DOCSLIB.ORG

The First Record of Trinchesia Lenkae Martynov, 2002 from Japan: Morphological and Molecular Comparison with the Material From

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The First Record of Trinchesia Lenkae Martynov, 2002 from Japan: Morphological and Molecular Comparison with the Material From VENUS 76 (1–4): 19–28, 2018 DOI: http://doi.org/10.18941/venus.76.1-4_19First Record of Trinchesia lenkae in Japan ©The Malacological Society of Japan19 The First Record of Trinchesia lenkae Martynov, 2002 from Japan: Morphological and Molecular Comparison with the Material from the Type Locality in Russia (Nudibranchia: Trinchesiidae) Tatiana Korshunova1,2, Toshihiko Fujita3 and Alexander Martynov2* 1Koltzov Institute of Developmental Biology RAS, 26 Vavilova Str., 119334 Moscow, Russia 2Zoological Museum, Moscow State University, Bolshaya Nikitskaya Str. 6, 125009 Moscow, Russia 3National Museum of Nature and Science, 4-1-1 Amakubo, Tsukuba, Ibaraki 305-0005, Japan Abstract: The nudibranch mollusc Trinchesia lenkae Martynov, 2002 is reported in the Japanese fauna for the first time. The newly collected Japanese specimens of T. lenkae are compared with those from the type locality of this species in Peter the Great Bay in the Sea of Japan, Russia, using external and internal morphological data and molecular analyses. The molecular study revealed high genetic homogeneity between Japanese and Russian populations of T. lenkae. The integrative morphological and molecular data thus clearly suggest that the same species occurs in Russia and Japan. Keywords: Japanese fauna, molecular analysis, morphology, nudibranchs, taxonomy Introduction The recently restored family Trinchesiidae Nordsieck, 1972 is a large and diverse group of predominantly small-sized aeolidacean nudibranchs (Korshunova et al., 2017a). Representatives of this family have been reported from Japan and included the genera Catriona Winckworth, 1941, “Cuthona” Alder & Hancock, 1855 s.l., Phestilla Bergh, 1874, Tenellia Costa, 1866 s.str., and Trinchesia Ihering, 1879 (e.g., Baba, 1937, 1949, 1955, 1961, 1975, 1984; Hamatani, 1993; Hirano & Hirano, 1991; Nakano, 2004). During a research trip to Hokkaido in October of 2016, T. Korshunova and A. Martynov were able to collect nudibranch molluscs at Akkeshi Marine Station, Hokkaido University. Among the collected nudibranchs several a trinchesiid species previously unrecorded from Japan were found. After morphological and molecular analysis it was confirmed that it belongs to the species Trinchesia lenkae Martynov, 2002 that had been described from the Russian part of the Sea of Japan fifteen years previously (Martynov, 2002). Additionally, a single specimen of Trinchesia lenkae without any morphological information was recorded as “Tenellia” lenkae in Cella et al. (2016) also from the Russian side of the Sea of Japan. In this study the description of the Japanese specimens of T. lenkae and its comparison with specimens of T. lenkae from the type locality in Russia are presented. * Corresponding author: [email protected] 20 T. Korshunova et al. Materials and Methods Collecting data and morphological methods Material for this study was obtained by T. Korshunova and A. Martynov during fieldwork at the Akkeshi Marine Station (Field Science Center for Northern Biosphere, Hokkaido University), Japan in 2016 and in the Far Eastern Marine Reserve in Peter the Great Bay, Russia in 2014. The morphology of the molluscs and their egg masses were studied under a stereomicroscope and using Nikon D-90 and D-810 digital cameras. For the description of internal features both preserved and fresh specimens were dissected under the stereomicroscope. The buccal mass of each specimen was extracted and processed in a weak solution of domestic bleach. The jaws were analysed under the stereomicroscope and scanning electron microscope. The gold and platinum sputter- coated radulae were examined using a scanning electron microscope (JSM 6380). The reproductive systems were also examined and drawn using the stereomicroscope. Molecular methods Three specimens were successfully sequenced for the mitochondrial genes cytochrome c oxidase