

un un un un un un n an an an an

G G G j j j j j j s r r r a l l l l ap ap

st t t t I d n n n n n n

l a C ga n n n C C Is Is Is Is S S S

a a a a a a

e n f w f f Q - er er er d d d d T T T T T T

o o o o o

h r r r r

h h h , , , , , , f t st t t t

a a a a l rr k k k k k k ed r rres rres rres a r r r z z z z d d d W W u a o o o o o o i i o i i o o e l l l K - b b b b b b N N B no G L L T no no no L L T T , Q Q Q h , , , ,

, , , , , , , , , , , t m m m m li m m t t t r d d d d d d d d d d d A A A A o o o o a o o s s s l l l l l l l l l l l a a a L L L L B L L W W Q Q Q Q Q Q Q Q Q W W Q Q e e e no , , , , , , , , , , , , , , , , , , , , , , , , , , o o o o o o o s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u nd nd nd nd nd nd nd A A A A A A A A A A A I I I I I I I A A A A A A A A

5 0 1 2 6 7 8 9 0 1 9 6 8 6 8 2 5 2 4 95646 956463 10801 10801 10800 108003 108004 67320 67320 67347 67347 67383 67435 67434 673164 673225 67322 673223 673224 48816 48825 48824 48826 48821 48827 48822 U U U U U U U U U U U U Q Q Q Q Q X X X X X X X D D D J J J G G J HQ J J J G G G G G D D G HQ G G G G

5 4 2 3 2 1 4 1 2 2 1 0 0 0 0 0 0 1 0 0 0 0 ------6 6 7 0 9 1 4 0 0 0 1

g g re re 668 668 614 679 407 466 614 671 671 671 671

un H H H H H H H un H H H H

8 0

3 O O O O O O O O O O O O O g R R R R R R R R R R R R R 27 28 45 I I I I I I I I I I I I I re D S S S S S S S S S S S S S M M un C K L L C C C C C C C C C C C C

) ) ) ) ) ) ) s s s s s s s u u u u u u u m m m m m m m l l l l l l l a

h ha ha ha ha ha ha t t t t t t t s s s s s s s s s s s u u u u u u u u u u u m m m m m m m m m m m oph oph oph oph oph oph oph l l l l l l l l l l l t t t t t t t a a a a a a a a a a a a a a a a a ha h h h h h h h h h h t t t t t t t t t t t m m m m m m m e e e e e e e h h h h h h h h h h

n n n n n n n

i i i i ...... oph . op op op op op op op op op op r r r r t t t t t t t t t t t f f f f f f f c c c c c c c a a a a a a a a a a a ( ( ( ( ( ( ( ge ge ge ge

i i i i

m m m m m m m m m m m ...... i i i i a a a a e e e e e e e e e e e p p p p p p p t t t t n s s s s s s s n n n n n n n n n n s s s s tti tti tti tti

e e e e s s s s s s s s s s s s s s s s s s s s s s n u u u u u u u u u u u u u u u u u u u u u u l l l l l l l l l l l l l l l l l l l l l l nn n nn nn a a a a a a a a a a a a a a a a a a a a a a o o o o h h h h h h h h h h h h h h h h h h h h h h s s s s n n n n a a a a r r r r

s s s s bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep bacep e e e e t t t t m m m m m m m m m m m m m m m m m m m m m m a a a a y y y y y y y y y y y y y y y y y y y y y y l l l l C C C C C C C C C C C C C C C C C C C C C C E E E E

4

0 1 2 6 7 6 1 0 5 1 2 1 8 0 1 9 4 5 6 8 6 7 8 9 0 48 48 48 510 510 510 519 519 563 911 912 1143 590 615 615 759 764 765 48 49 555 910 506 506 506 506 A A A A A A A A A A A A A A A A A A A A A A A A A A ------W W W W W W W W W W W W W W W W W W W W W W W W W W B B B B B B B B B B B B B B B B B B B B B B B B B B

140 APPENDIX 2

n

t t r r r i i w e e a a a g g

o k k u u u t n n a a a a a k L L L ar ar

w w

g g g m m oo Jav Jav Jav t t t t t t t

u u

i i i i i i i l l l g g C y y a a a a a a a un un un

a a a j j j r r r r r r r n n r r r t t t t t t t st a a un t t t n n n un S S S S S S S a a a a

B B K K e en en en

, , - T T T i i , , , h C C C a a t

, , , k k k rres rres rres rres rres rres rres S S d d d d d d d d o o o p p p o o o o o o o , , l l l l l l l l ou Java Java a a a b b b g g T T T T T T s T Q Q Q Q Q Q Q Q c c c t t n n

, , , , , , , , s s m m m t t t t t t t o o d d d d d d d d ili ili ili a a o o o st s s s s s s s l l l l l l l l a a a a a a a a K K C C C E E L L L

e Q Q Q Q e e Q Q Q e e e e e Q , , , , , , , , g g , , , , , , , , , , , , , , , , o o o o o o o o s s s s s s s s s s s s s s s s n n o o u u u u u u u u u u u u u u u u nd nd nd nd nd nd nd nd A A A A I I I H H I I I I I A A A A A A A A A A A A

0 5 9 1 9 2 7 0 3 7 5 3 9 0 1 4 18 8 956464 95647 956472 673221 673147 673144 673145 673485 673486 674348 673218 48821 48821 48818 48822 48827 48818 48819 48824 48822 48827 48825 48824 48817 48823 48 U U U U U U U U X X X X X X X X X X X X X X X G G G G J J J J J J J G G G J J G HQ HQ HQ J J J J J J

1 1 1 1 1 1 1 1 2 2 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 ------2 5 5 5 5 6 8 7 7 7 9 9 0

g g re re 671 674 674 674 672 672 672 672 672 672 672 672 673

H H H H un H H H H H H H H H un

9 O O O O O O O O O O O O O O R R R R R R R R R R R R R R RO 27 I I I I I I I I I I I I I I I S S S S S S S S S S S S S S S M C C C C C C L C C C C C C C C C

r r r a a a a a a a a a a a a a e e e

c c c c c c c c c c c c c i i i i i i i i i i i i i i i i i

ab ab ab tti tti tti tti i i i i i i e e e e sc sc sc

apon apon apon apon apon apon apon apon apon apon apon apon apon nn nn nn nn es es es rrisi rrisi rrisi rrisi rrisi rrisi j j j j j j j j j j j j j ...... o o o o a a a a a a f f f f f f f f f f f f f s s s s lit lit lit c c c c c c c c c c c c c h h h h h h n n n n

a a a a op op op a a a a a a a a a a a a a a a a a a a i i i i i i i i i i i i i i i i i i i r r r r

c c c c c c c c c c c c c c c c c c c s s s s e e e e mm mm mm t t t t go go go go go go go go go go go go go go go go go go go a a a e a a a a r r r l l l l ne ne ne ne ne ne ne ne ne ne ne n ne ne ne ne ne ne ne E E E E G G G I I I I I I I I I I I I I I I I I I I

1 0 7 8 9 2 3 7 8 0 1 3 4 9 3 4 8 0 8 1 5 6 7 9 0 1 574 507 514 514 514 574 574 908 908 598 598 614 614 764 510 510 510 911 911 912 510 510 510 510 511 511 A A A A A A A A A A A A A A A A A A A A A A A A A A ------W W W W W W W W W W W W W W W W W W W W W W W W W W B B B B B B B B B B B B B B B B B B B B B B B B B B

141 APPENDIX 2

a o

li l l a a a ag r t t l t e a a s p u N N

i - -

h A

R

u u

e l l d t t t t t B n i i i i i rc

u u

a a a a a

g on G A an e

er Z Z s r r r r r

t l d d t - - t t t t t I d l l s er n ill l a a Is S S S S S er es

v i Q Q w Q er ad s d

b t l o h W n r s st Kw Kw

t st

G m a a a rr , , rres rres rres w rres rres

a z a e e d d d d d d d d a W o o o undab o i o o e l l l l l l l l ff - - - ca ca B S G T T T B T Sou o L T T i i Q Q Q Q Q Q Q Q h h h , , ,

r r , , , , , , , , , , t t t t t t t t t t t f f r r r d d d d d d d d d d A A A s s s s s s s s l l l l l l l l l l A A a a a a a a a a

Q W no e e Q Q W W e e e e Q Q e Q Q Q e no Q Q no h h , , , , , , , , , , , , , , , , , , , , , , , , t t s s s s s s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u u u u u u u u o o A A A A A A A A A A A A A A A S S A A A A A A A A A

6 0 4 5 2 9 4 2 1 9 1 8 1 0 5 3 0 3 1 8 1 956466 956469 67321 67322 673217 673208 673137 48819 48814 48813 48820 48824 48825 48814 48815 48818 48818 48822 48826 48821 48820 48814 488 49402 494020 U U U U U X X X X X X X X X X F F X X X X X X J J J G J J J J G J J J HQ HQ J J G G G J J J J J J

6 1 1 1 1 1 1 1 1 2 2 0 0 0 0 0 0 0 0 0 0 0 0 1 ------

4 4 5 5 6 6 0 0 0 3 3 6 2 640 673 673 673 673 673 673 672 672 652 672 675

H H H H H H H H H H H H 39956

O O O O O O O O O O O O M R R R R R R R R R R R R N I I I I I I I I I I I I S S S S S S S S S S S S S U

C C C C C C

C C C C C C

s s s s s s i i i i i i a a a a a a s s s s s s

n n n n n n m m m m m m

a a a a a l l l l

ce t ce ce ce ce ce i s s i i i i i u u u u a i i r r r r r r qua qua qua qua qua qua l c c c c

p p e s s s s s s i

u a a a a i i i i i i e e

s c l l od m m m m ode ode ode ode ode a B B B B B i i i i r r r r r r

go go . . . . . d d d d and and and and and and rrisi m s s s s s s nop li li i r r r r r r e e e e p p p p p a i u u u u u u

s s s s s o o b g g g g g g p p p p i i i i i i h

a a a a a a a a a a a a a a a a a a a r a i i i i i i i i i i i i i i i i i i i o c c c c c c c c c c c c c c c c c c c r ococ ococ ococ ococ ococ ococ p go go go go go go go go go go go go go go go go go go i go i i i i i i i i i i i i i i i i i i m m m m m m n n n n n n n n n n n n n n n n n n u u u u u u ev ne O O I K K K K K K L O O O O O O O O O O O O O O O O

1 2

- - 2 1 9 0 1 2 3 4 4 5 6 5 3 7 9 8 4 8 9 7 8 9

4 4 . . 5

4 511 326 511 512 512 512 512 296 508 508 508 509 911 911 509 523 533 507 507 508 508 508 33

155 155

A A A A A A A A A A A A A A A A A A A A A A ------044 M A G W W W W W W W W W W W W W W W W W W W W W W B B B B B B B B G B B B B B B ADC ADC B B B U B B B B B

142 APPENDIX 2

l a

t f a l u N

-

G R

y y y u

l t t t t t

a a a i B i i i i h e u t a a a a a

B B B n G

Z r s s r r r r

e - t t t t t I I d d d d k k k ou r n l l l l a S r r r S S S S e m

i m w w Q Q Q Q s er o

x p o o h P Kw t st st st st Sha Sha Sha E

m , rr rr

, rre rres rres rres rres a a a a e d d d d d d d a a a o o o o o e e e e ff ff ff ff l l l l l l l - - - - ca o o o D o B B Sou T T T T T i Q Q Q Q Q Q Q qu h h h h , , , , , , ,

r , , , , , , i t t t t t t t t t t t f r r r r d d d d d d b A A A A A A A s s s s s s s l l l l l l A a a a a a a a

m e e e Q e Q Q Q no no no no Q Q e e e W W W W W W W h a , , , , , , , , , , , , , , , , , , , , , , , , t z s s s s s s s s s s s s s s s s s s s s s s s s u o u u u u u u u u u u u u u u u u u u u u u u u u o A A A A A A A A A A A A A A A A A A A A A A A A S M

