»    ¼½¾ (  ) - CTOZ

Biodiversity hotspot in cold waters: a review of the with descriptions of seven new (, Nudibranchia)

Tatiana A. Korshunova Koltzov Institute of Developmental Biology RAS, 26 Vavilova Str., 119334, Russia

Nadezhda P. Sanamyan Kamchatka Branch of Paci¤¥c Geographical Institute FEB RAS, Partizanskaya Str. 6, 683000 Petropavlovsk-Kamchatsky, Russia

Karen E. Sanamyan Kamchatka Branch of Paci¤¥c Geographical Institute FEB RAS, Partizanskaya Str. 6, 683000 Petropavlovsk-Kamchatsky, Russia

Torkild Bakken NTNU University Museum, Norwegian University of Science and Technology, NO-7491 Trondheim, Norway

Kennet Lundin Gothenburg Natural History Museum, P.O. Box 7283, 40235 Gothenburg, Sweden Gothenburg Global Biodiversity Centre, P.O. Box 461, 40530 Gothenburg, Sweden

Karin Fletcher Milltech Marine Port Orchard, Washington, 98366, USA

Alexander V. Martynov Zoological Museum, Moscow State University, Bolshaya Nikitskaya Str. 6, 125009 Moscow, Russia [email protected]

Abstract

Cuthonella Bergh, 1884 is of one of the most neglected groups, with a long history of taxonomic confusion with other aeolidacean genera. Owing to its predominantly Arctic distribution with

©   .,   |  : ./-  This is an open access article distributed under the terms of the cc-by 4.0 license.  %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    . cold water, its species are diÁ¤¥cult to ¤¥nd and to collect, and thus to describe. In this study we revise the genus by presenting molecular and morphological data for a majority of the species, including the type, C. abyssicola Bergh, 1884. The material is based on a broad geographic sampling throughout the Northern Hemisphere. Particular emphasis is placed on the Kuril Islands, a diversity hotspot for the genus. Seven new species and two subspecies of Cuthonella are described from the Arctic and North Paci¤¥c regions. The number of species of Cuthonella is thus increased over threefold and now comprises 15 species plus two subspecies instead of ¤¥ve species. This work is the most substantial update of the genus Cuthonella since its description in 1884. To delineate taxonomic and phylogenetic limits of Cuthonella-like aeolidaceans, the molecular phylogeny of the wider traditional “tergipedids” is presented and shows that Cuthonella- like aeolidaceans form a distinct molecular clade as the family Cuthonellidae Miller, 1977, corroborated by reliable morphological apomorphies.

Keywords molecular systematics – morphology – Mollusca – phylogenetics – taxonomic revision

Zoobank: http://urn:lsid:zoobank.org:pub:B52211DD-FA1B-419D-87B7-89EEA1909266

Introduction higher in northern seas, e.g. in marine isopods (Poore & Bruce, 2012) or nudibranchs of the Nudibranch molluscs are marine invertebrates family Dendronotidae (Korshunova et al., that display unique adaptations, like the 2020a). Here we report the unexpectedly high storage of stinging nematocysts from cnidarian diversity of a genus of aeolidacean nudibranch prey in their specialized dorsal outgrowths, molluscs in the waters of the North Paci¤¥c. i.e., , for defence (Martin et al., 2009). In this study, we report the discovery of ¤¥ve Cold waters are commonly equated with new species of nudibranch molluscs of the low species richness and diversity, whereas genus Cuthonella Bergh, 1884 among the fauna tropical waters are usually noted as biodiversity of a tiny volcanic island, which forms part of hotspots for marine (e.g., Roberts et al., the Kuril Islands group. These new species 2002; Hoeksema, 2007; Barman et al., 2018). are con¤¥rmed with both morphological and It has been concluded that a rise in sea water molecular data. In addition, we have discovered temperature along a latitudinal gradient from four more new species and subspecies of the the poles to the equator considerably increases genus Cuthonella from adjacent waters of both biodiversity (e.g., Bickford et al., 2007). This sides of the North Paci¤¥c and the Arctic. To place is generally true for nudibranchs as there are these new species within a broad phylogenetic many times the number of species in tropical and taxonomic framework of ‘tergipedid’ waters compared to the number of species aeolidaceans, we reviewed the genus Cuthonella found in cold polar and temperate waters using various specimens collected in the cold (e.g., Marshall & Willan, 1999; Martynov & waters of the Northern Hemisphere. We also Korshunova, 2012; Papu et al., 2020). However, document that the genus Cuthonella, which was for some groups of invertebrates biodiversity is originally described from the deep waters of the

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

North Atlantic, actually has a wide distribution each specimen was extracted and processed in in the shallow waters of northern Eurasia and 10% sodium hypochlorite solution. The features northern America. Additionally, based on the of the jaws of each species were studied under broad selection of various aeolidacean taxa, the a stereomicroscope and scanning electron validity of the family-rank taxon Cuthonellidae microscope (CamScan, Í). The platinum- Miller, 1977 is con¤¥rmed following recent palladium coated radulae were examined morphological and molecular studies and photographed using a scanning electron (Korshunova et al., 2017a, 2018a; Martynov et al., microscope. The reproductive systems were 2020a). examined and drawn using a stereomicroscope.

Molecular analysis Material and methods Twenty-four specimens of the genus Cuthonella were sequenced for the mitochondrial genes Material examined cytochrome c oxidase subunit I (COI) and 16S Material for this study was obtained from rRNA, and the nuclear genes Histone 3 (H3) various expeditions, and includes specimens and 28S rRNA (C1-C2 domain). Small pieces belonging to diÁferent taxa of aeolidacean of tissue were used for  extraction with nudibranchs. These specimens are deposited Syntol S-Sorb kit by Syntol Company, according in the Zoological Museum of Lomonosov to the manufacturer’s protocols. The primers Moscow State University (ÌÍÍ), Gothenburg and polymerase chain reaction programs that Natural History Museum (½Í), Natural we used are presented in Appendix (table A1). History Museum, University of Oslo (ÌÍ),  sequences of both strands were obtained and the  University Museum, Norwegian using the ABI PRISM1Big-Dye Terminator v.3.1. University of Science and Technology (- on an automated  sequencer (Applied Í) (Bakken et al., 2020). The majority of Biosystems Prism 3700). Ð and H3 sequences specimens were collected in various locations were translated into amino acids to verify in the North Atlantic, including Sweden, coding regions and avoid improper base- Norway, the United Kingdom, in the Arctic Sea calling. All new sequences were deposited in (including the Barents Sea), the Russian arctic GenBank (Appendix, table A2; highlighted in coasts of the White Sea, the East Siberian Sea, bold). Additional molecular data for Cuthonella the Chukchi Sea, the North Paci¤¥c (including specimens and several outgroup specimens Kamchatka, the Kuril Islands, the Sea of were obtained from GenBank. All new and Japan, and the Canadian and the United publicly available sequences were checked via States Paci¤¥c coasts). Some specimens were  searches in GenBank (https://blast.ncbi. collected during ship-based research cruises nlm.nih.gov/Blast.cgi) to verify identi¤¥cation in the North Atlantic and the Arctic Seas. and avoid potential contamination and errors. Original data and publicly available sequences Morphological analysis were aligned with the ÍÑÑ algorithm Nudibranch morphology was studied under a (Katoh et al., 2002). Separate analyses were stereomicroscope and using digital Nikon D810 conducted for Ð (657 bp), 16S (445 bp), H3 and Nikon D600 cameras. For the descriptions (327 bp), 28S (333 bp) and four concatenated of the internal features, both preserved and fresh markers (1762 bp). The GTR+I+G model was specimens (when available) were dissected chosen for the concatenated datasets using under a stereomicroscope. The buccal mass of MrModelTest 2.3 (Nylander et al., 2004). Two

 %  !  !    $ !%  $!"#&     & Ô 10.1163/18759866-10017 |    . diÁferent phylogenetic methods, Bayesian al., 2019, 2020a). Bayesian Inference ( ) and Inference ( ) and Maximum Likelihood (Í), Maximum Likelihood (Í) analyses based on were used to infer evolutionary relationships. the combined dataset for the mitochondrial Bayesian estimation of posterior probability Ð and 16S, and the nuclear H3 and 28S genes was performed in MrBayes 3.2 (Ronquist et yielded similar results (¤¥gs 1, 2). al., 2012). Four Markov chains were sampled All Cuthonella species constituted a highly at intervals of 500 generations. Analysis was supported clade (PP = 1, BS = 99). The ½ started with random starting trees and 10Õ analysis of the Ð dataset run with two generations. Í analysis was performed using diÁferent models revealed 14 lineages that RAxML 7.2.8 (Stamatakis et al., 2008) with 1000 could be assigned to morphologically distinct bootstrap replicates. Final phylogenetic tree Cuthonella species (¤¥g. 1): Cuthonella osyoro images were rendered in FigTree 1.4.2. Nodes in (Baba, 1940), C. soboli Martynov, 1992, C. the phylogenetic trees with Bayesian posterior georgstelleri sp. nov., C. benedykti sp. nov., C. ainu values > 0.96% and bootstrap values > 90% sp. nov., C. hiemalis (Roginskaya, 1987), C. denbei were considered ‘highly’ supported, nodes with sp. nov., C. vasentsovichi sp. nov., C. concinna 0.90–0.95% and 80–89% accordingly were (Alder & Hancock, 1843) with subspecies C. considered ‘moderately’ supported (lower concinna bellatula subsp. nov. and C. concinna support values were considered not signi¤¥cant, concinna, C. sandrae sp. nov., C. abyssicola Korshunova et al., 2018a). The program MEGA7 kryos subsp. nov., C. punicea (Millen, 1986), and (Kumar et al., 2016) was used to calculate two potential species in the C. cocoachroma the uncorrected p-distances between all the (Williams & Gosliner, 1979) group. Cuthonella sequences. Automatic Barcode Gap Discovery soboli was sister (PP = 1, BS = 100) to C. osyoro; (½ ) (Puillandre et al., 2012) was used to C. benedykti sp. nov. (PP = 1, BS = 97) was sister estimate the diversity of Cuthonella species. An (PP = 1, BS = 100) to C. ainu sp. nov. and together alignment of the Ð marker was submitted with C. georgstelleri sp. nov. they formed a highly and processed in ½ using the Jukes– supported lineage (PP = 1, BS = 98). Cuthonella Cantor (JC69) and Kimura (K80) models and sandrae sp. nov. and C. abyssicola kryos subsp. the default settings. To evaluate the genetic nov. clustered in two distinct and separate sister distribution of the diÁferent haplotypes, a clades (PP = 0.98, BS = 92) that formed the haplotype network for the Ð molecular data sister group (PP = 1, BS = 98) to the maximally was reconstructed using Population Analysis supported (PP = 1, BS = 100) C. punicea clade. with Reticulate Trees (PopART, http://popart. Unresolved evolutionary ties were revealed otago.ac.nz) with the Ð network method. for the C. concinna clade. All seven C. concinna specimens from the NE Paci¤¥c formed a separate clade (PP = 0.99, BS = 90) and clustered Results together with sixteen C. concinna individuals from the NE Atlantic (PP = 1, BS = 100). Molecular analysis The maximum intragroup distance for the In this molecular study, 55 specimens of Ð marker in C. concinna from the NE Atlantic Cuthonella were included, combining 78 novel is 0.91% and in C. concinna from the NE Paci¤¥c sequences with 93 sequences from GenBank. the maximum intragroup distance is 1.67%. Six outgroup specimens (22 sequences) from The minimum intergroup distance for the Ð the genera Murmania, Xenocratena, and marker between the NE Atlantic and the NE were used according to previous results Paci¤¥c C. concinna is 1.07%. Thus, the molecular

(Korshunova et al., 2017b, 2018a; Martynov et divergence within C. %  concinna !  ! from    the NE $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 1 Phylogenetic relationships of Cuthonella based on COI + 16S + H3 + 28S concatenated dataset inferred by Bayesian inference ( ). Numbers above branches represent posterior probabilities from  ; numbers below branches indicate bootstrap values for Maximum Likelihood. Summary of species delimitation results are noted by numbered clusters from the abgd analyses for the Ð dataset.

Paci¤¥c group exceeded the molecular divergence CAS185193. The Ð distances of 1.37% and between the NE Atlantic and the NE Paci¤¥c. 1.52% are found between C. cocoachroma The division of C. concinna into two subgroups CAS181307b and two C. cocoachroma (CAS179471 (C. concinna concinna and C. concinna bellatula and CAS185193) respectively. The ½ analysis subsp. nov.) was also con¤¥rmed by the haplotype suggested that two potential species within C. network based on Ð molecular data (¤¥g. 3). cocoachroma may become revealed in future Two C. cocoachroma (CAS179471 and CAS185193) studies. Nevertheless, the three C. cocoachroma clustered together (PP = 0.91, BS = 71) and specimens aligned as the same species in the formed the sister group to the C. cocoachroma present analysis according to the integrative CAS181307b. All three C. cocoachroma formed molecular results. The maximum intragroup a maximally supported clade (PP = 1, BS = 100). and minimum intergroup genetic distances The Ð distance of 0.15% is found between C. in Cuthonella species for the Ð marker are cocoachroma CAS179471 and C. cocoachroma presented in table 1% . !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    .

Ñ ½ 2 Phylogenetic relationships of Cuthonella based on COI + 16S + H3 + 28S concatenated dataset inferred by Bayesian inference ( ), radial tree layout. Posterior probabilities from  and bootstrap values for Maximum Likelihood (Í) are indicated on the ¤¥gure. Cuthonella species are illustrated on the tree.

Ñ ½ 3 Haplotype network based on cytochrome c oxidase subunit I (COI) molecular data showing genetic mutations occurring within Cuthonella concinna concinna (red circles) and Cuthonella concinna bellatula subsp. nov. (blue circles) species. Abbreviations: BS: Barents Sea; Ch: Churchill (Canada); NH: New Hampshire; UK: United Kingdom; WS: White Sea.

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

C. cocoachroma 9.74 1.52

C. punicea 0.76

C. sandrae sp. nov.

C. abyssicola

kryos subsp. nov. 12.02 10.96 11.26 10.20

C. vasentsovichi 0.15 sp. nov. 9.74 11.87 11.87 12.02 12.18

C. concinna bellatula 1.07 9.28 12.09 11.78 12.25 11.32 1.67 subsp. nov.

C. concinna 0.91 concinna 9.30 9.89 9.74 10.50 11.57 10.81 10.50 C. denbei sp. nov. 9.89 11.78 12.21 9.30 12.52 12.09 11.27 9.77 0.30

C. hiemalis 0.31 9.44 10.96 13.09 13.55 12.18 12.63 12.02 10.96 11.57

C. georgstelleri 8.07 8.37 9.69 10.51 11.82 11.11 11.72 10.65 11.11 10.02 sp. nov. 0.30

C. osyoro 1.15

C. soboli

C. ainu sp. nov. 2.65 6.20 7.88 7.75 8.53 9.97 10.44 11.37 10.23 13.08 11.63 11.94 10.85

C. benedykti 7.75 8.22 7.91 8.07 0.16 8.53 9.55 9.08 8.37 9.44 2.65 - 7.46 8.68 8.22 9.55 10.20 11.11 12.02 11.42 13.09 12.02 12.18 12.33 7.88 8.68 2.89 9.97 10.20 9.59 9.69 10.96 9.89 6.20 7.46 - 2.89 7.91 9.08 9.59 10.81 11.72 10.96 11.72 10.81 10.81 10.35 11.37 12.02 11.72 11.82 13.55 12.21 9.89 1.07 11.63 12.02 10.81 10.65 12.02 12.09 11.57 11.78 11.87 10.96 7.00 - 6.85 11.11 11.94 12.18 10.81 11.11 10.96 11.27 10.81 12.25 12.02 11.26 8.52 6.85 10.23 11.42 10.96 11.11 12.18 9.30 9.74 9.28 9.74 13.08 13.09 11.72 11.72 12.63 12.52 10.50 12.09 11.87 12.02 - 7.00 8.52 11.42 10.85 12.33 10.35 10.02 11.57 9.77 10.50 11.32 12.18 10.20 11.42 11.11 9.74 sp. nov. 10.44 11.11 10.81 10.51 13.09 11.78 9.30 C. cocoachroma C. punicea C. abyssicola C. abyssicola nov. subsp. kryos C. sandrae nov. sp. C. vasentsovichi nov. sp. C. concinna C. concinna bellatula nov. subsp. C. concinna C. concinna concinna C. denbei nov. sp. C. osyoro C. georgstelleri nov. sp. C. hiemalis C. soboli C.benedykti nov. sp. sp. nov. C. ainu sp.  1  in Cuthonella species distances (%) for the Ð marker genetic in bold) and minimum intergroup (highlighted Maximum intragroup  %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    .

Systematic account concinna (Alder & Hancock, 1843) (¤¥g. 8), C. Family Cuthonellidae Miller, 1977 concinna bellatula subsp. nov. (¤¥g. 9), C. denbei Diagnosis. Aeolidaceans with a wide to sp. nov. (¤¥g. 10), C. elenae Martynov, 2000, moderately broad body. Notal edges fully C. georgstelleri sp. nov. (¤¥g. 11), C. hiemalis reduced. Cerata non elevated, several per row. (Roginskaya, 1987) (¤¥g. 12), C. orientosiberica Ceratal rows branched or simple. Rhinophores sp. nov. (¤¥g. 13), C. osyoro (Baba, 1940) (¤¥g. 14), smooth to wrinkled, without distinct lamellae. C. punicea (Millen, 1986) (¤¥g. 15), C. sandrae Anus acleioproctic or cleioproctic, in anterior sp. nov. (¤¥g. 16), C. soboli Martynov, 1992 (¤¥g. to middle part of dorsal side. Radula formula 17), C. vasentsovichi sp. nov. (¤¥g. 18). 0.1.0. Rachidian teeth usually with strong cusp, Remarks. Until 1992, the genus Cuthonella was not compressed by adjacent lateral denticles. rarely used to refer just to the deep-sea species, Distal receptaculum seminis present. Vas C. abyssicola, and its two synonymous taxa (e.g., deferens usually moderate, with indistinct Odhner in Franc, 1968; Miller, 1977), or more prostate. Massive external permanent penial often it was considered invalid (Millen, 1986). collar absent. Penis internal, unarmed. Other species that demonstrate morphological Supplementary gland present, commonly similarities to the type species C. abyssicola inserts to vas deferens. were never considered as belonging to the genus Type genus Cuthonella Bergh, 1884. Cuthonella in faunal lists and guides (e.g., Odhner, 1907, 1939; Thompson & Brown, 1984; Behrens, Genus Cuthonella Bergh, 1884 1980; Behrens & Hermosillo, 2005). Martynov (Figs 1–22) (1992) initially revised the composition of the Cuthonella Bergh, 1884: 23–24. genus Cuthonella to include six species – C. Cuthonella Martynov, 1992, revision: 23. abyssicola (Bergh, 1884), C. concinna (Alder Non sensu Millen (1986) & Hancock, 1843), C. distans (Odhner, 1922), Type species: Cuthonella abyssicola Bergh, C. hiemalis (Roginskaya, 1987), C. marisalbi 1884. Recent, North Atlantic Ocean. Gender (Roginskaya, 1963), C. punicea (Millen, 1986) and feminine. to describe a new one, C. soboli Martynov, 1992. Diagnosis. Body wide to moderately broad Thus, a future monophyletic molecular (rarely more narrow). Cerata numerous, clade (¤¥g. 1) was predicted using only continuous. Rhinophores smooth to wrinkled, morphological data. This is a clear indication longer or similar in size to oral tentacles. that morphological data (ontogenetic in a Anterior foot corners never tentaculate. broad sense) should have value independent Anus acleioproctic (rarely cleioproctic). of molecular data (Korshunova et al., 2017a, b) Central teeth with strong cusp and distinct instead of being considered merely an inferior denticles. Distal receptaculum seminis. Long auxiliary addition, a view commonly held in vas deferens without separate granulated the current use of molecular techniques to prostate. Supplementary gland (= “penial delineate species (e.g., Carmona et al., 2013). gland”) inserts into vas deferens. Penis In the present study, ¤¥ve of the seven commonly elongated conical, unarmed. species that were included in the genus Contained species: Cuthonella abyssicola Cuthonella by Martynov (1992) are con¤¥rmed abyssicola Bergh, 1884 (¤¥g. 4), C. abyssicola to belong to the monophyletic molecular kryos subsp. nov. (¤¥g. 5), C. ainu sp. nov. (¤¥g. clade that includes Cuthonella abyssicola s.l. 6), C. benedykti sp nov. (¤¥g. 7), C. cocoachroma Moreover, Cuthonella concinna s.l., C. hiemalis (Williams & Gosliner, 1979), C. concinna (Roginskaya, 1987), C. punicea (Millen, 1986)

