And Β-Cells That Control Glucose Homeostasis

Molecular Mechanisms of Cell Cycle Regulation in Pancreatic α- and β-cells that Control Glucose Homeostasis

Erica Pei-Shan Cai

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Institute of Medical Science University of Toronto

Molecular mechanisms of cell cycle regulation

in pancreatic α- and β-cells that control glucose homeostasis

Erica Pei-Shan Cai

Doctor of Philosophy

Institute of Medical Science University of Toronto 2014

Abstract

Pancreatic islet cell mass is achieved through a rapid surge of neogenesis and proliferation during embryogenesis. However, this plasticity declines significantly in the postnatal period, resulting in the majority of mature islet cells, which permanently exit from cell cycle and are incapable of regenerating in adulthood. Understanding the molecular mechanisms that govern both neogenesis and proliferation in islet cells is paramount for treatment of both type 1 and type 2 diabetes. In this thesis, genetically modified mice were used to investigate molecular mechanisms of specific cell cycle regulators in α- and β-cell homeostasis under physiological and experimentally-induced diabetes. Specifically, in

Chapter IV, I describe the consequences of deleting the retinoblastoma protein (Rb) in proliferating islet progenitor cells. I show that loss of Rb increases β- to α-cell ratio by regulating cell proliferation, differentiation and survival, leading to improved glucose homeostasis and protection against diabetes. In Chapter V, I demonstrate that a central role for Rb, but not its family member p107, in the dual effects of GLP-1 on α- and β-cells in governing islet cell proliferation and survival. In Chapter VI, I show that the focal

iii

adhesion kinase (FAK) is critical for in vivo pancreatic β-cell viability and function through regulation of insulin signalling, actin dynamics and granule trafficking. Thus, studies in this thesis define novel functions of cell cycle regulators, Rb, p107 and FAK in regulating pancreatic α- and β-cell fate. Together, the results presented in the thesis provide novel mechanisms for enhancing islet mass and integrity, which may lead to new strategies to combat diabetes.

Acknowledgments

The work presented in Chapter IV, V and VI was supported by the Canadian Institute

Health Reseach (CIHR) operating grants MOP-81148 and CCI-125690 to Minna Woo.

Chapter VI of this thesis was also supported by Canadian Diabetes Association (CDA)

Grant-in-Aid to Patrick E. MacDonald.

My graduate stipend was in part supported by the Canadian Diabetes Association

Doctoral Student Research Award.

I sincerely thank my supervisor, Dr. Minna Woo, for her guidance and support, and my program advisory committee members, Dr. Allen Volchuk and Dr. Eldad Zacksenhaus, for their support and mentorship throughout the years. I also would like to thank all of our collaborators, Dr. Xiaohong Wu, Dr. Andrew J. Elia, Dr. M. Cristina Nostro, Dr. Marina

Casimir, Dr. Xiao Qing Dai, Catherine Hajmrle, Aliya F. Spigelman, Dr. Patrick E.

MacDonald, Dr. Dan Zhu, Dr. Herbert Y. Gaisano. Lastly, I want to thank all the past and present members of the Woo laboratory, Stephanie Schroer, Sally Shi, Cynthia Luk,

Tharini Sivasubramaniyam, Jara Brunt, Shunyan Lu, Diana Choi, Linyuang Wang, Rubén

García.

Manuscript arising from this thesis work

1. Erica P. Cai, Xiaohong Wu, Stephanie A. Schroer, Andrew J. Elia, M. Cristina Nostro,

Eldad Zacksenhaus and Minna Woo. (2013) Retinoblastoma tumor suppressor

protein in pancreatic progenitors controls α- and β-cell fate. Proc Natl Acad Sci U S

A. 110(36):14723-8

2. Erica P. Cai*, Marina Casimir*, Stephanie A. Schroer, Cynthia T. Luk, Sally Yu Shi,

Diana Choi, Xiao Qing Dai, Catherine Hajmrle, Aliya F. Spigelman, Dan Zhu,

Herbert Y. Gaisano, Patrick E. MacDonald and Minna Woo. (2012) In vivo role of

Focal Adhesion Kinase in regulating pancreatic β-cell mass and function through

insulin signalling, actin dynamics and granule trafficking. Diabetes. 61(7):1708-18

*Authors with equal contributions

3. Erica P. Cai, Xiaohong Wu, Eldad Zacksenhaus and Minna Woo. (2014) Timing is

everything: Rb’s choice in islet cell fate. Cell Cycle. 13(6): 873-4

4. Erica P. Cai, Xiaohong Wu, Stephanie A. Schroer, Sally Y. Shi, Cynthia T. Luk,

Tharini Sivasubramaniyam, Jara Brunt, Eldad Zacksenhaus and Minna Woo. (2014)

Pivotal role for Rb and p107 in α- and β-cell cycle control and response to GLP-1.

Under review in Diabetologia

Other Publications

1. Cynthia T. Luk, Sally Yu Shi, Diana Choi, Erica P. Cai, Stephanie A. Schroer,

Minna Woo. (2013) In vivo knockdown of adipocyte erythropoietin receptor does

not alter glucose or energy homeostasis. Endocrinology. 154(10):3652-9

2. Yunfeng Liu*, Yi Zhang*, Dan Zhu*, Erica P. Cai, Diana Choi, Stephanie A.

Schroer, Patrick P.L. Lam, Youhou Kang, Minna Woo, Herbert Y. Gaisano. (2012)

VAMP8 deletion delays the onset of streptozotocin-induced hyperglycemia.

Canadian Journal of Diabetes. 36(5):251-256

*Authors with equal contributions

3. Dan Zhu*, Yi Zhang,*, Patrick P. L. Lam,*, Subhankar Dolai,*, Yunfeng Liu,*,

Erica P. Cai, Diana Choi, Stephanie Schroer, Youhou Kang, Emma M. Allister,

Tairan Qin, Michael B. Wheeler, Cheng-Chun Wang, Wan-Jin Hong, Minna Woo,

Herbert Y. Gaisano. (2012) Dual Role of VAMP8 in Regulating insulin exocytosis

and islet β-cell Growth. Cell Metabolism. Aug 8;16(2):238-49

*Authors with equal contributions

4. Sally Yu Shi, Rubén Garcia Martin, Robin E. Duncan, Diana Choi, Shun Yan Lu,

Stephanie A. Schroer, Erica P. Cai, Cynthia T. Luk, Christine Tang, Mark Naples,

Mark J. Dekker, Adria Giacca, Khosrow Adeli, Kay-Uwe Wagner, Richard P.

vii

Bazinet, and Minna Woo. (2012) Hepatocyte-specific deletion of Janus kinase 2

(JAK2) protects against diet-induced steatohepatitis and glucose intolerance. J Biol

Chem. 287(13):10277-88

5. Diana Choi, Erica P. Cai, and Minna Woo. (2011) The redundant role of JAK2 in

regulating pancreatic β-cell mass. Islets. Nov-Dec;3(6):389-92

6. Diana Choi, Stephanie A. Schroer, Shun Yan Lu, Erica P. Cai, Zhenyue Hao,

Minna Woo. (2011) Redundant role of the cytochrome c-mediated intrinsic

apoptotic pathway in pancreatic β-cells. J. Endocrinol. 210(3):285-92

7. Diana Choi*, Erica P. Cai*, Stephanie A. Schroer, Linyuan Wang, and Minna Woo.

(2011) VHL is required for normal pancreatic β-cells function and the maintenance

of β-cell mass with age in mice. Lab Invest. 91(4):527-38

*Authors with equal contributions

viii

List of Figures

Chapter I: Introduction

Figure I- 1 The specification of the endocrine pancreas...... 6 Figure I- 2 β-cell function: glucose-stimulated insulin secretion...... 11 Figure I- 3 Glucagon secretory pathway in the pancreatic α-cells...... 17 Figure I- 4 The regulation of Rb in cell cycle control...... 35 Figure I- 5 FAK domain structure and phosphorylation sites...... 41