subunit I (COI) and 16S rRNA. Small pieces of foot tissue were used for DNA extraction with Diatom™ DNA Prep 100 kit by Isogene Lab, according to the manufacturer’s instructions. Extracted DNA was used as a template for the amplification of partial sequences of the COI and 16S. The primers that were used for amplification are LCO 1490 (GGTCAACAAATCATAAAGATATTGG (Folmer et al., 1994)); HCO 2198 (TAAACTTCAGGGTGACCAAAAAATCA (Folmer et al., 1994)); 16S arL (CGCCTGTTTAACAAAAACAT (Palumbi et al., 2002)); and 16S R (CCGRTYTGAACTCAGCTCACG (Puslednik & Serb, 2008). Polymerase chain reaction (PCR) amplifications were carried out in a 20-μL reaction volume, which included 4 μL of 5× Screen Mix (Eurogen Lab), 0.5 μL of each primer (10 μM stock), 1 μL of genomic DNA, and 14 μL of sterile water. The amplification of COI was performed with an initial denaturation for 1 min at 95°C, followed by 35 cycles of 15 s at 95°C (denaturation), 15 s at 45°C (annealing temperature), and 30 s at 72°C, with a final extension of 7 min at 72°C. The 16S amplification began with an initial denaturation for 1 min at 95°C, followed by 40 cycles of 15 s at 95°C (denaturation), 15 s at 52°C (annealing temperature) and 30 s at 72°C, with a final extension of 7 min at 72°C. DNA sequences of both strands were obtained using the ABI PRISM® BigDye™ Terminator v. 3.1. on an automated DNA sequencer (Applied Biosystems Prism 3700). COI sequences were translated into amino acids for confirmation of the alignment. All sequences were deposited in GenBank (Table 1, highlighted in bold). Original data and publicly available sequences were aligned with the MUSCLE algorithm (Edgar, 2004). Separate analyses were conducted for the following data sets: resulting alignments are 658 bp for COI, 442 bp for 16S, and 1,100bp for the concatenated dataset. Evolutionary models for each data set were selected using MrModelTest 2.3 (Nylander et al. 2004) under the Akaike information criterion (Akaike, 1974). The HKY+ I+ G model was chosen for COI, the GTR + I model was chosen for 16S, and the GTR + I + G model was chosen for the concatenated dataset. Two different phylogenetic methods, Bayesian Inference (BI) and Maximum Likelihood (ML) were used to infer evolutionary relationships. Bayesian estimation of posterior probability was performed in MrBayes 3.2. Markov chains were sampled at intervals of 1,000 generations. Analysis was started with random starting trees and 107generations. Maximum likelihood-based phylogeny inference was performed in GARLI 2.0 (Zwickl, 2006) with bootstrap in 1,000 replicates. The program Mega7 (Kumar et al., 2016) was used to calculate the uncorrected p-distances between all the sequences. Intra- and inter- group genetic distances were also examined. To evaluate the genetic distribution of the different haplotypes the haplotype network for the combined molecular data (COI + 16S) was reconstructed using the Population Analysis with Reticulate Trees (PopART, http://popart.otago.ac.nz) with the TCS network method. First Record of Trinchesia lenkae in Japan 21 Table 1. List of specimens used for molecular analyses. GenBank accession nos. Species Voucher Locality COI 16S Diaphoreolis lagunae CAS179465a California KY128956 KY128749 (O’Donoghue, 1926) Diaphoreolis viridis ZMMU:Op-537 Russia, White Sea MG266028 MG266026 (Forbes, 1840) Trinchesia caerulea ZMMU:Op-622 Norway, Gulen MG266024 MG266022 (Montagu, 1804) Trinchesia lenkae Japan: Hokkaido (Pacific side), ZMMU:Op-619 MG242334 MG242333 Martynov, 2002 Akkeshi Bay Trinchesia lenkae Japan: Hokkaido (Pacific side), ZMMU:Op-620 MG242336 MG242335 Martynov, 2002 Akkeshi Bay Trinchesia lenkae Russia: Sea of Japan, Spaseniya ZMMU:Op-621 MG242338 MG242337 Martynov, 2002 Bay Trinchesia lenkae AC17-19* Sea of Japan, Sobol Bay KY129093 KY128884 Martynov, 2002 Trinchesia ornata CAS180344 Hawaii KY128967 KY128758 (Baba, 1937) Trinchesia sibogae CAS177489 Philippines KY128975 KY128767 (Bergh, 1905) Trinchesia speciosa CAS176913 South Africa KY128996 KY128788 (Macnae, 1954) Trinchesia speciosa CAS176954 South Africa KY128998 KY128790 (Macnae, 1954) * The voucher number AC17-19 doesn’t belong to any of the museum collections mentioned