6 6 0 5 1 4 0 8 6 4 9 9 0 2 8 5 4 7 7 7 956471 956473 956474 956475 48823 48826 48827 48827 48816 48824 48817 48814 48816 48819 48826 48819 48825 48818 48819 48816 48826 48822 48819 48823 494054 494053 Q X X X X X X X X X X X X X X X X X X X X F F J J J J H HQ HQ HQ J J J J J J J J J J J J J J J J J J

9 8 8 3 0 2 0 0 0 0 1 0 ------2 8 4 4 5 2

5 g g

4 8

re re 637 640 640 6 640 638 g

00

- H H H re un un H H H

d 0 l e O O O O O O O O O R R R R R R R R R hh I I I I I I I I I t 2966 S S S S i S S S S S C C C

C w C C C C C A

s s p cep ce

i i s s s g i i i

p p p n

e e e o ong a l l l a a a l l

s s s s

o o o s s B B B B B B B B C C C C C C C C C p p cr cr cr no no no no ...... i i i i a a a ce ce p p p p p p p p p p p p p p p p p p p p p s s s s s s s s s s s s s s s s s s s s s m m m li li

u u a a a a a a a a a a a a a a a a a a a a a a a a i i i i i i i i i i i i i i i i i i i i i i i i c c c c c c c c c c c c c c c c c c c c c c c c c c o o ill ill go go go go go go go go go go go go go go go go go go go go go go go go i i i i i i i i i i i i i i i i i i i i i i i i n n n n n n n n n n n n n n n n n n n n n n n n ap ap O P O O O O O O O O O O O O O O O O O O O O O O O P

5 . 155

h t 1

i

- 8 0 1 7 3 9 2 3 4 0 1 2 3 2 3 4 6 2 3 4 5 7 9 0 5 m . S

509 509 509 530 911 912 912 912 508 508 508 508 509 509 509 509 529 326 326 326 326 326 327 155 #100 08 A A A A A A A A A A A A A A A A A A A A A A A ------G

F W W W W W W W W W W W W W W W W W W W W W W W 2 B B B B B B B B B B B B B B B B B B B B M B B B ADC ADC #

143 APPENDIX 2

t

t t

u

t gh y e e e e i d e e y y gh gh a l l l l a

i i t t t t r r k k B s

s s s s B o o B B I an a a

nr

p p

l t t a a a a

a k k k L L a a c c c c an

y y ry

c c an an ad on on li a w w w w a ec ec ec n y a a e li li

a e e e e

ah e ah

a B B m m f buh il il N N N r a a abbo

e l

H N N N N n o o t a B r r H

er er

p l p C C n l

s u k k k r r t t G f f f f

e o , , e s s k u f P P o o o o w w w G c er

c illi illi u u P

o t m a i A s s ugg n ugg

h h h h ,

h h s i o A A h t t t t ha ha onda t h

T T a er P P e r r r r e e

t r t t P L on cer on a Java Java

s l l l

d s i o o o o s t t a , a a t n l l ff ff r r re e il il r e a a o D N N N N o B Java ag ag ag re re re o o

o r r Sou , , , , , , , , G t E F E E t t W W P P qu ,

G G Sp P s , i , , , , , , , , e W , , , W W W W W W W , s s s s C b en en c c c c A i i i i I S S S S S S S S a a a a A A A A C W C m N S S V V T T T T V S V V N N N N N N N W S , , , a , , , , , , , , , , , , , , , , , , , , , , o o o z s s s s s s s s s s s s s s s s s s s s s s o u u u u u u u u u u u u u u u u u u u u u u nd nd nd M A A A A A A A A A A A A A A A A A A A A A A I I I

3 1 5 5 6 6 9 3 1 8825 392273 392262 902668 902678 392236 56153 956032 56451 108005 107991 107992 107993 107994 107995 107996 661065 673453 4 48815 48821 48824 312818 312819 48816 48818 48828 M M M M U M U Q Q Q Q Q Q Q X X X X N N X X X HQ J D J J J D J HQ J J H H D D D D D H H G H J J G HQ

1

1 3 1 0 3 3 3 1 0 0 0 - 0 1 1 2 - - -

- - - -

3 3 3 3

g g

3982 2 5 3 3 re re 5 683 3796 5316 4480 710 710 710

00 00 01 00 00 H H un un H H H H H H - - - -

- 3 5 3 5 5 7 O O O O O O O O O O R R R R R R R R R R I I I I I I I I I I 2455 2518 S S S 2620 2921 2614 S S S S S S S 4462 . A A

C C C I A A A C C C C C C C

s s s s s s s s u u u u u u u u t t t t t t t t

a a a a a a a a s s s t t t t t t t t c c c c c c c c u u u t t t

a a a

l l l s s s s

p u s s s u u s s s s s s u u u

i i i i i i i i i t t t opun opun opun opun opun opun opun opun c c c s s s s s s s s s s s ce e e e e e e e e a a a a a a i l l l l l l l l u u n n n n n n n n n t t ll ll ll u u u u u u u u m m m e e e i i i r r r sse sse sse sse sse sse sse sse sse lt lt lt er er er er er er er er ong l ona ona a a a a a a a a u u u

au ba ba ba c c au au ba ba ba ba ba ba c c c c c c c c c c c s

s s s s s s p s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u u u u u u u l l l l l l l l l l l l l l l l l l l l l l l l l ce li u pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha c o yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce ill t t t t t t t t t t t t t t t t t t t t t t t t t a a a a a a a a a a a a a a a a a a a a a a a a a l l l l l l ap l l l l l l l l l l l l l l l l l l l P P P P P P P P P P P P P P P P P P P P P P P P P P

3 #

5 5

7 8 1 3 3 8 6 1 . 1 5 6 2 1 2 1 3 8 9 0 1 2 3 4 5 00 - 47 47 49 49 50 943 943 944 50 50 50 50 50 841 842 575 618 907 7 #30 #76 #76 #96 #73 #73 _155 A A A A A A A A A A A A A A A A A A ------G G G G G G F F F F F F W W W W W W W W W W W W W W W W W W 4462 . ADC B B M B B B B B B M M M B B B B B B B I M M B B B

144 APPENDIX 2

e

e e e e l l l l

stl t t t t

g g a s s s s s c

e a a a a

e

c c c c

k w a a a a a n n n n n den den e a n n n n w w w w

on a a a a a a a b b b b b a a a a e e e e L N t y y y t t t t

n n n n n

S S s a a a m m m m m f N N N N n n n n , ,

a a a a a o f f f f B B B a a a a ga ga ga ga ga

ad o o o o l l l l Y Y Y Y Y n n n n n and h

m m m m l e e e t t t t t o o o o o f f f f f s G li li li li s s s s

Java Java o o o o o

f a a a a

a a a a ou pp pp pp ed ed ed ed ed l l o pp e e e a a N N N N N E E S E E

K K K K i K K K K K r r , , , , , , , , , , t t t t K K E K , , , , , t t G s s s s , , , , li li li li li , e e e e W W W W W W W W W W d d d d en en c a a a a a l l l l i S S S S S S S S S S W W W W C B B B B B C N N N N N Q Q Q Q N N N N N V , , , , , , , , , , , , , , , , , , , , , , , , , , o o o o o o o o o o o s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u nd nd nd nd nd nd nd nd nd nd nd I I I I A A A A A A A A A I I I I I I I A A A A A A

4 5 0 4 3 2 5 9 1 9 5 392244 107998 107999 108000 108001 107990 107986 107987 107988 107989 107974 673447 67344 67344 673443 673487 673462 48823 48827 48822 48828 48828 48817 48822 48827 48823 U U U U U U M Q Q Q Q Q Q Q Q Q Q X X X X X X X X X G G G G D D D D D J J J J J J J J J G G D D D D D H

1 1 2 2 2 1 0 0 0 0 0 0 ------

6 6 2 6

g g g g g g re re re re re re 3980 671 671 651 671 3986

un un un un un H H H H H H un

O O O O O O O O O O O O R R R R R R R R R R R R I I I I I I I I I I I I S S S S S S S S S S S S C

C C C C C C C C C C C

s s s s s s s i i i i i i i s s s s s s s

n n n n n n n s s s s s s s s s i i i i i i i i i e e e e e e e t t t t t t t s s s s s s s s s

h h h h h h h n n n n n n n n n s s s s c c c c c c c e e e e e e e e e t t t t t t t t t u u u u a a a a a a a t t t t h h h h h h h h h r r r r r r r

a a a a c c c c c c c c c s s s s s s ll ll ll ll a a a a a a a a a nd nd nd nd nd nd nd u u u u u u e e e e r r r r r r r r r e e e e e e e

lt lt lt lt sc sc sc sc sc sc ...... f f f f f f f u u u u nd nd nd nd nd nd nd nd nd u u u u u u c c c c c c c c f c c c e e e e e e e e e f f f f f

s s s s s s s s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u u u u u u u u l l l l l l l l l l l l l l l l l l l l l l l l l l a pha pha pha pha ph pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce t t t t t t t t t t t t t t t t t t t t t t t t t t a a a a a a a a a a a a a a a a a a a a a a a a a a l l l l l l l l l l l l l l l l l l l l l l l l l l P P P P P P P P P P P P P P P P P P P P P P P P P P

4 5 6 7 4 5 6 7 2 3 4 5 6 1 7 4 1 2 3 4 5 1 2 3 4 5 19 6 619 619 619 49 49 49 49 49 507 507 507 507 610 610 610 610 610 614 616 51 51 51 51 51 #30

A A A A A A A A A A A A A A A A A A A A A A A A A ------G F W W W W W W W W W W W W W W W W W W W W W W W W W B B B B B B B B B B B B B B B B B B B B B B B B B M

145 APPENDIX 2

k k k k r r r r a a a a P P P P

l l l l t t e e

a a a a a k k i i i i i ona ona ona ona r r r r r

ar ar ti ti ti ti a a a a a s a a a a t t t t t

e m m

n n n n n a N N N N k

e e e e e a a a n n k a e e e p p p p p a a u L r r r r r S S S h h s

a a a a a o C C band band band band C C C C C k na na na i i

y y y y i i i o f f f f f e e and l l l a a a a h h h o o o o o Y s

p p N N N N f f f f f C C C ,

l l l l

l , , , , A A o pp d d d u u u u h h h u t , , i l l l lf lf lf lf t t t g g G G G G G u u u u G Q Q Q an n n

, , , , , , t t t G G G G o o

d d d d d c K s s s Sou Sou Sou l l l l l i

, , , , a a a K K

V an an an an Q Q Q Q e e e Q a a a a a a a i i i i g g , , , , , , , , , na na na s i i i s s s s s s s s n n o o ore ore ore ore ore ore ore u h h h u u u u u u u u ers ers ers ers A C C C H H Japan K K K K K K K P P P P A A A A A A A A