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017  and C. soboli Martynov, 1992 are con¤¥rmed denticles is well attested for the type species to be valid species (¤¥gs 1–3, 4, 8, 12, 15, 17), of Guyvalvoria, G. francaisi Vayssière, 1906 whereas C. distans (Odhner, 1922) and C. with similar body size (up to 14.5 mm marisalbi (Roginskaya, 1963) – while still preserved length), whereas another Antarctic Cuthonella as predicted by Martynov (1992) – species Guyvalvoria gruzovi Martynov, 2006 are now both considered to be junior has a clearly larger number (11–15) of less synonyms of Cuthonella concinna concinna distinct lateral denticles in specimens with (see below and ¤¥g. 8). smaller (8–9 mm) preserved body length Previously, a few Antarctic species were (Martynov, 2006a: 78–84). In addition, described under the genus Cuthonella, i.e. Cuthona schraderi (PfeÁfer in Martens & Cuthonella antarctica Eliot, 1907 (currently is PfeÁfer, 1886) was considered as a potential known under a replacement name Cuthonella of G. “paradoxa” sensu Valdés et al. elioti (Odhner, 1944)), Cuthonella modesta (2012: 1173). Nonetheless, Cuthona schraderi Eliot, 1907 and Cuthonella paradoxa Eliot, 1907. diÁfers signi¤¥cantly from any species of the Since C. elioti is known to have supplementary genus Guyvalvoria by the presence of distinct gland that inserts into the penial base and ceratal rows and from G. “paradoxa” sensu possibly a penial stylet, and C. modesta is Valdés et al. (2012) also by considerably also described as having supplementary fewer lateral denticles (Odhner, 1926). gland that inserts into the penial base and Thus, Cuthona schraderi is not a potential jaws without denticles (Eliot, 1907; Valdés synonym of G. francaisi Vayssière, 1906 or et al., 2012), they are de¤¥nitely not considered G. “paradoxa” sensu Valdés et al. (2012: 1173). to be Cuthonella. The taxonomic placement of According to the morphology of the radular these taxa should be addressed in a separate teeth and reproductive system, Guyvalvoria study. “paradoxa” sensu Valdés et al. (2012) is It has also subsequently been shown the most similar to G. gruzovi (Martynov, that Cuthonella paradoxa belongs to a valid 2006a), but not to G. francaisi Vayssière, 1906 Antarctic genus Guyvalvoria Vayssière, (= “Cuthonella” paradoxa Eliot, 1907). 1906, and has been synonymised with the The genus Guyvalvoria is a well-de¤¥ned type species of the genus Guyvalvoria, G. taxon by the very speci¤¥c combination francaisi Vayssière, 1906 because of the high of a posterior anus, laterally compressed morphological similarity (Martynov, 2006a). branched rows of cerata, uniserial radula However, Guyvalvoria paradoxa sensu Valdés and a supplementary gland that inserts into et al. (2012: 1171–1173) does not match the the penial base. These features were already original description of Cuthonella paradoxa described in detail elsewhere (Martynov, in Eliot (1907: 24–25) and considerably 2006a) and by those characters Guyvalvoria diÁfers in the radular morphology. There is not only clearly diÁferent from the genus are seven distinct, “fairly stout and long” Cuthonella, but also from the majority of lateral denticles of the central teeth in the other aeolidacean families (Korshunova original description of Cuthonella paradoxa et al, 2017b; Martynov et al., 2020a). Some (Eliot 1907: 25, 11 mm preserved length) morphological similarity in presence of and 13–15 small denticles in Guyvalvoria the posterior anus Guyvalvoria shares only “paradoxa” sensu Valdés et al. (2012: 1172, with the family Murmaniidae (Martynov, 15 mm preserved length). Notably, a fewer 2006a; Martynov et al., 2020a). Therefore, number (ca. 5–11) of distinct, long lateral Guyvalvoria recently was transferred with

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    . reservation to the family Murmaniidae type species apparently may also have a few (Korshunova et al., 2017b: Supplementary additional indistinct rows), an exclusively material 1, Synopsis of the families of suborder uniserial radula with a central cusp always Aeolidacea). The current status of the genus protruding (except for the few anteriormost Guyvalvoria as “taxon inquirendum” of eroded teeth), either with lateral denticles the “family ” (MolluscaBase, closely adhering to the central cusp (as in 2020) should therefore be corrected to fully the type species) or usually distinct from valid status and, pending the availability of the central cusp. In the reproductive system, molecular data, to the family Murmaniidae. so far only a single receptaculum seminis The family Murmaniidae, on one hand, is reported (with a tendency to be more is morphologically consistent with the proximal in Cuthonella concinna s.l., otherwise characters of Guyvalvoria, but on the other in the majority of species it is distal) and the hand, is related to the families Cuthonellidae receptaculum seminis is usually oval, but it can and Xenocratenidae according to the most also be a rather tubular one (e.g., C. abyssicola recent phylogenetic analysis (Martynov et s.l., C. punicea). The penis is unarmed. al., 2020a). Therefore a future phylogenetic The most speci¤¥c feature of the genus – the analysis will show if Guyvalvoria can be insertion of the supplementary gland into the retained in the family Murmaniidae or vas deferens instead of the penis – was evident should be placed in its own family. in all the Cuthonella species that we were able In the original diagnosis of the genus to examine (¤¥gs 4–20). Cuthona norvegica was Cuthonella, Bergh (1884) did not mention the originally described by Odhner (1929) within key feature that has proven to be present in the genus “Cuthonella”. However, C. norvegica all species of the genus Cuthonella studied so has a supplementary gland inserted into the far (except for uncertainties in the species C. penial base (Millen, 1986) and was transferred cocoachroma Williams & Gosliner, 1979, see to the genus Cuthona s.str. by Martynov below), which is that the supplementary gland (1992). There are no new specimens of is inserted into the vas deferens instead of the Cuthona norvegica available, and after a future penis (Martynov, 1992; present study). From clari¤¥cation of its phylogenetic position, it the characters initially mentioned by Bergh may be necessary to transfer this species to a (1884), the dorso-lateral position of the anus diÁferent genus. cannot be considered speci¤¥c for the genus The insertion of the supplementary gland Cuthonella, and the absence of cnidosacs in into the vas deferens is likely a plesiomorphic the type species of the genus Cuthonella was feature because it is also present in at least disproved by Millen (1986). one very diÁferent taxon with a triserial radula So, at this time the genus Cuthonella should – tricolor – within the family be de¤¥ned by the following features: relatively Eubranchidae (Korshunova et al., 2017a, b). abundant anterior pre-anal rows of cerata, Potentially, this feature may occur within some either branched or unbranched (the majority other basal ‘tergipedids’. However, among of species have at least ¤¥ve to six, or more, genera and families with a uniserial radula it pre-anal ceratal rows in the adult state), a has so far been con¤¥rmed only for Cuthonella predominantly acleioproctic anus (the type and Cuthonellidae. Therefore, the insertion of species and a few other species may have a the supplementary gland into the vas deferens cleioproctic one), relatively broad jaws with should be used in combination with the other usually a single row of distinct denticles (the characters mentioned above to identify future

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017  members of Cuthonellidae. Notably, within the requirements of the relevant ICZN (1999) the family Cuthonidae (genera Cuthona and articles (i.e., 11.7, 13, 29) for the availability of Bohuslania) this feature has so far never been a family group name. Miller (1977: 200) also observed (Korshunova et al., 2017a, 2018a). mentioned that the name Cuthonellinae The family Cuthonellidae Miller, 1977 “replaced” the name Precuthoninae has been resurrected recently, including introduced by Odhner in Franc (1968: a morphological diagnosis and molecular 885). Miller did not provide explanations phylogenetic data (Korshunova et al., 2017a, of his reasons and did not make a special b, 2018a). Miller (1977: 200) proposed the indication why this is a “replacement” name. subfamily name Cuthonellinae based on the Bouchet & Rocroi (2005: 59) commented that valid genus name Cuthonella and provided Cuthonellinae Miller (1977) was invalid; they a brief morphological diagnosis “digestive said in their remarks that it was “Introduced ducts unbranched”. This diagnosis meets presumably (and thus in violation of Art. 40.1)

Ñ ½ 4 Cuthonella abyssicola abyssicola Bergh, 1884. A, B, dorsal and ventral views, respectively, of a preserved specimen ZMMU Op-616 from the deep waters of the Barents Sea, 23 mm. C, jaw (Í). D, jaw, details (light microscopy). E, jaws, details (Í). F, posterior part of the radula (Í). G, anterior part of the radula (Í). Scale bars: C, D, 500 µm; E, 10 µm; F, G, 30 µm; Photos: Alexander Martynov.

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    . as a replacement name for Precuthoninae, update to the knowledge of the genus because Cuthonella has precedence over Cuthonella since its description in 1884. All Precuthona Odhner, 1929.” However, previously known and novel species are Precuthona Odhner, 1929 is not a synonym of presented below in alphabetical order (¤¥gs the genus Cuthonella Bergh, 1884 and therefore 4–18). there is no violation of Article 40.1 of ICZN (1999). The name Precuthona Odhner, 1929 Cuthonella abyssicola abyssicola Bergh, is a synonym of the genus Cuthona (Brown, 1884 1980), which belongs to the diÁferent family (¤¥gs 1, 2, 4, 19A, 21) Cuthonidae, supported by morphological Cuthonella abyssicola Bergh, 1884: 24–26, and molecular data (Korshunova pl. 10, ¤¥gs. 1–3, pl. 11, ¤¥g. 2, pl. 12, ¤¥gs. 9– et al., 2017a, 2018a). The name Precuthoninae 13; Martynov, 1992: 23; Martynov, 2006a: Odhner in Franc (1968: 885), therefore, is a 73; Martynov, 2006b: 290; Martynov & synonym of the family Cuthonidae Odhner, Korshunova, 2011: 195. 1934. The name Cuthonellinae Miller, 1977 is Cuthonella berghi Friele, 1903: 11, tab. II, ¤¥g. thus an available family group name in full 3–4, tab. III, ¤¥g. 7–10. compliance with Article 13 (“to be available, Cuthonella ferruginea Friele, 1903: 10, tab. II, every new family-group name published after ¤¥g. 1–2, tab. III, ¤¥g. 3–5. 1930 must satisfy the provisions of Article Cuthona abyssicola (Bergh, 1884) – Millen, 13.1 and must be formed from an available 1986: 1358–1359, ¤¥gs 8, 9. genus-group name then used as valid by Type material. Holotype lost (K. Jensen the author in the family-group taxon [Arts. (ÌÍÐ), personal communication; K. Lundin 11.7.1.1, 29]”, ICZN 1999). The available family performed an additional search in ÌÍÐ and group name Cuthonellinae Miller, 1977 (in a con¤¥rmed the absence of the type material). restricted sense compared to the mention in Material. ÌÍÍ Op-616, L = 23 mm Miller (1977), without “Precuthona”) with an length (preserved, convoluted, more than amended diagnosis was therefore introduced 30 mm if unrolled), Arctic Ocean, Barents as the valid family Cuthonellidae Miller, 1977 Sea, 77° 06´ N, 58° 12´ E, 307 m, 07.08.1948. and the (incorrect and unnecessary) term NTNU-VM 73124, 1 spec., L = 31 mm length “replaced” should be discounted. (preserved), Norwegian Sea, Nyegga, 64° Cuthonellidae is distinct by the 40.115N 5° 15.702E, 731 m, coll. Hans Tore morphological and molecular phylogenetic Rapp, 05.08.2008. data (Korshunova et al., 2017a, 2018a, this External morphology. Body wide, massive. study). In some publications (Korshunova et Foot and tail broad. Oral tentacles moderate. al., 2017a, b) the year of the original publication Rhinophores smooth to slightly wrinkled, of Cuthonellinae was indicated as ‘Miller, similar in size to oral tentacles. Dorsal cerata 1971’ due to a typo (the reference ‘Miller, 1977’ elongate, thick, arranged in continuous rows. was provided correctly). The correct year of Up to 17 pre-anal branched ceratal rows. Anal publication is Miller (1977). The type genus of opening cleioproctic. the family Cuthonellidae is Cuthonella Bergh, Colour (preserved). Background colour 1884. yellowish white. Digestive gland diverticula In the present revision of the genus in cerata possibly reddish to pinkish. Ceratal Cuthonella the number of known species is tips without distinct spots or bands of opaque increased threefold. It is the most substantial white pigment.

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Jaws. Jaws broad, yellowish to brown in specimen showed closely similar features colour. Masticatory processes of jaws covered with the deeper-water specimens (300 m) with several rows of denticles (with a few from the Barents Sea in the presence of indistinct additional rows) (¤¥g. 4C–E). up to 17 pre-anal branched ceratal rows, Radula. Radula formula 21 × 0.1.0 (specimen a long vas deferens and a receptaculum 23 mm in length, Barents Sea). Central tooth seminis on a long stalk. In the original broad, with a strongly protracted, pointed description (Bergh, 1884), a type specimen non-compressed cusp (¤¥g. 4F, G). Central from deeper waters of the Faroe Channel teeth with up to 14 lateral denticles, which are (c. 1000 m) shows closely similar external rarely clustered. Cusp quite clearly delineated and reproductive features with the shallow- from the adjacent lateral denticles which do water specimen from Franz Joseph Land, but not reach the top of the cusp. the radular teeth have a signi¤¥cantly fewer Reproductive system. Diaulic. Hermaphroditic number of lateral denticles (10–14 vs. 13–36). duct leads to a swollen ampulla. Vas deferens Notably, in the Franz Joseph Land specimen long, without a distinct prostate. Supplementary the lateral denticles are usually clustered gland long, inserts into the vas deferens at a and extend to the top of the central cusp considerable distance from the elongated penial (¤¥g. 5I, J), compared to the deep-sea C. sheath. Penis conical, strong, unarmed. Oviduct abyssicola (¤¥g. 4F, G). Millen (1986) performed connects through the insemination duct into a detailed investigation of the surviving type the female gland complex. Exceedingly long material of the nominal species Cuthonella tubular receptaculum seminis placed distally, berghi Friele, 1903 and C. ferruginea widened in the middle part with a small oval Friele, 1903, which have been considered reservoir (¤¥g. 19A). synonymous with C. abyssicola. Both of these Ecology. Lives on soft bottoms with stones, synonymous species come from similar commonly at bathyal and shelf depths of c. geographic regions (NE Atlantic, Norwegian 300–1112 m. A record from the shallow waters Sea) and also from similar depths (from of the Laptev Sea (Martynov & Korshunova, deeper waters of 590–1098 m) as C. abyssicola. 2011) (49 m depth) needs veri¤¥cation. The radulae of C. berghi and C. ferruginea Distribution. Faroe Islands in the North are similar to the original description of C. Atlantic; Norwegian Sea; Barents Sea, possibly abyssicola (Bergh 1884): the central teeth the Laptev Sea (Millen, 1986; Martynov & possess only a few lateral denticles (c. 6–10), Korshunova, 2011; present study). and the cusp is more clearly delineated. This Remarks. Cuthonella abyssicola diÁfers from agrees well with our specimens from the deep the majority of other Cuthonella species by the waters of the Barents Sea (c. 6–14) (¤¥g. 4F, substantial number of anterior ceratal rows G). The number of teeth of the radula of the (up to 17), radular teeth with small denticles deeper water specimen from the Barents Sea which are not always clearly delineated from (21 teeth) also corresponds well with the ¤¥rst the cusp, long vas deferens and distal seminal description of Bergh (1884) and also to those receptacle on a very long stalk. described by Friele (1903) and Grieg (1913) In the present study, we give for the ¤¥rst (18–21 teeth), but not to the shallow-water time both morphological and molecular specimen from Franz Joseph Land (27 teeth). data for a relatively shallow-water specimen Thus, the radular characters (which are from Franz Joseph Land in the Arctic (see reliably based on several deep-sea specimens description below). Morphologically, this collected in various locations) are diÁferent

 %  !  !    $ !%  $!"#&     & Ô 10.1163/18759866-10017 |    .

Ñ ½ 5 Cuthonella abyssicola kryos subsp. nov. A, dorsal view of living holotype ÌÍÍ Op-727, shallow water of Franz Josef Archipelago, 25 mm (preserved length). B–E, dorsal, lateral, latero-ventral and ventral views respectively of the same preserved specimen. F, jaw (Í). G, jaw, details (light microscopy). H, jaws, details (Í). I, anterior part of the radula (Í). J, posterior part of the radula (Í). Scale bars: F, G, 500 µm; H, 50 µm; I, J, 100 µm; Photos: A, Oleg Savinkin, B–J, Alexander Martynov. from the shallow-water specimen from Franz nudibranch taxa, such as in the genera Joseph Land, which by other features are Adalaria, Microchlamylla, and Ziminella. We similar to the real C. abyssicola. Therefore, have also studied a single specimen from the these diÁferences cannot be ignored while Laptev Sea, from a relatively shallow-water making a taxonomic decision. Because only a locality at c. 50 m. Remarkably, compared to single shallow-water specimen was available, the specimen from Franz Joseph Land, the we preferred in this case to separate it here Laptev Sea specimen possesses no more than as a subspecies; Cuthonella abyssicola kryos 14–15 lateral denticles on the central tooth subsp. nov. (see description below). (23 teeth in total), and thus more closely It was previously shown (Korshunova et matches the real deep-sea C. abyssicola al., 2017b; Martynov & Korshunova, 2017) that than the Franz Joseph Land specimen. Thus, the waters of Franz Josef Land demonstrate the distributional data for C. abyssicola considerable endemism in other various abyssicola and C. abyssicola %  ! kryos ! subsp.   nov. $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017  implies that the nominative subspecies can smooth to slightly wrinkled. Dorsal cerata be found in shallow depths, but not in the elongate, thick, arranged in continuous rows. high latitude Franz Joseph Land. It should Up to 17 pre-anal branched ceratal rows. Anal also be taken into consideration that the opening cleioproctic. shallow-water record from the Laptev Sea Colour (live). Background colour light needs further veri¤¥cation. C. abyssicola s.l. pinkish to whitish. Digestive gland diverticula potentially feeds on athecate hydroids. We in cerata light pinkish to whitish. Ceratal tips have studied few deep-sea specimens of with dispersed white pigment. Rhinophores C. abyssicola abyssicola, but none of them light yellowish with indistinct white pigment were suitable for molecular investigation towards the top (¤¥g. 5A). due to the considerable age of collection Jaws. Jaws broad, yellowish to brown in and primary ¤¥xation in formaldehyde. colour. Masticatory processes of jaws covered We made additional inquiries to obtain with a few rows of denticles (with a few recent deep-sea specimens, but none were indistinct additional rows) (¤¥g. 5F, G, H). available. Therefore, though details of the Radula. Radula formula 27 × 0.1.0. Central radular features and distributional patterns tooth broad, with a strongly protracted, may potentially imply that we are dealing pointed non-compressed cusp (¤¥g. 5I, J). with two sister species rather than with two Central teeth with up to 36 lateral denticles subspecies, we need more data to con¤¥rm (often clustered and increasingly irregular this. However, because the shallow-water towards the cusps). Cusp is not clearly subspecies (see below) shows substantially delineated from the adjacent lateral denticles similar major features in both external which may reach the top of the cusp. and internal morphology, including the Reproductive system. Diaulic. reproductive system, we can con¤¥rm that it Hermaphroditic duct leads to a long, represents a form that is close to the original moderately swollen convoluted ampulla. Vas Cuthonella abyssicola and therefore can be deferens long, without a distinct prostate. used here for de¤¥ning the genus Cuthonella. Supplementary gland long, inserts into the vas For a morphological comparison with other a considerable distance from the elongated Cuthonella species, see table 2. penial sheath. Penial sheath elongated. Penis conical, strong, unarmed. Oviduct connects Cuthonella abyssicola kryos subsp. nov. through the insemination duct into the (Figs 1, 2, 5, 19B, 21) female gland complex. Very long tubular ZooBank: http://urn:lsid:zoobank. receptaculum seminis in a distal position, org:act:9F7FA1E7-3326-4009-9F9B- with a widened base and small pear-shaped ADFFC10E7F82 reservoir (¤¥g. 19B). Type material. Holotype, ÌÍÍ Op-727, Ecology. Lives on soft bottom with stones at L = 25 mm length (preserved), Arctic Ocean, depths of 18–33 m. Franz Josef Land, Wiltona Island, 18–33 m Distribution. High latitude arctic region of depth, collected by O.V. Savinkin, 23.08.2013. Franz Josef Land. Etymology. From Ancient Greek κρύος Remarks. See remarks for C. abyssicola (kryos), “icy cold” in reference to the Arctic, abyssicola. The lowest Ð intergroup distance high latitude type locality. of 7.00% is found between C. abyssicola kryos External morphology. Body wide, massive. subsp. nov. and C. sandrae sp. nov. (table 1). Foot and tail broad. Oral tentacles moderate. For a morphological comparison with other

Rhinophores similar in size to oral tentacles, Cuthonella species, %  see ! table  ! 2.    $ !%  $!"#&     &  10.1163/18759866-10017 |    .

Ñ ½ 6 Cuthonella ainu sp. nov. A, dorsolateral view of living holotype ÌÍÍ Op-618, Matua Island. B, C, dorsolateral and ventral views of preserved holotype, 4 mm. D, jaw (Í). E, jaws, details (Í). F, anterior part of the radula (Í). G, posterior part of the radula (Í). Scale bars: D, 200 µm; E, 10 µm; F, G, 20 µm. Photos: A, Nadezhda Sanamyan, B–J, Alexander Martynov.