Chapter IV: Rb in pancreatic progenitors controls α- and β-cell fate

Figure IV- 1 Rb specific deletion expression in mouse islets...... 72 Figure IV- 2 Increased islet precursors in p-RbKO mice...... 73 Figure IV- 3 Increased islet neogenic markers in p-RbKO mice...... 75 Figure IV- 4 Increased postnatal neogenesis in p-RbKO mice...... 76 Figure IV- 5 Effects of Rb on α–cell mass and development...... 78 Figure IV- 6 The regulatory role of Rb/E2f1 on Arx gene expression...... 79 Figure IV- 7 Increased β–cell mass in p-RbKO mice...... 82 Figure IV- 8 Increased β–cell function in p-RbKO mice...... 83 Figure IV- 9 Differential Rb expression level in α– and β-cells...... 85 Figure IV- 10 Opposing effects of Rb deletion on α– and β-cells...... 86 Figure IV- 11 Increased cell proliferation and p53 attenuation in Rb-deficient islets...... 88 Figure IV- 12 Improved glucose tolerance in p-RbKO mice...... 90 Figure IV- 13 p-RbKO mice display protection against STZ-induced diabetes...... 93 Figure IV- 14 Diagram illustrating the mechanisms of Rb regulating pancreatic α- and β-cell differentiation, mass and function...... 94

Chapter V: Pivotal role for Rb and p107 in α- and β-cell cycle control and response to GLP-1

Figure V- 1 Dichotomous role of Rb level is associated with islet cycle control...... 101 Figure V- 2 Exendin-4 administration in Rb- and/or p107-deficient mice...... 104 Figure V- 3 Expression levels of Rb family members in islets during diabetes development. .. 105 Figure V- 4 Rb/p107 deficiency in islets improves glucose tolerance in young but not old aged mice...... 106 Figure V- 5 Rb/p107 deficiency in islets leads to reduced α-cell mass...... 109 Figure V- 6 Deficiency of Rb and p107 in islets leads to increased cell apoptosis...... 110

Figure V- 7 Deletion of Rb and p107 in α- and β-cells leads to increased apoptosis through E2f1- Arf activity...... 114 Figure V- 8 Diagram of Rb family members in regulating islet cell fate...... 115

Chapter VI: The in vivo role of FAK in pancreatic β-cells

Figure VI- 1 Specific deletion of FAK in the pancreatic β-cells...... 121 Figure VI- 2 FAK deficiency in β-cells leads to glucose intolerance...... 123 Figure VI- 3 Reduced cell mass in FAK-deficient β-cells due to decreased proliferation and enhanced susceptibility to apoptosis...... 124 Figure VI- 4 Islet architecture and signal transduction pathways...... 127 Figure VI- 5 Reduced insulin secretion in FAK-deficient β-cells with normal GLUT2 expression...... 129 Figure VI- 6 Normal Ca+2 response in FAK-deficient β-cells...... 130 Figure VI- 7 Deletion of FAK in β-cells results in impaired actin depolymerisation and reduced phosphorylated paxillin and talin expression levels...... 132 Figure VI- 8 Reduced co-localization of paxillin and t-SNARE proteins in FAK-deficient β-cells...... 134 Figure VI- 9 Impaired insulin granule trafficking in FAK-deficient β-cells leads to reduce number of docked insulin granules...... 137 Figure VI- 10 Impaired exocytotic responses in FAK-deficient β-cells...... 138 Figure VI- 11 Diagram illustrating the mechanisms of FAK regulating pancreatic β-cell proliferation and function...... 139

List of Tables

Table 1: Primer sequences for quantitative real-time PCR ...... 63

List of Abbreviations

ADP Adenosine diphosphate Apaf1 Apoptotic protease activating factor 1 APC Antigen-presenting cell Arf Adp-ribosylation factor Arx Aristaless related homeobox arx ASPP Apoptosis-stimulating protein of p53 ATP Adenosine triphosphate cAMP Cyclic adenosine monophosphate Ccnd1 Cyclin D1 Ccne Cyclin E Cdk Cyclin-dependent kinase ChIP Chromatin immunoprecipitation DP Dimerization partner ECM Extracellular matrix EGFR Epidermal growth factor receptor ER Endoplasmic reticulum FAK Focal adhesion kinase FasL Fas ligand FAT Focal adhesion-targeting FERM N-terminal band 4.1, ezrin, radixin, moesin homology FFA Free fatty acids G-6-P Glucose-6-phosphate GABA γ-aminobutyric acid GH Growth hormone GLP-1 Glucagon-like peptide-1 GLUT Glucose transporter GSIS Glucose stimulated insulin secretion GTT Glucose tolerance test H&E Hematoxylin and Eosin HBSS Hank’s balanced salt solution HDAC Histone deacetylase IGF-1 Insulin-like growth factor-1 IL Interleukin iNOS Inducible nitric oxide synthase IR Insulin receptor IRS Insulin receptor substrate ITT Insulin tolerance test

xii

KATP channel ATP-sensitive potassium channel LDH Lactate dehydrogenase MafA Muscoloaponeurotic fibrosarcoma oncogene family proteins a MCT Monocarboxylate transporter Mdm2 Mouse double minute 2 MHC Major histocompatibility complex MLDS Multiple low-dose streptozotocin NES Nuclear export signal NeuroD1 Neurogenic differentiation 1 Ngn3 Neurogenin3 Nkx6.1 Nk6 homeobox 1 NLS Nuclear localization sequence NO Nitric oxide NOD mice Non-obese diabetic mouse Pax4 Paired box 4 PCNA Proliferating cell nuclear antigen PDGFR Platelet-derived growth factor receptor PDLN Pancreatic draining lymph node Pdx1/IPF-1 Pancreatic duodenal homeobox 1/insulin promoting factor-1 PGC-1α Peroxisome proliferator-activated receptor γ coactivator-1 α PI3K Phosphatidyl inositol 3-kinase PKA Protein kinase A Ppar γ Peroxisome proliferator-activated receptor γ PP-cell Pancreatic polypeptide-cell PUMA P53-upregulated modulator of apoptosis Rb Retinoblastoma protein RIP Rat insulin promoter ROS Reactive oxygen species Runx2 Runt-related transcription factor x 2 SH Src-homology Shh Sonic hedgehog siRNA Small interfering RNA SNARE Soluble N-ethylmaleimide-sensitive factor attachment protein receptor STZ Streptozotocin SUMO Small ubiquitin-related modifier SWI/SNF SWItch/Sucrose NonFermentable TCA Tricarboxylic acid TNFR1 Tumor necrosis factor receptor 1 TNF-α Tumor necrosis factor-α

xiii

TUNEL Terminal deoxynucleotidyl transferase dNTP nick end labeling VDCC Voltage dependent calcium channels

xiv

Table of Contents

ABSTRACT ...... II ACKNOWLEDGMENTS ...... IV MANUSCRIPT ARISING FROM THIS THESIS WORK ...... V OTHER PUBLICATIONS ...... VI LIST OF FIGURES ...... VIII LIST OF TABLES ...... X LIST OF ABBREVIATIONS ...... XI CHAPTER I: INTRODUCTION ...... 1

I. 1. THE PANCREATIC ISLETS ...... 2 I. 1-1 The pancreas and the pancreatic islets ...... 2 I. 1-2 Pancreas Development ...... 4 I. 1-2A Pancreas genesis ...... 4 I. 1-2B Pancreatic α- and β-cell development ...... 5 I. 2. ISLET CELL HOMEOSTASIS ...... 7 I. 2-1 Pancreatic β-cell Mass ...... 8 I. 2-2 Pancreatic β-cell Function ...... 9 I. 2-3 Regulation of β-cell Homeostasis ...... 12 I. 2-3A Insulin and insulin-like growth factor-1 ...... 12 I. 2-3B Glucagon-like peptide-1 ...... 12 I. 2-3C Lactogenic hormones and growth hormone ...... 13 I. 2-3D Cell cycle regulators ...... 14 I. 2-4 Pancreatic α-cell function ...... 15 I. 2-5 Regulation of α-cell Homeostasis ...... 18 I. 2-5A Insulin ...... 18 I. 2-6B GABA ...... 19 I. 2-6C Zinc ...... 19 I. 2-6D Glucagon ...... 20 I. 2-6E Glucagon-like peptide-1 ...... 21 I. 3. DIABETES MELLITUS ...... 22 I. 3-1 Type 1 autoimmune diabetes ...... 22 I. 3-1A Insulitis ...... 23 I. 3-1B β-cell destruction ...... 24 I. 3-1C α-cell dysfunction ...... 26 I. 3-2 Type 2 diabetes ...... 27 I. 3-2A Defects in β-cells...... 27 I. 3-2B Defects in α-cells ...... 29 I. 4 RETINOBLASTOMA PROTEIN ...... 30 I. 4-1 Rb family proteins ...... 30 I. 4-2 Mechanisms of Rb Action ...... 31 I. 4-2A Interaction with E2f family members ...... 31 I. 4-2B Cell cycle restriction point: G1/S transition ...... 33 I. 4-2C Cell apoptosis ...... 36 I. 4-2D Cell differentiation: cell fate decision ...... 38