in Cella et al. (2016). Results Taxonomy Family Trinchesiidae Nordsieck, 1972 Genus Trinchesia Ihering, 1879 Trinchesia lenkae Martynov, 2002 Trinchesia lenkae – Martynov, 2002: 48–50, fig. 1. Material: Three specimens, ZMMU Op-619, Op-620 (Fig. 1), 5 October 2016, Japan, Hokkaido (Pacific side), Akkeshi Bay, 2–4 m depth, on brown algae Sargassum spp., leg. T. Korshunova and A. Martynov. Comparative material: Two specimens and egg mass, ZMMU Op-621 (Fig. 2), 10 September 2014, Russia, Spaseniya Bay, Peter the Great Bay, the Sea of Japan, intertidal, under stones, leg. T. Korshunova and A. Martynov. Description (based on specimens from Akkeshi Bay): External morphology. The maximum length of the examined specimens is 12 mm (Figs 1A–C). The body is moderately broad. The rhinophores are similar in size to the oral tentacles, and smooth. The cerata are relatively long, thin, and finger-shaped. Ceratal formula of the largest 12 mm specimen (ZMMU Op-619): right (2,3,4;5 22 T. Korshunova et al. Fig. 1. Trinchesia lenkae. A, B, D–F. Specimen ZMMU Op-619 from Akkeshi Bay (Hokkaido, Japan), 12 mm length; (A) dorsal (B) ventral views of living specimen; (D) posterior part of the radula; (E) details of the radular teeth; (F) jaw; (G) denticles on the masticatory edge of the jaw (indicated by arrows); (H) penial stylet. C. Specimen ZMMU Op-620 from Akkeshi Bay (Hokkaido, Japan), 8 mm length. Scale bars: D, E, G, 10 μm; H, 20 μm; F, 100 μm. anus, 4,4,3,2,2,1) left (2,4,4;5 anus, 4,5,4,3,2,1). The foot is moderately broad, with well-defined long foot corners anteriorly (Fig. 1B). Colour. The ground colour is whitish. The digestive branches in the cerata are brownish (Figs 1A, B) to reddish (Fig. 1C). A few small opaque white spots are scattered on the ceratal tops. There First Record of Trinchesia lenkae in Japan 23 Fig. 2. Trinchesia lenkae. A, B, D–F. Specimen ZMMU Op-620 from Spaseniya Bay (Peter the Great Bay, the Sea of Japan, Russia), 12 mm length; (A) dorsal (B) ventral views of living specimen; (D) posterior part of the radula; (E) details of the radular teeth; (F) jaw; (G) denticles on the masticatory edge of the jaw (indicated by arrows); (H) penial stylet.
Load more

Recommended publications
  • A Radical Solution: the Phylogeny of the Nudibranch Family Fionidae
    RESEARCH ARTICLE A Radical Solution: The Phylogeny of the Nudibranch Family Fionidae Kristen Cella1, Leila Carmona2*, Irina Ekimova3,4, Anton Chichvarkhin3,5, Dimitry Schepetov6, Terrence M. Gosliner1 1 Department of Invertebrate Zoology, California Academy of Sciences, San Francisco, California, United States of America, 2 Department of Marine Sciences, University of Gothenburg, Gothenburg, Sweden, 3 Far Eastern Federal University, Vladivostok, Russia, 4 Biological Faculty, Moscow State University, Moscow, Russia, 5 A.V. Zhirmunsky Instutute of Marine Biology, Russian Academy of Sciences, Vladivostok, Russia, 6 National Research University Higher School of Economics, Moscow, Russia a11111 * [email protected] Abstract Tergipedidae represents a diverse and successful group of aeolid nudibranchs, with approx- imately 200 species distributed throughout most marine ecosystems and spanning all bio- OPEN ACCESS geographical regions of the oceans. However, the systematics of this family remains poorly Citation: Cella K, Carmona L, Ekimova I, understood since no modern phylogenetic study has been undertaken to support any of the Chichvarkhin A, Schepetov D, Gosliner TM (2016) A Radical Solution: The Phylogeny of the proposed classifications. The present study is the first molecular phylogeny of Tergipedidae Nudibranch Family Fionidae. PLoS ONE 11(12): based on partial sequences of two mitochondrial (COI and 16S) genes and one nuclear e0167800. doi:10.1371/journal.pone.0167800 gene (H3). Maximum likelihood, maximum parsimony and Bayesian analysis were con- Editor: Geerat J. Vermeij, University of California, ducted in order to elucidate the systematics of this family. Our results do not recover the tra- UNITED STATES ditional Tergipedidae as monophyletic, since it belongs to a larger clade that includes the Received: July 7, 2016 families Eubranchidae, Fionidae and Calmidae.