Cuthonella ainu sp. nov. Etymology. Named in honour of the Ainu, (Figs 1, 2, 6, 19C, 21) the indigenous people of the Kuril Islands ZooBank: http://urn:lsid:zoobank. (type locality of this new species), southern org:act:29DB6C94-45E8-4826-907D- Kamchatka, Sakhalin, Hokkaido and northern 2F5B53B85413 Honshu (Tohoku). The Ainu speak a highly Type material. Holotype. ÌÍÍ Op-618, isolated language, which is now critically 1 spec., L = 4 mm length (preserved), Paci¤¥c endangered. The Ainu were forced to leave Ocean, Middle Kuril Islands, Matua Island, their original lands both by Japanese and Klyuv Cape, 14 m, collected by N.P. Sanamyan, Russian authorities. Ainu de facto was extinct

04.08.2017. in Russia since the early %  ! 70s,  ! but attempts   to $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 7 Cuthonella benedykti sp. nov. A–D, dorsal, lateral, ventral and dorsolateral views of living holotype ÌÍÍ Op-194 from Kamchatka, 6 mm (preserved length). E, jaw (Í). F, jaws, details (Í). G, anterior part of the radula (Í). H, posterior part of the radula (Í). Scale bars: E, 200 µm; F, 50 µm; G, H, 20 µm. Photos: A–D, Tatiana Korshunova, E–H, Alexander Martynov. revitalize Ainu culture based on descendants white spots. Rhinophores semi-transparent with partial Ainu ancestry have been carried out and covered with a dense white pigment at recently in Kamchatka without governmental the top (¤¥g. 6A). support and oÁ¤¥cial recognition (e.g., Tanaka, Jaws. Jaws broad, yellowish in colour. 2017). In Japan, formerly forcedly-assimilated Masticatory processes of jaws covered with a Ainu now have governmental support for their single row of distinct denticles (¤¥g. 6D, E). language and culture with oÁ¤¥cial recognition Radula. Radula formula 18 × 0.1.0. Central (Tsunemoto, 2019). tooth elongated with a strongly protracted, External morphology. Body moderately pointed non-compressed cusp (¤¥g. 6F, G). wide. Foot and tail broad. Oral tentacles Central tooth bears up to 7 lateral denticles. moderate. Rhinophores similar in size to oral Cusp clearly delineated from the adjacent ¤¥rst tentacles, smooth to slightly wrinkled. Dorsal lateral denticles. cerata elongate, thick, arranged in a moderate Reproductive system. Diaulic. Herma- number of continuous rows. Five pre-anal phroditic duct leads to a relatively short, unbranched ceratal rows. Anal opening slightly bent, swollen ampulla. Vas acleioproctic. deferens short, without a distinct prostate. Colour (live). Background colour yellowish Supplementary gland long, inserts into the vas white. Digestive gland diverticula in cerata deferens a short distance from the elongated brownish to light orange. Ceratal tips with penial sheath. Penis conical, unarmed. opaque white spot, sometimes with very small Oviduct connects %  through !  ! the    insemination $ !%  $!"#&     &  10.1163/18759866-10017 |    . duct into the female gland complex. where he started his research (Wszolek et al., Receptaculum seminis in distal position, on a 1990). He also served as the only physician short stalk, elongate-oval (¤¥g. 19C). at the time (starting in 1879) for the large Ecology. Only found on soft bottom with region of Kamchatka, the type locality of this stones at 14 m depth. new species. Among other achievements, Distribution. Matua Island, Middle Kuril Dybowski contributed to Kamchatka’s Ainu Islands. dictionary. Remarks. According to the molecular External morphology. Body moderately phylogenetic analysis Cuthonella ainu sp. nov. is wide. Foot and tail broad. Oral tentacles closely related to C. benedykti sp. nov. (¤¥gs 1, 2). moderate. Rhinophores blunt and similar The maximum intragroup distance in C. ainu sp. in size to oral tentacles, smooth to slightly nov. is 0.15%. The lowest Ð intergroup distance wrinkled. Dorsal cerata elongate, thick, of 2.65% is found between C. ainu sp. nov. and arranged in continuous rows. Five pre-anal C. benedykti sp. nov. (table 1). Morphological unbranched ceratal rows. Anal opening analysis reveals diÁferences in radular patterns acleioproctic. between C. benedykti sp. nov. and C. ainu sp. nov. Colour (live). Background colour yellowish (¤¥gs 6F, G and 7G, H). Externally, C. ainu sp. nov. white. Digestive gland diverticula in cerata diÁfers from C. benedykti sp. nov. by its orange- brownish with a darker reddish to brown brownish colouration and spot-shaped rather hue. Ceratal tips with opaque white ring or than ring-shaped patterns of the white pigment spot, sometimes with additional yellow ring, on the ceratal apices. For a morphological and small white spots. Rhinophores light comparison with other Cuthonella species, see yellowish with white pigment on the top (¤¥g. table 2. 7A–D). Jaws. Jaws broad, yellowish in colour. Cuthonella benedykti sp. nov. Masticatory processes of jaws covered with a (Figs 1, 2, 7, 19D, 21) single row of distinct denticles (¤¥g. 7E, F). ZooBank: http://urn:lsid:zoobank. Radula. Radula formula 36 × 0.1.0 org:act:D4CDE4F2-05F3-46E4-8C6B- (specimen 6 mm in length). Central tooth B233722AAB25 elongated with a strongly protracted, pointed Type material. Holotype. ÌÍÍ Op-194, non-compressed cusp (¤¥g. 7G, H). Central 1 spec., L = 6 mm length (preserved), Paci¤¥c tooth bears up to 5 lateral denticles. Cusp Ocean, Kamchatka, Starichkov Island, 6–12 m, clearly delineated from the adjacent ¤¥rst stones, collected by T.A. Korshunova and A.V. lateral denticles. Martynov, 19.08.2008. Reproductive system. Diaulic. Herma- Etymology. The name is in honour of a phroditic duct leads to a relatively short, polymath scientist of Polish origin, Benedykt swollen ampulla. Vas deferens wide and Dybowski (1833–1930), who made substantial moderate in length, without a distinct achievements especially in zoology and the prostate. Supplementary gland relatively anthropology of Russian Siberia and the Far short, inserts into the vas deferens a short East. Benedykt Dybowski belonged to the distance from the elongated penial sheath. Polish intelligentsia, and he was arrested after Penis conical, unarmed. Oviduct connects the Polish rebellion against the Russian Empire through the insemination duct into the female (1863, “January Uprising”) and sentenced gland complex. Receptaculum seminis in to death, later changed to exile in Siberia, distal position, on a short stalk, oval (¤¥g. 19D).

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 8 Cuthonella concinna concinna (Alder & Hancock, 1843). A, living specimen ½Í 8866, Sweden, 9.5 mm (preserved length), dorsal view. B, living specimen from UK, 3.5 mm (preserved length), laterodorsal view. C, D, living specimen from Finnmark, Norway, 12.5 mm (live specimen), dorsal and ventral views respectively. E, F, lectotype of “Cuthona distans”, ÌÍ D 25946, Finnmark, Norway, 3 mm (preserved length), dorsal and ventral views respectively. G, living specimen from the Barents Sea, Russia, 9 mm (preserved length), dorsal view. H, I, living specimen from the White Sea (previously identi¤¥ed as “C. marisalbi”), Russia, ÌÍÍ Op-523, 8 mm (preserved length), dorsal and ventral views respectively. J, same, lateral view of ¤¥xed specimen. K, jaw, ½Í 8866, Sweden (Í). L, same, details. M, jaw, Finnmark, Norway (Í). N, same, details. O, anterior part of the radula, Sweden (Í). P, posterior part of the radula, Sweden (Í). Q, anterior part of the radula, Norway (Í). R, posterior part of the radula, Norway (Í). Scale bars: K, M, 200 µm; L, N, O, P, 20 µm; Q, R, 50 µm; Photos: A, Klas Malmberg, B, Bernard Picton, C–I, Tatiana Korshunova, J–R, Alexander Martynov.  %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    .

Ecology. Lives on stones at depths of c. feature needs to be particularly commented 6–12 m. on, because all the other 15 species of the genus Distribution. Kamchatka, Paci¤¥c side. Cuthonella invariably possess a supplementary Remarks. According to the molecular gland inserted into the vas deferens and not phylogenetic analysis Cuthonella benedykti into the penial sheath or penial base. The sp. nov. forms a separate clade sister to C. ainu reproductive system of C. cocoachroma (not sp. nov. (¤¥gs 1, 2). The maximum intragroup available for the present study) needs to be distance in C. benedykti sp. nov. is 0.16%. The re-examined in this respect, considering that minimum Ð intergroup distance of 2.65% according to the molecular data it belongs to the is found between C. benedykti sp. nov. and C. genus Cuthonella (¤¥g. 1). The thecate hydroid ainu sp. nov. (Table 1). Morphological analysis Thuiaria sp. was reported as a food object for C. reveals considerable diÁferences in the cocoachroma (Goddard, 1985). The maximum denticulation of the central teeth between C. intragroup distance in C. cocoachroma is benedykti sp. nov. and its sister C. ainu sp. nov. 1.52%. Interestingly, the minimum Ð as well as more distantly related, C. georgstelleri intergroup distance of 9.74% is found between sp. nov., C. hiemalis, C. osyoro, and C. soboli C. cocoachroma and the allopatric C. punicea (¤¥gs 6, 7, 11, 12, 14, 17). Externally, C. benedykti (table 1) rather than between the sympatric C. sp. nov. (¤¥g. 7A–D) diÁfers from C. ainu sp. nov. cocoachroma and C. concinna bellatula subsp. (¤¥g. 6A) by a more brownish colouration with nov. which are externally nearly identical. a dark reddish hue, and more distinct ring- For a morphological comparison with other shaped white pigment on the ceratal apices. Cuthonella species, see table 2. For a morphological comparison with other Cuthonella species, see table 2. Cuthonella concinna concinna (Alder & Hancock, 1843) Cuthonella cocoachroma (Williams & (Figs 1–3, 8, 19E, 21) Gosliner, 1979) Eolis concinna Alder & Hancock, 1843: 234; Cuthona cocoachroma Williams & Gosliner, Alder & Hancock, 1845–1855: 50, fam. 3, pl. 24, 1979: 204–211, ¤¥gs. 3–6. plus unnumbered pages. Remarks. Cuthonella cocoachroma has been Cuthona concinna – Brown, 1980: 249–250, described in detail by Williams & Gosliner ¤¥g. 5H; 6D, H. (1979), which will not be repeated here except to Cuthona distans Odhner, 1922: 28–29, ¤¥gs 11, say that it diÁfers from the sympatric C. concinna 12, syn. nov. bellatula in having rhinophores which are twice Cratenopsis concinna – Nordsieck, 1972: 81. as long as the oral tentacles, having fewer pre- concinna – Pruvot-Fol, 1954: 385. anal ceratal rows (3–4 vs 5–6) and fewer ceratal Cuthonella marisalbi Roginskaya, 1963: rows altogether (9–10 vs 10–12), and lacking 258–264, ¤¥gs 1–7; Martynov & Korshunova, scattered white or bluish spots on its cerata. 2011: 200 –201, ¤¥gs. In the present material commonly up to 4 pre- Cuthonella concinna – Martynov, 1992: 23; anal rows in C. concinna bellatula, that make Martynov, 2006: 290; Martynov & Korshunova, external diÁferences from C. cocoachroma as 2011: 198 –200, ¤¥gs. more subtle. According to ¤¥gure 5D in Williams Type material. Natural History Museum, & Gosliner (1979), C. cocoachroma possess a London, one specimen collected by Joshua supplementary gland which is inserted into Alder at Cullercoats (original type locality) the penial base instead of the vas deferens. This and indicated as “type” (NHM, 2020).

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Other material. ÌÍÍ Op-41, 2 spec., Berlevåg, 70.85021°N 29.151252°E, intertidal, L = 9 mm and 5 mm length (preserved), Barents collected by T.A. Korshunova, A.V Martynov, Sea, Dalnie Zelentsy, intertidal, collected by T. A. and K. Hårsaker, 01.05.2019. NTNU-VM 76044, Korshunova, 08.2006. KM 452, L = 3 mm length 1 spec., Finnmark, Kamøyvær, 71.049696°N (preserved), Barents Sea, Dalnie Zelentsy, 0.2– 25.91252°E, intertidal, collected by T. Bakken, 0.5 m depth, collected by T.A. Korshunova and C. Skauge, 05.05.2019. NTNU-VM 76045, 2 A.V. Martynov, 05.08.2005. KM 453, L = 8 mm spec., Finnmark, Kamøyvær, 71.049696°N length (preserved), Barents Sea, Dalnie 25.91252°E, intertidal, collected by T. Bakken, Zelentsy, 0.2–0.5 m depth, collected by T.A. C. Skauge, 05.05.2019. NTNU-VM 75960, 1 Korshunova and A.V. Martynov, 01.08.2005. spec., Finnmark, Bugøynes, 69.972744°N ÌÍÍ Op-523, two spec., L = 7 mm and 8 mm 29.627895°E, intertidal, collected by T.A. length (preserved), White Sea, Rugozerskaya Korshunova and A.V. Martynov, 29.04.2019. Bay, intertidal, collected T.A. Korshunova and NTNU-VM 75981, 1. spec., Finnmark, Berlevåg, A.V. Martynov, 15.06.2009. ½Í Gastropoda 70.850088°N 29.154291°E, intertidal, collected 8866, L = 9.5 mm length (preserved), by T. Bakken, T.A. Korshunova, A.V. Martynov, Skagerrak, Sweden, 5–10 m depth, collected and K. Hårsaker, 30.04.2019. NTNU-VM 75992, by Klas Malmberg. KM 616, L = 3.5 mm length 1. Spec., Finnmark, Berlevåg, 70.85021°N (preserved), the North Atlantic, Northern 29.151252°E, intertidal, collected by T.A. Ireland, Strangford Lough, UK, 10–20 m Korshunova, A.V Martynov, and K. Hårsaker, depth, collected B. Picton, 23.05.2015. ZMO 01.05.2019. NTNU-VM 75994, 4. Spec., D 25946 (lectotype of “Cuthona” distans), Finnmark, Berlevåg, 70.85021°N 29.151252°E, L = 3 mm length (preserved), Finnmark, intertidal, collected by T.A. Korshunova, A.V Vadsø, collected G.O. Sars. KM 767, 1 spec., Martynov, and K. Hårsaker, 01.05.2019. L = 12.5 mm (live), Finnmark, Kirkenes vicinity, External morphology. Body moderately wide. intertidal, collected by T.A. Korshunova and Foot and tail broad. Rounded foot corners A.V. Martynov, 29.04.2019. NTNU-VM 76078, present. Oral tentacles moderate. Rhinophores 1 spec., Finnmark, Alta¤äorden, 70.156664°N similar in size, or slightly longer than oral 23.285329°E, intertidal, collected by T.A. tentacles, smooth to slightly wrinkled. Dorsal Korshunova, A.V Martynov, and K. Hårsaker, cerata elongate, arranged in continuous rows. 08.05.2019. NTNU-VM 76079, 1 spec., Finnmark, Up to 6 pre-anal unbranched ceratal rows. Alta¤äorden, 70.156664°N 23.285329°E, Anal opening acleioproctic. intertidal, collected by T.A. Korshunova, Colour (live). Background colour yellowish A.V Martynov, and K. Hårsaker, 08.05.2019. white. Digestive gland diverticula in cerata NTNU-VM 75959, 1 spec., Finnmark, Bugøynes, brown to purplish-brown. Ceratal tips 69.972744°N 29.627895°E, intertidal, collected with opaque white subapical band or spot, by T.A. Korshunova and A.V. Martynov, sometimes with a bluish hue and smaller 29.04.2019. NTNU-VM 76009, 1 spec., Finnmark, white spots. Rhinophores and oral tentacles Porsanger, 70.245495°N 24.999314°E, intertidal, semi-transparent with commonly white collected by T.A. Korshunova, A.V Martynov, pigment on the tips (¤¥g. 8A–D, G–I). and K. Hårsaker, 03.05.2019. NTNU-VM 76010, Jaws. Jaws broad, yellowish in colour. 1 spec., Finnmark, Porsanger, 70.245495°N Masticatory processes of jaws covered with a 24.999314°E, intertidal, collected by T.A. single row of distinct denticles (¤¥g. 8K–N). Korshunova, A.V Martynov, and K. Hårsaker, Radula. Radula formula 30 × 0.1.0 (specimen 03.05.2019. NTNU-VM 75991, 1. spec., Finnmark, 8 mm in length), 29 × 0.1.0 (specimen 9.5 mm

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    . in length), 19 × 0.1.0 (specimen 3 mm in length), In this study we also obtained recently 26 × 0.1.0 (specimens 8 mm in length). Central collected specimens (¤¥g. 8C, D) from the tooth elongated with a strongly protracted type locality of the enigmatic Norwegian cusp (¤¥g. 8O–R). Central tooth bears up to 10 species Cuthona distans Odhner, 1922 in the lateral denticles (more commonly, up to 4–5). northernmost mainland Norwegian county of Cusp clearly delineated from the adjacent ¤¥rst Finnmark. We also studied the type specimen lateral denticles. of C. distans from the Oslo Natural History Reproductive system. Diaulic. Museum in Norway (ZMO D 25946, designated Hermaphroditic duct leads to a relatively here as the lectotype) (¤¥g. 8E, F). According to short or folded swollen ampulla. Vas deferens the morphological study of the type material relatively long, without a distinct prostate. of C. distans, it has a supplementary gland that Supplementary gland usually relatively long, inserts into the vas deferens relatively close sometimes shorter, inserts into the vas deferens to the penis, similar to that of C. concinna at a relatively short distance from the elongated concinna. Molecular analysis shows that penial sheath. Penis conical, unarmed. Oviduct new specimens from Finnmark belong to C. connects through the insemination duct into concinna concinna (¤¥gs 1–3). Morphological female gland complex. Receptaculum seminis data from the original description of C. in a more proximal position than in most distans (Odhner, 1922) and our study of the other Cuthonella species, and on a short stalk, type material also con¤¥rm that C. distans without a distinct reservoir (¤¥g. 19E). syn. nov. is a junior synonym of C. concinna Ecology. Lives on stones and rocks. concinna. In the northern localities such as Intertidal to 30 m depth. the Barents Sea and the Finnmark region, C. Distribution. Boreal European waters of the concinna concinna is one of the most common NE Atlantic (France, British Isles, Netherlands, shallow-water species of nudibranchs. Several Denmark, Sweden, Norway to the Barents Sea thecate hydroid species of the families and the White Sea in Russia) and the Atlantic Campanulariidae and Sertulariidae were coast of the USA and Canada. reported as food objects for C. concinna Remarks. In the present study we obtained concinna: Diphasia fallax (Johnston, morphological and molecular data from 1847), Dynamena pumila (Linnaeus, 1758), specimens of C. concinna concinna from the Sertularia spp. (Roginskaya, 1987; Martynov British Isles (the type locality of this subspecies) & Korshunova, 2011), Hartlaubella gelatinosa and thereby con¤¥rm that it is conspeci¤¥c with (Pallas, 1766), Laomedea ˜lexuosa Alder, 1857, our other specimens from diÁferent localities Obelia longissima (Pallas, 1766), Sertularia across the North Atlantic. Present molecular argentea Linnaeus, 1758, Sertularia cupressina phylogenetic analysis (¤¥gs 1, 2) hereby con¤¥rms Linnaeus, 1758 (Alder & Hancock, 1845–1855; that C. concinna concinna has an amphiatlantic Swennen, 1961; Brown, 1980; Thompson & distribution, but North Paci¤¥c populations Brown, 1984; Picton & Morrow, 1994). A report belong to the separate subspecies C. concinna of the feeding on the athecate Tubularia bellatula subsp. nov. (see details below). The indivisa Linnaeus, 1758 (Hamond, 1972) needs range of C. concinna concinna is con¤¥rmed here a veri¤¥cation. from the White Sea to the Northeast Atlantic The maximum intragroup distance in C. coast, including occurrences in Eastern Canada, concinna concinna is 0.91%. The minimum Ð the Netherlands, Norway, Russia, Sweden, the interspecies distance of 9.28% is found between UK, and the Eastern USA. C. concinna concinna and C. vasentsovichi

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 9 Cuthonella concinna bellatula subsp. nov. A, living holotype ÌÍÍ Op-729 from the NE Paci¤¥c, Port Orchard, USA, 6 mm (live length), dorsal view. B, living holotype in natural conditions. C, living paratype ÌÍÍ Op-728 in natural conditions on a hydroid of the family Sertulariidae, Port Orchard, USA, 8 mm (live length), dorsolateral view. D, E, two living paratypes ÌÍÍ Op-742, 5–6 mm (live length), dorsal view in natural conditions, including hydroid of the family Sertulariidae (E). F, living paratype ÌÍÍ Op-740, Port Orchard, USA, 7 mm (live length), dorsal view. G, jaw, paratype ÌÍÍ Op-728 (Í). H, same, details. J, anterior and middle parts of radula of paratype ÌÍÍ Op-728 (Í). K, same, anterior part of the radula (Í). I, jaw, details of the paratype ÌÍÍ Op-740 (Í). L, posterior part of the radula paratype ÌÍÍ Op-740 (Í). Scale bars: G, 100 µm; H, K, 20 µm; I, L,10 µm; J, 50 µm; Photos: A–F, Karin Fletcher, G–L, Alexander Martynov. sp. nov. (Table 1). Morphologically, the reported for this species by Williams & Gosliner nominative subspecies diÁfers from C. concinna (1979). The reason the receptaculum in C. bellatula subsp. nov. by its larger maximum concinna s.l. (¤¥gs 19E, F) appears to be placed in body size (20 mm compared to 15 mm), and a a more proximal position than in the majority larger number of lateral denticles of the central of Cuthonella species (¤¥gs 19, 20) is possibly teeth of the radula. We also checked several because a channel from the receptaculum specimens of C. concinna s.l. from diÁferent to the female opening is partially concealed locations over large geographic distances, but within female gland mass. For a morphological were unable to con¤¥rm the presence of a narrow comparison with other Cuthonella species, see distal “bursa” (in addition to the receptaculum) table 2.

 %  !  !    $ !%  $!"#&     & Ô 10.1163/18759866-10017 |    .