I. 5 FOCAL ADHESION KINASE ...... 39 I. 5-1 Structure and Function of FAK ...... 39 I. 5-1-A The N-terminal FERM domain of FAK ...... 40 I. 5-1-B The C-terminal FAT domain of FAK ...... 42 I. 5-1-C The central kinase domain of FAK ...... 42 I. 5-2 Actions of FAK ...... 43 I. 5-2A Signalling of Extracellular Matrix/FAK in cell motility ...... 43 I. 5-2B Signalling of FAK in cell proliferation ...... 44 I. 5-2C Signalling of FAK in insulin signalling ...... 44 CHAPTER II: THESIS OBJECTIVES AND HYPOTHESES ...... 46 CHAPTER III: MATERIALS AND METHODS ...... 50

III. 1 MOUSE PROTOCOL ...... 51 III. 2 DNA EXTRACTION...... 52 III. 3 PCR GENOTYPING ...... 53 III. 4 IN VIVO METABOLIC STUDIES AND HORMONE MEASUREMENTS ...... 54 III. 5 MULTIPLE LOW-DOSE STREPTOZOTOCIN (MLDS): INDUCTION OF TYPE 1 DIABETES (CHAPTER IV AND VI) ...... 55 III. 6 IMMUNOHISTOCHEMISTRY AND IMMUNOFLUORESCENT STAINING ...... 55 III. 7 TERMINAL DEOXYNUCLEOTIDYL TRANSFERASE DUTP NICK END LABELING (TUNEL) ...... 56 III. 8 ISLET MORPHOMETRY ...... 57 III. 9 ISLET ISOLATION ...... 57 III. 10 ISLET INSULIN CONTENT (CHAPTER IV AND VI) ...... 58 III. 11 CHROMATIN IMMUNOPRECIPITATION (CHIP) (CHAPTER IV) ...... 58 III. 12 CELL CULTURE, SIRNA TRANSFECTION, EXENDIN-4 TREATMENT AND ADENOVIRUS INFECTION (CHAPTER IV AND V) ...... 59 III. 13 WESTERN BLOTTING ...... 60 III. 14 PROPIDIUM IODIDE STAINING AND FLOW CYTOMETRY (CHAPTER IV AND V) ...... 60 III. 15 CELL, MOUSE AND HUMAN RNA EXTRACTION AND QUANTITATIVE REAL-TIME PCR (CHAPTER IV AND V) ...... 61 III. 16 ADMINISTRATION OF EXENDIN-4 (CHAPTER V) ...... 62 III. 17 TRANSMISSION ELECTRON MICROSCOPY (CHAPTER VI) ...... 62 III. 18 F-ACTIN DYNAMICS AND CO-LOCALIZATION OF FOCAL ADHESION PROTEINS (CHAPTER VI) ...... 62 III. 19 ELECTROPHYSIOLOGY (CHAPTER VI) ...... 65 III. 20 STATISTICAL ANALYSIS ...... 65 CHAPTER IV: RB IN PANCREATIC PROGENITORS CONTROLS Α- AND Β-CELL FATE ..... 66

IV.1 INTRODUCTION ...... 67 IV. 2 MOUSE MODELS AND EXPERIMENTAL DESIGN ...... 69 IV. 3 RESULTS ...... 71 IV. 3-1 Rb-deficiency in islet precursors promotes β-cell fate through differentiation and neogenesis ...... 71 IV. 3-2 Rb ablation disrupts α-cell development...... 77 IV. 3-3 Rb deletion in islet precursors leads to increased β-cell mass and function ...... 80 IV. 3-4 Rb has opposing effects on α– and β–cell survival ...... 84 IV. 3-5 p-RbKO mice have increased β-cell mass with improved glucose tolerance ...... 87 IV. 3-6 p-RbKO mice are protected from STZ-induced diabetes ...... 91

xvi

IV. 4 SUMMARY ...... 92 CHAPTER V: PIVOTAL ROLE FOR RB AND P107 IN Α- AND Β-CELL CYCLE CONTROL AND RESPONSE TO GLP-1 ...... 95

V. 1 INTRODUCTION ...... 96 V. 2 MOUSE MODELS AND EXPERIMENTAL DESIGN ...... 98 V. 3 RESULTS ...... 99 V. 3-1 Critical role of Rb decline in mediating exendin-4 action on α- and β-cells ...... 99 V. 3-2 Reduction of Rb but not p107 in islets of humans with diabetes ...... 102 V. 3-3 Unique role of p107 in potentiating effects of Rb-deficiency in regulating islets homeostasis ...... 103 V. 3-4 Disruption of Rb and p107 in α- and β-cells leads to deregulation of E2f ...... 108 V. 4 Summary ...... 112 CHAPTER VI: THE IN VIVO ROLE OF FAK IN PANCREATIC Β-CELLS ...... 116

VI. 1 INTRODUCTION ...... 117 VI. 2 MOUSE MODELS AND EXPERIMENTAL DESIGN ...... 119 VI. 3 RESULTS ...... 120 VI. 3-1 Specific deletion of FAK in β-cells and glucose homeostasis ...... 120 VI. 3-2 Reduced β-cell mass in RIPcre+fakfl/fl mice due to decreased proliferation and increased apoptosis ...... 122 VI. 3-3 FAK-deficient pancreatic β-cells show intact islet architecture but reduced insulin signalling ...... 125 VI. 3-4 Impaired glucose-stimulated insulin secretion with normal GLUT2 and Ca2+ response in FAK–deficient β-cells ...... 128 VI. 3-5 Defective actin dynamics and decreased focal proteins in FAK-deficient β-cells ...... 131 VI. 3-6 FAK-deficient β-cells have impaired insulin granule trafficking ...... 133 VI. 4 SUMMARY ...... 135 CHAPTER VII: DISCUSSION AND FUTURE PERSPECTIVES ...... 140

VII. 1 THE ROLE OF RB AND P107 IN PANCREATIC Α- AND Β-CELLS AND GLUCOSE HOMEOSTASIS ...... 141 VII. 2 THE ROLE OF COMBINED RB AND P107 DEFICIENCY IN Α-CELLS ...... 143 VII. 3 THE ROLE OF RB IN PANCREATIC Α- AND Β-CELL PROLIFERATION AND APOPTOSIS DURING THE POSTNATAL PERIOD ...... 144 VII. 4 THE ROLE OF RB IN PANCREATIC Α- AND Β-CELL LINEAGE COMMITMENT ...... 145 VII. 5 THE REGULATION OF E2F1, ARF AND P53 IN PANCREATIC Α- AND Β-CELLS BY RB FAMILY MEMBERS IN DETERMINING CELL SURVIVAL ...... 146 VII. 6 THE POTENTIAL ROLE OF RB IN CELL FATE REGULATION AND METABOLIC HOMEOSTASIS ...... 147 VII. 7 THE POTENTIAL ROLE OF RB IN CELL REGENERATION ...... 149 VII. 8 THE ROLE OF FAK IN THE REGULATION OF Β-CELL MASS ...... 150 VII. 9 THE ROLE OF FAK IN Β-CELL FUNCTION ...... 151 VII. 10 CONCLUSION REMARKS ...... 152 CHAPTER VIII: REFERENCES ...... 155 CHAPTER IX: PERMISSIONS ...... 181

Chapter I: Introduction

I. 1. The Pancreatic Islets

I. 1-1 The pancreas and the pancreatic islets

The pancreas is a complex glandular organ which participates in the digestion and endocrine systems through a network of three major pancreatic cell types. Specifically these include (i) digestive enzyme-producing exocrine acinar cells, which release proteases, lipases and amylases to formulate pancreatic juice that helps break down nutrients in the small intestine; (ii) ductal cells that form the branched ducts to deliver digestive enzymes secreted by acinar cells into the duodenum; and (iii) endocrine islet cells that consist of five cell types: α-, β-, δ-, ε-, and pancreatic polypeptide (PP)-cells (Grapin-Botton, 2005; Gu et al., 2003).