7 9 3 2 1 8 4 0

2 1 9 0 6 7 8 9 9 8 7 7 5 1 2 39223 18078 18079 18079 18079 18078 18079 18079 14990 14990 14989 14990 10797 10797 10797 10797 107975 673222 673219 59522 59522 59522 48828 48814 48826 95281 M M M M M M M M U U Q Q Q Q Q U U U X X F X H E E E J J J H H H H H H H HQ HQ HQ HQ D D D D J G G D

1 1 1 0 0 0 - - - 3 5 4

4 671 671 671

00 H H H -

d l 3 e O O O R R R hh I I I t 2551 S S S i

A C C C w

) ) ) s s s u u u t t t a a a ll ll ll e e e lt lt lt u u u c c c . . . P P P

y y y l l l e e e

k k k s s s s s s s s s s li li li u u u u u u u u u u

(

( (

c c c c c c c c c c

s s s s s s s s s s s i i i i i i i i i i s s s s s u u u u u u u u u u u u u u u cu c c c c c c c c c c c c c c nd nd nd nd nd nd nd nd nd nd i i i i i i i i i i i i i i i i i i i i i i i i i sc d ...... f f f f f f f f f f u n nd nd nd nd nd nd nd nd nd nd nd nd nd nd c c i c c c c c c c c i i i i i i i i i f i i i i i

s s s s s s s s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u u u u u u u u l l l l l l l l l l l l l l l l l l l l l l l l l l a h pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha p pha pha pha pha pha pha pha yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce t t t t t t t t t t t t t t t t t t t t t t t t t t a a a a a a a a a a a a a a a a a a a a a a a a a a l l l l l l l l l l l l l l l l l l l l l l l l l l P P P P P P P P P P P P P P P P P P P P P P P P P P

1 2 3

1 2 3 4 5 6 7 71106 71106 71106 Z Z Z - - -

h h h

_00000 _00000 _00000 _00000 _00000 _00000 _00000

s s s 9 0 1 2 3 I I I I I I I 6 i i i 3 7 8 9 0 6 P P P P P P P F F F - - - ______

908 909 51 51 51 52 507 507 507 51 1013 1044 1138 109 #73 2 K K K K K K K O O O A A A A A A A A A A I I I ------G C PF S S S M M M M M M M F S S S S S S S PPF P PPF PPF W W W W W W W W W W C C C M S S S B B KO N N N N N N N N N N N B B B B B B B B

146 APPENDIX 2

a e S

na l l

i e e e e

l l l l l a a i h t t t t a t t

g s s s s t a a C e e p p d d n

a a a a a

p p a a N N c c c c a h a a N - - c c a a l l t

- w w w w w u u a a u u C C l l

e e e e n n u u s s

il il l e u u Soun Soun

li li y N N N N n n n n

u Sou C C n i i a k k Z Z n f f f f n n , e , , - - Z n n er er a r r o o o o ar e e a a a

an an m st st B li h h h h P P r r o a a , bu bu

t t t t

o F F t t t t t e e P k k Java Java

Kw E E Kw Kw s s s s s T

t t c c , k k l l , , , , , a a a a a , r r e r r o o a a Sou Sou Sou Sou e e e e e r o o o o Java r r ca ca ca ca ca - - - - - , , , , C C a i i i i i t t P P qu t h h h h h Y Y c , , uangdong r r r r r i n s t t t t t , , s f f f f f , , W W W W e b en c c A A a G i i S S S S A A A A A A A , ou ou ou ou ou C

C E m

s s s s s V S V S W W N N N N , , , h h h h h a , , , , , , , , , , , , , , , t t t t t na o o o z i s s s s s s s s s s s s s s s u u u u u o adaga h u u u u u u u u u u u u u u u o o o o o nd nd nd M S S S S S M I I I C A A A A A A A A A A A A A A A

9 9 1 5 4 7 8 3 9 0 9 6 1 6 9 885038 885039 107980 107981 107966 107967 107968 107 107970 107971 107972 60748 48823 48824 48817 48817 48821 48823 48815 48821 48820 48820 48824 313240 313241 494161 Q Q Q Q Q Q Q Q Q Q Q F F X X X X X X X X X X X N N J D J J D J J J J J E D D D D D J J J J J J D D D D

1 4 3 0 0 0 - - -

1 1

3 1

- 2 3 1 635 635 3963 6

. 00 00 00 H H H 9750 - - -

5 0 0 155

O O O B 9 9 h t R R R A i I I I I 2619 2938 2613 S S S m A

S A A A 7829 7829 C C

C S

1 1 2

r r r

s s s s s s i i i i i i s s s s s s s s s n n n n n n va va va

u u u u u u u u u

i i i i i i

t t t t t t t t t s s s s s s s s s s p p p p p p s s s s s s u u u u u u u u u u ga ga ga ga ga ga ga ga ga i i i i i i i i i i i i i i i c c c c c c c c c c

i i i i i i i i i i

. ev ev ev ev ev ev ev ev p nd a a a nd nd nd nd nd nd nd a a a a a ong ong ong ong ong ong nd nd aev s i l l l i i i i i i i l l l l l l l l l l l i i

l s s s s s s s s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u u u u u u u u l l l l l l l l l l l l l l l l l l l l l l l l l l a a h h pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha p yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce ycep t t t t t t t t t t t t t t t t t t t t t t t t t t a a a a a a a a a a a a a a a a a a a a a a a a a a l l l l l l l l l l l l l l l l l l l l l l l l l l P P P P P P P P P P P P P P P P P P P P P P P P P P

6 9 2 . 18 32 155 T T

- -

- h 2 9 9

1 t - i 9 C - 1 3 4

6 -

. 5 6 0 5 C w m 6 5 6 6 07 1 2 3 4 5 6 7 8 9 - - . - S 7829 7829 6 9

0 155 578 578 597 52 52 52 52 52 1092 1092 52 52 52 52 5 #30

A

B B #73 #73 #96 08 155 - A A A A A A A A A A A A A A h S I ------t A A G G G G 201 i I I C II

F F F F V - W W W W W W W W W W W W W W S m A A 7 ADC S S S ADC L A B B B F B B B B B M M M M B B B B B B #

147 APPENDIX 2

e e e e k k k k

a a a a

h h h h h e e e e e e L L L L

l

l l l l l t t t t t h

st s s s s s l l l l l oug oug oug oug oug ah ah ah a a a a a a

r r r r r c c c c c c ga ga ga ga ga er er er d

i i i i i w w w w w w y bo bo bo bo bo e e e e e e ggera r r r r r a an

l a a a a a u err err err err ugg ugg ugg err N N N N N N B s s s s

c c c c c

I I I Is I f f f f f f T T T T T T T T T

S S S S S k o o o o o o t t t t t

f f f f f f f f f

r f f f f f o o o o o o o o o h h h h h h

es es es es es o o o o o t t t t t t

t t t t t t t t t n n n n n t t t t t s s s s s s s s s Sha a a a tt tt a a a a a a tt tt tt

es es es es es o o o o o Sou Sou E E E Sou Sou Sou Sou E E E E E E ff

, , , , , , , , , , , , , , , W W W W W R R R o R R , , , , , , , , , , , W W W W W W W W W W W W W W W A A A A A A A A A A A S S S S S S S S S S S S S S S N W W W W W N N N W W N N N N N N N N N N N W W W W , , , , , , , , , , , , , , , , , , , , , , , , , , s s s s s s s s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u u u u u u u u A A A A A A A A A A A A A A A A A A A A A A A A A A

9 3 1 3 8 4 6 0 829 8 902691 902692 902569 902659 902662 90267 902689 902696 107973 107958 107959 107960 107961 107962 10796 107964 107965 107950 107951 4 48824 48815 313246 48828 48828 48815 M M M M M M M M Q Q Q Q Q Q Q Q Q Q Q X X X N X X X D D D D D D J H H J J D D D D D H H H H H H J J J J

1 3 2 4 2 5 1 3 2 6 0 0 0 0 0 0 2 0 0 0 ------

8 8 9 0 6 0 1 3 6

g g g g g g re re re re re re 634 634 634 635 683 635 638 3985 683 683

H H H H un un H H H un H un H un H un

O O O O O O O O O O O O O O O O R R R R R R R R R R R R R R R R I I I I I I I I I I I I I I I I S S S S S S S S S S S S S S S S C C C C C C C

C C C C C C C C C

s s s s s s s s s s s

s s s s s s s s s s s u u u u u u u u u u u i i i i i i i i i i i t t t t t t t t t t t

a a a a a a a a a a a n n n n n n n n n n n i s s i i s s i i i i i i i i r r r r r r r r r r r p p p p p p p p p p p li li o o o o o o o o o o li li o s s s s s s s s s s a a a a is i i i i i i i i i i m m m m m m m m m m m it it it it r r r r r r r r r r r b b b b a a a a a a a a a a a r r r r ong ong ong ong ong ong ong ong ong ong ong l l o o l l l l l l l l l m m m m m m m m m m o o m

s s s s s s s s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u u u u u u u u l l l l l l l l l l l l l l l l l l l l l l l l l l a h pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce ycep t t t t t t t t t t t t t t t t t t t t t t t t t t a a a a a a a a a a a a a a a a a a a a a a a a a a l l l l l l l l l l l l l l l l l l l l l l l l l l P P P P P P P P P P P P P P P P P P P P P P P P P P

5

4 9 0 2 4 7 4 6 4 6 0 1 2 3 4 5 6 7 8 9 0

2 3 4 5 53 53 53 53 53 53 827 843 844 53 53 53 53 54 829 840 840 842 843 844 1093 325 6 6 6 6 A A A A A A A A A B B A A A A A A A A A A A A A B B ------W W W W W W W W W W W W W W W W W W W W W W W W W W B B B B B B B B B B B B B B B B B B B B B B B B B B

148 APPENDIX 2

y y y n n s s a a a o o

e t t B B B d k

a and n n n

l res res y y y y an e e e L s

l a a a a

P P

Is I

k k k s

d t t

t t t B B B B o o o i i e e n t

s s o o

r r r f f a a e p ll ll p p p an

gh gh gh l and r r i ee l B ap ap B B i i i l e e t t l

d ee ee n u s a a a l f f f I C C illi illi illi il B B Is S S

r r r

R R o o o Q

t t t f f h h h h

Q e e

d pp

t t t t t o o n n er S S S i P P P P r s s s h i i

st n t

t t t t a a a a a a G rres rres a r on r on ss ss ss

r r r r z d d W W E E E o o i e l l w w o o a a a o o o o ff - , , , N N M M T T L S S B B B P C P P P o N Q Q h , , , ,

, , , , , t , , , , , , , , , , t t W W W r d d d d d d c c c c c c c c c A A A c A s s l l l l l l i i i i i i i i i i S S S a a V V V N V V V V V V W W W Q V Q e e no Q Q Q Q N N W , , , , , , , , , , , , , , , , , , , , , , , , , , s s s s s s s s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u u u u u u u u A A A A A A A A A A A A A A A A A A A A A A A A A A

0 4 7 4 8 2 2 7 1 2 3 3 2 8821 392238 90265 108006 108007 107952 107953 107954 107955 107956 107997 107982 107983 10798 107985 48821 312804 4 48823 48819 48817 48818 48814 48823 48828 48820 48825 M M Q Q Q Q Q Q Q Q Q Q Q Q X N X X X X X X X X X X D D J J D D D D D H D D D D D J J J J J J J J J H J