Cuthonella concinna bellatula subsp. nov. sheen and a few scattered white or bluish (Figs 1–3, 9, 19F, 21) spots. Ceratal tips with opaque white spots or ZooBank: http://urn:lsid:zoobank. bands. Rhinophores and oral tentacles semi- org:act:82CF5393-CF70-42DF-A95A- transparent with white pigment on the tips E8869B4FBED8 (¤¥g. 9A–F). Cuthonella concinna s.l. auct., e.g. Jaws. Jaws broad, yellowish in colour. O’Donoghue, 1922: 162–163; Millen, 1983: 384; Masticatory processes of jaws covered with a Behrens, 1980: 98; Korshunova et al., 2018a: single row of distinct denticles (¤¥g. 9G, H, I). 317, non Alder & Hancock, 1843 Radula. Radula formula about 17 × 0.1.0 Type material. Holotype. ÌÍÍ Op-729, (specimen 8 mm in length), Central tooth L = 6 mm length (live), NE Paci¤¥c, Rich elongate with protracted, pointed non- Passage, West of Pt. Glover, c. 12 m depth, compressed cusp (¤¥g. 9J, K, L). Central tooth bears collected by Karin Fletcher, 13.07.2013. 3–5 lateral denticles. Cusp clearly delineated Paratypes. ÌÍÍ Op-728, one spec., from the adjacent ¤¥rst lateral denticles. L = 8 mm length (live), NE Paci¤¥c, Rich Reproductive system. Diaulic. Passage, Port Orchard, 10.7 m, collected by Hermaphroditic duct leads to a short, swollen Karin Fletcher, 18.04.2012. ÌÍÍ Op-740, ampulla. Vas deferens short, without a distinct one spec., L = 7 mm length (live), NE Paci¤¥c, prostate. Supplementary gland short, inserts Rich Passage, West of Pt. Glover, c. 10 m depth, into the vas deferens a relatively long distance collected by Karin Fletcher, 02.02.2019. ÌÍÍ from the elongated penial sheath. Penis Op-742, two spec., L = 5–6 mm length (live), conical, unarmed. Oviduct connects through NE Paci¤¥c, Rich Passage, West of Pt. Glover, the insemination duct into the female c. 10 m depth, collected by Karin Fletcher, gland complex. Receptaculum seminis in a 30.04.2014. more proximal position than in most other Etymology. From Latin bellatula (“small Cuthonella species, and on a short stalk, with beautiful”) referring to the morphological only a weakly de¤¥ned reservoir (¤¥g. 19F). similarity, but smaller size, compared to Ecology. Lives on stones and rocks at the nominative subspecies C. concinna depths of c. 10–15 m, primarily found between concinna, for which the name “concinna” March-September on its prey, the hydroids of has a similar meaning in Latin, “beautiful, the family Sertulariidae. well-proportionated”. Distribution. Temperate NE Paci¤¥c waters External morphology. Body moderately from Alaska to Sonoma County, California. narrow. Foot and tail moderate. Rounded foot Remarks. Morphologically C. concinna corners present. Oral tentacles moderate. bellatula subsp. nov. diÁfers from the Rhinophores similar in size, or slightly longer nominative subspecies by its smaller than oral tentacles, smooth to slightly wrinkled. maximum body size (15 mm compared to Dorsal cerata elongate, arranged in continuous 20 mm), more varied ceratal colour (in C. rows. Potentially up to 6, but in present material concinna bellatula subsp. nov. the ceratal commonly up to 4 pre-anal unbranched ceratal colour ranges from pinkish to brownish- rows. Anal opening acleioproctic. orange, reddish, grayish-purple to blackish, Colour (live). Background colour white to whereas in C. concinna concinna the colour yellowish white. Digestive gland diverticula is a rather uniform brownish to dark brown) pinkish, brownish-orange, reddish, grayish- and fewer number of lateral denticles on the purple to blackish. Cerata can have a bluish central teeth of the radula (in C. concinna

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 10 Cuthonella denbei sp. nov. A, living holotype ÌÍÍ Op-730, 6 mm (preserved length), Matua Island, dorsal view. B, preserved holotype, lateral view. C, preserved holotype, ventral view. D, living paratype Op-741, 7 mm (preserved length), Matua Island, dorsal view. E, jaw, paratype ÌÍÍ Op-673 (Í). F, jaw, same, details. G, anterior part of the radula of the paratype ÌÍÍ Op-673 (Í). H, I, middle and posterior part of the radula of the paratype ÌÍÍ Op-673 respectively (Í). Scale bars: E, 200 µm; F, 20 µm; G–I, 30 µm; Photos: A, B, Nadezhda Sanamyan, C–I, Alexander Martynov. bellatula subsp. nov. the number of lateral California (Ð Ì 181307a and Ð Ì 181307d), denticles is commonly no more than 5, plus another specimen collected from the whereas in the nominative subspecies the same site on a diÁferent date (Ð Ì 179469), number of denticles can reach up to 10). all putatively considered to be C. cocoachroma Cuthonella concinna bellatula and C. when they were collected, turned out to be cocoachroma are also likely to be mistaken for C. concinna (named C. concinna bellatula in each other. These two species are so similar this paper). These results were not discussed externally that two of the ¤¥ve specimens in details within the study which originally collected at the same time in Sonoma County, sequenced the specimens (Cella et al., 2016)

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    . but until then the southernmost limit of the C. concinna bellatula subsp. nov. from the range of C. concinna bellatula was Vancouver NE Paci¤¥c compared to the location of the Island, British Columbia, Canada. A record of nominative subspecies. In our opinion, the Cuthonella concinna s.l. from the Commander best decision in this case was the separation Islands (Martynov, 1997) may also include of such forms as subspecies, which meets the a diÁferent species and needs further requirements of both the ÐÌ and general investigation. Several hydroid species were taxonomic practice when subspecies status previously reported as food objects for NE commonly implies a considerable geographic Paci¤¥c C. concinna s.l.: Bougainvillia glorietta separation. It is possible that with a really Torrey, 1904, Obelia commissuralis McCrady, large dataset this decision can be clari¤¥ed, 1859 (currently also mentioned as Obelia but given the amount of currently available dichotoma (Linnaeus, 1758)), Coryne eximia data we prefer to consider it a subspecies. Allman, 1859 (Waters, 1966), and Sertularia sp. The maximum intragroup distance in C. (Behrens & Hermosillo, 2005). These reports concinna bellatula is 1.67%. The minimum need veri¤¥cation. In the present study we Ð intergroup distance of 9.74% is found found C. concinna bellatula subsp. nov. on between C. concinna bellatula subsp. nov. hydroids of the family Sertulariidae. and C. vasentsovichi sp. nov. (table 1). For The maximum intragroup distance in C. a morphological comparison with other concinna bellatula subsp. nov. is 1.67%. At the Cuthonella species, see table 2. same time, the minimum intergroup distance between C. concinna concinna and C. concinna Cuthonella denbei sp. nov. bellatula subsp. nov. is 1.07%. A considerable (Figs 1, 2, 10, 20A, 21) intragroup genetic divergence suggests that ZooBank: http://urn:lsid:zoobank.org:act:9D- the present North Paci¤¥c populations of C. D902C3-B8CA-4941-9712-11E77977DB77 concinna bellatula subsp. nov. may conceal Type material. Holotype. ÌÍÍ Op-730, potentially more taxonomic diversity and may L = 6 mm length (preserved), Paci¤¥c Ocean, also have experienced a genetic introgression Middle Kuril Islands, Matua Island, Klyuv with Atlantic C. concinna concinna Cape, intertidal, collected by N.P. Sanamyan, occasionally introduced to the Paci¤¥c coast. 06.08.2017. While making a decision on the taxonomic Paratypes. ÌÍÍ Op-674, 1 spec., status of “C. concinna” from the NE Paci¤¥c L = 4.5 mm length (preserved), Paci¤¥c Ocean, we encountered a diÁ¤¥cult situation because Middle Kuril Islands, Matua Island, Klyuv of the lack of a clear and universal de¤¥nition Cape, intertidal, collected by N.P. Sanamyan, of a “species” concept. “Cuthonella concinna” 22.08.2016. ÌÍÍ Op-673, 1 spec., L = 4 mm from the NE Paci¤¥c is case of a “species” (or length (preserved), Paci¤¥c Ocean, Middle Kuril a part of a group of species) which has likely Islands, Matua Island, Klyuv Cape, 16 m depth, only relatively recently started to diverge into on brown algae Thalassiophyllum clathrus, a separate species, where specimens already collected by N.P. Sanamyan, 23.08.2016. ÌÍÍ show some morphological and molecular Op-741, 1 spec., L = 7 mm length (preserved), diÁferences from C. concinna concinna, but Paci¤¥c Ocean, Middle Kuril Islands, Matua these diÁferences are not distinct enough for a Island, Klyuv Cape, intertidal, collected by full species status. N.P. Sanamyan, 06.08.2017. At the same time, a clear and signi¤¥cant Etymology. Named in honour of the geographic gap was revealed in the case of Japanese merchant clerk Denbei (Dembei) –

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

伝兵衛（でんべえ）(c.1670–1714) from into the vas deferens a considerable distance Osaka who represented the ¤¥rst well- from the elongated penial sheath. Penis documented case of the appearance of a conical, unarmed. Oviduct connects through Japanese native in Russia. Denbei arrived in the insemination duct into the female gland Russia due to the shipwrecking of a Japanese complex. Receptaculum seminis in a distal vessel on the Kamchatka coast, followed by a position, on a short stalk, pear-shaped (¤¥g. long drift through the Kuril Islands chain, the 20A). type locality of the present species. Afterwards, Ecology. Lives on soft bottoms with stones. Denbei had an audience with the Russian Intertidal to 16 m depth. tsar Peter the Great in 1702. This became an Distribution. Matua Island, Middle Kuril historic event since Denbei promoted the Islands. ¤¥rst oÁ¤¥cial connections between Japan and Remarks. The maximum intragroup Russia, and also established the ¤¥rst school of distance in C. denbei sp. nov. is 0.30%. The Japanese language in Russia (e.g., Ikuta, 2008). minimum Ð intergroup distance of 9.30% External morphology. Body moderately is found between C. denbei sp. nov. and C. narrow. Foot and tail broad. Oral tentacles concinna concinna (table 1). Morphological moderate. Rhinophores similar in size to oral analysis reveals considerable diÁferences in tentacles, smooth to slightly wrinkled. Dorsal the denticulation of the central teeth between cerata elongate, thick, arranged in continuous C. denbei sp. nov. and related species C. rows. Up to 6 pre-anal unbranched ceratal benedykti, C. georgstelleri sp. nov., C. hiemalis rows. Anal opening acleioproctic. sp. nov., C. osyoro, and C. soboli (¤¥gs 7, 11, 12, Colour (live). Background colour yellowish 14, 17). For a morphological comparison with to more intense yellow-pinkish. Digestive other Cuthonella species, see table 2. gland diverticula within cerata brownish to dark-reddish. Ceratal tips with distinct ring- Cuthonella elenae Martynov, 2000 shaped opaque white pigment, sometimes Cuthonella elenae Martynov, 2000: 5–9, Figs with few scattered white spots. Rhinophores 1–3; Martynov, 2006b: 290. light yellowish with a sparse white pigment at Remarks. Cuthonella elenae from the the top (¤¥g. 10A, B). Chukchi Sea has been described in detail in Jaws. Jaws broad, yellowish in colour. Martynov (2000), which will not be repeated Masticatory processes of jaws covered with a here. This species has all the diagnostic single row of distinct denticles (¤¥g. 10E, F). characters of the genus Cuthonella, including Radula. Radula formula 19 × 0.1.0 a supplementary gland inserted into the vas (specimen 4 mm in length). Central tooth deferens, which unambiguously places this elongated with a strongly protracted, pointed species in the genus Cuthonella, even in the non-compressed cusp (¤¥g. 10G–I). Central absence of molecular data. At the same time, tooth bears up to 7 lateral denticles. Cusp this species evidently shows several unique clearly delineated from the adjacent ¤¥rst features, including small lobes around the lateral denticles. penial opening, a very broad penial sheath, Reproductive system. Diaulic. a relatively short supplementary gland, and Hermaphroditic duct leads to a relatively çèattened oral tentacles. short, swollen ampulla. Vas deferens These characters clearly delineate this moderately long, without a distinct prostate. species from any other Cuthonella species, Supplementary gland relatively short, inserts including the newly-described ones in

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    .

Ñ ½ 11 Cuthonella georgstelleri sp. nov. A, B, living holotype ÌÍÍ Op-670, Matua Island, 14 mm (preserved length), dorsal and dorsolateral views respectively. C, Living paratype ÌÍÍ Op-731, Matua Island, 10 mm (preserved length), dorsal view. D, Preserved paratype ÌÍÍ Op-731, lateral view. E, jaw, holotype (Í). F, jaw, same, details. G, anterior part of the radula of the holotype (Í). H, posterior part of the radula of the holotype (Í). Scale bars: E, 500 µm; F, 50 µm; G, 100 µm; H, 30 µm; Photos: A–C, Nadezhda Sanamyan, D–H, Alexander Martynov. this study. By the presence of the many- ZooBank: http://urn:lsid:zoobank. branched digestive gland, this species shares org:act:FF40FDD4-CF8D-4758-899A- a common plesiomorphic condition with 6D2A548E686B the type species, C. abyssicola s.l. There are Type material. Holotype. ÌÍÍ Op-670, no additional specimens collected since 1 spec., L = 14 mm length (preserved), Paci¤¥c the original description, and molecular Ocean, Middle Kuril Islands, Matua Island, phylogenetic data are not available for this Klyuv Cape, 16 m depth, collected by N.P. species. For a morphological comparison with Sanamyan, 28.08.2016. other Cuthonella species, see table 2. Paratypes. ÌÍÍ Op-672, 1 specimen, L = 12 mm length (preserved), same locality, Cuthonella georgstelleri sp. nov. date and collector as holotype. ÌÍÍ Op-731, (Figs 1, 2, 11, 20B, 21) 1 spec., L = 10 mm length (preserved), Paci¤¥c

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 12 Cuthonella hiemalis (Roginskaya, 1987). A, living specimen from the type locality, White Sea, dorsal view, c. 5 mm (preserved length). B, C. preserved syntype collected and identi¤¥ed by I.S. Roginskaya, ÌÍÍ Op-732, White Sea, 14 mm (preserved length), dorsal and lateral views respectively. D, jaw, ÌÍÍ Op-732 (Í). E, jaw, same, details. F, anterior part of the radula, ÌÍÍ Op-732 (Í). G, posterior part of the radula, same (Í). Scale bars: D, 200 µm; E, 50 µm; F, G, 20 µm; Photos: A, courtesy of Anna Zhadan, B–G, Alexander Martynov.

Ocean, Middle Kuril Islands, Matua Island, made substantial eÁforts to study the North Klyuv Cape, 14 m depth, collected by N.P. Paci¤¥c region, and particularly the Kuril Sanamyan, 20.08.2017. and Commander Islands, but met a very Etymology. The name is in honour of the unfortunate fate. Georg Steller was the only prominent 18th-century scientist Georg professional scientist who saw and personally Wilhelm Steller (1709–1746) of German described the now extinct Steller’s sea cow origin who served in the Russian Empire and (Hydrodamalis gigas). Georg Steller is also

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    . considered the ¤¥rst European who stepped the insemination duct into the female gland onto the land of Alaska (Stejneger, 1936). complex. Receptaculum seminis distal, on a In 1742, Georg Steller was falsely accused of long stalk, compressed (¤¥g. 20B). organizing a rebellion against the Russian Ecology. Lives on soft bottoms with stones Government in Kamchatka and was forced at depths of 14–16 m. to return to mainland Russia, but on the way Distribution. Matua Island, Middle Kuril to Moscow he died in the Siberian area of Islands. Tyumen. The majority of the descriptions of Remarks. The maximum intragroup his collected materials and prepared notes (in distance in C. georgstelleri sp. nov. is 0.30%. his diaries) was published after his death. The minimum Ð intergroup distance External morphology. Body moderately of 7.75% is found between C. georgstelleri wide. Foot and tail broad. Oral tentacles sp. nov. and C. benedykti sp. nov. (table 1). moderate. Rhinophores similar in size to Phylogenetically, C. georgstelleri sp. nov. is oral tentacles, smooth to slightly wrinkled. close to C. soboli, C. osyoro, C. ainu sp. nov., Dorsal papillae elongate, thick, arranged in and C. benedykti sp. nov. Morphological continuous rows. Up to 8 pre-anal unbranched analysis reveals considerable diÁferences in or partially branched ceratal rows. Anal the denticulation of the central teeth between opening cleioproctic. C. georgstelleri and the related species C. ainu Colour (live). Background colour whitish. sp. nov., C. hiemalis, C. osyoro and C. soboli (¤¥gs Digestive gland diverticula light orange- 6, 12, 14, 17). For a morphological comparison brownish and salmon-brownish to dark, with other Cuthonella species, see table 2. intensive brownish reddish. Ceratal tips with extended opaque white band or spot, Cuthonella hiemalis (Roginskaya, 1987) sometimes with few white small spots. (Figs 1, 2, 12, 20C, 21) Rhinophores whitish to light yellowish with Cuthona hiemalis Roginskaya, 1987: 197–199; slight disperse white pigment (¤¥g. 11A–C). Fig. 118 was supposed to illustrate this species Jaws. Jaws broad, yellowish in colour. in the original description, but it was omitted Masticatory processes of jaws covered with a in the publication due to an editorial error. single row of denticles (¤¥g. 11E, F). Cuthonella hiemalis (Roginskaya, 1987) – Radula. Radula formula 30 × 0.1.0 Martynov, 1992: 23; Martynov, 2006b: 290; (specimen 14 mm in length). Central tooth Martynov & Korshunova, 2011: 195–197, ¤¥gs. elongated with a strongly protracted, pointed Type material. The previously indicated non-compressed cusp (¤¥g. 11 G, H). Central (Martynov, 2006b) syntypes series (including tooth bears up to 10 lateral denticles. Cusp labelled, but not published by Roginskaya clearly delineated from the adjacent ¤¥rst (1987) “holotype”) is not traceable. A syntype lateral denticles. was discovered, accompanied by a label written Reproductive system. Diaulic. by I.S. Roginskaya. The syntype was collected Hermaphroditic duct leads to a relatively over the same period of time in the same short, swollen ampulla. Vas deferens locality with the previously mentioned type moderate in length, without a distinct series: ÌÍÍ Op-732, L = 14 mm (preserved), prostate. Supplementary gland long, inserts White Sea, Rugozerskaya Bay, intertidal, into the vas deferens at a considerable length collected by I.S. Roginskaya, 7.02.1962. from the elongated penial sheath. Penis Other materials. ÌÍÍ Op-186, egg- conical, unarmed. Oviduct connects through mass and juveniles (preserved), White Sea,

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 13 Cuthonella orientosiberica sp. nov. A, B, preserved holotype ÌÍÍ Op-184, the East Siberian Sea, 3.5 mm (preserved length), dorsal and ventral views respectively. C, photograph of a living specimen (juvenile, not collected), the East Siberian Sea, c. 2–3 mm. D, jaw, paratype, ÌÍÍ Op-185, the East Siberian Sea (Í). E, jaw, same, details. F, anterior part of the radula, ÌÍÍ Op-185 (Í). G, posterior part of the radula, same. Scale bars: D, 200 µm; E, 20 µm; F, G, 30 µm; Photos: A, B, Alexander Martynov, C, courtesy of Sergei Gagaev, D, G, Alexander Martynov.

Rugozerskaya Bay, intertidal, collected by T.A. Dorsal cerata elongate, thick, arranged in Korshunova, and A.V. Martynov, 14.06.2009. continuous rows. Up to 7 pre-anal unbranched ZMMU Op-666, 5 spec., L = c. 5 mm each ceratal rows. Anal opening acleioproctic. (preserved), White Sea, Rugozerskaya Bay, Colour (live). Background colour yellowish, collected by A.E. Zhadan, 2009–2010. sometimes with dispersed orange pigment. External morphology. Body moderately wide. Digestive gland diverticula in cerata from Foot and tail broad. Oral tentacles moderate. dark beige to dark brown. Ceratal tips with Rhinophores similar in size or slightly shorter peculiar opaque bluish to whitish subapical than oral tentacles, smooth to slightly wrinkled. band or spot, without opaque white pigment.

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    .

Rhinophores yellowish without distinct white osyoro, and C. soboli Martynov, 1992 (¤¥gs pigment at the top (¤¥g. 12A). 7, 10, 11, 14, 17). Reproduction occurs in the Jaws. Jaws broad, yellowish in colour. wintertime. Cuthonella hiemalis feeds on the Masticatory processes of jaws covered with a athecate hydroids Clava multicornis (Forsskål, single row of distinct denticles (¤¥g. 12D, E). 1775), Sarsia lovenii (M. Sars, 1846), and on Radula. Radula formula 23 × 0.1.0 the thecate Dynamena pumila (Linnaeus, (specimen 14 mm in length). Central tooth 1758) (Roginskaya, 1987). For a morphological elongated with a strongly protracted, pointed comparison with other Cuthonella species, see non-compressed cusp (¤¥g. 12F, G). Central table 2. tooth bears up to 12 lateral denticles. Cusp clearly delineated from the adjacent ¤¥rst Cuthonella orientosiberica sp. nov. lateral denticles. (Figs 1, 2, 13, 20D, 21) Reproductive system. Diaulic. ZooBank: http://urn:lsid:zoobank.org:act:- Hermaphroditic duct leads to a relatively long, 106FE0CB-1D90-4EDC-B649-BB4AE07932C7 folded, non-swollen ampulla. Vas deferens long, Type material. Holotype. ÌÍÍ Op-184, without a distinct prostate. Supplementary L = 3.5 mm length (preserved), East Siberian gland long, inserts into the vas deferens a Sea, 70° 09.90´ N, 161° 16.18´ E, depth 9 m, considerable distance from the elongated collected by A.Y. Voronkov, 06.09.2004. penial sheath. Penis conical, unarmed. Oviduct Paratypes. ÌÍÍ Op-733, L = 4 mm connects through the insemination duct into length (preserved), East Siberian Sea, 70° the female gland complex. Receptaculum 09.90´ N, 161° 16.18´ E, depth 9 m, collected seminis in a distal position, on a long massive by A.Y. Voronkov, 06.09.2004. ÌÍÍ Op-185, stalk, oval (¤¥g. 20C). L = 4 mm length, East Siberian Sea, 69° 10.50´ Ecology. Lives on stones and rocks. N, 169° 52.87´ E, depth 15 m, collected by A.Y. Intertidal to 5 m depth. Larvae exhibit direct Voronkov, 07.09.2004. development without a planktonic stage. Etymology. The name refers to the type Distribution. Currently known only from locality. Oriento-, Lat. “belonging to the east” the White Sea, possibly it also occurs in the and the Siberian Sea. Barents Sea. External morphology. Body moderately Remarks. According to the molecular wide. Foot and tail broad. Oral tentacles phylogenetic analysis, Cuthonella hiemalis moderate. Rhinophores similar in size to oral forms a separate clade sister to the clade tentacles, smooth to slightly wrinkled. Dorsal containing C. soboli, C. osyoro, C. benedykti cerata elongate, thick, arranged in continuous sp. nov., C. georgstelleri sp. nov., and C. ainu rows. Up to 6 pre-anal unbranched ceratal sp. nov. (¤¥gs 1, 2). The maximum intragroup rows. Anal opening acleioproctic. distance in C. hiemalis is 0.31%. The Colour (live). Background colour yellowish minimum Ð intergroup distance of 8.37% white. Digestive gland diverticula light is found between C. hiemalis and C. osyoro brownish to yellowish in juveniles and (table 1). brownish to dark brown in adults. Ceratal Morphological analysis reveals tips whitish. Rhinophores light yellowish with considerable diÁferences in the denticulation white pigment at the top. of the central teeth between C. hiemalis and Jaws. Jaws broad, yellowish in colour. the related species C. benedykti sp. nov., C. Masticatory processes of jaws covered with a denbei sp. nov., C. georgstelleri sp. nov., C. single row of denticles (¤¥g. 13D, E).

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 14 Cuthonella osyoro (Baba, 1940). A, living neotype ÌÍÍ Op-743, the Sea of Japan, 4 mm (live length), dorsal view. B, C, living specimen ÌÍÍ Op-613, the Sea of Japan, 9 mm (live length), dorsal and ventral views respectively. D, living specimen ÌÍÍ Op-607, the Sea of Japan, 4 mm (preserved length), dorsal view. E, living specimen ÌÍÍ Op-524, the Sea of Japan, 3 mm (preserved length), dorsal view. F, living specimen ÌÍÍ Op-606, the Sea of Japan, 3 mm (preserved length), dorsal view. G, original drawings of external view by Kikutaro Baba, essentially similar to those used for the original description of “Cuthona” osyoro Baba, 1940. H, jaw, ÌÍÍ Op-607 (Í). I, same, details. J, anterior and middle parts of the radula, ÌÍÍ Op-607 (Í). K. anterior part of the radula, ÌÍÍ Op-604 (Í). L, posterior part of the radula, ÌÍÍ Op-604 (Í). M, original drawings of radular teeth of “Cuthona” osyoro by Kikutaro Baba. Scale bars: G, 100 µm; H, J, K, 10 µm; I, 20 µm; Photos: A–F, Tatiana Korshunova, G, M, drawings by Kikutaro Baba courtesy of Yoshiaki Hirano, So Ishida and Sho Kashio, H–L, Alexander Martynov.

Radula. Radula formula 28 × 0.1.0 (specimen cusp (¤¥g. 13F, G). Central tooth bears up to 9 4 mm in length). Central tooth elongated with lateral denticles. Cusp clearly delineated from a strongly protracted, pointed non-compressed the adjacent ¤¥rst lateral denticles.