Mature islet cells are clustered into a spheroidal architecture called islets of

Langerhans, which are dispersed throughout the exocrine tissue. The endocrine pancreas comprises only of 1-2 % of the whole pancreas volume (mouse pancreas contains ~1000 islets and human pancreas contains ~1,000,000 islets), but within each islet, each type of islet cells can secrete unique hormones to regulate energy homeostasis (Ravier and Rutter,

2010). For instance, the majority (~80 %) of the whole islet cell population is composed of insulin-producing β-cells (Nir and Dor, 2005), while glucagon-producing α-cells make up about 15 % of the population, and the remaining 5 % is occupied by somatostatin- producing δ-cells, ghrelin-producing ε-cells and pancreatic polypeptide-producing PP-cells

(Kulkarni, 2004; Wierup et al., 2013).

Pancreatic β-cells are the exclusive cell type capable of secreting insulin into the circulation and play an essential role in regulating whole body energy homeostasis. In healthy individuals, glycemic levels are tightly controlled within a narrow physiological range, between 4 mmol/L and 7.8 mmol/L (Ceriello and Colagiuri, 2008; Engelgau et al.,

2000), regardless of variations caused from fasting and feeding. β-cell hormone insulin enhances the circulating glucose uptake into peripheral insulin-responsive tissues, primarily in skeletal muscle and adipose tissue. In addition, insulin inhibits glucose output in liver and promotes nutrient storage in liver, skeletal muscle and adipose tissue by increasing synthesis of glycogen, protein and lipid, and inhibits the breakdown processes of nutrients within these tissues (Saltiel and Kahn, 2001). As such, changes of β-cell number and function directly result in impaired fuel metabolism (Stumvoll et al., 2005).

Loss of β-cell mass or insulin insufficiency may lead to development of type 1 or type 2 diabetes mellitus (Cnop et al., 2005).

Moreover, pancreatic α-cells, the second largest population within the islets, also plays a critical role in glucose metabolism. Pancreatic α–cell hormone glucagon stimulates glycogen breakdown in liver, thereby increasing hepatic glucose output into the circulation.

As an insulin-counteracting hormone, glucagon elevates circulating glucose levels by releasing glucose from peripheral tissues to prevent hypoglycemia. As such, there is evidence to show that dysregulation of α-cell mass or function also contributes to both type

1 and type 2 diabetes pathogenesis (Del Prato and Marchetti, 2004; Ehses et al., 2009; Li et al., 2000). It is therefore essential to understanding the underlying molecular mechanisms that regulate both α- and β-cell homeostasis.

I. 1-2 Pancreas Development

I. 1-2A Pancreas genesis

During the early phase of vertebrate embryogenesis, the single-layered blastula is reorganized into a three-layered structure known as the gastrula. These three primary germ layers are well-recognized as the ectoderm (outside layer), mesoderm (middle layer) and endoderm (inside layer). Each of these germ layers will give rise to specific tissues and form body systems. The ectoderm differentiates into the skin and the central nervous system; the mesoderm develops into muscles, bone, cartilage, blood cells and vessels and connective tissues; and the endoderm gives rise to the respiratory and digestive systems

(Jensen et al., 2000). Pancreas endocrine cells have been suggested to arise from the ectoderm as they carry neural markers (Apelqvist et al., 1999). However, a lineage-tracing experiment in vitro, culturing genetically-tagged pancreatic epithelium with mesenchyme, showed first evidence that islet cells are of an endodermal origin (Percival and Slack, 1999).

During embryogenesis, the morphological features of the early pancreas become distinct at embryonic day 8.75 (E8.75) in mice and E28 in humans. The pancreas arises from the foregut/midgut junction to form a primitive region of pancreatic epithelium decorated gut endoderm (Peters et al., 2000). The dorsal gut endoderm then thickens and outgrows into an evagination called the dorsal pancreatic bud at E9.5 in mice and the ventral bud subsequently appears at E10.25. The ventral bud later rotates dorsally and eventually fuses with the dorsal bud to form the pancreas by E12.5 (Jorgensen et al., 2007;

Pictet et al., 1972; Slack, 1995).

I. 1-2B Pancreatic α- and β-cell development

The pancreas ductal, exocrine and endocrine cells emerge from a common embryological origin - the gut endoderm (Slack, 1995). Multipotent stem/progenitor cells in the gut endoderm are able to adopt a specific cell fate through a complex genetic programme of a hierarchical network of genetic factors and signal induction from adjacent tissues (Edlund, 2002; Kim and Hebrok, 2001). Specifically, the notochord signals from mesenchymal tissue inhibit expression of Sonic Hedgehog (Shh) in the primitive gut endoderm. This suppression permits the differentiation process towards a pancreatic lineage and subsequent expression of pancreatic transcription factors.

Expression of pancreatic duodenal homeobox 1/insulin promoting factor-1

(Pdx1/IPF-1) starts at mouse E8.5, which represents the onset of pancreas development

(Figure I-1). Pdx1-expressing progenitor cells between E9.5 and E11.5 differentiate into pancreatic ductal, acinar or islet cells; and by E12.5, Pdx1 is selectively expressed in either exocrine or endocrine cells. After E13.5, Pdx1 becomes exclusively expressed in endocrine α- and β-cells and ultimately its expression is restricted to β-cells postnatally.

Following Pdx1 induction, specification of endocrine islet cell lineage is first controlled by activation of Neurogenin3 (Ngn3) (Apelqvist et al., 1999). Following Ngn3 activation,

Figure I- 1 The specification of the endocrine pancreas. A diagram outlining the differentiation cascade of pancreatic endocrine islet cell fate decision.

two homeodomain-containing transcription factors, paired box 4 (Pax4) and aristaless relatedhomeobox (Arx), act as transcription repressors to each other to mediate proper endocrine islet cell specification (Collombat et al., 2005). Lacking expression of Arx, endocrine precursor cells flavour β- and δ-cell fate specification at the expense of α-cells

(Collombat et al., 2003). In contrast, mice lacking Pax4 present an opposite phenotype, showing a favourable differentiation towards α- and PP-cell development (Sosa-Pineda et al., 1997).

Following the specification of the α- and β-cell lineage by Arx and Pax4, respectively, several transcription factors that are critical for proper islet cell allocation and maturation have been described (Lin and Vuguin, 2012). Specifically, pancreatic β-cell fate is primarily specified by Pax4 and followed by the expression of Nkx6.1, Nkx2.2, MafA and

Pax6, which promote full differentiation towards β-cells. Arx determines pancreatic α-cell identity and subsequent activations of Foxa2, Pax6, Brn4 and MafB are required for a completed α-cell differentiation. The islet cell differentiation programme is a complex and tightly regulated process by multiple genetic factors and proper islet cell specification is essential for glucose homeostasis. Thus dysregulation in this process can lead to impaired glucose homeostasis resulting in diabetes mellitus.

I. 2. Islet Cell Homeostasis

I. 2-1 Pancreatic β-cell Mass

The homeostatic control of -cell mass in both normal and pathophysiological conditions is based on the balance of β-cell neogenesis, proliferation and apoptosis. Adult

β-cell mass is primarily generated by the replication of pre-existing β-cells (Dor et al.,

2004). In adult rodent islets, β-cell neogenesis is a rare event during postnatal period but has been shown to occur under more severe circumstances, such as extreme β-cell loss or partial pancreatectomy (Collombat et al., 2010; Gu et al., 2003). However, whether facultative pancreatic stem/progenitor cells contribute to postnatal neogenesis still remains highly controversial (Bouwens and Rooman, 2005; Gu et al., 2003; Xiao et al., 2013).

Together, the contributions made by cell growth, neogenesis, proliferation, cell loss and apoptosis to the total islet mass vary throughout the lifespan depending on the metabolic demand (Bonner-Weir, 2000b).