1 2 1 2 1 2 1 7 5 2 3 3 3 0 0 0 - 0 0 0 0 0 1 0 0 0 0 - -

------

3 9 9 0 8 2 4 9 1 4

g

3761 6 re 4317 4310 654 673 673 674 689 641 727 683 684 727

00 H H H H H H H H H H H H H un -

4 O O O O O O O O O O O O O O R R R R R R R R R R R R R R I I I I I I I I I I I I I I 2551 S S S S S S S S S S S S S S A

C C C C C C C C C C C C C C

i i i i

r r r r r r e e e e e e e e e e e

on on on on o o o o o o s a a a a a a a a a a a t t t t t t

s s s s u li li li li li li li li li li s li s s s a a a a a a d d d d t l l l l l l a a a a a a a a a a r r r r a n n n n a u r r r r r r r r r r u u u u u r e t t t t t t t t t t t tt d de de de ha ha ha s ha ec i ec ec ec ec ec i i i u c c c es es es es es es es es es es e c p i i i p p p p p i g rs rs rs rs i s r r r s s s s s w w w w w w w w w w r w

v s s s s s s s s s s s s s s s s s s s s s l ve ve ve ve i i i i u u u u u u u u u u u u u u u u u u u u u u l l l l l l l l l l l l l l l l l l l l l d d d d f

s s s s s u u u u u pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha l l l l l e e u u u u u c c yce yce yce y yce yce yce yce yce yce yce yce y yce yce yce yce yce yce yce yce ab ab ab ab ab t t t t t t t t t t t t t t t t t t t t t t t t t t a a a a a a a a a a a a a a a a a a a a a a a a a a l l l l l l l l l l l l l l l l l l l l l P P P P P P P P P P P P P P P P P P P P P R R R R R

5 6

8 7 8 9 0 6 2 2 0 8 9 2 3 1 2 3 4 5 6 7 8 9 0

3 47 48 48 843 54 54 54 54 54 50 50 50 50 51 512 512 512 513 911 1194 1194 838 839 325 #73 A A A A A A A A A A A A A A A A A A A A A A A A ------G 052 F G W W W W W W W W W W W W W W W W W W W W W W W W B B B B B B B B B M B B B B B B B B B B U B B B B B

149 APPENDIX 2

d d d d y y e a a

an an an an s on B B l l l l

y I R t s s s s

t t t t t t t t

s s s a i i i i i i i i B o e n n n n d d a a a a a a a a B ll n

G ad r r r r r r r r ee ee ee ee

e l e t t t t t t t t ar ar k u u u u n r B S S S S S S S S h h G m

c c Q Q Q Q e o f i i er

t o h P R R

st st st st Sha t

t ,

, , rres rres rres rres rres rres rres rres a a a a r on s e d d d d d d d o o o o o o o o e e e e ff l l l l l l l a - - - - ca ca o M e T T T T T no T T T i i Q Q Q Q Q Q Q qu h h h h , ,

r r , , , , , , , , , , i t t t t t t t t t t t f f r r r r d d d d d d d d d d b A A s s s s s s s l l l l l l l l l l A A a a a a a a a

m W W Q e e Q Q no no no no Q Q Q Q Q e e e e e Q Q h h a , , , , , , , , , , , , , , , , , , , , , , , t t z s s s s s s s s s s s s s s s s s s s s s s s u u o u u u u u u u u u u u u u u u u u u u u u u u o o A A A A A A A A A A A A A A A A S S M A A A A A A A

4 7 7 7 7 7 6 8 2 4 2 5 4 8 0 0 9 5 4 9 7 561519 956467 673209 673210 80497 805103 67322 48815 48826 48820 48814 48814 48822 48816 48814 48821 48820 48815 48820 48826 48828 48823 48817 48816 48824 48816 U U U U U X X X X X X X X X X X X X X X X X X X J J J J J J J J J J J J J J G G G G HQ J J G J J J HQ

2 1 1 1 2 6 2 3 3 3 1 4 1 3 1 1 1 2 3 4 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ------2 3 4 4 3 2 4 4 1 1 1 8 9 2 3 1 9 3 3 8 674 674 674 674 642 641 654 654 654 654 674 653 670 674 653 674 670 653 653 653

H H H H H H H H H H H H H H H H H H H H

O O O O O O O O O O O O O O O O O O O O R R R R R R R R R R R R R R R R R R R R I I I I I I I I I I I I I I I I I I I I S S S S S S S S S S S S S S S S S S S S C C C C C

C C C C C C C C

C C C C C C C

s s

a a a a a a a u u

t t t t t t t t t a a

a a a a a a a a a s s l l l l l l l

a

tt tt e e t e e e e e u u u u u u u r r r r r r r s s u u u u o c c c c c c c a a a a a e i i i i i u u r r r r r r r g g g g n ge ge ge ge ge g ge t t i i c c c c c e u u o i i i i i a a ti ti ti ti ti ti ti v v t t i be be be be be be r r r r r l l s s s s s s s r r r t t t t t i i i i i i i rr rr ub u u u u u u u u t p r r r r r r r e e f f

t t t t t t

po po pa pa pa pa pa p p p p p p p s s a

a a a a a a s s s s s s s s s s s s s s s s a a n n n n n n n u u l l u u u u u u u u u u u u u u n n i i i i i i i i i i i i i i u u ogona og og ogo ogo ogo ogo ogo ogo ogo ab ab t t rs rs rs rs rs rs rs rs rs rs a a ogad ogad ogad ogad ogad ogad ogad ogad ogad ogad ogad ogad ogad ogad o o o o o o o o o o S S S R R R R R R R R R R R R R R R R S S S S S S S

1 1 1 # # #

3 3 7 . . .

1 2 7 8 9 0 1 1 2 3 4 5 6 5 7 4 9 0 1 2 3 6 4 325 325 513 513 513 514 514 513 513 513 513 513 513 514 520 522 505 506 506 506 506 514 911 08_155 09_155 10_155 A A A A A A A A A A A A A A A A A A A A A A A ------W W W W W W W W W W W W W W W W W W W W W W W B B B B B B B B B B B B B B B B ADC ADC ADC B B B B B B B

150 APPENDIX 2

l a t a

N a a a a a

-

y

re u re re re re n

l a d t t t t i f i i i a u l B oo oo oo oo oo a a a

n an

u Z ra r r r s l - t t t t M d M M M M G

l ga a S Is S S S

, , , , , on

n a a a a a Q s s s d i i i i i

o t r cer Kw a st es es es es es

a n ed , rres rres rre a z n n n n n d d d d d e orre W o o i o e l l l l l K y y y y y - ca , l l l l l

T T T L T i , Q Q Q Q Q

h Sp s s s o o o o o

r , , , , , t li t t t t t e e e f W , P P P P P r d d d d d a s s s s s

l l l l l ll ll ll S A A a a a a a

h h h h h B e e e Q Q Q Q e e no Q e e e N S c c c c c , h h h h , , , , , , , , , , , , , t o n n n n n c c c s s s s s s s s s s s s s u y y y u u u u u u u u u u u u u re re re re re e o e e nd A A A A A A A S A I F F F F F A S A A S S A A

B

-

0 1 9 2 3 0 2 3 0 6 3 3 8 6 1 3 8 8 6 6 418266 956468 673488 43194 43194 43193 43194 43194 48814 48815 48826 48816 48822 48817 48815 48817 48815 48820 48825 48827 48826 48827 48817 U M A or BW X X X X X X X X Q Q Q Q Q X X X X X X X - HQ J J J J J J J J G J J J J J J J J J J J H J

3 1 2 2 1 1 1 3 4 0 0 0 0 0 0 0 0 0 ------7 1 1 1 2 2 3 3 3

g

7 3 6 re 1 672 673 673 673 673 673 673 630 630

6 4 03 un H H H H H H H H H

085

33 33 085 - 012 s s s s s 4

i i i i

i O O O O O O O O O O r r r r 5 r 7 7 R R R R R R R R R R a a a a I I I I I I I I I I P P pa P P S S S S S S S S S S 4108 . M M M M M 7822 C C C C C C C C C I C 7806 7806

s s s s s s

hu hu hu hu hu hu a a e e e e

t t t t t t

s s a a n n n n n n a a t

c c i i s s s s s s n a a a ona ona ona ona i i i i i l l l b b ona o si s s s s s aca aca aca aca aca aca e e u ilt ilt ilt ilt r r r r r r l l n n n n n n rr co co c to BOLD specimen numbers commencing BW irr i h h h h i i e e e e e e r c c ce c c ce c c ac ac ac ac ac ac n n it it it it it it

e e be s a a a a a a m m m m m m t t t t t r r t

y u s s s s s s o o o o o a a o r rys rys rys rys rys rys rys

t u u u u u u h a a a a a a a a a i d d d d d d i i i i i i i n c un un un un un un r r r r r r anoph anoph anoph anoph anoph anoph anoph anop ogo ago agoc agoc agoc agoc agoc agoc agoc ys ys ys ys ys ys ys ys n gg gg gg gg gg gg rs h h h h h h h h o Sun Sun Sun Sun Su T Sun T T T S Su Su Su Su Su Su Sun Sun T T T T

9 4 5 54 24 24 T T T - - -

5 7 7 -

4 4

. . 1 M 4 4 4 5 3 4 5 6 7 8 2 4 2 3 8 - . . .

2 03 7822 7806 7806 -

8 A 911 511 511 511 511 511 511 614 514 514 514 4 #30 - B B B

I A A A A A A A A A A A 0479 0185 0480 01384 01383 ------A A A I I I I I G 018 I II I I B B B B B - F G W W W W W W W W W W W 4108 A A A . B B B B B B B S U B M M M M M B M B B S S I M * ANFC voucher numbers refer onl y

151 APPENDIX 2

6 e

. 3 r s 1 a

±

e uscu a . 66 . f P li 10 a r t s

3 9 e s u . 3 . 5 t w a 1 1 . ll ± ±

e P lt

. 64 . 53 cu . 10 13 nd P a

s

u 5 2 3 c . 3 . 4 . 4 s 1 1 1

u d ± ± ± l f Q . 42 . . 49 . 79 9 P 12 10

, s u t

3 9 6 4 a

. 8 . 7 . 6 . 3 a ll v 1 1 1 1 a e ± ± ± ± J lt 2 62 r u . . 59 . 12 . 03 a c v 16 14 13 10 . P

s

3 3 6 7 8 c

i . 0 . 4 . 9 . 7 . 5 a r 1 1 1 1 1 av e ± ± ± ± ± J n 1 e r . 32 . 54 . 03 . 59 . 57 6 9 va 17 13 11 ong c

5 6 6 6 6 1

. 3 . 3 . 3 . 7 . 8 . 6 a ee e r 1 1 1 1 1 1

r s o h ± ± ± ± ± ± K . 1 / cu T i . 55 . 48 . 37 . 05 . 68 . d na 11

i 11 10 16 16 14 n s h i e *

e C * g s g u l ea ea n

pha n 7 2 8 1 6 3 5 li 8 . . 2 . 3 . 8 . 5 . 3 . 4 s li 1 yce

1 1 1 1 1 1 u t

s ± a c

± ± ± ± ± ± K u l i H c P 99 . . 48 . 27 . 58 . 68 . 01 . 34 i 8 5 nd 1 10 14 12 10 11 . i nd i

P

s

f

7 7 8 5 6 4 u .2 .7 o l

. 2 . 2 . 1 . 7 . 7 . 4 1 1 s

1 1 1 0 1 1 r n ± ± i a ± ± ± ± ± ± p a pha . 73 . 4 . 03 p 8 9 . 88 . 45 . 72 . 41 . 54 Ja