    [Show full text]
  • Native Biodiversity Collapse in the Eastern Mediterranean Supplementary Material: Details on Methods and Additional Results/Figures and Tables
    Native biodiversity collapse in the Eastern Mediterranean Supplementary material: details on methods and additional results/figures and tables Paolo G. Albano1, Jan Steger1, Marija Bošnjak1,2, Beata Dunne1, Zara Guifarro1, Elina Turapova1, Quan Hua3, Darrell S. Kaufman4, Gil Rilov5, Martin Zuschin1 1 Department of Paleontology, University of Vienna, Althanstrasse 14, 1090 Vienna, Austria 2 Croatian Natural History Museum, Demetrova 1, Zagreb, Croatia 3 Australian Nuclear Science and Technology Organisation, Kirrawee DC, NSW 2232, Australia 4 School of Earth and Sustainability, Northern Arizona University, Flagstaff, Arizona 86011 USA 5 National Institute of Oceanography, Israel Oceanographic and Limnological Research (IOLR), Haifa 3108001, Israel 1 Additional information on the methodology 1.1 Study area and sampling sites Table S1. List of sampling stations on the Mediterranean coast of Israel. Latitude Longitude Station Locality Depth [m] Date Device Substrate Replicates [N] [E] Intertidal rocky substrate S8 Tel Aviv 32.08393 34.76573 Intertidal 27/04/2018 Scraping Breakwaters 3 S9 Netanya 32.32739 34.84591 Intertidal 29/04/2018 Scraping Breakwaters 4 S10 Ashqelon 31.68542 34.55967 Intertidal 30/04/2018 Scraping Breakwaters 4 S57 Ashqelon 31.68542 34.55967 Intertidal 31/10/2018 Scraping Breakwaters 3 S61 Netanya 32.32739 34.84591 Intertidal 02/11/2018 Scraping Breakwaters 3 Rocky S62 Nahariyya 33.01262 35.08973 Intertidal 06/11/2018 Scraping 3 platform S63 Tel Aviv 32.08393 34.76573 Intertidal 08/11/2018 Scraping Breakwaters 3 Subtidal
    [Show full text]
  • Diversity of Norwegian Sea Slugs (Nudibranchia): New Species to Norwegian Coastal Waters and New Data on Distribution of Rare Species
    Fauna norvegica 2013 Vol. 32: 45-52. ISSN: 1502-4873 Diversity of Norwegian sea slugs (Nudibranchia): new species to Norwegian coastal waters and new data on distribution of rare species Jussi Evertsen1 and Torkild Bakken1 Evertsen J, Bakken T. 2013. Diversity of Norwegian sea slugs (Nudibranchia): new species to Norwegian coastal waters and new data on distribution of rare species. Fauna norvegica 32: 45-52. A total of 5 nudibranch species are reported from the Norwegian coast for the first time (Doridoxa ingolfiana, Goniodoris castanea, Onchidoris sparsa, Eubranchus rupium and Proctonotus mucro- niferus). In addition 10 species that can be considered rare in Norwegian waters are presented with new information (Lophodoris danielsseni, Onchidoris depressa, Palio nothus, Tritonia griegi, Tritonia lineata, Hero formosa, Janolus cristatus, Cumanotus beaumonti, Berghia norvegica and Calma glau- coides), in some cases with considerable changes to their distribution. These new results present an update to our previous extensive investigation of the nudibranch fauna of the Norwegian coast from 2005, which now totals 87 species. An increase in several new species to the Norwegian fauna and new records of rare species, some with considerable updates, in relatively few years results mainly from sampling effort and contributions by specialists on samples from poorly sampled areas. doi: 10.5324/fn.v31i0.1576. Received: 2012-12-02. Accepted: 2012-12-20. Published on paper and online: 2013-02-13. Keywords: Nudibranchia, Gastropoda, taxonomy, biogeography 1. Museum of Natural History and Archaeology, Norwegian University of Science and Technology, NO-7491 Trondheim, Norway Corresponding author: Jussi Evertsen E-mail: [email protected] IntRODUCTION the main aims.