During mouse embryogenesis, the β-cell number rapidly expands in the late fetal gestation with a ~10 % high cell proliferation rate, doubling islet cell mass daily from E16 to the prenatal period (Bouwens and Rooman, 2005; Hellerstrom and Swenne, 1991). This is followed by a wave of β-cell apoptosis that peaks after birth during the postnatal remodelling period in rodents and humans (Bonner-Weir, 2000b; Kassem et al., 2000).

Subsequently, β-cell population grows at a rate of 2-3% per day postnatally, as a result of expansion of cell mass from proliferation and neogenesis (Finegood et al., 1995; Montanya et al., 2000). In adult pancreas, the number of dividing β-cells progressively reduces and the aged β-cells undergo a very slow turnover rate of <0.25% beyond 3 months of age

(Montanya et al., 2000; Wang et al., 1996). Although adult β-cell mass population is

relatively constant under physiological conditions, β-cells have the remarkable ability and plasticity to adapt to wide ranges of metabolic challenges, which can occur during pregnancy, obesity or insulin resistance (Bouwens and Rooman, 2005). For example, the

Kulkarni group report that a hepatocyte-derived factor(s) promote β-cell proliferation in vivo and ex vivo in the insulin resistant liver-specific insulin receptor knockout mouse model (El Ouaamari et al., 2013). Recent reports by the Melton group describe a novel protein betatrophin that is primarily expressed in the liver and adipose tissue which can be secreted to promote β-cell proliferation under insulin resistant conditions (Yi et al., 2013).

This transient expression of betatrophin significantly expands β-cell mass and leads to improved glucose tolerance.

I. 2-2 Pancreatic β-cell Function

The pancreatic β-cell is an exclusive cell type that can produce and secrete insulin by coupling nutrient sensing with the electrical activity of the cell membrane. The glucose transporter isoform 2 (GLUT2) is expressed on the β-cell membrane, which functions to sense changes in circulating blood glucose levels and triggers insulin release. Glucose is transported through GLUT2 into the β-cell and subsequently converted by glucokinase to glucose-6-phosphate (G-6-P), then to pyruvate via the glycolytic pathway, and transported into the mitochondria to activate the mitochondrial tricarboxylic acid (TCA) cycle to generate adenosine triphosphate (ATP) from adenosine diphosphate (ADP). The increased cytoplasmic ATP/ADP ratio leads to closure of the ATP-sensitive potassium (KATP)

channels, and subsequent depolarization of the plasma membrane, resulting in opening of the voltage-sensitive calcium (Ca2+) channel and influx of calcium ions. This subsequent rise of intracellular Ca2+ levels stimulates the exocytosis of insulin granules from the β- cells (Figure I-2).

Proinsulin is produced in the endoplasmic reticulum (ER) of β-cells and subsequently transferred to the Golgi complex where it becomes converted into its biologically active form, insulin, as a result of the cleavage of the C-peptide of proinsulin.

Insulin is then packaged into secretory granules awaiting signals for its release. Insulin granules undergo trafficking through the cytoskeleton which undergoes remodeling to facilitate the granules to reach the plasma membrane where Ca2+-dependent exocytotic fusion with the plasma membrane occurs (Chapman, 2002; Easom, 2000). This process of insulin granule exocytosis is mediated by a protein superfamily soluble N-ethylmaleimide- sensitive factor attachment protein receptor (SNARE) proteins (Rorsman and Renstrom,

2003; Wheeler et al., 1996). During docking, the insulin vesicular SNAREs (v-SNAREs) bind with their plasma membrane partners, target-membrane SNAREs (t-SNAREs), forming a tight complex that tethers the insulin vesicle to cell membrane, followed by the fusion of the two membranes and release of insulin.

Figure I- 2 β-cell function: glucose-stimulated insulin secretion. Glucose enters the β-cell via GLUT2. Glucose is metabolized to increase the intracellular 2+ ATP/ADP ratio, leading to closed KATP channels, membrane depolarization, and Ca influx via opening of the Ca2+ channels, which ultimately triggers the release of insulin.

I. 2-3 Regulation of β-cell Homeostasis

Several growth factors and intracellular molecules, including insulin/insulin-like growth factor-1 (IGF-1), glucagon-like peptide-1 (GLP-1), growth hormone, prolactin and cell cycle regulators, have been identified as capable of regulating β-cell mass.

I. 2-3A Insulin and insulin-like growth factor-1

Conditional deletion of the insulin receptor specifically in mouse β-cells leads to reduced β-cell mass, impaired glucose tolerance and a defect in glucose stimulated insulin secretion that is characteristic of type 2 diabetes (Kulkarni et al., 1999; Otani et al., 2004).

Likewise, specific deletion of IGF-1 receptor in mouse β-cells results in glucose intolerance with impaired insulin secretion in response to glucose (Kulkarni et al., 2002). Mice with concomitant deletion of insulin receptor and IGF-1 receptor show an enhanced β-cell apoptosis and a modest reduction in β-cell proliferation, leading to a severe reduction in β- cell mass and development of overt diabetes at 3-wks of age (Ueki et al., 2006). These results demonstrate that insulin and IGF-1 signalling are critical and have non-overlapping additive effects in controlling β-cell homeostasis.

I. 2-3B Glucagon-like peptide-1

Glucagon-like peptide-1 (GLP-1), a gastrointestinal incretin hormone, is secreted by the enteroendocrine L-cells and has been shown to be a crucial effector in β-cell function,

replication, apoptosis and neogenesis (Brubaker and Drucker, 2004). In leptin-deficient hyperglycemic ob/ob mice, a long-acting GLP-1 analog improves glucose metabolism by increasing β-cell mass, as a result of increased β-cell proliferation (Rolin et al., 2002). GLP-

1 has further been reported to delay the onset of diabetes in leptin receptor-deficient db/db mice (Wang and Brubaker, 2002). Moreover, GLP-1 is capable of promoting β-cell mass through the induction of postnatal neogenesis from Pdx1-expressing ductal precursor cells

(Stoffers et al., 2000). Unexpectedly, deletion of the GLP-1 receptor in mice show normal

β-cell mass but maintain the ability of adaptive β-cell expansion in response to obesity, suggesting that other incretin hormones may play a possible compensatory role in regulating β-cell mass under basal conditions (Ling et al., 2001; Scrocchi et al., 2000).

I. 2-3C Lactogenic hormones and growth hormone

Lactogenic hormones, prolactin and placental lactogen, and growth hormone (GH) are also responsible for β-cell growth and cell function. Deletion of the prolactin receptor in mice leads to reduced islet size and β-cell mass due to impaired islet development

(Freemark et al., 2002; Freemark et al., 1997). Furthermore, overexpression of placental lactogen in β-cells results in an enhanced β-cell function and increased β-cell proliferation, leading to increased β-cell mass (Vasavada et al., 2000). Similarly, specific deletion of growth hormone receptor in β-cells leads to impaired insulin secretory function (Wu et al.,

2011). In a high fat diet-induced obesity model, β-cell GH receptor-deficient mice fail to exhibit β-cell expansion due to impaired β-cell proliferation, resulting in glucose

intolerance (Wu et al., 2011). These three growth factors have all been demonstrated as potent islet mitogens in increasing islet cell mass and function.

I. 2-3D Cell cycle regulators

Deficiency of cell cycle agonists, cyclin-dependent kinase (Cdk) 4 or cyclinD1/D2, in mouse islets directly decreases β-cell replication, resulting in a reduced β-cell number and insulin insufficiency, leading to hyperglycemia. In general, cell cycle is divided into

G0/quiescent, G1, S, G2/M phase. Interestingly, the DNA synthetic S phase entry requires promoter E2f family members which have been shown to be essential for normal pancreatic function and homeostasis. Deletion of E2f1 in mice has been shown to impair β-cell function and reduce β-cell mass (Fajas et al., 2004); while E2f1 deletion in a type 1 diabetes model, the non-obese diabetic (NOD) mouse, exhibits abnormalities in lymphocytes leading to increased incidence and accelerated onset of diabetes (Salam et al., 2004). Mice with both deletion of E2f1 and E2f2 exhibit deregulated cell cycle leading to apoptosis and atrophy of the pancreas, resulting in exocrine pancreatic insufficiency and diabetes

(Iglesias et al., 2004). Furthermore, overexpression of E2f1 in β-cells results in enhanced glucose tolerance with increased insulin secretion and attenuation in streptozotocin- induced diabetes (Grouwels et al., 2010). Interestingly, Cdk4-E2f1 pathway has been shown to directly regulate insulin secretion by modulating energy-sensing molecule Kir6.2 expression, the key component of the potassium ATP-dependent channel (Annicotte et al.,

2009). Together these regulators of cell cycle progression may play a critical role in

diabetes pathogenesis through its regulation in pancreatic β-cell proliferation and secretory function.