 %  !  !    $ !%  $!"#&     & Ô 10.1163/18759866-10017 |    .

Reproductive system. Diaulic. Herma- stones, collected by T.A. Korshunova and phroditic duct leads to a relatively long, A.V. Martynov, 16.09.2014. ÌÍÍ Op-607, 1 folded, swollen ampulla. Vas deferens spec., L = 4 mm length (preserved), the Sea moderately long, without a distinct prostate. of Japan, Spaseniya Bay, 0.3–0.7 m, stones, Supplementary gland long, inserts into the collected by T.A. Korshunova and A.V. vas deferens a considerable distance from Martynov, 16.09.2014. ÌÍÍ Op-524, 1 spec., the elongated penial sheath. Penis conical, L = 3 mm length (preserved), the Sea of Japan, unarmed. Oviduct connects through the Gornostay Bay, 0.5–0.7 m, stones, collected insemination duct into the female gland by T.A. Korshunova and A.V. Martynov, complex. Receptaculum seminis in a distal 18.09.2014. ÌÍÍ Op-604, 1 spec., L = 4 mm position, on a short stalk, oval (¤¥g. 20D). length (live), the Sea of Japan, Spokoinaya Ecology. Lives on stones and rocks at depths Bay, 3–5 m, brown algae, stones, collected of c. 9–15 m. by T.A. Korshunova and A.V. Martynov, Distribution. Arctic Seas – East Siberian 25.09.2014. ÌÍÍ Op-613, 1 spec., L = 9 mm Sea, Laptev Sea, possibly also Chukchi Sea. length (live), the Sea of Japan, Spokoinaya Bay, Remarks. According to the morphological 3–5 m, brown algae, stones, collected by T.A. data, Cuthonella orientosiberica sp. nov. is Korshunova and A.V. Martynov, 25.09.2014. similar to C. hiemalis (Roginskaya, 1987) and External morphology. Body moderately C. soboli Martynov, 1992. However, there are wide. Foot and tail broad. Oral tentacles diÁferences in the denticulation of the central moderate. Rhinophores similar in size to teeth between C. orientosiberica sp. nov. and oral tentacles, smooth to slightly wrinkled. the species C. hiemalis and C. soboli (¤¥gs 12, Dorsal papillae elongate, thick, arranged in 17). The available material was not suitable for continuous rows. Up to 6 pre-anal unbranched molecular study, despite several attempts to ceratal rows. Anal opening acleioproctic. extract . For a morphological comparison Colour (live). Background colour trans- with other Cuthonella species, see table 2. lucent whitish, sometimes slightly yellowish. Digestive gland diverticula brownish to dark Cuthonella osyoro (Baba, 1940) red or violet. Ceratal tips with variously (Figs 1, 2, 14, 20E, 21) expressed red or orange band or spot. On Cuthona osyoro Baba, 1940: 108, ¤¥g. 8 cerata white streaks or dots may be present. Cuthonella osyoro (Baba, 1940) – Martynov, Rhinophores semi-transparent, sometimes 2006b: 290; Martynov, Korshunova, 2011, with white pigment at the top (¤¥g. 14A–G). partim, only the ¤¥g. on page 198. Jaws. Jaws broad, yellowish in colour. Type material. Holotype, lost. Neotype Masticatory processes of jaws covered with a ÌÍÍ Op-743, L = 4 mm length (live), the Sea single row of distinct denticles (¤¥g. 14H, I). of Japan, Spokoinaya Bay, 3–5 m depth, brown Radula. Radula formula 26 × 0.1.0 (specimen algae, stones, collected by T.A. Korshunova 9 mm in length), 24 × 0.1.0 (specimen 8 mm and A.V. Martynov, 25.09.2014. in length). Central tooth elongated with a Other material. ÌÍÍ Op-734, L = c. strongly protracted, pointed non-compressed 15 mm length (preserved, c. 25 mm live), the cusp (¤¥g. 14 J–M). Central tooth bears up to 11 Sea of Japan, Vostok Bay, 0.2–0.4 m, stones, lateral denticles. Cusp clearly delineated from collected by A.V. Martynov, 18.02.1990. ÌÍÍ the adjacent ¤¥rst lateral denticles. Op-606, 1 spec., L = 3 mm length (preserved), Reproductive system. Diaulic. Herma- the Sea of Japan, Spaseniya Bay, 0.3–0.7 m, phroditic duct leads to a relatively short,

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 15 Cuthonella punicea (Millen, 1986). A, living specimen, British Columbia, Plumper Islands, 21 mm (live length), dorsal view. B, living specimen, British Columbia, Plumper Islands, 13 mm (live length), dorsal view. C, living specimen on the hydroid Zyzzyzus rubusidaeus, food object (specimen was not collected). D–F, topotype specimen collected and identi¤¥ed by Sandra Millen, British Columbia, Plumper Islands, ÌÍÍ Op-735, 7 mm (preserved length), dorsal, lateral and ventral views respectively. G, jaw, from specimen 15 mm (Í). H, jaw, details, same. I, jaw, ÌÍÍ Op-735 (Í). J, jaw, details, same. K, anterior part of the radula from specimen 15 mm (Í). L, posterior part of the radula, same (Í). M, anterior part of the radula, ÌÍÍ Op-735 (Í). N, posterior part of the radula, same. Scale bars: G, I, 100 µm; H, 10 µm; J, K, 50 µm; L–N, 20 µm; Photos: A, B, Karin Fletcher, C, Neil McDaniel, D–N, Alexander Martynov.

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    . swollen, convoluted ampulla. Vas deferens painting by Baba (¤¥g. 14G, M) to con¤¥rm the moderately long, without a distinct prostate. identity of this species. In the summertime in the Supplementary gland long, inserts into the intertidal and upper subtidal zones of the Sea of vas deferens a considerable distance from the Japan juveniles of C. osyoro are quite common, elongated penial sheath. Penis conical, unarmed. and therefore Baba (1940) described a juvenile Oviduct connects through the insemination duct of exactly this species from a neighbouring into the female gland complex. Receptaculum location at the Hokkaido coast of the Sea of seminis in a distal position, on a short stalk, Japan. In order to avoid confusion between two rather rounded (¤¥g. 20E). sympatric sister species C. soboli and C. osyoro, Ecology. Lives on stones and rocks. neotype is selected here for C. osyoro (¤¥g. 14A). Intertidal to 20 m depth. The neotype is essentially similar in colouration Distribution. The Northern part of the Sea and size to the ¤¥rst description of C. osyoro and of Japan, Hokkaido, possibly also the Southern was collected in the Sea of Japan across from Kuril Islands. the type locality in Hokkaido. The food objects Remarks. According to the molecular of C. osyoro possibly include athecate hydroids. phylogenetic analysis, Cuthonella osyoro forms For a morphological comparison with other a sister clade with C. soboli and is also a member Cuthonella species, see table 2. of a larger clade which includes C. hiemalis, C. benedykti sp. nov., C. georgstelleri sp. nov., Cuthonella punicea (Millen, 1986) and C. ainu sp. nov. (¤¥gs. 1, 2). The maximum (Figs 1, 2, 15, 20F, 21) intragroup distance in C. osyoro is 1.15%. The Cuthona punicea Millen, 1986: 1356–1358, minimum Ð intergroup distance of 2.89% is ¤¥gs 1–7. found between C. osyoro and C. soboli (table Cuthonella punicea (Millen, 1986) – 1). Cuthonella osyoro diÁfers externally from Martynov, 1992: 23. the closely related species C. soboli (¤¥g. 17) in Non “” pustulata sensu Cella always having red or orange spots or rings on et al., 2016 (= Zelentia nepunicea, see the ceratal tips. This variable-sized reddish or discussion in Korshunova et al., 2017a, 2018b; orange spot at the ceratal tips is present in all misidenti¤¥cation of Zelentia nepunicea with specimens of C. osyoro that we have observed, Cuthonella punicea in Cella et al., 2016). even in small juveniles, which was con¤¥rmed Type material. Holotype. Ð Ì 060327, NE in the present study (¤¥g. 14E, F). However, Paci¤¥c, Canada, British Columbia, Plumper prior to this study C. osyoro specimens were Islands, 50° 36´ N, 126° 49´ W, 13 m depth, sometimes mistaken for C. soboli because the rocks, collected by S.V. Millen, 06.05.1985. pale orange ceratal spot on juvenile C. osyoro Topotypes. ÌÍÍ Op-735, 3 specimens, specimens that were sequenced (¤¥g. 14D, L = 7 mm, 7.2 mm, and 4 mm length (preserved), for example) was inadvertently overlooked NE Paci¤¥c, Canada, British Columbia, Plumper (Korshunova et al., 2017b, 2018a). Islands, 50° 36´ N, 126° 49´ W, 20–22 m, rocks, In the original description, Baba (1940) collected by S.V. Millen, 07.05.1983. KM 765, described a juvenile specimen from Hokkaido 1 specimen, L = 21 mm, NE Paci¤¥c, Canada, which is identi¤¥able by the presence of red British Columbia, Plumper Islands, 8.2–17.7 markings on the ceratal apices and patterns of m, collected by Karin Fletcher, 12.04.2019. KM the radula. In the present study, we specially 766, L = 15 mm, NE Paci¤¥c, Canada, British visited the archive of Baba’s material in Osaka Columbia, Plumper Islands, 8.2–17.7 m, and have presented a copy of the original collected by Karin Fletcher, 12.04.2019.

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 16 Cuthonella sandrae sp. nov. A, living holotype, Matua Island, ÌÍÍ Op-671, 4 mm (preserved length), lateral view. B, C, same, preserved holotype, lateral and ventral views respectively. D, jaw, holotype (Í). E, jaw, details, same. F, anterior part of the radula, holotype (Í). G, posterior part of the radula, same. Scale bars: D, 100 µm; E, 10 µm; F, 20 µm; G, 50 µm; Photos: A, Nadezhda Sanamyan, B–G, Alexander Martynov.

External morphology. Body wider in front gland diverticula from purple to dark wine- than behind. Foot and tail broad. Oral tentacles red,(pomegranate colour). Cerata with moderate. Rhinophores smooth and similar in white spots or streaks on surface. Cerata size or slightly longer than the oral tentacles. with dispersed white tips. Rhinophores Dorsal papillae elongate, arranged in continuous and oral tentacles semi-transparent to light rows. Up to 8 pre-anal partially branched ceratal yellowish and often frosted with varying rows. Anal opening cleioproctic. amounts of white pigment for almost the Colour (live). Background colour pinkish- entire length, or the pigment can form a yellowish white to pale peach. Digestive line (fig. 15A–C).

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    .

Jaws. Jaws broad, yellowish in colour. Sandra Millen in 1983 (¤¥g. 15D–F, I, J, M, N), Masticatory processes of jaws covered with a and con¤¥rm their essential similarity with single row of distinct denticles (¤¥g. 15G–J). the recent specimens collected from the type Radula. Radula formula 12 × 0.1.0 (specimen locality (¤¥g. 15A–C). 7 mm in length), c. 18 × 0.1.0 (spec. 15 mm The profound morphological diÁferences in length). Central tooth elongated with a between this cuthonellid, Cuthonella punicea, strongly protracted, pointed non-compressed and the trinchesiid Zelentia nepunicea have cusp (¤¥g. 15K–N). Central tooth bears up to 7 previously been highlighted (see Korshunova et lateral denticles. Cusp clearly delineated from al., 2017a, 2018b). Those diÁferences combined the adjacent ¤¥rst lateral denticles. with the examination of original topotypes Reproductive system. Diaulic. and fresh material for molecular analysis in Hermaphroditic duct leads to relatively short, this study provide irrefutable evidence that straight, swollen ampulla. Vas deferens long, the synonymy of those two species proposed without a distinct prostate. Supplementary by Cella et al. (2016) is not valid. gland long, inserts into the vas deferens a A cuthonellid from the NW Paci¤¥c (Matua considerable distance from the elongated Island), Cuthonella sandrae sp. nov., with a penial sheath. Penis conical, narrow, unarmed. similar purple colour is a sister species to C. Oviduct connects through the insemination punicea (¤¥gs 1, 2), but diÁfers signi¤¥cantly duct into the female gland complex. Tubular according to genetic distances, molecular receptaculum seminis in a distal position, phylogenetic analysis, external patterns of the without a distinct reservoir (¤¥g. 20F). digestive gland branches and the shape of the Ecology. Lives on soft bottoms with stones radular teeth (¤¥gs 15, 16). at depths of 8–33 m, on or near its hydroid Cuthonella punicea forms the clade sister prey, the large athecate species Zyzzyzus to the clade containing Cuthonella sandrae rubusidaeus Brinckmann-Voss & Calder, sp. nov. and C. abyssicola kryos subsp. nov. 2013 (Millen, 1986; Brinckmann-Voss & (¤¥g. 1). The maximum intragroup distance Calder, 2013). Eggs hatch after 14–15 days as in C. punicea is 0.76%. The minimum Ð planktotrophic veligers. intergroup distance of 6.85% is found between Distribution. Northeast Paci¤¥c, so far only C. punicea and C. sandrae sp. nov (table 1). known from the Plumper Island group located For a morphological comparison with other on the northern end of Vancouver Island, Cuthonella species, see table 2. British Columbia. Remarks. In the present study, molecular Cuthonella sandrae sp. nov. data from recently collected Cuthonella (Figs 1, 2, 16, 21) punicea from the exact type locality of the ZooBank: http://urn:lsid:zoobank.org:act:- Plumper Islands (Canada, British Columbia) F04A4DCF-8A29-45BA-88B7-9749DA6E4C72 is presented for the ¤¥rst time (¤¥gs 1, 2, 21). Type material. Holotype. ÌÍÍ Op-671, According to that molecular phylogenetic 1 spec., L = 4 mm length (preserved), Paci¤¥c data, the species originally described by Ocean, Middle Kuril Islands, Matua Island, Millen (1986) as “Cuthona” belongs to the Klyuv Cape, 14 m depth, collected by N.P. same subclade with the type species of Sanamyan, 20.08.2017. Cuthonella, C. abyssicola, and to a larger clade Etymology. Named in honour of Sandra with all other Cuthonella (¤¥gs 1, 2). We also Violet Millen, a prominent nudibranch examined topotypes originally collected by researcher of North Paci¤¥c nudibranch

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 17 Cuthonella soboli Martynov, 1992. A, living holotype ÌÍÍ Op-736 (adult), the Sea of Japan, Sobol Bay, c. 30 mm (live length) dorsal view. B, living specimen ÌÍÍ Op-605, the Sea of Japan, Spokoinaya Bay, 8 mm, semi-juvenile (live length), dorsal view. C, same specimen on substrate. D, E, second living specimen, from the same location and lot, dorsal and ventral views respectively. F, jaw, ÌÍÍ Op-737 (Í). G, jaw, details, same. H, anterior part of radula, ÌÍÍ Op-737. I, posterior part of the radula, same. J, anterior part of radula, ÌÍÍ Op-605 (Í). K, posterior part of radula, same. Scale bars: F, 200 µm; G, H, 50 µm; I, J, 30 µm; K, 10 µm; Photos: A, F–K, Alexander Martynov, B–E, Tatiana Korshunova. molluscs. Most remarkably, in the present continuous rows. Up to c. 7 pre-anal branched study we discovered a new species from ceratal rows. Anal opening cleioproctic. the Kuril Islands which is a sister species to Colour (live). Background colour semi- Cuthonella punicea (Millen, 1986) previously transparent white with purple-bluish areas. described by Sandra Millen from British Digestive gland diverticula in the cerata Columbia, and which is similar to the new violet-purple. Ceratal tips with dispersed species in its reddish-purple colouration white pigment and bluish hue. Rhinophores (¤¥g. 15A–C) but with substantial genetic and semi-transparent with sparse white pigment radular diÁferences. at the top (¤¥g. 16A). External morphology. Body moderately Jaws. Jaws broad, yellowish in colour. wide. Foot and tail broad. Oral tentacles Masticatory processes of jaws covered with a moderate. Rhinophores similar in size to single row of distinct denticles (¤¥g. 16D, E). oral tentacles, smooth to slightly wrinkled. Radula. Radula formula 12 × 0.1.0 (specimen Dorsal papillae elongate, thick, arranged in 4 mm in length). Central tooth elongated

 %  !  !    $ !%  $!"#&     & Ô 10.1163/18759866-10017 |    . with a strongly protracted, pointed non- on page 197, excluding the ¤¥gure on page 198 compressed cusp (¤¥g. 16F, G). Central tooth (C. osyoro). bears up to 8 lateral denticles. Cusp relatively Type material. Holotype. ÌÍÍ Op-736, unclearly delineated from the adjacent ¤¥rst L = c. 30 mm (live), The Sea of Japan, Sobol lateral denticles. Bay, intertidal, stones, 03.03.1992. Paratype. Reproductive system is underdeveloped in ÌÍÍ Op-737, L = 15 mm length (preserved), the holotype and not suitable for a detailed The Sea of Japan, Sobol Bay, 0.2–0.7 m depth, study. stones, collected by A.V. Martynov, 05.02.1992. Ecology. Lives on soft bottoms with stones Other material: ÌÍÍ Op-605, 2 spec., at 14 m depth. L = 8 mm length (live), The Sea of Japan, Distribution. Matua Island, Middle Kuril Spokoinaya Bay, 3–5 m depth, brown algae, Islands. stones, collected by T.A. Korshunova and A.V. Remarks. According to the molecular Martynov, 25.09.2014. phylogenetic analysis, Cuthonella sandrae External morphology Body moderately sp. nov. is closest to C. punicea (Millen, wide. Foot and tail broad. Oral tentacles 1986) and C. abyssicola kryos (¤¥gs 1, 2). The moderate. Rhinophores similar in size, or minimum Ð intergroup distance of 6.85% slightly longer than oral tentacles, smooth to is found between C. sandrae sp. nov. and C. slightly wrinkled. Dorsal cerata elongate, thick, punicea (Table 1). Morphological analysis arranged in continuous rows. Up to 6 pre-anal and molecular analysis reveal considerable ceratal rows. Anal opening acleioproctic. diÁferences between C. sandrae sp. nov. and Colour (live). Background colour yellowish any other species of the genus Cuthonella, white. Digestive gland diverticula in cerata including the externally similar C. punicea from light brownish and sandy to tobacco- and (¤¥g. 15). Particularly in C. sandrae sp. nov. a dark-brown. Basal parts of cerata commonly continuous series of small branches of the darker. White spots or streaks on the ceratal digestive gland forms between the anterior external surface. Ceratal tips colourless or and posterior parts of the digestive gland with dispersed white pigment. Rhinophores even at a relatively small size. In contrast, semi-transparent to light yellowish and C. punicea has a rather linear, only weakly orange ochre with indistinct to dispersed branched digestive gland which does not form white pigment on the top (¤¥g. 17A–E). a continuous row in between the anterior and Jaws. Jaws broad, yellowish in colour. posterior parts of the digestive gland even at a Masticatory processes of jaws covered with a considerably larger size. The radular patterns single row of distinct denticles (¤¥g. 17F, G). between C. punicea and C. sandrae sp. nov. are Radula. Radula formula 28 × 0.1.0 (specimen also considerably diÁferent (¤¥gs 15M, N and 15 mm in length), 24 × 0.1.0 (specimen 8 mm 16F, G). For a morphological comparison with in length). Central tooth elongated with a other Cuthonella species, see table 2. strongly protracted, pointed non-compressed cusp (¤¥g. 17H–K). Central tooth bears up to 10 Cuthonella soboli Martynov, 1992 lateral denticles. Cusp clearly delineated from (Figs 1, 2, 17, 20G, 21) the adjacent ¤¥rst lateral denticles. Cuthonella soboli Martynov, 1992: 18–23, ¤¥gs Reproductive system. Diaulic. Herma- 1–3; Martynov, 2006b: 290; Martynov, 2015b: phroditic duct leads to a moderately 80; Martynov & Korshunova, 2011: 197–198, ¤¥g. long, swollen ampulla. Vas deferens

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 Ô

Ñ ½ 18 Cuthonella vasentsovichi sp. nov. A, living holotype ÌÍÍ Op-738, Matua Island, 21 mm (preserved length), dorsal view. B, C, preserved holotype, lateral and ventral views respectively. D, jaw, paratype ÌÍÍ Op-739, Matua Island (Í). E, jaw, details, same. F, anterior part of the radula, paratype (Í). G, posterior part of the radula, same. Scale bars: D, 500 µm; E, F, G, 50 µm; Photos: A, Nadezhda Sanamyan, B– G, Alexander Martynov. moderately long, without a distinct prostate. Ecology. Stones, rocks. Intertidal to c. 10 m Supplementary gland long, inserts into the depth. Veligers exhibit direct development or vas deferens a considerable distance from a shortened planktonic stage. the elongated penial sheath. Penis conical, Distribution. The northern part of the Sea unarmed. Oviduct connects through the of Japan, possibly also the Southern Kuril insemination duct into the female gland Islands and Hokkaido. complex. Receptaculum seminis in a distal Remarks. According to the molecular position, on a moderately long stalk, pear- phylogenetic analysis, Cuthonella soboli shaped (¤¥g. 20G). Martynov, 1992 forms a separate clade sister

 %  !  !    $ !%  $!"#&     & Ô 10.1163/18759866-10017 |    . to the C. osyoro clade (¤¥gs 1, 2). The minimum also repressed earlier in the tsar’s Russian Ð intergroup distance of 2.89% is found Empire. between C. soboli and C. osyoro (Table 1). External morphology. Body wide. Foot Externally C. soboli diÁfers from the closely and tail broad. Oral tentacles moderate. related species C. osyoro by the absence of any Rhinophores similar in size to oral tentacles, reddish or orange spots on the cerata (¤¥g. 17). smooth to slightly wrinkled. Dorsal papillae Morphological analysis reveals considerable numerous, elongate, thick, arranged in diÁferences in the denticulation of the continuous rows. Up to 10 (or more) pre-anal central teeth between C. hiemalis, C. osyoro, branched and unbranched ceratal rows. Anal C. soboli, and the type species of the genus opening cleioproctic. Cuthonella, C. abyssicola s.l. (¤¥gs 4, 5, 12, 14, Colour (live). Background colour greyish. 17). Reproduction occurs in the wintertime. Digestive gland diverticula in cerata greyish The food objects of C. soboli possibly include to light greenish. Ceratal tips yellowish. athecate hydroids (Martynov & Korshunova, Rhinophores dark yellowish, without distinct 2011). For a morphological comparison with white pigment at the top (¤¥g. 18A). other Cuthonella species, see table 2. Jaws. Jaws moderately broad, yellowish in colour. Masticatory processes of jaws covered Cuthonella vasentsovichi sp. nov. with a single row of denticles (¤¥g. 18D, E). (Figs 1, 2, 18, 20H, 21) Radula. Radula formula 40 × 0.1.0 ZooBank: http://urn:lsid:zoobank. (specimen 15 mm in length). Central tooth org:act:B49EBF1D-8E9F-4743-9F13- elongated with a strongly protracted, pointed 860063D7FA9C non-compressed cusp (¤¥g. 18F, G). Central Type material. Holotype. ÌÍÍ Op-738, tooth bears up to 9 lateral denticles. Cusp L = 21 mm length (preserved), Paci¤¥c Ocean, clearly delineated from the adjacent ¤¥rst Middle Kuril Islands, Matua Island, Klyuv lateral denticles. Cape, 14 m, collected by N.P. Sanamyan, Reproductive system. Diaulic. Herma- 20.08.2017. phroditic duct leads to a relatively short, Paratype. ÌÍÍ Op-739, L = 15 mm length partially swollen, convoluted ampulla. (preserved), Paci¤¥c Ocean, Middle Kuril Vas deferens moderate in length, without Islands, Matua Island, Klyuv Cape, 14 m, a distinct prostate. Supplementary gland collected by N.P. Sanamyan, 20.08.2017. relatively short, inserts into the vas deferens Etymology. Named in honour of Vladislav a considerable distance from the elongated Konstantinovich Vasentsovich (1898–1961). penial sheath. Penis conical, unarmed. Oviduct He was a Division Commander in the Soviet connects through the insemination duct into Far East before êê and was repressed the female gland complex. Receptaculum during Stalin’s Great Purge, imprisoned for seminis in a distal position, on a short stalk, 15 years and freed only a few years before his oval (¤¥g. 20H). death (Milbakh, 2003). Vladislav Vasentsovich at 14 m depth. is a relative of one of the authors of this article Distribution. Matua Island, Middle Kuril (Í). The name was also chosen because the Islands. Kuril Islands (type locality of the new species) Remarks. The maximum intragroup belongs to the Russian Far East region and distance in C. vasentsovichi is 0.15%. The for the additional cultural intersection with minimum Ð intergroup distance of 9.28% Benedykt Dybowski, who like Vladislav is found between C. vasentsovichi sp. nov.