    [Show full text]
  • Phylum MOLLUSCA
    285 MOLLUSCA: SOLENOGASTRES-POLYPLACOPHORA Phylum MOLLUSCA Class SOLENOGASTRES Family Lepidomeniidae NEMATOMENIA BANYULENSIS (Pruvot, 1891, p. 715, as Dondersia) Occasionally on Lafoea dumosa (R.A.T., S.P., E.J.A.): at 4 positions S.W. of Eddystone, 42-49 fm., on Lafoea dumosa (Crawshay, 1912, p. 368): Eddystone, 29 fm., 1920 (R.W.): 7, 3, 1 and 1 in 4 hauls N.E. of Eddystone, 1948 (V.F.) Breeding: gonads ripe in Aug. (R.A.T.) Family Neomeniidae NEOMENIA CARINATA Tullberg, 1875, p. 1 One specimen Rame-Eddystone Grounds, 29.12.49 (V.F.) Family Proneomeniidae PRONEOMENIA AGLAOPHENIAE Kovalevsky and Marion [Pruvot, 1891, p. 720] Common on Thecocarpus myriophyllum, generally coiled around the base of the stem of the hydroid (S.P., E.J.A.): at 4 positions S.W. of Eddystone, 43-49 fm. (Crawshay, 1912, p. 367): S. of Rame Head, 27 fm., 1920 (R.W.): N. of Eddystone, 29.3.33 (A.J.S.) Class POLYPLACOPHORA (=LORICATA) Family Lepidopleuridae LEPIDOPLEURUS ASELLUS (Gmelin) [Forbes and Hanley, 1849, II, p. 407, as Chiton; Matthews, 1953, p. 246] Abundant, 15-30 fm., especially on muddy gravel (S.P.): at 9 positions S.W. of Eddystone, 40-43 fm. (Crawshay, 1912, p. 368, as Craspedochilus onyx) SALCOMBE. Common in dredge material (Allen and Todd, 1900, p. 210) LEPIDOPLEURUS, CANCELLATUS (Sowerby) [Forbes and Hanley, 1849, II, p. 410, as Chiton; Matthews. 1953, p. 246] Wembury West Reef, three specimens at E.L.W.S.T. by J. Brady, 28.3.56 (G.M.S.) Family Lepidochitonidae TONICELLA RUBRA (L.) [Forbes and Hanley, 1849, II, p.
    [Show full text]
  • Marine Science
    Western Indian Ocean JOURNAL OF Marine Science Volume 18 | Issue 1 | Jan – Jun 2019 | ISSN: 0856-860X Chief Editor José Paula Western Indian Ocean JOURNAL OF Marine Science Chief Editor José Paula | Faculty of Sciences of University of Lisbon, Portugal Copy Editor Timothy Andrew Editorial Board Lena GIPPERTH Aviti MMOCHI Sweden Tanzania Serge ANDREFOUËT Johan GROENEVELD France Cosmas MUNGA South Africa Kenya Ranjeet BHAGOOLI Issufo HALO Mauritius South Africa/Mozambique Nyawira MUTHIGA Kenya Salomão BANDEIRA Christina HICKS Mozambique Australia/UK Brent NEWMAN Betsy Anne BEYMER-FARRIS Johnson KITHEKA South Africa USA/Norway Kenya Jan ROBINSON Jared BOSIRE Kassim KULINDWA Seycheles Kenya Tanzania Sérgio ROSENDO Atanásio BRITO Thierry LAVITRA Portugal Mozambique Madagascar Louis CELLIERS Blandina LUGENDO Melita SAMOILYS Kenya South Africa Tanzania Pascale CHABANET Joseph MAINA Max TROELL France Australia Sweden Published biannually Aims and scope: The Western Indian Ocean Journal of Marine Science provides an avenue for the wide dissem- ination of high quality research generated in the Western Indian Ocean (WIO) region, in particular on the sustainable use of coastal and marine resources. This is central to the goal of supporting and promoting sustainable coastal development in the region, as well as contributing to the global base of marine science. The journal publishes original research articles dealing with all aspects of marine science and coastal manage- ment. Topics include, but are not limited to: theoretical studies, oceanography, marine biology and ecology, fisheries, recovery and restoration processes, legal and institutional frameworks, and interactions/relationships between humans and the coastal and marine environment. In addition, Western Indian Ocean Journal of Marine Science features state-of-the-art review articles and short communications.