I. 2-4 Pancreatic α-cell function

Among the islet cell subtypes, α-cells co-operate with β-cells to play a critical role in the regulation of glucose homeostasis during the fasting and fed states. Glucagon is secreted by α-cells to induce glucose production through hepatic gluconeogenesis and glycogenolysis during the fasting state (Gerich, 2000). Glucagon can further stimulate the release of fatty acids from the adipose tissue, which in turn can promote β-oxidation in skeletal muscles and thereby provide substrates for hepatic gluconeogenesis. These glucagon-induced actions aim to restore the plasma glucose level within the physiological range to overcome hypoglycemia that results from prolonged fasting.

Glucose is transported into α-cells via glucose transporter 1 (GLUT1) and subsequently phosphorylated by glucokinase, followed by glycolysis (Heimberg et al.,

1995). Pancreatic α-cells express high levels of lactate/monocarboxylate transporter (MCT) and lactate dehydrogenase (LDH), both of which are responsible in facilitating anaerobic glucose metabolism, leading to stimulation of glucagon secretion (Sekine et al., 1994; Zhao et al., 2001). During exercise, pyruvate is released from the skeletal muscle and is transported through MCT in α-cells, leading to a mitochondria required glucagon secretion.

In addition, LDH diverts the glycolysis-product pyruvate towards lactate production, instead of entering the TCA cycle for generation of ATP. Interestingly, in contrast to α-

cells, β-cells have low expression levels of MCT and LDH but high expression of pyruvate carboxylase, which would drive glucose-derived pyruvate to enter the TCA cycle. This would lead to ATP production and consequent release of insulin (Quesada et al., 2008).

These results suggest that α-cells favour anaerobic glucose metabolism, whereas β-cells adopt an aerobic glycolytic pathway to couple ATP production from mitochondrial respiration to insulin secretion (Schuit et al., 1997).

Pancreatic α-cells have membrane electrical activity and different types of ion channels which have been identified to be involved in the coupling of glucagon secretion,

+ 2+ including voltage-gated Na , Ca and KATP channels (Rorsman et al., 2008). The illustration of the electrophysiology of α-cells is proposed by the Rorsman group and displayed in Figure I-3, showing the sequential events of channel activation in the regulation of glucagon secretion. In brief, low levels of plasma glucose enter α-cells to mildly increase intracellular ATP concentration. This leads to the opening of KATP channels, fluxing out K+ ions to depolarize cell membrane. Subsequently, Na+ channel and Ca2+ channels are activated, leading to an increase in intracellular Ca2+ levels, which triggers glucagon granule exocytosis (Barg et al., 2000; Gopel et al., 2004; Kanno et al., 2002).

Figure I- 3 Glucagon secretory pathway in the pancreatic α-cells. A proposed scheme of α-cell glucagon secretory function by the Rorsman group; however, there are several controversies still under debate. Low levels of glucose enter the α-cell via glucose transporter 1 (GLUT1). Once glucose is metabolized in α-cells, there is a mild increase in intracellular ATP concentration and this leads to partly open KATP channel, cell membrane depolarization, and subsequently activate voltage-gated Na+ channel and voltage-activated Ca2+ channel, ultimately resulting in glucagon release via exocytosis.

I. 2-5 Regulation of α-cell Homeostasis

I. 2-5A Insulin

Accumulating evidence has suggested that insulin has a potent inhibitory effect on α- cell glucagon secretory machinery. Insulin receptor is highly expressed on α-cell membrane (Diao et al., 2005; Franklin et al., 2005). In humans, infusion of low level of insulin intravenously led to the suppression of glucagon release (Brunicardi et al., 2001;

Raskin et al., 1975). In contrast, anti-insulin serum perfusion into rat pancreata showed increased circulating glucagon level (Maruyama et al., 1984; Unger, 1985). Mice with α- cell specific insulin receptor deficiency displayed enhanced glucagon secretion upon L- arginine stimulation and hyperinsulinemic-hypoglycemic clamp. Consistently, in vitro insulin receptor knock-down by small interfering RNA (siRNA) in α-cell line, InR1G cells showed increased glucose-stimulated glucagon secretion (Kawamori and Kulkarni, 2009;

Kawamori et al., 2009).

Mechanistically, direct suppression of insulin on glucagon secretion has shown to reduce the sensitivity of KATP channels (Franklin et al., 2005; Leung et al., 2006). This leads to a hyperpolarized membrane potential and inhibition of the glucagon secretion machinery by decreasing the activation of phosphatidyl inositol 3-kinase (PI3K)/Akt pathway, which may recruit inhibitory GABAA receptor to the plasma membrane and induce GABA-mediated inhibition of glucagon release (Wendt et al., 2004; Xu et al., 2006).

I. 2-6B GABA

The γ-aminobutyric acid (GABA) is a neurotransmitter that can be found in the central nervous system. Depending on the types of receptor, GABA can play an inhibitory or excitatory role. GABAA receptor mediates an inhibitory effect once stimulated by

GABA, whereas GABAB receptor acts as an excitatory effector to stimulate downstream pathways (Macdonald and Olsen, 1994). Pancreatic β-cells have been shown to contain high levels of expression of GABA, which is produced from glutamate by glutamate decarboxylase 65 (Franklin and Wollheim, 2004; Gromada et al., 2007). GABA is released from β-cells in response to increased intracellular calcium concentration, as a result of membrane depolarization (Franklin and Wollheim, 2004). The released GABA molecules are taken by the adjacent α-cell GABAA receptors, resulting in α-cell membrane hyperpolarization via Cl- ion influx and subsequent inhibition of glucagon release (Braun et al., 2007; Xu et al., 2006).

I. 2-6C Zinc

Zinc as a suppressor of glucagon release was first proposed by the Wollheim group

(Ishihara et al., 2003). Zinc has been suggested to be co-secreted with insulin granules from

β-cells to inhibit glucagon secretion (Gee et al., 2002; Kristiansen et al., 2001). Upon zinc perfusion into rat pancreata, pyruvate-stimulated glucagon secretion was remarkably suppressed in α-cells. On the other hand, a zinc chelator calcium EDTA stimulated glucagon release in pancreata which were perfused with glucagon secretion suppressor, monomethyl-succinate (Gyulkhandanyan et al., 2008; Ishihara et al., 2003). The underlying

mechanism of zinc-induced suppression of α-cell function had been further suggested by the Wollheim group (Franklin et al., 2005). They proposed that zinc may interact with a subunit of KATP channel, SUR1, to activate the channel, resulting in α-cell membrane hyperpolarization and inhibition of glucagon release. However, this mechanism of zinc- mediated actions on α-cells is still under debate. Recent reports have suggested that zinc ion has no significant regulatory role in modulating KATP channel activity, thereby the regulation of zinc in α-cell function is still unclear (Gyulkhandanyan et al., 2008; Ravier and Rutter, 2005).

I. 2-6D Glucagon

Autocrine regulation of glucagon on α-cells has been shown to modulate glucagon secretory function in a positive feedback loop. Glucagon is secreted by α-cells and is able to bind to the glucagon receptor expressed on the cell membrane of α-cells, leading to an increase in glucagon gene expression and granule exocytosis. This autocrine effect is mediated by a cAMP-dependent mechanism (Ma et al., 2005). Glucagon enhances intracellular cyclic adenosine monophosphate (cAMP) concentration by activating protein kinase A (PKA) via adenylate cyclase (Leibiger et al., 2012). PKA-independent manner has also been suggested to be involved in the autocrine effect via cAMP-binding protein cAMP-guanidine nucleotide exchange factor II, which mimics the cAMP effect and enhances glucagon exocytosis (Ma et al., 2005). Together, glucagon stimulates the autocrine positive feedback by binding to the glucagon receptor and increasing cAMP levels to boost glucagon granule release.