Vasentsovich, was of a Polish origin and was sp. nov. and C. concinna %  ! concinna  !    (table 1). $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 Ô

Ñ ½ 19 Reproductive systems of the genus Cuthonella. A, Cuthonella abyssicola abyssicola; B, Cuthonella abyssicola kryos subsp. nov.; C, Cuthonella ainu sp. nov.; D, Cuthonella benedykti sp. nov.; E, Cuthonella concinna concinna; F, Cuthonella concinna bellatula subsp. nov. Abbreviations: a, ampulla; fgm, female gland mass; fo, female opening; ps, penial sheath; rs, receptaculum seminis; sg, supplementary gland; vd, vas deferens.

By a combination of morphological ceratal rows makes C. vasentsovichi sp. nov. characters Cuthonella vasentsovichi sp. nov. partially resemble Cuthonella abyssicola readily differs from any previously described s.l. (figs 4, 5), but C. vasentsovichi differs Cuthonella species. Morphological analysis in having a broader body with greyish to also reveals considerable differences in the greenish colouration instead of reddish denticulation of the central teeth between or light pinkish, and by the morphology C. vasentsovichi sp. nov. (fig. 18) and any of its radula and reproductive system. related species, e.g., C. ainu sp. nov., C. denbei Such multilevel differences between the sp.nov., C. hiemalis, and others from this new species and the type species are clade (figs 6, 7, 10–12, 14, 17). Externally C. remarkable and align well with the recently vasentsovichi sp. nov. differs from all known proposed scheme of multilevel organismal species of the genus Cuthonella by a peculiar diversity (Korshunova et al., 2019b). For “shaggy” appearance of numerous, densely a morphological comparison with other placed cerata (fig. 18A). The large number of Cuthonella species, %  see! table  ! 2.    $ !%  $!"#&     & ÔÔ 10.1163/18759866-10017 |    .

Ñ ½ 20 Reproductive systems of the genus Cuthonella. A, Cuthonella denbei sp. nov.; B, Cuthonella georgstelleri sp. nov.; C, Cuthonella hiemalis; D, Cuthonella orientosiberica sp. nov.; E, Cuthonella osyoro; F, Cuthonella punicea; G, Cuthonella soboli; H, Cuthonella vasentsovichi sp. nov. Abbreviations: a, ampulla; fgm, female gland mass; fo, female opening; ps, penial sheath; rs, receptaculum seminis; sg, supplementary gland; vd, vas deferens.

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 Ô Distribution Atlantic North and Sub-arctic, commonly at shelf and depths bathyal 1000 m) (up to High latitude shallow Arctic, waters Rece- ptaculum seminis long On a very stalk, tubular, widened in middle part with a small reservoir oval long On a very stalk, tubular, widened basally, with a small pear-shaped reservoir supplementary gland, vas and deferens penis Long, inserts into Long, inserts into deferens a long vas at a considerable distance from penial sheath. conical, Penis unarmed strong, Long, inserts into deferens a long vas at a considerable distance from penial sheath. conical, Penis unarmed strong, Long, moderately swollen, convoluted Long, moderately swollen, convoluted Central teethCentral Ampulla of Patterns denticles, denticles, rarely which are Cusp clustered. clearly is rather from delineated the adjacent denticles lateral which do not of top reach the teeth c. 36 up to have denticles, lateral clustered often and increasingly towards irregular Cusp the cusps. is not clearly from delineated the adjacent denticles lateral reach which may oftop the cusp Radula formula (max) of anterior ofbranches gland digestive (max) and its pattern 17, branched17, 21 × 0.1.0 14 lateral Up to branched17, × 0.1.0 27 teeth Central Cerata colourationCerata Number Possibly reddish to to reddish Possibly pinkish, tips without distinct spots or bands of opaque white pigment Light pinkish to whitish, tips with dispersed white (max) 30 mm (preserved) 25 mm (preserved)  2  Morphological comparison of the species of Cuthonella the genus Species Body length C. abyssicola C. abyssicola abyssicola Bergh, 1884 kryos C. abyssicola nov. subsp.

 %  !  !    $ !%  $!"#&     & Ô 10.1163/18759866-10017 |    . Distribution Middle Kuril Islands, waters shallow Kamchatka, waters shallow Rece- ptaculum seminis On a short stalk, elongate-oval On a short stalk, oval supplementary gland, vas and deferens penis Long, inserts into a Long, inserts into deferens short vas at a short distance penial from sheath. Penis conical, unarmed short, Relatively a inserts into long moderately at deferens vas a short distance penial from sheath. Penis conical, unarmed Relatively Relatively short, slightly bent, swollen Relatively short, swollen Central teethCentral Ampulla of Patterns lateral denticles, denticles, lateral cusp well delineated denticles, lateral cusp well delineated Radula formula (max) of anterior ofbranches gland digestive (max) and its pattern 5, unbranched 18 × 0.1.0 7 distinct Up to 5, unbranched 36 × 0.1.0 5 distinct Up to Cerata colourationCerata Number Brownish to light to Brownish tips ceratal orange, with opaque white spot with darker Brownish brown to reddish tips with hue, ceratal ring, opaque white sometimes with ring additional yellow (max) 4 mm (preserved) 6 mm (preserved) Species Body length sp. nov. C. ainu sp. C. benedykti nov. sp.  2  Morphological comparison of the species of.) Cuthonella ( Contd the genus

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 Ô Distribution NE Paci¤¥c, California, waters shallow Atlantic North (both sides), waters shallow Rece- ptaculum seminis On short stalk, rounded On a short stalk, without distinct in a reservoir, proximal more position supplementary gland, vas and deferens penis Short, reportedly Short, reportedly the inserts into penis (Williams & but 1979), Gosliner, without further con¤¥rmation. Unarmed penis reported was as possessed a base, broadened which could conceal potentially the distalmost part of deferens the vas long or Relatively inserts shorter, a relatively into deferens long vas short at a relatively distance from penial sheath. conical, Penis unarmed Long, moderately swollen, convoluted Relatively short or folded, swollen Central teethCentral Ampulla of Patterns lateral denticles, denticles, lateral cusp well delineated denticles, lateral cusp not well delineated Radula formula (max) of anterior ofbranches gland digestive (max) and its pattern 4, unbranched 39 × 0.1.0 5 distinct Up to 6, unbranched 30 × 0.1.0 10 distinct Up to Cerata colourationCerata Number reddish-brown to dark to reddish-brown tips brown, chocolate with opaque white spot tips with brown, opaque white subapical band or spot with a bluish hue (max) 15 mm (live) deep brown, Dark 20 mm (live) purplish- to Brown Species Body length C. cocoachroma (Williams & 1979) Gosliner, C. concinna (Alder & concinna Hancock, 1843)

 %  !  !    $ !%  $!"#&     & Ô 10.1163/18759866-10017 |    . Chukchi Sea Chukchi oÁfWrangel Island region, waters shallow Distribution NE Paci¤¥c Alaska from California, to waters shallow Middle Kuril Islands, waters shallow On a very long On a very stalk, small, drop-shaped Rece- ptaculum seminis On a short stalk, with only distinct weakly in a reservoir, proximal more position On a short stalk, pear-shaped Short, inserts long a very into at deferens vas a considerable distance from penial sheath. wide, very Penis unarmed, but with triangular several papillae around opening supplementary gland, vas and deferens penis Short, inserts a short vas into at a deferens long relatively distance from penial sheath. conical, Penis unarmed short, Relatively ainserts into longmoderately at a deferens vas long distance from penial sheath. Penis conical, unarmed Consists of few short reservoirs Relatively Relatively short, bent, swollen Relatively short, swollen Central teethCentral Ampulla of Patterns denticles, lateral cusp not well delineated lateral denticles, denticles, lateral cusp well delineated denticles, lateral cusp well delineated Radula formula (max) 26 × 0.1.0 7 distinct Up to of anterior ofbranches gland digestive (max) and its pattern 4, unbranched × 0.1.0 17 5 distinct Up to 6, unbranched × 0.1.0 19 7 distinct Up to and 15, branched unbranched Cerata colourationCerata Number reddish, orange, to grayish-purple with blackish, often or white few scattered tips with bluish spots, spots or opaque white band dark- to Brownish tips with ring- reddish, shaped opaque white pigment Unknown 15 mm (live) Pinkish, brownish- 7 mm (preserved) 45 mm (preserved) (max)  2  Morphological comparison of the species of.) Cuthonella ( Contd the genus C. concinna C. concinna bellatula nov. subsp. nov. C. denbei sp. C. elenae 2000 Martynov, Species Body length  %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 Ô Middle Kuril Middle Kuril Islands, waters shallow Sea, White waters shallow East Siberian Sea, Laptev Sea, shallow waters Distribution On a long stalk, compressed On a long stalk, massive oval On a short stalk, oval Rece- ptaculum seminis Long, inserts into Long, inserts into long a moderately at deferens vas a considerable distance from penial sheath. conical, Penis unarmed Long, inserts into deferens long vas at a considerable distance from penial sheath. conical, Penis unarmed Long, inserts into long a moderately at deferens vas a considerable distance from penial sheath. conical, Penis unarmed supplementary gland, vas and deferens penis Relatively Relatively short, swollen Relatively long, folded, non-swollen Relatively long, slightly folded, swollen lateral denticles, denticles, lateral cusp well delineated denticles, lateral cusp well delineated Central teethCentral Ampulla of Patterns denticles, lateral cusp well delineated Radula formula (max) 30 × 0.1.0 10 distinct Up to 7, unbranched × 0.1.0 23 12 distinct Up to 6, unbranched 28 × 0.1.0 9 distinct Up to of anterior ofbranches gland digestive (max) and its pattern 8, unbranched plus few branched dark brown, tips with dark brown, peculiar opaque bluish subapical band or spot, without opaque pigment white to Light brownish in juveniles yellowish dark to and brownish tips in adults, brown whitish Cerata colourationCerata Number Light orange-brownish and salmon-brownish dark, intensive to tips reddish, brownish opaque with extended band or spot white 26 mm (live) to dark beige From 4 mm (preserved) 14 mm (preserved) (max) C. hiemalis 1987) (Roginskaya, C. orientosiberica nov. sp. C. georgstelleri nov. sp. Species Body length

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    . NE Paci¤¥c, so NE Paci¤¥c, only far known British from Columbia, waters shallow Islands, waters shallow Distribution The Sea of and Japan neighbouring shallow waters, waters On a moderately long stalk, elongate Rece- ptaculum seminis On short stalk, rounded Long, inserts into Long, inserts into deferens a long vas at a considerable distance from penial sheath long, narrow, Penis unarmed supplementary gland, vas and deferens penis Long, inserts into Long, inserts into long a moderately at deferens vas a considerable distance from penial sheath. conical, Penis unarmed Relatively Relatively long, swollen Unknown Unknown Unknown Middle Kuril Moderately Moderately short, bent, swollen lateral denticles, denticles, lateral cusp relatively unclear from delineated the adjacent ¤¥rst denticles. lateral Central teethCentral Ampulla of Patterns denticles, lateral cusp clearly from delineated the adjacent ¤¥rst denticles lateral lateral denticles, denticles, lateral cusp well delineated Radula formula (max) 20 × 0.1.0 7 distinct Up to 7, branched 12 × 0.1.0 8 distinct Up to of anterior ofbranches gland digestive (max) and its pattern 6, unbranched 26 × 0.1.0 11 distinct Up to and 8, branched unbranched Violet-purple, tips with Violet-purple, and dispersed white bluish hue Cerata colourationCerata Number or violet, tips with expressed variously band or or orange red surface spot, on ceratal or dots streaks white be present may wine-red, with white tips spots or streaks, with dispersed white 4 mm (preserved) (max) 23 mm (live)23 mm dark red to Brownish 24 mm (live) dark purple to From  2  Morphological comparison of the species of.) Cuthonella ( Contd the genus nov. sp. C. sandrae Species Body length C. osyoro (Baba, 1940) C. punicea (Millen, 1986)  %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017  Middle Kuril Middle Kuril Islands, waters shallow The Sea of and Japan neighbouring shallow waters, waters Distribution On a short stalk, oval On a moderately long stalk, pear-shaped Rece- ptaculum seminis Relatively short, Relatively a inserts into long moderately at deferens vas a considerable distance from penial sheath. conical, Penis unarmed Long, inserts into Long, inserts into long a moderately at deferens vas a considerable distance from penial sheath. conical, Penis unarmed supplementary gland, vas and deferens penis Relatively Relatively short, partially swollen Moderately Moderately long, slightly bent, swollen lateral teeth, cusp teeth, lateral delineated well Central teethCentral Ampulla of Patterns denticles, lateral cusp well delineated 40 × 0.1.0 9 distinct Up to Radula formula (max) 29 x 0.1.0 10 distinct Up to 10(+), branched 10(+), branched and unbranched of anterior ofbranches gland digestive (max) and its pattern (in unbranched, 6, some specimens a few can be branched) Greyish to light to Greyish tips greenish, yellowish Cerata colourationCerata Number and sandy to tobacco- tobacco- and sandy to basal and dark-brown, part commonly darker, spots or streaks white external on ceratal surface, tips colourless or with dispersed pigment white 21 mm (preserved) (max) 30 mm (live) light brownish From C. vasentsovichi nov. sp. Species Body length C. soboli 1992 Martynov,  %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    .

Discussion temperate conditions of the North Atlantic and the NE Paci¤¥c respectively, compared Cold-water biodiversity hotspot: the to the very cold NW Paci¤¥c (including the Cuthonella case Kuril Islands), where negative sea water In the past ¤¥ve years, our knowledge of the temperatures can occur in the wintertime. nudibranch fauna of the Arctic Sea and The Kuril Islands group, including Matua the Northwest Paci¤¥c Ocean has advanced Island, are a chain of active volcanic islands substantially (e.g., Martynov et al., 2015a, b, (e.g., Blokh et al., 2018). They are located on 2020b; Korshunova et al., 2016a, b, 2017a, c, the edge of the continental shelf and are in 2018a, b). Prior to that, Cuthonella species the conçèuence of the southward çèowing from these areas, such C. hiemalis and C. soboli, Oyashio current and the Western Subarctic were shown to have direct development, i.e. gyre (Qiu, 2001). Matua is a small island, only without a planktonic stage (Roginskaya, 1987; about 11 × 6.5 km, essentially just the top of a Martynov, 1992). Although we have no data volcano. for the developmental patterns of our newly Five new species (C. ainu sp. nov., C. denbei described species from the NW Paci¤¥c, ¤¥ve of sp. nov., C. georgstelleri sp. nov., C. sandrae them belong to the same clade as C. hiemalis sp. nov. and C. vasentsovichi sp. nov., see and C. soboli according to our molecular data descriptions above, ¤¥gs 1, 2, 6, 10, 11, 16, 18, (¤¥gs 1, 2). Therefore, it is plausible to suggest 21) were discovered in the shallow waters of that these species may also have direct or a this island, plus the new species C. benedykti shortened planktonic development as they sp. nov was discovered from a neighbouring inhabit essentially the same cold-water Kamchatka locality (¤¥gs 7, 21). This peculiar environment. Direct development implies geologic composition and the geographic limited dispersal capabilities, and hence position between the warm Japanese waters more opportunities to form separate species. with abundant fauna, the Arctic sea, and the For other marine invertebrates, an increasing oceanic currents, supports a high abundance rate of speciation has been linked to direct of marine life and active speciation. development (e.g., Hurtado et al., 2017). We therefore suggest that the cold- Thorson (1950), in his study of the water biodiversity hotspot exempli¤¥ed by reproductive and larval ecology of marine the cuthonellids is a result of the special bottom invertebrates, concluded that direct biogeographic conditions coupled with or other non-feeding development is the direct development among some species. dominate reproductive mode in polar waters. Because several Cuthonella species occur Therefore, a higher proportion of direct- sympatrically in a restricted area, we suggest development nudibranch species might that they could have originated by a direct- be found in cold-water and polar regions. development-driven evolution in isolated Although “Thorson rule” has been contested, narrow areas in relatively remote parts of the recent broad-scale analyses con¤¥rm its middle Kuril Islands and adjacent regions. In validity in several groups (e.g. Fassio et al., contrast, for the North Atlantic subspecies 2019). Alternately, planktonic development from temperate waters such as C. concinna has been noted for C. concinna s.l., C. concinna, planktonic development has been cocoachroma and C. punicea (Thompson & documented (Roginskaya, 1987; Martynov Brown, 1984; Goddard, 1992; Millen, 1986), & Korshunova, 2011). This suggests a case however these three species occur in relatively of allopatric speciation between the North

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 21 World map showing the distribution of Cuthonella species. Coloured symbols are indicated on the ¤¥gure.

Atlantic C. concinna concinna and its sister NE 1977), especially after the genus Cuthonella Paci¤¥c subspecies C. concinna bellatula subsp. was synonymized with the genus Cuthona nov. Allopatric speciation has previously been (Millen, 1986). After 1986, Cuthonella was well documented from various species of replaced by Cuthona Alder & Hancock, 1855 nudibranchs (e.g., Korshunova et al., 2018b, in descriptive papers and guide books (e.g., 2020a). The reasons why the biodiversity Behrens & Hermosillo, 2005). However, in hotspot for cuthonellids in the Middle Kuril 1992 it was shown that the genus Cuthonella Islands has not been recognised before can be diÁfers considerably from the genus Cuthona explained by both insuÁ¤¥cient sampling and and from any other genera of the traditional a de¤¥cit of taxonomic reviews for this region. tergipedids according to the morphology of the reproductive system and so it was considered of Cuthonella: a morphological a valid taxon (Martynov, 1992, 2002, 2006b; prediction and molecular conrmation Martynov & Korshunova, 2011) (¤¥g. 22A). The genus Cuthonella Bergh, 1884 was until Only since the work of Martynov (1992) quite recently only considered valid by a few was a diagnosis for the genus provided which authors (e.g., Odhner in Franc, 1968; Miller, characterized the genus (¤¥g. 22A). The genus

 %  !  !    $ !%  $!"#&     & Ô 10.1163/18759866-10017 |    .

Cuthonella was expanded to encompass families Cuthonidae and Cuthonellidae. The not only the deep-sea type species, but also second is that the supplementary gland in shallow-water species such as C. concinna s.l., C. cocoachroma in reality inserts into the vas C. hiemalis, C. punicea and C. soboli. Recently, deferens, but closer to the penis, and this was the validity of the genus Cuthonella was missed by Williams & Gosliner (1979). Except supported by molecular phylogenetic studies for this detail, the genus Cuthonella appears (Korshunova et al., 2017b, 2018a; Martynov et to be very consistent internally among all al., 2020a), albeit with few species involved. examined species, with the presence of an In the present study, we con¤¥rm the validity unarmed penis and protruding radulae cusps and monophyly of the genus Cuthonella by in most of the species. involving a considerably broader species External morphological features vary diversity of the genus (¤¥gs 1, 2, 21). This is the considerably within the species of the genus largest expansion of the number of species Cuthonella. The type species, Cuthonella of the genus Cuthonella since 1992 and one abyssicola s.l., and some species such as of the largest recent expansions of described C. sandrae sp. nov. and C. punicea, possess diversity among northern nudibranchs. branched anterior ceratal rows and may have Here we present novel molecular data a cleioproctic anus. Instead, other species, for a species that is morphologically similar such as C. ainu sp. nov., C. benedykti sp. nov., C. to C. abyssicola, the type species of the hiemalis, C. concinna s.l., C. soboli, and C. osyoro, genus Cuthonella. It is separated here as C. possess unbranched anterior ceratal rows abyssicola kryos subspec. nov. This subspecies and an acleioproctic anus. The correlation of clusters together with other species included these features with molecular phylogenetic in this study, forming a well-supported data is quite a mosaic (¤¥gs 1, 2, 4 –9, 14, 17), monophyletic group (¤¥g. 1). In total, we so at this stage we have not separated more obtained and analysed molecular data for 13 genera, but retained just the one the genus of the 15 currently recognised species of the Cuthonella within the family Cuthonellidae, genus. For all species of Cuthonella, except for though with more data more genera will C. cocoachroma (which was unavailable for our most likely be necessary. Therefore, we do morphological study), we con¤¥rmed that the not synonymise the previously established supplementary gland in the male part of the subgenus Fiocuthona with the type species reproductive system is inserted into the vas C. concinna s.l. (Martynov, 1992) or further deferens instead of the penis. Hence, this is a diÁferentiating the taxonomic structure of the well-supported morphological synapomorphy family Cuthonellidae pending more data from for the genus Cuthonella. For C. cocoachroma, other species. Williams & Gosliner (1979) reported that the In total, the species diversity within the supplementary gland inserts into the penis genus Cuthonella has now increased over instead of the vas deferens. Since the insertion of threefold, from ¤¥ve valid species (Martynov, the supplementary gland into the vas deferens 1992) plus two which are veri¤¥ed here as is a very stable morphological character among synonyms, C. marisalbi (Roginskaya, 1963) and species in the genus Cuthonella according to C. distans (Odhner, 1922), to the current 15 our data, there are at least two possibilities species and two subspecies (¤¥gs 1, 2, 21), for C. cocoachroma. The ¤¥rst is that in this thus con¤¥rming the phylogenetic pattern of species, a supplementary gland inserting the almost 30-year-old prediction based on into the penis has evolved in parallel to the morphology (Martynov, 1992).