    [Show full text]
  • 45–60 (2018) a Survey of Marine Mollusc Diversity in The
    Phuket mar. biol. Cent. Res. Bull. 75: 45–60 (2018) 3 A SURVEY OF MARINE MOLLUSC DIVERSITY IN THE SOUTHERN MERGUI ARCHIPELAGO, MYANMAR Kitithorn Sanpanich1* and Teerapong Duangdee2 1 Institute of Marine Science, Burapha University, Tumbon Saensook, Amphur Moengchonburi, Chonburi 20131 Thailand 2 Department of Marine Science, Faculty of Fisheries, Kasetsart University 50, Paholyothin Road, Chaturachak, Bangkhen District, Bangkok, 10900 Thailand and Center for Advanced Studies for Agriculture and Food, Kasetsart University Institute for Advanced Studies, Kasetsart University, Bangkok 10900 Thailand (CASAF, NRU-KU, Thailand) *Corresponding author: [email protected] ABSTRACT: A coral reef ecosystem assessment and biodiversity survey of the Southern Mergui Archipelago, Myanmar was conducted during 3–10 February 2014 and 21–30 January 2015. Marine molluscs were surveyed at 42 stations: 41 by SCUBA and one intertidal beach survey. A total of 279 species of marine molluscs in three classes were recorded: 181 species of gastropods in 53 families, 97 species of bivalves in 26 families and a single species of cephalopod (Sepia pharaonis Ehrenberg, 1831). A mean of 21.8 species was recorded per site. The range was from 4 to 96 species. The highest diversity site was at Kyun Philar Island. The most widespread species were the pearl oyster Pinctada margaritifera (Linnaeus, 1758) (33 sites), muricid Chicoreus ramosus (Linnaeus, 1758) (21 stations), turbinid Astralium rhodostomum (Lamarck, 1822) (19 sites) and the wing shell Pteria penguin (Röding, 1798) (16 sites). Data from this study were compared with molluscan studies from the Gulf of Thailand, the Andaman Sea sites in Thailand and Singapore. Fifty-eight mollusc species in Myanmar were not found in the other areas.
    [Show full text]
  • List of Marine Alien and Invasive Species
    Table 1: The list of 96 marine alien and invasive species recorded along the coastline of South Africa. Phylum Class Taxon Status Common name Natural Range ANNELIDA Polychaeta Alitta succinea Invasive pile worm or clam worm Atlantic coast ANNELIDA Polychaeta Boccardia proboscidea Invasive Shell worm Northern Pacific ANNELIDA Polychaeta Dodecaceria fewkesi Alien Black coral worm Pacific Northern America ANNELIDA Polychaeta Ficopomatus enigmaticus Invasive Estuarine tubeworm Australia ANNELIDA Polychaeta Janua pagenstecheri Alien N/A Europe ANNELIDA Polychaeta Neodexiospira brasiliensis Invasive A tubeworm West Indies, Brazil ANNELIDA Polychaeta Polydora websteri Alien oyster mudworm N/A ANNELIDA Polychaeta Polydora hoplura Invasive Mud worm Europe, Mediterranean ANNELIDA Polychaeta Simplaria pseudomilitaris Alien N/A Europe BRACHIOPODA Lingulata Discinisca tenuis Invasive Disc lamp shell Namibian Coast BRYOZOA Gymnolaemata Virididentula dentata Invasive Blue dentate moss animal Indo-Pacific BRYOZOA Gymnolaemata Bugulina flabellata Invasive N/A N/A BRYOZOA Gymnolaemata Bugula neritina Invasive Purple dentate mos animal N/A BRYOZOA Gymnolaemata Conopeum seurati Invasive N/A Europe BRYOZOA Gymnolaemata Cryptosula pallasiana Invasive N/A Europe BRYOZOA Gymnolaemata Watersipora subtorquata Invasive Red-rust bryozoan Caribbean CHLOROPHYTA Ulvophyceae Cladophora prolifera Invasive N/A N/A CHLOROPHYTA Ulvophyceae Codium fragile Invasive green sea fingers Korea CHORDATA Actinopterygii Cyprinus carpio Invasive Common carp Asia CHORDATA Ascidiacea
    [Show full text]
  • Phestilla (Gastropoda; Opisthobranchia) ⁎ Raphael Ritson-Williams A, , Sonia M
    This article was published in an Elsevier journal. The attached copy is furnished to the author for non-commercial research and education use, including for instruction at the author’s institution, sharing with colleagues and providing to institution administration. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier’s archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/copyright Author's personal copy Journal of Experimental Marine Biology and Ecology 351 (2007) 160–167 www.elsevier.com/locate/jembe Larval metamorphic competence in four species of Phestilla (Gastropoda; Opisthobranchia) ⁎ Raphael Ritson-Williams a, , Sonia M. Shjegstad b, Valerie J. Paul a a Smithsonian Marine Station at Fort Pierce, 701 Seaway Drive, Fort Pierce, FL 34949, United States b 46-010 Aliikane Place #221, Kaneohe, HI 96744, United States Received 21 November 2006; received in revised form 4 April 2007; accepted 20 June 2007 Abstract Many marine invertebrates depend on their larvae for dispersal and to find the appropriate habitat for adult survival, yet their larval ecology remains poorly known. In this study we test the time required until metamorphic competence in the veliger larvae of four species of Phestilla nudibranch. Larvae of Phestilla melanobrachia are planktotrophic and had the highest percentage of metamorphosis in response to the prey coral Tubastraea aurea.