I. 2-6E Glucagon-like peptide-1

GLP-1 has been shown to suppress glucagon secretion from the perfused rat pancreata (Kawai et al., 1989). Administration of GLP-1 receptor antagonist in individuals with or without type 1 diabetes both leads to increased plasma glucagon levels, suggesting that GLP-1 has inhibitory effect on glucagon secretion (Edwards et al., 1999; Kielgast et al., 2011). However, the underlying mechanism of GLP-1 actions on α-cells is still highly controversial. Several potential scenarios have been proposed as described below but further examinations are still needed to determine the mechanism of GLP-1 actions on α- cells.

Reports have suggested that α-cells may contain lower expression levels of GLP-1 receptor compared with β-cells. Nevertheless, this low expression may be sufficient to mediate GLP-1 stimulation on α-cells, resulting in the suppression of glucagon secretion

(De Marinis et al., 2010; Ding et al., 1997). In addition, GLP-1 action is thought to occur at least in part through inhibition of the efferent parasympathetic neuronal activity to suppress glucagon secretion (Holst et al., 1986; Wettergren et al., 1998). Recent reports have suggested that paracrine inhibition from adjacent δ-cells might also play a role in

GLP-1-mediatd glucagon suppression. Somatostatin release was significantly increased upon GLP-1 perfusion to rat pancreas. In support of this, administration of a somatostatin receptor antagonist led to increased glucagon release in the presence or absence of GLP-1

(de Heer et al., 2008). These results therefore demonstrate multiple potential mechanisms through which GLP-1 plays an inhibitory role on the regulation of glucagon secretion.

I. 3. Diabetes mellitus

Type 1 and type 2 diabetes mellitus are chronic metabolic disorders of insulin deficiency and glucose homeostasis. Type 1 diabetes is an autoimmune disease whereas type 2 diabetes, the most common form of diabetes and the most prevalent metabolic disorder, is a polygenic disease and is strongly associated with environmental influences, such as obesity and stress. The global prevalence of diabetes is approximately 382 million in 2013 and is expected to rise to 592 million by 2035 (Guariguata et al., 2013). Diabetic complications are severe and the risks of microvascular complications in particular are tightly associated with the degree of hyperglycemia. The micro- and macrovascular complications include retinopathy, nephropathy, neuropathy, myocardial infarction, and stroke, all of which leads to increased risk of mortality (Casiglia et al., 2000). These significant complications that increase the morbidity and mortality account for the emerging global health burden and public concern (Onkamo et al., 1999; Sloan et al., 2008).

I. 3-1 Type 1 autoimmune diabetes

Type 1 diabetes or insulin-dependent diabetes is an autoimmune disease caused by pathogenic T lymphocytes which specifically destroy the insulin-producing pancreatic β cells, resulting in cell death and insulin deficiency (Daneman, 2006). Typically, there is an estimated 60-80% reduction of β-cell mass in individuals with type 1 diabetes at the time

of diagnosis (Notkins and Lernmark, 2001). This autoimmune disease has a 0.5% prevalence rate in the developed countries and continues to increase in incidence (Bach,

1994). Both genetic susceptibility and environmental factors are suggested to contribute to the development of type 1 diabetes (Barnett et al., 1981; Maier and Wicker, 2005).

Mechanistically, T lymphocytes are now well accepted as the critical player in the pathogenesis of type 1 diabetes (Mathis et al., 2001). Cytotoxic CD8+ and helper CD4+ T lymphocytes both become self-reactive cells directly against pancreatic β-cells, resulting in their destruction. The CD8+ T lymphocytes, as an effector, are able to initiate β-cell death by triggering apoptosis upon direct contact with β-cells. On the other hand, CD4+ T lymphocytes can secrete inflammatory cytokines and chemokines that induce β-cell death by recruiting immune cells, such as B lymphocytes, macrophages and dendritic cells, to the pancreas (Eizirik and Mandrup-Poulsen, 2001).

I. 3-1A Insulitis

Two distinct phases of type 1 diabetes have been identified: insulitis and β-cell destruction. During the first insulitis phase, pathogenic T lymphocytes become self- reactive and infiltrate the pancreatic islets, resulting in the initial β-cell loss (Mathis et al.,

2001). Accumulating evidence suggests that β-cell auto-antigens that are derived from destroyed β-cells are displayed by the antigen-presenting cells (APCs) in the pancreatic draining lymph nodes (PDLNs). This therefore becomes the prelude of type 1 diabetes whereby signals are provided for activation to self-reactive T lymphocytes at the PDLNs

(Hoglund et al., 1999). Several scenarios have been proposed to suggest that naïve T lymphocytes encounter APCs displaying β-cell auto-antigens which induces autoimmunity

(Albert et al., 2001; Kurts et al., 1997; Kurts et al., 1999).

Interestingly, β-cell apoptosis also occurs under physiological conditions during the neonatal period in rodents at about 2-wks of age (Bonner-Weir, 2000c; Turley et al., 2003).

This naturally occurring wave of β-cell apoptosis has been shown to activate β-cell-specific

T lymphocytes in the PDLNs which can lead to insulitis and ultimately to the development of type 1 diabetes (Verdaguer et al., 1997). In addition, naïve T lymphocytes may be activated by virus-mediated β-cell apoptosis. Viruses that have been frequently associated with the onset of type 1 diabetes include rubella, cytomegalovirus, mumps and coxsackie

B4 (Faideau et al., 2005). Studies have suggested that viral infection results in tissue damage, leading to auto-antigen release and the trigger of self-reactive T lymphocytes activation along with autoimmune processes to mediate β-cell death (Horwitz et al., 1998;

Horwitz et al., 2002).

I. 3-1B β-cell destruction

β-cell apoptosis is the main mechanism of cell destruction in type 1 diabetes. Studies have been shown that T lymphocyte-mediated β-cell cytotoxicity is induced by receptor- ligand interactions via perforin/granzyme (Thomas et al., 2010), Fas/Fas ligand

(FasL)(Chervonsky et al., 1997), tumor necrosis factor receptor 1/tumor necrosis factor-α

(TNFR1/TNF-α) (Kagi et al., 1999) or by the release of pro-inflammatory cytokines, including the interferons and interleukins (Donath et al., 2003).

Perforin and granzyme are effectors of CD8+ lymphocytes that mediate the majority of β-cell cytotoxic events during the development of type 1 diabetes (Ashton-Rickardt,

2005). Perforin is a pore-forming protein that is capable of disrupting cell membranes, thereby allowing the entry of granzymes, serine proteases, into cells (Masson and Tschopp,

1985; Peters et al., 1991). Granzyme A is able to induce breakage of single-stranded DNA and granzyme B induces cell apoptosis via the activation of a caspase-dependent mechanism (Thomas et al., 2010). In the non-obese diabetic (NOD) mouse model, perforin deficiency leads to a significant reduction in diabetes development due to protection against islet destruction (Quan et al., 1996). However, diabetes was not completely eliminated in these perforin-deficient NOD mice, which suggests that perforin/grazyme independent mechanisms may also participate in β-cell destruction in the pathogenesis of type 1 diabetes.

Fas is a death receptor which mediates the apoptotic pathway and has been implicated in the development of type 1 diabetes. NOD mice with β-cell specific expression of Fas mutation show a significant delay in the development of spontaneous diabetes (Chervonsky et al., 1997; Itoh et al., 1997). Antagonizing FasL via anti-FasL antibody administration leads to a complete protection against insulitis in the NOD mice

(Nakayama et al., 2002). These results suggest that Fas plays an important role in the initiation of autoimmune diabetes in these NOD mice.

Activated T lymphocytes and other immune cells produce pro-inflammatory cytokines that have been demonstrated to contribute to the development of type 1 diabetes.

For example, elevated levels of cytokine TNF-α have been implicated in β-cell apoptosis during the development of type 1 diabetes (Kagi et al., 1999; Mueller et al., 1995).