14 8 8 3 n * 13 11 yce t ee a l w

t

8 5 4 7 3 3 P f .1 .8 .6 e l

. 9 . 2 . 6 . 6 . 7 . 4 1 1 1 u f b 0 1 1 1 1 1

G ± ± ± o

± ± ± ± ± ±

n a . 76 . 79 . 76 x i ces 6 . 22 . 22 . 48 . 17 . 65 . 73 i 6 15 12 9 n r ers t 13 14 15 10 e P a g r m e

v 8 6 7 8 4 8 8 4 9 .1 i . 7 . 0 . 2 . 6 . 6 . 7 . 4 . 8 . 5 ce d 1

0 1 1 1 1 1 1 1 1 a n ± ) c ± ± ± i ± ± ± ± ± ± a t fr . 91 ** s 6 . 16 . 52 . 22 . 72 . 31 . 94 . 12 . 33 . 63 A ( i 4 6 9

13 14 15 11 16 12 d

. m P u on 2 m s i

K ) ) x ri f l t a ea u n r pa

m G o a a

v v ce n m K

) / ) r a nd i a Ja Ja

n

ca e s ) ) n a co i a r 1 2 i

d

P p e

fr l )

h r r r

s P e a a * A Ja HK C Q ( o 2 u a ( ( ( ( ( v v ( t . f

li

a s s s s s s s s 3 a s u u u u u u u u ll d m u c c c c c c c c S e i i i i i i i i u

c str lt s e de e u nd nd nd nd nd nd nd nd u m l i i i i i i i i c f w i u l ...... b n i c P P P P P P P P P P P a n i T M

152 APPENDIX 3

n n n

o o o a d r r r r t t t i a a a a r an es es es a u u u u l t r r r s

L L L L n P P P

I

R R R n n d d d e e e t o pe a a i B B B

p p p r ll a n n ung ung ung ung an an an a a a a a a a e r j j j j G G G l l l l l l a a

t

s s s n n n C C C C n e e e B n

n n n I I S I

a a a a

f f f f r r r o e ug ug ug T e e e T T T d d d o o o o t ti

r r es r , , , h h h , dong dong T T T f t t t

l e e rr on , , , r r r W W W za za za d d u i i i oca l l K K N N N M ca ca ca bok bok bok bok l G no no no L L L To i i i Q Q , , , , , , , , , , , , m m li, li, m m t t fr fr fr on d d d d d d d d A A A A a a o o o o l l l l l l l l ti A A A L B B L L L

W W W Q Q Q Q Q Q eas W Q eas Q , , , , , , h h h ec , , , , , , , , , , , , , , t t t o s s s s s s s s s s s s s s ll d u u u u u u u u u u u u u u o ou ou ou ndo ndo ndo ndo ndo n A A A A A A A A I S S I S I I A C I I A A A A A

b b b 1 b b s r e b NC

unpu unpu unpu

E

unpu unpu m u N

n b b b b b b b b b b b b b o i S

unpu unpu unpu unpu unpu unpu

16 unpu unpu

unpu unpu unpu unpu unpu ccess A

9 0 1 2 6 7 8 9 5 8 nk 2 6 2 5 4 2 6 8 6 8 a nb e

10800 10801 10801 10800 67320 67320 67347 67347 95646 10800 I

48820 48818 48826 48821 48822 48827 48819 48828 48825 48824 G . Q O F493229 F493230 F493231 X X X X X X X X X X s J J J J J DQ DQ DQ D GU GU J J J J GU GU C HQ J J DQ J J e l p

# I

m 4 4 2 2 2 2 2 5 1 1 1 1 2 3 2 2 p

a 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 O a s C H

d ea

h

2 * t 3 2 1 0 4 2 * - a 0 0 0 0 0 r

l - - - - - e f 0 2 7 6 7

b

g g r m e e 4012 o r r 679 652 673 668 614

f nu

H H H H H H un un r

s e r

O O O O O O O O h e g c R R R R R R R R e I I I I I I I I b r ou S S S S S S S S

m V C C C C C C un C C nu

) ) ) ) s s s s on u u u u i m m m m l l l l ss ha ha ha ha

t t t t s s s s s s s s s s s s u u u u u u u u u u u u acce m m m m m m m m m m m m oph oph oph oph

l l l l l l l l l l l l t t t t a a a a ha ha ha ha ha ha ha ha ha ha ha ha ce m m m m t t t t t t t t t t t t

e e e e n i i t t n n n n e

r r . . . . oph oph oph oph oph oph oph oph oph oph oph oph o o f f f t t t t t t t t t t t t f f c c cf c a a a a a a a a a a a a qu ( ( ( (

m m m m m m m m m m m m . . . . e a a i i i e p p p p s s s a a a s s s s n beau beau ne ne ne ne ne ne ne ne ne ne ne

o o r r r

t t t g g s s s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u u j j l l l l l l l l l l l l l l l l l l nd m m m

a a a

l l u u hee hee hee

rr rr a a a on s e e ll ll ll e ti i e e e is is bacepha bacepha bacepha bacepha bacepha bacepha bacepha bacepha bacepha bacepha bacepha bacepha bacepha bacepha bacepha bacepha bacepha bacepha i i i b b m m m m m m m m m m m m m m m m m m ec ca oc oc oc y y y y y y y y y y y y y y y y y y m m p o S A A C C C C C C C C C C C C C C C C C C C C C l on ti ec

5 5 5 ll

* o er C #6_0 #7_0 #8_0

b

2 2 2 1 m . . . . 4 nu

4 155 155 155 e S

l 4 5 3 4 1 2 6 7 6 1 0 5 1 2

h h h p 4 5 6 7 8 e it it it l m 512 512 611 611 48 48 48 48 48 510 510 519 519 563 911 912 1143 590 615 615 a m m m b S A A S S S A A A A A A A A A A A A A A A A A A a T

153 APPENDIX 3

y

a a B li

l

a

t t

r r r r r i e e t ko a a a a s k k

c u u u u r r ng i u a a a a a a L L L L v v v N A

a m m w

n f

J Ja Ja t n t t a i i i o r g g l l l

a a a

n e ung ung ung ung t n n a a a s s r t r r j j j j nyu a d r r r t I t I t u u l t t t n n n n

a S es S S a a a a n n n eas

K K

Q B w w - e e e s T T T T i i t , o o W h es es e

a a , , , , C C C dong a t

rr rr r e , , , rr rr rr S S v a a d d d d d d d d W eas p p p , , l l l l l l l l

K Ja S no B B - bok bok bok bok To To To Q Q Q Q Q Q Q Q ca ca ca t , , , , h , , , li, m m m m t t t t t t t t t ong ong r d d d A A A A a ili ili ili o o as o o l l l K K B L L C C E C L L

W eas W Q eas eas eas Q eas W eas Q eas W no eas , , , , , , , , , , , , , , , , , , , , , , , , , o s s s s s s s s s s s s s s s s d ong ong u u u u u u u u u u u u u u u u ndo ndo ndo ndo ndo ndo n ndo ndo I I I I I I H I H A A I I A A A A A A A A A A A A A A

b b b b b b b b b b

unpu unpu unpu

unpu unpu unpu unpu unpu unpu unpu

b b b b b b b b b b b b b b b b b b b b b b b b

unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu

0 1 9 1 9 2 3 7 0 9 9 5 3 9 9 1 1 8 2 67383 67435 67434 673485 673486 108003 108004 673225 673147 673218 48821 48818 48822 48819 48827 48818 48814 48821 48822 48827 48825 48813 48825 48815 48818 48814

X X X X X X X X X X X X X X X X GU J J J J J J J

GU GU GU GU DQ DQ GU GU J J GU J J J J J J J

1 1 1

8 8 8

2 1 1 1 1 1 1 1 2 1 1 1 2 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ------4 9 1 0 5 5 6 8 7 7 4 6 0 3

0 g g 4 e e r r 407 466 671 674 672 672 672 672 672 6 673 673 672 652

H H H H H H H un un H H H H H H H

8 0 3 O O O O O O O O O O O O O O O O 7 8 R R R R R R R R R R R R R R R R 2 2 45 I I I I I I I I I I I I I I I I S S S S S S S S S S S S S S S S M M

KD L L C C C C C C C C C C C C C C C C

) ) ) s s s u u u m m m l l l ha ha ha t t t oph oph oph t t t a a a m m m

e e e

s s s

n n n i i i i i

a a . . . s s s r r f f f

m m c c c r r r ge ge ( ( ( a a a a a a a a a a e e e i i cen cen cen

c c c c c c c c . . . i i i i i i i i i i i i i i a a p p p qu qu t t r r r ab ab ab

s s s s s s s tti i i tti tti

i i i i e e e s s s s s s sc sc sc s s

ode ode ode i i n n u u u u u apon apon apon apon apon apon apon apon l l l l l r r r j j n n

es es es and and j j j j j j

rr rr s s s onn ...... o o nop r r f f s s s lit lit lit u u u i g g i i i cf cf cf cf cf cf c c ha ha

a a a an an an r op op op a a a a a a a a a a i i r r r i i i i i i i i i i o c c

c c c c c c c c c c r s s s ococ ococ ococ bacepha bacepha bacepha bacepha bacepha p e e e mm mm mm go go i t t t go go go go go go go go go go i i m m m a a a m m m m m a a a e e e e e e e e e e r r r n n y y y y y u u u l l l ev n n n n n n n n n n C C C C C E E E G G G I I I I I I I I I I K K K L O O

1 8 0 4 7 7 1 2 3 3 4 8 0 3 4 7 8 5 6 1 9 3 4 5 6

9 0 759 764 765 48 49 506 506 514 574 574 574 510 510 510 598 614 614 908 908 510 510 326 511 512 296 508 508 A A A A A A A A A A A A A A A A A A A A A A A A A A A

154 APPENDIX 3

t

h y l l l y y g a a a a r r

i

t t t f o o s B l a a a B t t I

u n y N N N

r - - - on o G

an y

y y y R

n u u u

e a li

l l l m m a a a d bbo h t t e B n t i i a e e u u u o o a B B B B

r r r o a a H

n n

G t an

Z Z Z t s s r r r

G l e e P P ou s - - - t t I k k I k s

k d d

e s

n r r r f l l u a a a t d S S I s s c r m m m a a a

i o w w a e

Q Q A r l d o o on h on es es h r e t t sas t Po Po Ex Sh Sh Sh t Kw Kw Kw t s s i G

rr rr d ,

, rr rr , , , il il za a ea a e d d d e e D ff ff ff ff i l l l ff r r eas eas , B o o o B o ca ca ca - - Sou o To L To W W F Sou i i i Q Q Q G qu qu , , , , , , h h , , , , , i i , , , , t t t t , W t fr fr fr r d d r d c d d c c b b A A A A A A l l l i l l i i S as A o A A A

m m Q Q n eas Q eas V Q Q no V W V eas W W W S T W W N h h h , , , , , , , , , , , , , , , , , , , , , , t t t za za s s s s s s s s s s s s s s s s s s s s s s o o u u u u u u u u u u u u u u u u u u u u u u ou ou ou S S A A S M A A A A M A A A A A A A A A A A A A A A A

b b b b b b b b

unpu unpu unpu unpu unpu

unpu unpu unpu

b b b b b b b b b b b b b b b b b b b b

unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu

3 0 3 4 0 4 6 9 6 6 1 7 7 7 2 8 5 5 1 673208 673137 56153 107992 108005 107991 48822 48814 48818 48827 48824 48816 48826 48821 48824 48818 48822 48819 48823 48818 48819 48816 48825 F49402 F494020 X X X X X X X F494054 F494053 X X X X X X X X X X J J GU GU J J J J J J J J HQ J J J DQ J J J J J J J J DQ DQ

1 3 1 2 9 8 8 2 3 0 0 0 0 - - - 0 0 0 0 0 0 1

------3 8 4 4 2 5 2 3796 5316 4480 672 637 640 640 645 640 638

H H H H H H H H H H

O O O O O O O O O O R R R R R R R R R R I I I I I I I I I I S S S S S S S S S S

C C C C C C C C C C

s u t

a t s s c u u t t n

a a s s s u

l l

p p p s s s a u u a a a l l l op c c

si si si m ce ce ce e a a a a a i i i l a a a n n n a

l l l g g g u e e e m m s s ph ph ph u u u

i r i i n n n

qu c c c r ri ss ss ss e p p o o o e e e s a a a ce ce ce l l l a a a u a a a i a e e

s s s

o o o l l a b b b c au s s s m m m

i i i C C C p p p s s s s s s cr cr cr no no no go go d d d . . . and i i i u u u u u u a a a boga boga boga l l l l l l e r li li e e ce ce ce i i i p p p p p p s s s s s s p g m m m o o p p s s s li li li

u u u a a a a a a a a a a a a a a a a a a pha pha pha pha pha pha i i i i i i i i i i i i i i i i i i c c c c c c c c c c c c c c c c c c oc oc oc o yce yce yce yce yce yce ill ill ill go go go go go go go g go go go go go go go go go go t t t t t t i i i i i i i i i i i i i i i i i i a a a a a a n n n n n n n n n n n n n n n n n n ap ap ap l l l l l l O O O O O O O O O O O O O O O O O O P P P P P P P P P

2 #

5 .