    [Show full text]
  • 2018 Volume VI - Numéro 1 ÉDITEURS : Vincent LE GARREC Jacques GRALL
    2018 Volume VI - numéro 1 ÉDITEURS : Vincent LE GARREC Jacques GRALL COMITÉ ÉDITORIAL : Vincent LE GARREC Jacques GRALL Michel LE DUFF IUEM–UBO, Brest IUEM–UBO, Brest IUEM–UBO, Brest Michel GLÉMAREC Frédéric BIORET Daniela ZEPPILLI Professeur Professeur Ifremer, Brest UBO, Brest UBO, Brest Jérôme JOURDE Nicolas LAVESQUE OBIONE, LIENSs, La Rochelle EPOC, Arcachon ISSN 2263-5718 Observatoire – UMS 3113 Institut Universitaire Européen de la Mer Rue Dumont d’Urville Technopôle Brest-Iroise 29280 PLOUZANE France An aod - les cahiers naturalistes de l’Observatoire marin, vol. VI (1), 2018 Table des matières Nouveau signalement de l’algue rouge Centroceras clavulatum (Agardh) Mon- tagne dans les eaux bretonnes New occurence of Centroceras clavulatum (Agardh) Montagne on the coast of Brit- tany 1 Michel Le Duff, Vincent Le Garrec & Erwan Ar Gall Premier signalement de l’espèce non indigène Neomysis americana (Crus- tacé : Mysidacé) dans l’estuaire de la Seine (Normandie, France) First record of the non-indigenous species Neomysis americana (Crustacea: Mysi- dacea) in the Seine estuary (Normandy, France) 7 Cécile Massé, Bastien Chouquet, Séverine Dubut, Fabrice Durand, Benoît Gouillieux & Chloé Dancie First record of the non-native species Grandidierella japonica Stephensen, 1938 (Crustacea: Amphipoda: Aoridae) along the French Basque coast Premier signalement de l’espèce introduite Grandidierella japonica Stephensen, 1938 (Crustacé : Amphipode : Aoridae) au Pays basque dans sa partie française 17 Clémence Foulquier, Floriane Bogun, Benoît Gouillieux,
    [Show full text]
  • First Observation and Range Extension of the Nudibranch Tenellia Catachroma (Burn, 1963) in Western Australia (Mollusca: Gastropoda)
    CSIRO Publishing The Royal Society of Victoria, 129, 37–40, 2017 www.publish.csiro.au/journals/rs 10.1071/RS17003 A VICTORIAN EMIGRANT: FIRST OBSERVATION AND RANGE EXTENSION OF THE NUDIBRANCH TENELLIA CATACHROMA (BURN, 1963) IN WESTERN AUSTRALIA (MOLLUSCA: GASTROPODA) Matt J. NiMbs National Marine Science Centre, Southern Cross University, PO Box 4321, Coffs Harbour, NSW 2450, Australia Correspondence: [email protected] ABSTRACT: The southwest coast of Western Australia is heavily influenced by the south-flowing Leeuwin Current. In summer, the current shifts and the north-flowing Capes Current delivers water from the south to nearshore environments and with it a supply of larvae from cooler waters. The nudibranch Tenellia catachroma (Burn, 1963) was considered restricted to Victorian waters; however, its discovery in eastern South Australia in 2013 revealed its capacity to expand its range west. In March 2017 a single individual was observed in shallow subtidal waters at Cape Peron, Western Australia, some 2000 km to the west of its previous range limit. Moreover, its distribution has extended northwards, possibly aided by the Capes Current, into a location of warming. This observation significantly increases the range for this Victorian emigrant to encompass most of the southern Australian coast, and also represents an equatorward shift at a time when the reverse is expected. Keywords: climate change, Cape Peron, range extension, Leeuwin Current, Capes Current The fionid nudibranch Tenellia catachroma (Burn, 1963) first found in southern NSW in 1979 (Rudman 1998), has was first described from two specimens found at Point been observed only a handful of times since and was also Danger, near Torquay, Victoria, in 1961 (Burn 1963).