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Ñ ½ 22 Discussion of the radula characters and ¤¥ne-scale diagnostics in the taxonomy of the former “tergipedid” families. A. Taxonomic composition of the tergipedid aeolidacean nudibranchs before 2016. B. A ‘superlumping’ aggregation of the “family sensu latissimo” (Cella et al., 2016; Epstein et al., 2019) lacking morphological apomorphies. C. Modern ¤¥ne-scale tergipedid taxonomy that integrates molecular data and provides morphological apomorphies for several separate families and genera (Korshunova et al., 2017a, b; 2018a,b, 2019a, b; Mehrotra et al., 2020). The crossed-out taxon names signify a change in the genus status, the normally displayed names signify valid taxa at every consequential level of the history of the taxonomy of this group. All drawing schemes and Í images are original.

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    .

Fine-scale diferentiation of the family more genera. The old notion that if genera Cuthonellidae have some putative overlap of morphological One practical question should be particularly patterns (Mayr, 1969; Gosliner & GriÁ¤¥ths, addressed in respect to the revision of the 1981) they should be merged into a single large genus Cuthonella. Marcus (1958) noted that genus, without morphological apomorphies the degree of protrusion of the central cusp (¤¥g. 22B), is counterproductive to phylogenetic of the radular teeth can vary within the same investigation. species among the traditional “tergipedid” Obviously, with such an approach an group. Recently, Korshunova et al. (2017a) integrative taxonomy involving morphology demonstrated that various genera or groups and molecular analysis will be contradictory. of genera, particularly within the family We have already clearly demonstrated this fact , have their own peculiar for the “superlumping” concept of the “family patterns of radular teeth, not just because of Fionidae” s.l. (¤¥g. 22), which has no reliable the degree of the relative height of the central morphological apomorphies (see discussion cusp and lateral teeth, but also because of in Korshunova et al., 2017a). Only narrower, patterns that integrate several speci¤¥c traits. more ¤¥nely de¤¥ned taxa of genus- and family For example, the genera Trinchesia s.str. and groups can be used to integrate morphological Diaphoreolis have arch-shaped teeth with the and molecular data (Korshunova et al., 2017b, central cusp similar in length to the central 2020a, b, c) (¤¥g. 22C). teeth. The genus , as another example, These integrative arguments were not has a central cusp, not just lower than the understood and were contradicted recently lateral denticles but strongly retracted, making and labelled “cumbersome” and based on the general shape of the teeth a distinctive “dubious, minor characters” by Epstein et al. trait (¤¥g. 22). The genus also has a (2019). Notably, it was a reverse reiteration of the special combination of long needle-like teeth argument from our previous study (Martynov, and a lower central cusp covered with smaller 1992) regarding the genus Cuthona: “if (one) denticles (¤¥g. 22). None of these trinchesiid does not intend to create a cumbersome, radular patterns show similarity to those of the unnatural genus Cuthona, it is necessary to family Cuthonellidae and the genus Cuthonella apply a less lumping approach than what has (¤¥g. 22B). The genus Tenellia s.str. (the family been applied by most of the recent authors” Trinchesiidae, ¤¥g. 22C) has a peculiar tooth (translated from Russian; Martynov, 1992: 23). shape, displaying only little variation, contrary Further molecular analysis (see discussions in to the statement in Epstein et al. (2019). Korshunova et al., 2017a, 2018a, b, c; Martynov According to the molecular phylogenetic et al., 2020a) con¤¥rmed the conclusions of data, the family Cuthonellidae forms a well- that almost 30-year-old study. The “Cuthona supported clade, which is only distantly sensu lato” was revealed as a large polyphyletic related to the Trinchesiidae (Korshunova assemblage and Cuthona s.str. was then et al., 2017b, 2018a; Martynov et al., 2019, limited to only a few morphologically similar 2020a). When more of the diversity within the species. Importantly, the genus Cuthonella was essentially tropical Trinchesiidae and cold- shown to be neither closely related to Cuthona water Cuthonellidae will be investigated, with nor Trinchesia. When de¤¥ning the characters successively ¤¥ner diÁferentiated characters of the “family Fionidae sensu latissmo” Cella and an increasing number of monophyletic et al. (2016) (¤¥g. 22B) used characters that subclades, it will be necessary to establish are not present in the type genus , like a

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017  penial gland, and hence the real Fionidae s.str. is pointless to make a classi¤¥cation using has a reproductive system as well as patterns only radular characters and to argue that if of external morphology that are drastically radulae among some taxa demonstrate some diÁferent from any other “”. In similarities or similar variabilities these taxa table 3 of our 2017 study (Korshunova et al., must automatically be synonymized. 2017a) we mentioned the relative height of Instead, every taxon at the family- and the central cusp and formally described the genus-level demonstrates a complicated diÁferences in the shape of the teeth along multilevel mosaic of morphological characters with several other characters, and thus did (including potentially a big disparity between not build a classi¤¥cation solely on a single characters of diÁferent organ systems) character. Moreover, Eubranchidae have and molecular features. Any diagnosis a triserial radula, have radula that professes to encompass a complex with fused teeth, and both conditions are evolutionary history in a classi¤¥cation must very diÁferent from the uniserial radula of be based on such multilevel diÁferences, and Cuthonella (¤¥g. 22C). Furthermore, Epstein not on simplistic binary alternatives such as et al. (2019) based their arguments on an older “presence” or “absence”, “lower” or “higher” or drawing based on light microscopy studies in on an overestimated “variability”. Williams & Gosliner (1979, ¤¥g. 5) without any Recently, the obvious problems of the additional Í study. ‘superlumping’ approach were revealed within To present modern comparative the large aeolidacean group in which a very morphological data, in this study we complex molecular pattern was shown to be made a thorough Í investigation of aligned with an extremely mosaic distribution a majority of the species of the genus of morphological characters (Korshunova et Cuthonella (¤¥gs 4–18). We specially show al., 2017b, 2019a, b; Martynov et al., 2020a). In that in some species of Cuthonella, e.g., conclusion, to have a ‘superlumping’ name for C. concinna s.l., C. denbei sp. nov., and such a group, one has to go much further than to C. osyoro, the relative height of the central cusp unite many disparate taxa into a single “family and lateral denticles can vary to some degree Fionidae” but to unite all order-level diversity of between the anterior and posterior teeth (¤¥gs the Aeolidacea into a single family, Aeolidiidae. 8O–R, 10G –I, 14J–L), but they never attain any This would lead to a morphologically non similarity in the general radular pattern to any ¤¥nely diagnosable group, with only the most of the trinchesiid genera (¤¥g. 22). general potential apomorphy (possession of a Furthermore, in this study we made a cnidosac at the extremity of each ceras) which novel review of data for all species of the corresponded to the taxonomic level of order/ genus Cuthonella, including seven new ones suborder, and not to the family level, because (¤¥gs 1–21), and none of the species possess a majority of aeolidaceans from any family radular teeth that have a similar pattern to any possess a cnidosac. trinchesiid genera (Korshunova et al., 2017a) However, even such a potential general (¤¥g. 22C). Therefore, the conclusion that the apomorphy would be problematic since shape of the radular teeth cannot be used as several non-related genera lack cnidosacs, taxonomic characters in Fionoidea (¤¥g. 22B) is e.g., Phestilla Bergh, 1874 in the family incorrect, and to the contrary, these characters Trinchesiidae or Phyllodesmium Ehrenberg, are very useful for taxonomy in an integrative 1831 in the family Myrrhinidae. In contrast, context. It is important to highlight that it when separating many ¤¥nely de¤¥ned

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    . families and genera, including Abronicidae, Most recently, our ¤¥ne-scale approach Calmidae, Cuthonellidae, Cuthonidae, was supported by an independent study Eubranchidae, Fionidae s.str., , of the tropical trinchesiid genus Phestilla Trinchesiidae, Xenocratenidae, Murmaniidae, (Mehrotra et al., 2020). The review presented and potentially several others (¤¥g. 22C), it here of the genus Cuthonella and the family facilitates making complex morphological Cuthonellidae is therefore of high relevance for diagnoses and a list of morphological demonstrating the bene¤¥ts of this approach, apomorphies that is maximally consistent. since this is a properly narrow family and Importantly, it is also concordant with the genus, whose validity has been con¤¥rmed molecular data. Every narrowly de¤¥ned family ¤¥rst by using morphological data (Martynov, and genus has its own set of ¤¥nely scaled 1992; Martynov & Korshunova, 2011) then characters, that, if taken separately, may be recently by the application of molecular data incorrectly considered “overlapping” ones. in Korshunova et al. (2018a) and ¤¥nally by the The pitfalls of the ‘superlumping’ approach addition of seven new species and two new can immediately inçèuence practical subspecies detailed in this study. taxonomy. For example, the maximally broad approach that evoked the single huge “family Fionidae” (which then “overlaps” by almost Acknowledgements all possible morphological apomorphies with all other aeolid families, see Korshunova Sandra Millen (University of British et al., 2017a, 2019a) led to the result (Cella et Columbia) is thanked for providing the type al., 2016) of failing to distinguish two externally specimens of Cuthonella punicea and helping similar taxa with drastically diÁferent internal to organize the collecting trip. Doug Miller morphologies: Cuthonella punicea (Millen, 1986) and Neil McDaniel are warmly thanked and Zelentia nepunicea Korshunova et al., 2018. for collection of specimens of C. punicea. Thus, the maximally broad approach (e.g., Oleg Savinkin (The Institute of Ecology and Williams & Gosliner, 1979; Epstein et al., 2019) Evolution ) is thanked for collecting and not only “does not permit other users of the providing specimen from Franz Josef Land. classi¤¥cation (largely other comparative B.I. Sirenko, S.Y. Gagaev, and A.Y. Voronkov biologists) to identify taxa readily from living (Zoological Institute ) are thanked for examples”, but clearly misleads nudibranch collecting and providing specimens from taxonomists per se. Alternately, the ¤¥ne-scale East Siberian Sea and images. Our gratitude approach of numerous narrowly-de¤¥ned goes to Bernard Picton (National Museums families and genera easily avoids such pitfalls: of North Ireland) for collection of specimens Cuthonella punicea belongs to the family of C. concinna concinna from the British Cuthonellidae, whereas Zelentia nepunicea Isles and to Klas Malmberg (Universeum belongs to the family Trinchesiidae. Both and Aquatilis, Gothenburg) for collection families have a minimally overlapping of specimens of C. concinna concinna from particular set of morphological characters Sweden. T.A. Bakke and Kjersti Kvalsvik are (which of course are not absolutely “stable” thanked for the loan of specimen from the because of the continuing evolutionary process) Oslo Natural History Museum. So Ishida and show signi¤¥cant molecular divergence, and (Osaka Museum of Natural History) and thus are only distantly related to each other Sho Kashio (Natural History Museum of the (Korshunova et al., 2017a, b, 2018a, b, 2019b). Kishiwada City, Osaka) are thanked for help

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017  with access to the archived material of Dr. org/10.15468/ddbs14 accessed via GBIF.org on Kikutaro Baba. The team of Gulen Dive Resort 2020-08-04. (Christian Skauge, Ørjan Sandnes, Monica Barman, A.S., Singh, M., Singh, S.K., Saha, H., Bakkeli and Guido Schmitz) are generously Singh, Yu. J., Laishram, M. & Pandey, P.K. (2018) thanked for their help during ¤¥eldwork in DNA barcoding of freshwater ¤¥shes of Indo- Norway, as the specimens collected there Myanmar biodiversity hotspot. Sci. Rep., 8, 8579. were used for comparative purposes in this Behrens, D. (1980) Paci¥¦c coast nudibranchs, a study, and the #sneglebuss project ¤¥eld team guide to the opisthobranchs of the northeastern for assistance during ¤¥eld work in Finnmark, Paci¥¦c. Los Osos, CA, Sea Challengers. Norway. Anna Zhadan (Moscow State Behrens, D. & Hermosillo, A. (2005) Eastern Paci¥¦c University) is thanked for providing some nudibranchs, a guide to the opisthobranchs material and images on C. hiemalis. Reviewers from Alaska to Central America. Monterey, Sea are thanked for providing comments that Challengers. helped to improve the paper. Electron Bergh, R. (1884). Report on the Nudibranchiata Microscopy Laboratory Í is thanked for collected by H.M.S. Challenger, during the years support with electron microscopy. The study 1873–1876. Rep. Sci. Res. Voyage of Challenger, 10, was supported by the Norwegian Taxonomy 1–154. Initiative project #sneglebuss Barents Sea (19- Bickford, D., Lohman, D.J., Sodhi, N.S., Ng, P.K.L., 18_70184240). The work of Í was supported Meier, R., Winker, K., Ingram, K.K. & Das, by the research project of Í Zoological I. (2007) Cryptic species as a window on Museum (AAAA-A16-116021660077-3). The diversity and conservation. Trends Ecol. Evol., work of  was conducted under the   22, 148–155. Government basic research program in 2020 Blokh, Y.I., Bondarenko, V.I., Dolgal, A.S., Novikovac, № 0108-2019-0002. P.N., Petrova, V.V., Pilipenko, O.V., Rashidova, V.A. & Trusov, A.A. (2018) The Rikord submarine volcanic Massif, Kuril Island Arc. J. Volcanol. References Seism., 12, 252–267. Bouchet, P, & Rocroi, J.-P. (2005). Classi¤¥cation Alder, J. & Hancock, A. (1843) Notice of a British and nomenclator of gastropod families. species of Calliopaea, D’Orbigny, and of Malacologia, 47, 1–397. four new species of Eolis, with observations Brinckmann-Voss, A., & Calder, D. R. (2013) on the development and structure of the Zyzzyzus rubusidaeus (Cnidaria, Hydrozoa, nudibranchiate Mollusca. Ann. Mag. Nat. Hist., Tubulariidae), a new species of anthoathecate 12, 233–238. hydroid from the coast of British Columbia, Alder, J. & Hancock, A. (1845–1855) A monograph Canada. Zootaxa, 3666, 389–397. of the British nudibranchiate mollusca. pt. I–VII. Brown, G.H. (1980). The British species of the Ray Society, London. aeolidiacean family Tergipedidae (Gastropoda: Baba, K. (1940) Some additions to the nudibranch Opisthobranchia) with a discussion of the fauna of the northern part of Japan. Bull. genera. Zool. J. Linn. Soc., 69: 225–255. Biogeogr. Soc. Japan, 10,103–111. Carmona, L., Pola M., Gosliner, T.M., & Cervera, Bakken, T., Hårsaker, K. & Daverdin, M. (2020) J.L. (2013) A tale that morphology fails to tell: a Marine invertebrate collection NTNU University molecular phylogeny of Aeolidiidae (, Museum. Version 1.574. NTNU University Nudibranchia, Gastropoda). PLoS ONE, 8, Museum. Occurrence dataset https://doi. e63000.

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    .

Cella, K., Carmona, L., Ekimova, I., Chichvarkhin, A., Gosliner, T.M. & GriÁ¤¥ths, R.J. (1981) Description Schepetov, D. & Gosliner, T.M. (2016) A Radical and revision of some South African aeolidacean solution: The phylogeny of the nudibranch Nudibranchia (Mollusca, Gastropoda). Ann. family Fionidae. PloS One, 11, e0167800. South Afr. Mus., 84, 105–150. Colgan, D., Macaranas, J., Cassis, G. & Gray, Grieg, J.A. (1913) Nudibranchiate Mollusker M.R. (1998) Histone H3 and U2 snRNA DNA indsamlede av den norske ¤¥skeridamper sequences and arthropod molecular evolution. “Michael Sars”. Norske Vidensk. Selsk. Skr., 13: Austr. J. Zool., 4, 419–437. 1–13. Dayrat, B., Tillier, A., Lecointre, G. & Tillier, S. Hamond, R. (1972) The marine Mollusca of Norfolk. (2001) New clades of euthyneuran gastropods Trans. Norfolk Norwich Nat. Soc., 22, 271–306. (Mollusca) from 28S rRNA sequences. Mol. Hoeksema, B.W. (2007) Delineation of the Phylogenet. Evol., 19, 225–235. Indo-Malayan centre of maximum marine Eliot, C.N.E. (1907) Mollusca IV.—Nudibranchiata. biodiversity: The Coral Triangle. In: Renema W. Nat. Ant. Exped. 1901–1904. Nat. Hist. Zool., 2, (ed.) Biogeography, time and place: distributions, (Vertebrata: Mollusca: Crustacea), 1–28. barriers and islands, pp 117–178. Springer, Epstein, H.E., Hallas, J.M., Johnson, J.F., Lopez, Dordrecht. A. & Gosliner, T. (2019) Reading between the Hurtado, L.A., Mateos, M. & Liu, S. (2017) lines: revealing cryptic species diversity and Phylogeographic patterns of a lower intertidal colour patterns in Hypselodoris nudibranchs isopod in the Gulf of California and the (Mollusca: : Chromodorididae). Caribbean and comparison with other intertidal Zool. J. Linn. Soc., 186, 116–189. isopods. Ecol. Evol., 7, 346–357. Fassio, G., Modica, M.V., Alvaro, M.V., Buge, B., ICZN (1999) International code of zoological Salvi, D., Oliverio, M. & Schiaparelli, S. (2019) nomenclature. London, The International Trust An Antarctic çèock under the Thorson’s rule: for Zoological Nomenclature. diversity and larval development of Antarctic Ikuta, M. (2008) Changing Japanese-Russian Velutinidae (Mollusca: Gastropoda). Mol. Images in the Edo Period. In: Japan and Phylogenet. Evol., 132, 1–13. Russia. Three centuries of mutual images, Eds Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, Mikhailova Y., Steele M.W.. Global Oriental LTD, R. (1994) DNA primers for ampli¤¥cation of Kent, UK, pp. 11–31. mitochondrial cytochrome c oxidase subunit I Katoh, K., Misawa, K., Kuma, K. & Miyata, T. (2002) from diverse metazoan invertebrates. Mol. Mar. MAFFT: a novel method for rapid multiple Biol. Biotechnol., 3, 294–299. sequence alignment based on fast Fourier Friele, H. (1903) Mollusken der ersten transform. Nucl. Acids Res., 30, 3059–3066. Nordmeerfahrt des Fischereidampfers “Michael Korshunova, T.A., Sanamyan, N.P., Zimina, O.L., Sars” 1900, unter der Leitung von Herrn Dr Fletcher, K. & Martynov, A.V. (2016a) Two Johan Hjort. Bergens Mus. Aarbog, 3, 1–19. new species and a remarkable record of the Goddard, J.H.R. 1985. Food habits of some genus Dendronotus from the North Pacific nudibranchs from Cape Arago, Oregon. Western and Arctic oceans (Nudibranchia). ZooKeys, Soc. Malacol. Ann. Rep., 17, 9–10. 630, 19–42. Goddard, J.H.R. (1992) Patterns of development Korshunova, T.A., Sanamyan, N.P. & Martynov, in nudibranch molluscs from the northeast A.V. (2016b) Morphological and molecular Paci¥¦c Ocean, with regional comparisons. Ph.D. evidence indicate Dendronotus primorjensis is Dissertation, University of Oregon, Eugene, a valid species that has priority over D. dudkai Oregon. (Nudibranchia). ZooKeys, 634, 15–28.

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

Korshunova, T.A., Martynov, A.V. & Picton, B.E. Korshunova, T.A., Picton, B., Furfaro, G., Mariottini, (2017a) Ontogeny as an important part of P., Pontes, M., Prkić, J., Fletcher, K., Malmberg, integrative taxonomy in tergipedid aeolidaceans K., Lundin, K. & Martynov, A.V. (2019b) (Gastropoda: Nudibranchia) with a description Multilevel ¤¥ne-scale diversity challenges the of a new genus and species from the Barents ‘cryptic species’ concept. Sci. Rep., 9, 1–23. Sea. Zootaxa, 4324, 1–22. Korshunova, T.A., Bakken, T., Grøtan, V., Johnson, Korshunova, T.A., Martynov, A.V., Bakken, T., K., Lundin, K. & Martynov, A.V. (2020a). A Evertsen. J., Fletcher, K., Mudianta, W.I., Lundin, synoptic review of the family Dendronotidae K., Schrödl, M. & Picton, B. (2017b) Polyphyly (Mollusca: Nudibranchia): a multilevel of the traditional family Flabellinidae aÁfects organismal diversity approach. Contrib. Zool., a major group of Nudibranchia: aeolidacean doi:10.1163/18759866-BJA10014 taxonomic reassessment with descriptions Korshunova, T.A., Fletcher K., Picton, B., Lundin, of several new families, genera, and species K., Kashio, S, Sanamyan, N.P., Sanamyan, (Mollusca, Gastropoda). ZooKeys, 717, 1–139. K.E., Padula, V., Schrodl, M. & Martynov, Korshunova, T.A., Zimina, O.L. & Martynov. A. A.V. (2020b) The Emperor Cadlina, hidden (2017c) Unique pleuroproctic taxa of the diversity and gill cavity evolution: new insights nudibranch family Aeolidiidae from the Atlantic for the taxonomy and phylogeny of dorid and Paci¤¥c Oceans, with description of a new nudibranchs (Mollusca: Gastropoda). Zool. J. genus and species. J. Moll. Stud., 83, 409–421. Linn. Soc., 189, 762–827. Korshunova, T.A., Lundin, K., Malmberg, K., Korshunova, T.A., Malmberg, K., Prkić, J., Petani, A., Picton, B. & Martynov, AV. (2018a) First true Fletcher, K., Lundin, K. & Martynov, A.V. (2020c) brackish water nudibranch mollusc provides Fine-scale species delimitation: speciation in new insights for phylogeny and biogeography process and periodic patterns in nudibranch and reveals paedomorphosis driven evolution. diversity. ZooKeys, 917, 15–50. PLoS ONE, 13, e0192177. Kumar, S., Stecher, G., & Tamura, K. (2016) MEGA7: Korshunova, T.A., Fletcher, K., Lundin, K., molecular evolutionary genetics analysis Malmberg, K., Picton, B. & Martynov, A.V. version 7.0 for bigger datasets. Mol. Biol. Evol., (2018b) The genus Zelentia is an amphi-boreal 33, 1870–1874. taxon expanded to include three new species Marcus, Er. (1958) On western Atlantic from the North Paci¤¥c and Atlantic oceans opisthobranchiate gastropods. Amer. Mus. (Gastropoda: Nudibranchia: Trinchesiidae). Novit., 1906, 1–82. Zootaxa, 4482, 297–321. Marshall, J.G.. & Willan, R.C. (1999). Nudibranchs Korshunova, T.A., Fujita, T. & Martynov, A.V. (2018c) of Heron Island, Great Barrier Reef. A survey of The ¤¥rst record of Trinchesia lenkae Martynov, the Opisthobranchia (Sea Slugs) of Heron and 2002 from Japan: morphological and molecular Wistari Reefs. Leiden, Backhuys Publishers. comparison with the material from the type Martin, R., Heß, M., Schrödl, M. & Tomaschko, locality in Russia (Nudibranchia: Trinchesiidae). K.H. (2009) Cnidosac morphology in Venus, J. Malacol. Soc. Japan, 76, 19–28. dendronotacean and aeolidacean nudibranch Korshunova T.A., Mehrotra R., Arnold S., Lundin K., molluscs: from expulsion of nematocysts to use Picton B. & Martynov A.V. (2019a.) The formerly in defense? Mar. Biol., 156, 261–268. enigmatic Unidentiidae in the limelight again: Martynov, A.V. (1992) A new species of a new species of the genus Unidentia from nudibranch molluscs of the Sea of Japan with Thailand (Gastropoda: Nudibranchia). Zootaxa, notes on the genus Cuthonella (Gastropoda, 4551, 556–570. Opisthobranchia). Zool. Zhur., 71, 18–24.