155

3

h # 1 2 1

it - - - 5 5 . 4 4 m . . .

5 S

4 5

155 155 1 5 7 9 0 8 4 8 9 7 1 2 4 3 4 5

_155 08 1 3 8 9 0 1 C C 044 C C C 509 326 326 327 523 533 508 508 509 508 509 509 326 326 326 47 47 49 49 50 50 A A A A AD AD A A UG A A A A A A A A A AD AD AD A A A A A A

155 APPENDIX 3

t

h t t e e u g e

t i tl tl ke k a a a a a a r r i i i i i B r

r r r r r

a a

n a a a a a n cas cas p g g t t t t t a m m a

n n w n n n n n w

li

e e n n e e n n n n n aca a

a a n d d pe pe pe pe pe r buh a a a a a N N il n r r r r r t a a a h h

a l n n n n n t s a a a a a f f l S S C a a C a a a C o n u e o o , , , C C C C C c

i i a

P a a a A e f f f f f e n h h l l i , t t m v v v t o o o o o r r a

p p L li dong dong dong dong dong f f f f f o o Ja Ja Ja v

a l l l l l ea t e e e e e A A r l l l r d d d u u u u u N N , , l K l l Ja a a a K K K K K , , G r r r G G G G G t t t t t Q Q Q Po , , , , , , li, li, li, n li, li, n n , W t t W t es es ong ong d d d d d A a a a e a a e e l l l l l S S A K K B B B C W B B C C W

Q Q Q Q Q W eas S N eas eas N , , , , , , , , , , , , , , , , , , , , , , s s s s s s s s s s s s u u u u u u u u u ong ong u u u ndo ndo ndo ndo ndo ndo ndo ndo ndo ndo

I I A A A A A A I I A A I A I I H I H I

A A I A

b b b b b

unpu unpu unpu unpu unpu

b b b b b b b b b b b b

unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu

7 6 8 9 5 9 1 9 5 7 5 1 3 1 97 7 392236 107994 107975 10797 10 10797 10797 673447 673487 673462 673219 673453 107993 673222 48828 48817 48822 48827 48823 48828 48814 48828 48818 48826 M

X X X X X X X X X X H DQ J J J J J DQ DQ DQ DQ DQ J J J

J GU GU GU GU GU DQ J GU

3 3 3 3 3 4 3 3 3 2 6 5 0

3 3 3 9 3 1

6 6 6 6 6 5 5 5 5 5 4 4 4 6 6 5 3 5 5

1 1 0 1 1 - 0 0 0

- - - 4 3 5

g g g g 2 e e e e 3982 r r r r 671 671 671

00

- H H un un H H un un d

3 5 l e O O O O O O O O R R R R R R R R hh I I I I I I I I it 2455 2518 S S S S S S S S

C C C C C C w A A C C

s s

u u s s s s s s s t t i i s s a a si si si si si t t n n n n n n n c c e e e e e e e n n t t t t t t t

u u h h h h h h h s s s s s s s s s s s s s c c c c c c c u u u u u u u u u u u u u

a a a a a a a t t t op op c c c c c c c c c c s s s s s r r r r r r r i i i i i i i i i i e e a a a l l u u u u u d d d d d d d t t t t ll ll ll t u u nd nd nd nd nd nd nd nd nd nd e e e r r en en en en en en en i i i i i i i i i e e lt lt lt . i ...... f a a f f f f f f f ona ona ona ona u u u ona cf cf cf cf cf cf cf cf cf c c c c c c c c c c c c c c c c c c

s s s s s s s s s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u u u u u u u u u l l l l l l l l l l l l l l l l l l l l l l l l l l l pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce t t t t t t t t t t t t t t t t t t t t t t t t t t t a a a a a a a a a a a a a a a a a a a a a a a a a a a l l l l l l l l l l l l l l l l l l l l l l l l l l l P P P P P P P P P P P P P P P P P P P P P P P P P P P

1 2

2 3 4 5 6 1 7 1 2 3 9 0 7 9 6 4 8 #73 #73 2 3 6 7 8 9 0 4 5 G G 7 F F 50 50 610 610 610 610 610 614 616 507 507 507 51 51 51 51 52 908 909 325 325 47 618 5 619 A A A A A A A A A A A A A A A A A A A A A A M M A A A

156 APPENDIX 3

k k k k ar ar ar ar P P P P l l l l

a a a a

l l

l e e e a a t t a on on on on tl tl tl t

a a ti ti ti ti a p

a a a a N N

cas cas cas - N - e

- N N N N a a a a a a

u u n

a a w w w aca

l l u

b b b b b n n o e e l e e e e u u il t a y y a y uk

u nd nd nd nd S S t t n m m m m m s s a a a N N N Z Z

C a a a a a

e a a a a a n n - - Z d r , f f f B B B a a a a a a a na na Y Y Y Y Y a m o o o l l l l yb yb yb yb

i i li oko v m m f f f f f e e t t e t a a a a h h G o o o o o o li li

Po Y Kw Kw Kw

Ja N N N N f C C as as as a a T , pp pp pp ,

, , , , , , , l o e N N N N E E N e e E e , o h h

f f f f K K a r t t t l l l l , , , , , , , , ca ca ca r t K K t E K i i i t n u u u u qu , , ca , , i a n ou ou W W W W W W W W fr fr fr es es s G G G G d d d d b e

S S S S S S S S S l l l l S K a A A A n n n n , , C W

W , m g N N N N N N N Q Q Q Q N a a a a

, , h a h h , n i i i i , , , , , , , , , , , , t t t na na za a d s s s s s s s s s s s s i i o a p u u u u u u u u u u u u h h ou ou ers ou ers ers ers a ndo ndo ndo S C C J I A A A A S P S P P P M I M A A A A I A A A A

b b b b

unpu

unpu unpu unpu

b b b b b b b

unpu unpu unpu unpu unpu unpu unpu

1 2 1 0 9 5 9 8 4 7 0 4 3 2 2 22 22 5 5 885039 56451 107999 108000 108001 107990 107987 107989 14990 885038 14990 14990 14989 67344 673443 107998 107986 59 59 48817 48817 48823 48827 48822 48828 U U F95281 X F494161 X X X X X DQ HQ DQ DQ DQ DQ DQ DQ J J HQ DQ J HQ HQ HQ E E J GU GU DQ J J J J DQ

9 0 7 4 8 5 8 7 3 7 2 9 9 0 1 2 8 8 8 1 1 4 6 4 4 9 8 5 4 6 6 6 6 4 4 4 5 6 5 5 6 6 6 3 3 5 4 4 6 6 6 6 6 4

1 1 0 2 2 2 1 0 - - 0 0 0 0

- - - -

6 6 2 6

3 1 g g - e e 3980 3986 r r 671 671 651 671 6

. 9750 un un H H H H H H

B O O O O O O O O h155 A R R R R R R R R it I I I I I I I I I S S S S S S S S m A

C C C C C C C C S S

) )

a a s s s s s s s s s n n i i i i s s si si si si si si si

h h n n s s s e e en en en en en en en C C u u u t t t t t t t t t ( ( t t t

h h h h h h h h h

a a a s s s s s s s s s s s s c c c c c c c c c s s s u u ll ll ll a a a a a a a a a u u u c c cu cu cu cu cu cu cu cu cu cu e e e r r r r r r r r r i i i i i i i i i i i i c c c lt lt lt s s s d d d d d d d d d d nd nd u u u nd nd nd nd nd nd nd nd nd u u u n n n n n n n n n n e e c c c e e e e e e e f f f i i i i i i i i i i

i i

s s s s s s s s s s s s s s s s s s s s s s s s s s s u u u u u u u u u u u u u u u u u u u u u u u u u u u l l l l l l l l l l l l l l l l l l l l l l l l l l l a h pha pha pha pha pha pha pha pha pha pha p pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha e e yce yce yce yce yce yce yce yce yce yce yce yc yce yce yce yce yce yce yce yce yc yce yce yce yce yce yce t t t t t t t t t t t t t t t t t t t t t t t t t t t a a a a a a a a a a a a a a a a a a a a a a a a a a a l l l l l l l l l l l l l l l l l l l l l l l l l l l P P P P P P P P P P P P P P P P P P P P P P P P P P P

7

# 1 2

6 . 06 06 155 711 711

h Z Z 2

- - - - 9 1 it

C h h 6 - . s s m 6 6 C 07 i i . - - S F F

6 0 - -

155

A 6 7 1 4 5 6 7

155 2 08 O O - h I I 1 2 3 4 5 1 2 4 I C 201 C C it S S II 619 619 907 49 49 49 49 49 507 507 507 507 51 51 51 PPF1013 PPF1044 PPF109 PPF1138 - m C C A A A A A A A A A A A A A A A AD AV KO L N S AD N N N S S

157 APPENDIX 3

a e S

e e e e na i tl tl tl tl

i h

g C

cas cas cas cas

n p p

y y a

s h w w w w t

a I a y

e e e e w

a t t t aca aca a

B B t o e t

ou

h h h i N N N N il il B

ll e s s s s p a p S g g g S

f f f f l

I I I I C i i C e i r nyu , k t a o o o o n a a a t t t t , , a r

B I r r illi r illi S n

a a

t t a t

h h h h i B r es es es es e t t t t v v S S S

t h , e n n n n Ph Ph

t t t es Sh a n Ja Ja C t tt tt tt tt

t

r rr on v r r l l o o o o d Sou Sou Sou Sou ff ass ass o h ass l eas eas eas a a t , , , , Ja - - - R o R R R M r r To B B C Po B Po t t Q t h h h , , , , , ,

uangdong , , , , , , , t t t n n ou W W W W t c c c c d d c c A A A A A A e e as S G S S S i i i i l l S i i ou ou ou , , C C E s N N N V V V V s s W W W Q Q W N W V V eas W , , , , , , , , , , , , , , , , , , , , , , , , , na na s s s s s s s s s s s s s s s s s s s s s s i i u u u u u u u u u u u u u u u u u u u u u u h h ndo ndo ndo C I I I C A A A A A A A A A A A A A A A A A A A A A A

b b b b b b b b b b b

unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu

b b b b b b b b b b b b b b b b b b b b b b

unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu

3 4 7 9 8 3 9 4 3 8 4 6 0 7 8 2 22 5 0748 107967 107968 107971 107964 107965 108007 107953 107954 107980 10796 108006 107952 10798 59 6 48821 48823 48815 48821 48824 48815 48828 48828 48815 48821 48823 48825 U F X X X X X X X X X X X X E J J J DQ DQ DQ DQ DQ DQ J E DQ DQ DQ J J DQ J J J DQ DQ DQ J J J