    [Show full text]
  • Table of Contents
    ALL INDIA CO-ORDINATED PROJECT ON TAXONOMY OF MOLLUSCA ANNUAL REPORT (December 2016 – May 2018) GUJARAT STATE BOMBAY NATURAL HISTORY SOCIETY Dr. Deepak Apte Director Dr. Dishant Parasharya Dr. Bhavik Patel Scientist – B Scientist – B All India Coordinated Project on Taxonomy – Mollusca , Gujarat State Acknowledgements We are thankful to the Department of Forest and Environment, Government of Gujarat, Mr. G. K. Sinha, IFS HoFF and PCCF (Wildlife) for his guidance and cooperation in the work. We are thankful to then CCF Marine National Park and Sanctuary, Mr. Shyamal Tikader IFS, Mr. S. K. Mehta IFS and their team for the generous support, We take this opportunity to thank the entire team of Marine National Park and Sanctuary. We are thankful to all the colleagues of BNHS who directly or indirectly helped us in our work. We specially thank our field assistant, Rajesh Parmar who helped us in the field work. All India Coordinated Project on Taxonomy – Mollusca , Gujarat State 1. Introduction Gujarat has a long coastline of about 1650 km, which is mainly due to the presence of two gulfs viz. the Gulf of Khambhat (GoKh) and Gulf of Kachchh (GoK). The coastline has diverse habitats such as rocky, sandy, mangroves, coral reefs etc. The southern shore of the GoK in the western India, notified as Marine National Park and Sanctuary (MNP & S), harbours most of these major habitats. The reef areas of the GoK are rich in flora and fauna; Narara, Dwarka, Poshitra, Shivrajpur, Paga, Boria, Chank and Okha are some of these pristine areas of the GoK and its surrounding environs.
    [Show full text]
  • The Extraordinary Genus Myja Is Not a Tergipedid, but Related to the Facelinidae S
    A peer-reviewed open-access journal ZooKeys 818: 89–116 (2019)The extraordinary genusMyja is not a tergipedid, but related to... 89 doi: 10.3897/zookeys.818.30477 RESEARCH ARTICLE http://zookeys.pensoft.net Launched to accelerate biodiversity research The extraordinary genus Myja is not a tergipedid, but related to the Facelinidae s. str. with the addition of two new species from Japan (Mollusca, Nudibranchia) Alexander Martynov1, Rahul Mehrotra2,3, Suchana Chavanich2,4, Rie Nakano5, Sho Kashio6, Kennet Lundin7,8, Bernard Picton9,10, Tatiana Korshunova1,11 1 Zoological Museum, Moscow State University, Bolshaya Nikitskaya Str. 6, 125009 Moscow, Russia 2 Reef Biology Research Group, Department of Marine Science, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand 3 New Heaven Reef Conservation Program, 48 Moo 3, Koh Tao, Suratthani 84360, Thailand 4 Center for Marine Biotechnology, Department of Marine Science, Faculty of Science, Chulalongkorn Univer- sity, Bangkok 10330, Thailand5 Kuroshio Biological Research Foundation, 560-I, Nishidomari, Otsuki, Hata- Gun, Kochi, 788-0333, Japan 6 Natural History Museum, Kishiwada City, 6-5 Sakaimachi, Kishiwada, Osaka Prefecture 596-0072, Japan 7 Gothenburg Natural History Museum, Box 7283, S-40235, Gothenburg, Sweden 8 Gothenburg Global Biodiversity Centre, Box 461, S-40530, Gothenburg, Sweden 9 National Mu- seums Northern Ireland, Holywood, Northern Ireland, UK 10 Queen’s University, Belfast, Northern Ireland, UK 11 Koltzov Institute of Developmental Biology RAS, 26 Vavilova Str., 119334 Moscow, Russia Corresponding author: Alexander Martynov ([email protected]) Academic editor: Nathalie Yonow | Received 10 October 2018 | Accepted 3 January 2019 | Published 23 January 2019 http://zoobank.org/85650B90-B4DD-4FE0-8C16-FD34BA805C07 Citation: Martynov A, Mehrotra R, Chavanich S, Nakano R, Kashio S, Lundin K, Picton B, Korshunova T (2019) The extraordinary genus Myja is not a tergipedid, but related to the Facelinidae s.
    [Show full text]