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    .

Martynov, A.V. (1997). Opisthobranch molluscs of biodiversity of Kamchatka and coastal waters the coastal waters of the Commander Islands and – Proceedings of XV international scienti¤¥c remarks on their fauna in the Far-Eastern Seas of conference Petropavlovsk-Kamchatsky, pp. 55– Russia. In: Rzhavsky A.V. (ed.) Benthic ˜lora and 69. Petropavlovsk-Kamchatsky, Kamchat Press. fauna of the shelf zone of the Commander Islands, Martynov, A.V., Sanamyan, N.P. & Korshunova pp 117–178. Vladivostok, Dalnauka. T.A. (2015b) Review of the opisthobranch Martynov, A.V. (2000) A new species of Arctic mollusc fauna of Russian Far Eastern seas: tergipedid Cuthonella elenae sp. nov. Pleurobranchomorpha, Doridida and (Opisthobranchia, Nudibranchia) oÁf Wrangel Nudibranchia. Bull. Kamchatka State Techn. Island. Ruthenica, 10, 5–10. Univ., 34, 62–87. Martynov, A.V. (2002) Two new species of the genus Martynov, A.V, Mehrotra, R., Chavanich, S., Trinchesia Ihering, 1879 from Peter the Great Nakano, R., Kashio, S., Lundin, K., Picton, B. & Bay, Japan Sea (Nudibranchia, Tergipedidae), Korshunova T. (2019) The extraordinary genus with notes on the taxonomy of the family. Myja is not a tergipedid, but related to the Ruthenica, 12, 45–54. Facelinidae s. str. with the addition of two new Martynov, A.V. (2006a) Archaic Tergipedidae of the species from Japan (Mollusca, Nudibranchia). Arctic and Antarctic: Murmania antiqua gen. et ZooKeys, 818, 89–116. sp. nov. from the Barents Sea and a revision of the Martynov, A.V., Lundin, K., Picton, B., Fletcher, genus Guyvalvoria Vayssière with descriptions of K., Malmberg, K., & Korshunova, T.A. (2020a) two new species. Ruthenica, 16, 73–88. Multiple paedomorphic lineages of soft- Martynov, A.V. (2006b) . In – Marine substrate burrowing invertebrates: parallels and brackish water Gastropoda of Russia and in the origin of Xenocratena and Xenoturbella. adjacent countries: an illustrated catalogue, pp. PLoS ONE, 15, e0227173. 267–294. KMK Scienti¤¥c Press Ltd., Moscow. Martynov, A.V., Fujiwara, Y., Tsuchida, S., Nakano, Martynov, A.V. & Korshunova, TA. (2011) R., Sanamyan, N., Sanamyan, K., Fletcher, K. & Opisthobranch molluscs of the seas of Russia. Korshunova, T.A. (2020b) Three new species of A colour guide to their taxonomy and biology. the genus Dendronotus from Japan and Russia Moscow, Fiton Press. (Mollusca, Nudibranchia). Zootaxa, 4747, Martynov, A.V., Korshunova, T.A. (2012) 495–513. Opisthobranch molluscs of Vietnam Mayr, E. (1969) Principles of systematic zoology. (Gastropoda: Opisthobranchia). In Britayev, New York: McGraw-Hill. T.Z., Pavlov, D.S. (eds.) Benthic Fauna of the Bay Mehrotra, R., Arnold, S., Wang, A., Chavanich, S., of Nhatrang, Southern Vietnam, pp 142–257. Hoeksema, B.W. & Caballer, M. (2020) A new KMK Scienti¤¥c Press, Moscow. species of coral-feeding nudibranch (Mollusca: Martynov, A.V. & Korshunova, T.A. (2017) World’s Gastropoda) from the Gulf of Thailand. Mar. northenmost and rarely observed Nudibranchs: Biodivers., 50, 36. three new Onchidoridid species (Gastropoda: Milbakh, V.S. (2003) Repression in the red army in Doridida) from Russian seas. Zootaxa, 4299, the Far East, 1936–1939. J. Slavic Mil. Stud., 16, 391–404. 58–130. Martynov, A.V., Sanamyan, N.P. & Korshunova, Millen, S.V. (1983) Range extensions of T.A. (2015a) New data on the opisthobranch opisthobranchs in the northeastern Paci¤¥c. The molluscs (Gastropoda: Opisthobranchia) Veliger, 25, 383–386. of waters of Commander Islands and Far- Millen, S.V. (1986) Northern, primitive tergipedid Eastern seas of Russia. In: Conservation of nudibranchs, with a description of a new

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017 

species from the Canadian Paci¤¥c. Can. J. Zool., Odhner, N. [in Franc A.] (1968) Sous-classe des 64, 1356–1362. opisthobranches. In: Fischer E., Franc A., Miller, M.C. (1977) Aeolid nudibranchs Martoja M., Termier G. & Termier H. (Eds) (Gastropoda: Opisthobranchia) of the family Traite de zoologie. Anatomie, systematique, Tergipedidae from New Zealand waters. Zool. J. biologie. Tome V, Mollusques gasteropodes et Linn. Soc., 60, 197–222. scaphopodes, 608–893. MolluscaBase (2020). Guyvalvoria Vayssière, O’Donoghue, C.H. (1922) Notes on the 1906. Accessed through: World Register of nudibranchiate Mollusca from the Vancouver Marine Species at: https://www.marinespecies. Island region. III. Records of species and org/aphia.php?p=taxdetails&id=391305 on distribution. Trans. R. Can. Inst., 14, 145–167. 2020-09-23 Palumbi, S.R., Martin, A.P., Romano, S., McMillan, NHM. (2020) Eolis concinna 1858.5.28.186. W.O., Stice, L. & Grabowski, G. (2002) The simple Accessed through https://data.nhm. fool’s guide to PCR. Honolulu: University of Hawaii. ac.uk/object/ae7ba9bb-504e-4aa3-aa6e- Papu, A., Undap, N., Martinez, N.A., Segre, M.R., 55çôe2feae0b/1594857600000 Datang, IG, Kuada, R.R., Perin, M., Yonow, N. Nordsieck, F. (1972) Die europäischen & Wägele, H. (2020). First study on marine Meeresschnecken (Opisthobranchia mit Heterobranchia (Gastropoda, Mollusca) in Pyramidellidae; Rissoacea), vom Eismeer bis Bangka Archipelago, North Sulawesi, Indonesia. Kapverden, Mittelmeer und Schwarzes Meer. Diversity, 12: 52. Gustav Fischer Verlag, Stuttgart. Picton, B.E. & Morrow, C. (1994) A ¥¦eld guide to the Nylander, J.A., Ronquist, F., Huelsenbeck, J.P. & nudibranchs of the British Isles. London, Immel Nieves-Aldrey, J.L. (2004) Bayesian phylogenetic Publishing. analysis of combined data. Syst. Biol., 53, 47–67. Poore, G.C.B. & Bruce, N.L. (2012) Global diversity Odhner, N. (1907) Northern and Arctic invertebrates of marine isopods (Except Asellota and in the collection of the Swedish state museum. crustacean symbionts). PLoS ONE, 7(8), e43529. Det Kongelige. Norske Viden. Selsk. Skrift., 41, Pruvot-Fol, A. (1954) Mollusques Opisthobranches. 1–114. Faune de France, 58, 1–460. Odhner, N. (1922) Norwegian opisthobranchiate Puillandre, N., Lambert, A., Brouillet, S. & Achaz, G. Mollusca in the collections of the Zoological (2012) ABGD, Automatic barcode gap discovery Museum of Kristiania. Nyt Mag. Naturvidensk., for primary species delimitation. Mol. Ecol., 21, 60, 1–47. 1864–1877. Odhner, N. (1926) Die Opisthobranchien. Further Puslednik, L. & Serb, J.M. (2008) Molecular Zool. Res. Swed. Antar. Exped. 1901–1903 under the phylogenetics of the Pectinidae (Mollusca: direction of Dr. Otto Nordenskjold, 2, 1–100. Bivalvia) and eÁfect of increased taxon sampling Odhner, N. (1929) Aeolidiiden aus dem nördlichen and outgroup selection on tree topology. Mol. Norwegen. Tromsø Mus. Aarsheft., 50, 1–22 Phylogenet. Evol., 48, 1178–1188. Odhner, N. (1939) Opisthobranchiate Mollusca Qiu, B. (2001) Kuroshio and Oyashio Currents. In: from the western and northern coasts of Encyclopedia of Ocean Sciences, pp.1413 –1425. Norway. Det Kong. Norsk. Vidensk. Selsk. Skrift., Roberts, C.M., McClean, C.J., Veron, J.E., Hawkins, 1, 1– 93. J.P., Allen, G.R., McAllister, D.E., Mittermeier, Odhner, N. (1944) Mollusca: Nudibranchia and C.G., Schueler, F.W., Spalding, M., Wells, F., Vynne, Scaphopoda with zoogeographical remarks C. & Werner, TB. (2002) Marine biodiversity and explanations. Sci. Res. Norw. Antar. Exped. hotspots and conservation priorities for tropical 1927–1928, 21, 1–48. reefs. Science, 295, 1280–1284.

 %  !  !    $ !%  $!"#&     & Ô 10.1163/18759866-10017 |    .

Roginskaya, I.S. (1963) Cuthona marisalbi n. sp. – a Thorson, G. (1950) Reproductive and larval ecology new nudibranch mollusc from the White Sea. of marine bottom invertebrates. Biol. Rev. Proc. Kandalakshsky Nat. Reserv., 4, 258–265. Cambr. Philos. Soc., 25, 1–45. Roginskaya, I.S. (1987) Order Nudibranchia Tsunemoto, T. (2019) Overview of the Ainu Blainville, 1814. In: Molluscs of the White Sea. Keys Policy Promotion Act of 2019. Hokkaido to the Fauna of USSR, 151, 155–201. University. Accessed through https:// Ronquist, F., Teslenko, M., van der Mark, P., Ayres, fpcj.jp/wp/wp-content/uploads/2019/11/ D.L., Darling, A., Höhna, S., Larget, B., Liu, b8102b519c7b7c4a4e129763f23ed690.pdf L., Suchard, M.A. & Huelsenbeck, J.P. (2012) Valdés, A., Moran, A.L. & Woods, H.A. (2012) MrBayes 3.2: EÁ¤¥cient Bayesian phylogenetic Revision of several poorly known Antarctic aeolid inference and model choice across a large nudibranch species (Mollusca, Gastropoda) with model space. Syst. Biol., 61, 539–542. the description of a new species. J. Mar. Biol. Stamatakis, A., Hoover, P. & Rougemont, J. (2008) Assoc. UK, 92, 1161–1174. Rapid bootstrap algorithm for the RAxML Waters, V.L. (1966) Food preference and feeding webservers. Syst. Biol., 75, 758–771. behaviour of four nudibranchs. Ann. Rep. Amer. Stejneger, L. (1936) Georg Wilhelm Steller. The Malacol. Union, Paci¥¦c Division, 63. pioneer of Alaskan Natural History. Harvard Williams, G. & Gosliner, T. (1979) Two new species University Press, Cambridge, Massachusets. of nudibranchiate molluscs from the West Swennen, C. (1961) Data on distribution, Coast of North America, with a revision of reproduction and ecology of the nudibranchiate the family Cuthonidae. Zool. J. Linn. Soc., 67, molluscs occurring in the Netherlands. Neth. J. 203–223. Sea Res., 1, 191–240. Wszolek, Z.K., Williams, D.P. & Kyle, R.A. (1990) Tanaka, T. (2017) Russian Ainu leader calls for greater Benedykt Dybowski—physician, explorer, respect. Nikkei, Asian Review. Accessed through scientist, political prisoner. Mayo Clinic https://asia.nikkei.com/Politics/Russian-Ainu- Proceed., 65, 1381. leader-calls-for-greater-respect2 Thompson, T.E. & Brown, G.H. (1984) Biology of Ð  : 11 ½ 2020 |    opisthobranch molluscs. Vol. 2. The Ray Society ÐÐö : 28 Ё 2020 Publishing, London.  : .ê. Í

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017  Program References Puslednik & Serb, 2008 Puslednik & Serb, Colgan et al., 1998 Colgan Dayrat et al., 2001Dayrat C 7 min C 30s), 72° 72° 50° C 15 s, 95° C 3 min, 40× (94° 15 s, CCGRTYTGAACTCAGCTCACG ATATCCTTGGGCATGATGGTGAC Appendix 1  Primers Name 5′→3′ LCO 1490LCO GGTCAACAAATCATAAAGATATTGG et al., 1994 Folmer C 7 min C 30s), 72° 72° 45° C 15 s, 35× (95° C 15 s, 95° C 60 s, HCO 2198HCO TAAACTTCAGGGTGACCAAAAAATCA et al., 1994 Folmer 16S arL CGCCTGTTTAACAAAAACAT et al., 2002 Palumbi C 7 min C 30s), 72° 72° 52° C 15 s, 95° C 3 min, 40× (94° 15 s, 16S R H3 AF ATGGCTCGTACCAAGCAGACGG et al., 1998 Colgan C 7 min C 30s), 72° 72° 52° C 15 s, 95° C 3 min, 40× (94° 15 s, H3 AR 28S C1 ACCCGCTGAATTTAAGCAT

 %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    . - - 16S H3 28S - COI MG323544 MG323550JQ699567 MG323565 - JQ699477MW150847 JQ699388 MW158728MW150866 MW158323 MW158746MW150867 - MW158334 MW158713 MW158747 MW158725 MW158322 MW158726 MW150854 MG323543 MG323549MW150851 MG323564 MW158732 MG323555 MW158327MW150852 MW158715 MW158733 MW158328 MW158716 Voucher Locality ÌÍÍ :Op-603 Norway CPIC00562ÌÍÍ :Op-727 - ÌÍÍ :Op-618 Josef Franz Land Russia: ÌÍÍ :Op-194 Matua Russia: WS3452 Kamchatka Russia: WS3450CAS179471 Kamchatka Russia: CAS185193 Kamchatka Russia: California USA: KY129023CAS181307b California USA: KY129019 KY128814 California USA: KY128925KM767 KY128810 KY128608 KY128720 KY128594 - KY128931GNM8866 KY128513 - Finnmark Norway: KY128927 KY128726KM452 Sweden - KY128519 KY128722KM453 KY128515 - Sea Barents Russia: - WS3444 Sea Barents Russia: WS3445 Sea Barents Russia: Sea Barents Russia: KY129013 KY128817 KY129014 KY128611 KY128805 - KY128612 -  2  List of references. and voucher localities, samples, Species name (Alder & Hancock, 1854) (Alder & Hancock, Calma glaucoides 1854) nov. subsp. kryos Cuthonella abyssicola nov. Cuthonella ainu sp. nov. sp. Cuthonella benedykti nov. sp. Cuthonella benedykti nov. sp. Cuthonella benedykti (Williams & Cuthonella cocoachroma 1979) Gosliner, (Williams & Cuthonella cocoachroma 1979) Gosliner, (Williams & Cuthonella cocoachroma 1979) Gosliner, (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843)

 %  !  !    $ !%  $!"#&     &      (  ) | 10.1163/18759866- 10017  - - MW158714 ------16S H3 28S COI MW150853 MW158734 KY128934 KY128729KY128935 KY128522 KY128730KY128936 - KY128523 KY128731KY128932 - KY128524 KY128727 - KY128520MW150848 - MW158729 MW150849 MW158730 MW150850 MW158731 MW150868 MW158748 MW158331 MW158727 VoucherÌÍÍ :Op-523 SeaWhite Russia: Locality WS3449WS3443 MF523377 SeaWhite Russia: MF523459WS3447 MF523302 SeaWhite Russia: - KY129018KM616 SeaWhite Russia: KY12880809PROBE-00278 KY129012 Canada: Churchill KY128603 UK KY128804CAS182701 KY129016 - KY128600 KF644266 KY128807CAS182702 - Hampshire New USA: - KY128602 KY128933CAS183926 Maine USA: - KY128728CAS183932 Maine USA: KY128521 Maine USA: - ÌÍÍ :Op-728Washington ÌÍÍ :Op-729 USA: Washington ÌÍÍ :Op-740 USA: Washington USA: ÌÍÍ :Op-673 Matua Russia: Species name (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) (Alder & concinna Cuthonella concinna Hancock, 1843) nov. bellatula subsp. Cuthonella concinna CAS181522b nov. bellatula subsp. Cuthonella concinna CAS179469 nov. bellatula subsp. Cuthonella concinna Alaska USA: CAS181307a nov. bellatula subsp. Cuthonella concinna CAS181307d California USA: nov. bellatula subsp. Cuthonella concinna California USA: nov. bellatula subsp. Cuthonella concinna California USA: nov. bellatula subsp. Cuthonella concinna nov. Cuthonella denbei sp. KY128924 KY128926 KY128719 KY128929 KY128721 KY128512 KY128724 KY128514 - KY128517 - -  %  !  !    $ !%  $!"#&     &  10.1163/18759866-10017 |    . - - - MG323556 ------16S H3 28S COI MW150869 MW158749MW150870 MW158332 MW158750 MW150860 MW158740MW150861 MW158329MW150862 MW158741 MW158721 MW158742 MW158330 MW158722 MW150855 MW158735MW150856 MW158325 MW158736 MW158717 MW158326 MW158718 MW150857 MW158737 MW150858 MW158738MW150863 MW158337 MW158743MW150859 MW158719 MW158333 MW158739MW150865 MW158723 MW158324 MW158745MW150864 MW158720 MW158336 MW158744MF523390 MW158724 MW158335 MN850079 MF523394MN850080 MN850072 MF523315 MN850055 MN850073MN850081 MF523470 MN850056 MN850062 MN850074 MN850063 MN850057 MN850064 Voucher Locality ÌÍÍ :Op-674 Matua Russia: ÌÍÍ :Op-730 Matua Russia: ÌÍÍ :Op-672 Matua ÌÍÍ :Op-670 Russia: Matua Russia: ÌÍÍ :Op-731ÌÍÍ :Op-186 Matua Russia: SeaWhite Russia: MG323545 MG323551ÌÍÍ :Op-524 - ÌÍÍ :Op-604 Sea of Russia: Japan Sea of Russia: JapanÌÍÍ :Op-606 Sea of Russia: Japan ÌÍÍ :Op-607 MF523378 Sea of Russia: Japan MG323546 MF523457 MG323552 MF523303 MG323566 MF523523 MG323557 ÌÍÍ :Op-671ÌÍÍ :Op-605 Matua Russia: Sea of Russia: Japan ÌÍÍ :Op-739ÌÍÍ :Op-738 Matua Russia: ÌÍÍ :Op-399 Matua Russia: Russia Species name sp. nov. Cuthonella denbei sp. sp. nov. Cuthonella denbei sp. nov. sp. Cuthonella georgstelleri nov. sp. Cuthonella georgstelleri nov. sp. Cuthonella georgstelleri 1987) Cuthonella hiemalis (Roginskaya, 1987)Cuthonella hiemalis (Roginskaya, 1987)Cuthonella hiemalis (Roginskaya, WS3439 1987)Cuthonella hiemalis (Roginskaya, WS3440 1987)Cuthonella hiemalis (Roginskaya, WS3441 1987)Cuthonella hiemalis (Roginskaya, WS3438 SeaWhite Russia: (Baba, 1940) Cuthonella osyoro SeaWhite Russia: WS3442 (Baba, 1940) Cuthonella osyoro SeaWhite Russia: (Baba, 1940) Cuthonella osyoro Sea KY129008White Russia: (Baba, 1940) Cuthonella osyoro KY129009 SeaWhite Russia: KY128800 (Baba, 1940)Cuthonella osyoro KY129010 KY128801 KY128596 (Baba, 1940)Cuthonella osyoro KY129007 KY128802 KY128597 (Millen, 1986)Cuthonella punicea KY129011 - KY128799 (Millen, 1986)Cuthonella punicea KY128598 - WS3453 KY128803 nov. KY128595 sp. Cuthonella sandrae - WS3451 KM765 1992 Cuthonella soboli Martynov, KY128599 - KM766 nov. sp. Cuthonella vasentsovichi - Sea of Russia: Japan nov. sp. Cuthonella vasentsovichi Sea of Russia: Japan 2006 Murmania antiqua Martynov, Canada: British Columbia 1940 Odhner, suecica Xenocratena Canada: British Columbia KY129024 1940 Odhner, suecica Xenocratena KY129021 KY128815 1940 Odhner, suecica Xenocratena GNM9816 KY128812 - GNM9770-1 KY128606 GNM9770-2 Sweden Norway - Norway  a2  .) ( Contd List of references. and voucher localities, samples,

 %  !  !    $ !%  $!"#&     &