8 6 6 3 4

3 5 5 5 4

1 1 1 2 1 0 3 2 0 3 4 2 0 0 0 2 1 5 - - - - - 0 0 0 0 0 0 0 1

------8 8 1 9 0 3 9 2 3963 3985 3761 4317 4310 634 634 638 634 635 654 673 641

H H H H H H H H H H H H H

O O O O O O O O O O O O O R R R R R R R R R R R R R I I I I I I I I I I I I I S S S S S S S S S S S S S

C C C C C C C C C C C C C

) a

n

1 1 2 i s s s

i i i

h

r r r s u s s u u n n r r r i t e e e i i s s s t t a a a C

on o o o o o n a a a a n n u u u a a v v v ( t t t s s s s s s s i i i t t t

r r r li li li a a a d u s s s s d d li li li a a a p p p o o o l l l t a a a r r r a a a g g g r u is is is u u a i i i m m m a a cu cu cu cu t

it it it i i i i g g g r r r tt

ha str str s h h . b ec b b ec ec d d d d n n n a a a c e e e u c c r r r p i p p p n n n n aev aev aev o o o g s r o s i i i i l l l l l l m m m o o ri ri s s w w w i

v s s s s s s s s s s s s s s s s s s s s s s s s s s l u u u u u u u u u u u u u u u u u u u u u u u u u u u l l l l l l l l l l l l l l l l l l l l l l l l l l f

a a s ha h u pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha pha ph pha pha p pha pha p pha pha pha l u yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce yce t t t t t t t t t t t t t t t t t t t t t t t t t t ab t a a a a a a a a a a a a a a a a a a a a a a a a a a l l l l l l l l l l l l l l l l l l l l l l l l l l a P P P P P P P P P P P P P P P P P P P P P P P P P P R

3 06 711

Z 1 - - h s w i - F 9 -

5

5 6 0 6 7 8 0

O I S 1 4 5 8 6 7 8 9 2 3 1 2 3 9

S 2 3 4 5 C 578 578 597 52 52 52 52 53 53 53 325 47 48 48 54 54 54 50 512 512 325 6 6 6 6 C S A A A A A A A B B A A A A B B A A A FS A A A A A A A

158 APPENDIX 3

l a t

a e d d y y

a a N n n

s

- a a on

I B B

y l l t

u

R n

l s s a s d t t t t t o s s a i i i i i e u n n B d d d B ll a a a a a n n

a an Z

r e r r r r G l l a e ee ee - t k t t t t ar ar

d s r B u u l a h h n G S S I S S S

m a

r c c e f Q Q Q s i i e d

t o e es r es es es t t t Po h Sh dong R Kw R R t

t , rr rr rr rr e rr on , , , r za d d d d d d d e B ff o i l l l l l l l eas eas eas K

o M ca ca ca - - - T no L To To eas To G To i i i Q Q Q Q Q Q Q s

qu , , h h h , , , , , , , , , i t t li, t e t t t t t t t fr fr fr d d r d r d d d d r d d A b A a ll l l l l l l l l l A A A e B

m Q Q Q eas W no Q no W Q Q Q eas eas eas eas Q eas eas no Q h , h h h , , , , , , , , , , , , , , , , , , , , , t t t c za s s s s s s s s s s s s s s s s s s s s s y o u u u u u u u u u u u u u u u u u u u u u ou ou ou e ndo S A A A S S A S A A A M I A A A A A A A A A A A A A A

b b b b b b b b b b

unpu

unpu unpu unpu unpu unpu unpu unpu unpu

unpu

b b b b b b b b b b b b b b b b b b b b b

unpu unpu unpu unpu unpu unpu unpu unpu

unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu

4 7 8 8 4 4 8 7 1 7 7 8 9 9 2 6 3 8 0 0 3 80497 805103 673209 673210 561519 673488 67322 48826 48817 48814 48815 48820 48815 48820 48826 48820 48822 48823 48824 48816 48815 48825 48827 48814 48816 48817

X X X X X X X X X X X X X X X X X X X GU GU GU GU HQ GU J J J J J

J J J J J J GU J J J J J J J J

7

2 3 1 2 6 1 1 1 2 3 1 3 3 4 1 1 1 7806 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 ------4 1 1 3 2 2 4 9 3 3 4 7 3 3 1 2 3

g e r 654 654 674 642 641 674 674 670 653 653 674 672 630 630 673 673 673

un H H H H H H H H H H H H H H H H H

O O O O O O O O O O O O O O O O O O R R R R R R R R R R R R R R R R R R I I I I I I I I I I I I I I I I I I S S S S S S S S S S S S S S S S S S

C C C C C

C C C C C C C C C C C C C

s s s

hu

hu hu

e e e t t t s s

a a a a a

u u t t t

c c t t an a a an an

i i s a a a a

a s s a i ona ona ona c l l l c c l

a b b

s e e t e e e tt a u u u a a tt r r r o e e s s s ilt ilt ilt n l l r r r a a a c c c e e e c u i i i u u u i e h h h r r r c c c g g g t t t gu g c c c ce c c c ce i n e e e i it a a a ugu ugu ono i a a a

t t i v e v r a l l r r r m m m t tri tri r t rr rr rr ub ub ub

u u p risti risti risti a o e e e s s s rys rys rys rys rys f f t t t

po po pa pa pa p p p s s s

a a s s i i s s s s s s s s s u u c c u l l u u u u u u u u i i i i i i i i i u u undu undu undu d d d d d d d d r r r anoph anoph anoph anoph anoph ogna ogna ogona ogona ogona ogona ab ab gad t t ys ys ys ys ys rs rs rs rs rs rs a a oga oga o oga oga oga oga oga oga h h h h h R R R R R R R R R R R So So So So So So Sugg Sugg Sugg Sunago Sunago T T T T T

4

24 1 1 1 # # # T

- 3 3 7

7 . . . - M -

2 7806

8

A B 1 2 7 0 1 1 4 5 6 7 4 9 1 3 3 6 8 2 4 2 3 - 08_155 09_155 10_155 I 3 A C C C 018 I 1 II - 325 325 513 514 514 513 513 5 520 520 522 505 506 506 511 511 511 614 514 514 514 A A A A A A A A A A A A AD AD AD A A A A A A UG A A M A A S

159 APPENDIX 3

l l a a t t

a a e

N N

- - y op u u

l a R l l f s l B B u u t

u s Z Z G

- - es G

a a n on r w r s - e t ce h h a Kw Kw t t n r , , e W ou ,

no ca ca s i i Sp s , , e , W fr fr d A ll S l A A A e

S N W Q h h h , , , , t t c s s s s y u u u u e ou ou S A A S A A S

b b b

unpu unpu unpu

b b b

unpu unpu

unpu

6 6

B b b - 418266 48817 48827 M W X F494056 F494057 X J unpu unpu J J J H B

r o

A -

W

B 7

ng i 7806 c n e

1 03 mm - o 4 c

rs 4108 x . e

I b m xxx A nu -

n W e B m

i rs ec e p b s

m D

nu

L

i i a a

e n s s n a l e on o

BO s s a s ona

n n h ona ona m i i i o p ilt nu b rr rr i h i i t ob r o ce ec c c c r r y

it a

l p c s s

s a a eg

rys rys rys r r on ys m

b b D

h r t s m m L e h a e e f c r anoph anoph anoph e b li ab ab r r r

BO ys ys ys m

op e a a h h h rs o T T T B H P P e t r b e f m e r

nu

5 r rs e e 24 h b T c -

m 7 4 5

- -

1 1 1 . . nu vou 8

03 7806 -

C

154 154 4 #30

B 0 1 F

h h A G it it xxxx I F 420 558 4108 A m m AN A .

S I M A A S S

** *

160 APPENDIX 3

Table S4.2 Character matrix of minimum and maximum depth ranges, hard or soft substrate type, bathome (E: estuarine, C: coastal, SH: shelf, SL: slope) and lateral line scale (LLS) counts.

Species Depth (m) LLS Min Max Substrate Bathome Min Max Mean Ambiserrula jugosa (McCulloch 1914) 5 85 soTyft pe E,C,SH 52 55 53.5 Cociella heemstrai Knapp 1996 52 55 53.5 Cymbacephalus beauforti (Knapp 1973) 5 25 50 55 52.5 Cymbacephalus nematophthalmus (Günther 1860) 7 51 hard C,SH 57 70 63.5 Cymbacephalus staigeri (Castelnau 1875) 0 46 soft C,SH 51 54 52.5 Elates ransonnettii (Steindachner 1876) 5 93 soft C,SH 83 107 95 Grammoplites scaber (Linnaeus 1758) 0 55 soft 51 55 53 Inegocia harrisii (McCulloch 1914) 7 64 soft C,SH 51 54 52.5 Inegocia japonica (Cuvier 1829) 5 85 soft C,SH 51 55 53 Kumococius rodericensis (Cuvier 1829) 9 104 soft C,SH 50 54 52 Leviprora inops (Jenyns 1840) 0 30 hard C Onigocia grandisquama (Regan 1908) 64 64 soft C,SH 32 39 35.5 Onigocia macrolepis (Bleeker 1854) 0 150 soft C,SH 34 41 37.5 Onigocia oligolepis (Regan 1908) 19 80 soft C,SH Onigocia pedimacula (Regan 1908) 15 110 hard C,SH 29 33 31 Onigocia sibogae Imamura 2011 30 31 30.5 Onigocia spinosa (Temminck & Schlegel 1843) 0 250 soft C,SH,SL 34 42 38 Onigocia sp C - Knapp Papilloculiceps longiceps (Cuvier 1829) 1 15 both 52 56 54 Platycephalus aurimaculatus Knapp 1987 10 160 soft C,SH 81 85 83 Platycephalus bassensis Cuvier 1829 0 100 soft C,SH 74 80 77 Platycephalus caeruleopunctatus McCulloch 1922 40 100 soft SH Platycephalus conatus Waite & McCulloch 1915 70 510 soft SH,SL 72 78 75 Platycephalus cultellatus Richardson 1846 67 67 67 Platycephalus endrachtensis Quoy & Gaimard 1825 1 50 soft E,C,SH 67 84 75.5 Platycephalus fuscus Cuvier 1829 0 25 soft E,C Platycephalus indicus (Linnaeus 1758) 0 30 soft E,C 62 81 71.5 Platycephalus laevigatus Cuvier 1829 0 20 hard C Platycephalus longispinis Macleay 1884 3 75 soft C,SH Platycephalus marmoratus Stead 1908 20 80 hard C,SH 63 70 66.5 Platycephalus orbitalis Imamura & Knapp 2009 50 124 hard 65 68 66.5 Platycephalus richardsoni Castelnau 1872 20 428 soft SH,SL,C 64 74 69 Platycephalus speculator Klunzinger 1872 0 30 soft C Platycephalus westraliae Whitley 1938 0 50 soft E,C,SH 70 83 76.5 Ratabulus fulviguttatus Imamura & Gomon 2010 54 56 55 Rogadius patriciae Knapp 1987 7 100 soft C,SH 49 55 52 Rogadius pristiger (Cuvier 1829) 9 95 soft C,SH 49 55 52 Rogadius serratus (Cuvier 1829) 11 45 soft C,SH 51 54 52.5 Sorsogona portuguesa (Smith 1953) Sorsogona prionota (Sauvage 1873) 52 54 53 Sorsogona tuberculata (Cuvier 1829) 9 88 soft C,SH 47 54 50.5 Suggrundus macracanthus (Bleeker 1869) 7 132 soft C,SH 50 55 52.5 Sunagocia arenicola (Schultz 1966) 0 30 soft C 50 55 52.5 Sunagocia otaitensis (Cuvier 1829) 0 20 soft C 50 54 52 Thysanophrys celebica (Bleeker 1855) 0 43 hard C 49 53 51 Thysanophrys chiltonae Schultz 1966 1 69 hard C,SH 50 57 53.5 Thysanophrys cirronasa (Richardson 1848) 0 35 hard E,C

161 APPENDIX 3

162 APPENDIX 4

4 c

o e o4

ill ag a a a l e e e m r r r e e e nv r r r u u u T pe e t t t a a a

i

r

R

G ch d d n t

on on on r B nd

i

s efec s s efec efec o a r y r r

A a G an an i y r

l l m m a m

t P t P P a ape r . s s k

n a a a e B S I I 2 r a a a B C i

y S S S

ca e l bok bo p k d d f t e t t

m m m h r es r r o i i o t n a n n a a m m l l

a m i i i ttl rr l y y y a a o o a za za AG on E o i i a a a

L B L Sh B Po Po Po D k k k

B N To L Sou L s R on , , , , f , , , , a a a

,

, , , , , a a a a , o ti i i i i d d d d d d d d d d d d d d d d A A A A l l l l l l l l l l l l l l l l ce W W W S es es es es , , , ec n Q Q Q Q Q Q Q Q W W Q Q Q Q Q Q Q W W W Q n n n , , , , , , , , , , , , , , , , , , , , , e ll a a a s s s s s s s s s s s s s s s s s s s s s 16 o p p p u u u u u u u u u u u u u u u u u u u u u , a a a ndon ndon ndon ndon qu I A I A A A A A A A I A A A A A I J J A A A A I A A A A C J e O s

C

d

4 e

d c b b b b b b b b b b b h s

ce o4 li n unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu m e T pub qu

e r s o , f

r

2 n e b b b b b b b b b b b e b

v AG i m unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu g R

nu e

r r a e

h rs c

e

b b b b b b b b b b b b b b b b b b b b b b b b b b b b S u

p vou m 16 , unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu un unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu nu

on ti on a i

c

3 4 5 i 3 4 1 2 3 4 0 6 7 8 9 9 0 ss f

b b b b b b b b b b b b I ti O 0932 90247 90247 90247 en 67330 67330 67330 67355 67355 67355 67314 67354 67354 67354 67354 6 31310 acce C unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu

d F M M M N J E i GU GU GU GU GU GU GU GU GU GU GU H H H ce e l n e p m

qu

a 5 e s 01 01 0 01 07 09 07 06 s

------

1 6 2 9 6 6 6 5 g

g 2 0 1 n nk i e eg eg eg eg eg eg eg eg eg eg eg

r r r r r r r r r r r r 410 389 645 690 692 692 692 689 a

r d 005 . un un un un H un un H un H un H un H H H un H un un u B 6410 6415 6415

l

n O O O O O O O O O O O O O O O O O O O O c e R R R R R R R R R R R R R R R R R R R R n I I I I I I I I I I I I I I I I I I I I i ouche G 33532

S S S S S S S S S S S S S S S S S S S S AKU AKU AKU . s . V C C C F F F C C C C C C C P C C C C C C C C C C e l on p

ti

# m

9 0 9 a ca 4 7 2 0 1 2 5 6 7 9 0 9 1 2 3 4 5 2 3 4 3 6 7 8 9 e s l o

l p i 105 106

580 580 590 780 780 780 125 125 125 122 123 489 550 605 646 646 646 643 643 643 533 642 642 642 642 1061 n m i A A A A A A A A A A A A A A A A A A A A A A A A A A a UG UG on y S ti e g i ec s ll

o s s c u u

hyp r r

n e e f

e

o

a a a

m s s s o o o ritif ritif

a a a m m m i

e e s s

il

t t s s g g g m m m

s s u u s ag ag ag ga ga

i i i a o o u u i i

o o o ec r r r r r u u l l t t u t n n n sti sti sti r r r n n t t t o o o o o o a a p a a e e e e o o o o o o a a i i t t t s ri ri ri n n n m m c c d d

na na na ch ch ch m m m D u u u pha pha anod anod s s r r . . o o o e e

z z z au au au f f re a a o o 1 an an an a a a c c c ce ce c c cy cy f f fr fr go go go j j m m m nd f

. a n n n n n n n n n n n n n n n n n n n n n n n n n n n 5

on o o o o o o o o o o o o o o o o o o o o o o o o o o o

s S d s r

od od od od od od od od od od od od od od od od od od o od od od od od od od od od e e e i r r r r r r r r r r r r r r r r r r r r r r r r r r r r l k r b ec oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe a a h h h h h h h h h h h h h h h h h h h h h h h h h h h h p S C C C C C C C C C C C C C C C C C C C C C C C C C C C C

m T

163 APPENDIX 4

u u u

t t t

a a a r r r r r r

a a a n n n e u u u a a a u L L L

e eq n n n n r

buh buh buh a v u e e e w w w a a a e n ung ung ung t l l l r r r j j j

a L e e e u u u n n n

a no no no t t t P P P a a a e p k k k i , , , efec p T T T r e a a a a , , , un un un dong v v v P efec efec efec

C

e

r r r W

a n Ja Ja f Ja P P P K f on on on

bok bok bok o t t t m o ti ti

ti a a a

a m m m li, es es es w w w y ca ca ca a o o o W W a a a a o o o L W W W L L B N n n n k N i i i , , , , , , ,

, l , l , l , a

, k k k a a a a a a a i i i i i i i d d d d d d d d d d A A A A A edongana l l l l l l l l l l O O W O es es es es es es es , , , , K Q W W Q Q Q Q Q Q W Q Q Q W W n n n n , , , , , , , , , , , , , , , a a a a s s s s s s s s s s s s s s s li, p p p p u u u u u u u u u u u u u u u a a a a a ndon ndon ndon ndon ndon ndon ndon A A A I I I A A A A A B A I A A

J J J

I A A I A I A J

0 5 4 4

b b b b b b b b

npu 27978 27978 27979 27978 unpu u unpu unpu unpu unpu unpu unpu AY AY AY AY

3 8 7 7

b b b b b b b b

27988 27988 27989 27988 unpu unpu unpu unpu unpu unpu unpu unpu AY AY AY AY

7 2 1 1

b b b b b b b b b b b b b b b b b b b b b b b b b

pu n 27967 27968 27969 27968 unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu u unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu unpu AY AY AY AY

9 0 6 2 9 6 6 1 6 7 8 5 6 1 2 3 9 7 0 1 8

6

d b b b b b b b b a o

l 0933 0933 0927 90246 90247 90247 90247 p 67346 67346 67345 67345 67356 67356 67356 67330 67330 67356 67356 67356 67348 22476 6 6 6 58290 unpu unpu unpu unpu unpu unpu unpu unpu J U F F F M M M M F E E E GU GU GU GU GU GU GU GU GU GU GU GU GU GU H H H H

1 01 02 03 04 03 03 03 01 03 00 ------

5 5 5 2 9 9 9 3 4 6

g

7 0 6 g e eg eg eg eg eg eg eg eg eg eg d r re r r r r r r r r r r 487 487 487 410 651 651 651 691 690 e

n 2967 n

i un un un un u un H H H H un un H H H un H un H un un 7748 7749 77488 6414

a

A t

O O O O O O O O O O O O O O O O O O O O O e r V R R R R R R R R R R R R R R R R R R R R R I I I I I I I I I I t I I I I I I I I I I I o M S S S S S S S S S S S S S S S S S S S S S AKU AKU AKU AKU C C C C C F F C C C C N C F C C C C C C C C C C N C F

0 6 2 3 2 1 9 5 6 0 1 2 2 3 8 3 7 8 9 0 1 1 2 3 0 0 9 4

4 616 616 567 618 618 779 779 126 126 126 125 125 580 780 6 644 644 645 646 646 644 644 644 430 614 779 1149 A A A A A A A A A A A A A A A A A A A A A A A A A A A

s s e e e i i i i

i i i i

a a a

hu hu n n n n

g g g s s s t t m m m x i i i i

n n n s s s s s s s s e e e e u u u a

l l l l t t t r u u u u u u u u an an s t n n n n a a a ce ce i c c

s st st st st st st st s s e e e e

d ho boan boan boan e esce e e ill ill ill i A

t o o o o a a a ga ga a r s bu . nu nu nu m m m o i li li s u itt itt itt ub obu obu obu obu o ub ub ch ch ch ch p ug ug ug a a a rr v f

e o o r r r r r r r r s s s s s s s s ve ve ve v v v z z z

u s m r pa

n n n n n n n n n n n n n n n n n n n n n n n n n n n

s o o o o o o o o o o o o o o o o o o o o o o o o o o o / s s s u odu r od od od od od od od od od od od od od od od od od od od od od od od od od od od c r r r r r r r r r r r r r r r r r r r r r r r r r r r oup e anu anu ti r i i g oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe t ho ep h h h h h h h h h h h h h h h h h h h h h h h h h h h l u c od od C C C C C C C C C C C C C C C C C C C C C C C C C C C O A B B C

164 APPENDIX 4

5 9 6 3 4 9 5 5 30 1 08111 66280 27986 27986 27986 27985 27986 60

U x E AY AY AY AY AY AY AY x x x

5 7 9 3 6 7 2 8 A - W 27994 27992 27996 27995 27996 27996 27996 27996 B

rs AY AY AY AY AY AY AY AY e b m

9 6 3 7 0 1 6 2 nu

n e 27973 85794 27976 27974 27976 27976 27975 27976 m i AY AY AY AY AY AY AY AY ec p s

e 1 9 5 1 3 s

a b b b b a t 42225 22453 95610 44052 58399 a unpu unpu unpu J M F D GU HQ GU H

e f i L

f o

e od c r a B

ng i

pond s e rr

o c

o t r e f e r

rs e b

s s m r u u e h nu m

i an c

l s

x s s cc a u

t a pu pu u x s

l m l y

s u e xxxx ea o lli s t s lt m u til m A

u phu m x ba il i op ll

r e a l A ssy h ax ac cyanoa cyano c o *

d c i o hno udoda o c e m pho dax dax dax e s i a e L N O O O P S X

165 APPENDIX 4

166

This Appendix has been removed for copyright or proprietary reasons

Appendix 5

Neotrygon ningalooensis n. sp. (Myliobatoidei: Dasyatidae), a new maskray from Australia

Published in:

http://www.aqua-aquapress.com/abstract_volume_16_2.html

Last P, White WT, Puckridge M (2010) Neotrygon ningalooensis n. sp. (Myliobatoidei: Dasyatidae), a new maskray from Australia. Aqua, International Journal of Ichthyology 16, 37-50.