Neutralizing ant-TNF-α antibody has been shown to prevent diabetes in NOD mice, whereas TNFR1-deficient NOD mice still develop insulitis but showed a complete protection against diabetes progression (Yang et al., 1994). In addition, interleukin-1β induces the expression of inducible nitric oxide synthase (iNOS) and nitric oxide (NO)

(Stassi et al., 1997). This iNOS/NO signal may further upregulate expression of Fas and class I major histocompatibility complex (MHC) on β-cells, resulting in increased susceptibility of β-cell death mediated by cytotoxic CD8+ T lymphocytes (Stassi et al.,

1997). Together, type 1 diabetes is a multifactorial disease, in which environmental factors and multigenic susceptibility may play important roles in the autoimmune destruction of

β-cells (Taborsky et al., 1998).

I. 3-1C α-cell dysfunction

Elevated levels of plasma glucose in type 1 diabetes fail to suppress glucagon secretion, as a result of loss of sensitivity to hypoglycemia, ultimately leading to α-cell dysfunction (Unger and Orci, 1977). This impaired glucagon secretion has been shown to arise from impairment of the autonomic nervous system. This autonomic impairment emerges from a slow-onset neuropathy during diabetes progression or a rapid-onset autonomic dysfunction due to repeated hypoglycemia (Taborsky et al., 1998). The autonomic nervous system is responsible for the counterregulatory response to release catecholamines and increase glucagon secretion to stimulate hepatic gluconeogenesis,

which provides protection against hypoglycemia during the early stages of type 1 diabetes.

However, insulin treatment in patients with type 1 diabetes may lead to frequent events of hypoglycemia, thereby resulting in impaired autonomic counterregulatory response and further increased circulating levels of cortisol and growth hormone (Unger, 1983).

Ultimately, this leads to excessive glucagon release and increased glucose levels by increased hepatic gluconeogenesis and glycogenolysis (Lefebvre, 1995; Lefebvre and

Luyckx, 1979).

I. 3-2 Type 2 diabetes

Type 2 diabetes, the most common form of diabetes and the most prevalent metabolic disorder, is also characterized by insulin insufficiency, in addition to peripheral insulin resistance (Kahn, 2003). The prevalence of type 2 diabetes is increasing rapidly despite advancements in treatment largely due to environmental factors including sedentary lifestyle and increased caloric intake, in addition to genetic factors (Nguyen et al., 2011).

I. 3-2A Defects in β-cells

It is now well appreciated that pancreatic β-cells are indeed dynamic with potential for continual proliferation and mass expansion to compensate for the increase in insulin

demand during the early stages of type 2 diabetes (Weir et al., 2001). However, this β-cell compensation fails when β-cells start to lose substantial cell mass or function due to chronic metabolic stress. Specifically, β-cell dysfunction may result from glucose insensitivity, impairment of glucose-stimulated insulin secretion leading to reduction of insulin production (Deng et al., 2004; Hosker et al., 1989). On the other hand, increased β-cell apoptosis is the key contributor of the loss of cell mass in the pathogenesis of type 2 diabetes as a result of gluco- and lipo-toxicity (Butler et al., 2003; Leonardi et al., 2003;

Rhodes, 2005).

In rodent animal models, Goto-kakizaki rats and Psammomys obesus, which were fed a sucrose and high-caloric diet, respectively, demonstrated that hyperglycemia can induce

β-cell glucotoxicity by promoting apoptosis, leading to the development of type 2 diabetes

(Donath et al., 1999; Koyama et al., 1998). To support this, human islets have also been used to show that prolonged exposure of high glucose concentrations induces interleukin

(IL)-1β release from the β-cells themselves, resulting in cell apoptosis by Fas-dependent mechanism (Maedler et al., 2002; Maedler et al., 2001). Chronic high glucose conditions can further induce oxidative damage in β-cells by enhancing the production of reactive oxygen species (ROS) (Evans et al., 2003). This increased oxidative stress, as well as increased cytokines, such as TNF-α, IL-6 and IL-1β, can induce β-cell death through the activation of different apoptotic signalling pathways, including caspase-3- and caspase-8- dependent apoptotic pathways (Donath et al., 2003; Kim et al., 2005; Spranger et al., 2003).

In addition to hyperglycemia, hyperlipidemia has also been demonstrated as a major contributor of β-cell death in the pathogenesis of type 2 diabetes (Shimabukuro et al., 1997;

Zhou and Grill, 1995). High plasma levels of free fatty acids (FFA) induced β-cell

apoptosis in Zucker diabetic fatty rats, as a result of decreased levels of anti-apoptotic Bcl-

2 (Lupi et al., 2002; Shimabukuro et al., 1998). Chronic hyperlipidemia can also induce lipid accumulation in β-cells which leads to an increase of ceramide production, ultimately resulting in an upregulation of iNOS and subsequent β-cell death (Unger and Zhou, 2001).

Conversely, chronic increase in FFAs can cause β-cell dysfunction (Zhang et al., 2001).

Upon chronic exposure of FFAs, insulin secretion was inhibited in β-cells due to the induction of uncoupling protein-2, which suppresses insulin release by diminishing the mitochondrial membrane potential to reduce the efficiency of ATP production (Joseph et al., 2004).

I. 3-2B Defects in α-cells

Hyperglucagonemia and α-cell hyperplasia have been demonstrated together with loss of β-cell insulin secretory function and mass in type 2 diabetes (Del Prato and

Marchetti, 2004; Rahier et al., 1983). The mechanism responsible for α-cell dysfunction and mass expansion are still unclear. One possibility is the impaired paracrine regulation, such as decreased levels of intraislet insulin and zinc, resulting in inadequate suppression of glucagon secretion (Gromada et al., 2007; Maruyama et al., 1984). Abnormal glucose modulation on glucagon secretion is also proposed to be a contributor to α-cell dysfunction in individuals with type 2 diabetes (Dimitriadis et al., 1985). Together, while type 1 and type 2 diabetes have distinct mechanisms of disease pathogenesis, both types are characterized by a concomitant β-cell loss and α-cell dysfunction.

I. 4 Retinoblastoma protein

I. 4-1 Rb family proteins

Cell proliferation or replication is controlled by a complex cell cycle regulation. The retinoblastoma (Rb) protein was the first tumor suppressor to be cloned which was a critical regulatory molecule in cell cycle progression (Knudsen and Knudsen, 2008a). Rb (p105), along with p107 and p130, belongs to the pocket protein family, which shares sequence similarity within the carboxyl terminal DNA binding domain. This domain contains a pocket-shape structure that manipulates interactions with E2fs, the viral oncoprotein adenovirus E1A and many other factors (Classon and Harlow, 2002; Wikenheiser-

Brokamp, 2006). Despite the structural and functional similarities, the pocket proteins have significant differences in their downstream signals. Rb predominantly interacts with transcription factors, E2f-1, -2, -3, -4 and -5 in both postmitotic and cycling cells, whereas p107 interacts with E2f-4 and -5 in cycling cells and p130 is mainly expressed in postmitotic cells and associates with E2f-4 and -5. These interactions between Rb family proteins and E2fs can restrict the activity of the E2f family, which are transcription factors that determine the timely expression of genes required for cell cycle S-phase entry.

Moreover, the pocket proteins can recruit chromosome modeling complexes, such as histone deacetylases (HDACs) to modulate cell cycle progression (Dyson, 1998).

Through these mechanisms, Rb family can control commitment G1/S transition, thereby suppressing cell cycle progression. Additionally, Rb proteins are involved in other

cellular processes, including DNA repair, DNA replication, anti-apoptosis and differentiation (Lee et al., 2009; Steele et al., 2009). Therefore the role of Rb family in controlling various aspects of cell biology is complex and is cell type and context dependent (Chen et al., 2009a; Polager and Ginsberg, 2009; Wu and Yu, 2009).

I. 4-2 Mechanisms of Rb Action

I. 4-2A Interaction with E2f family members

The E2f transcription factors were first recognized as activators that bind to adenoviral E2 gene promoter for its transactivation (Kovesdi et al., 1986). For instance, this transactivation was required for the function of adenoviral E1A protein (Bagchi et al.,

1990), which is also regulated by Rb activity and hence, these findings led to initially demonstrate the interaction between Rb and E2fs (Chellappan et al., 1991). To date, eight

E2f family members have been identified: the first five family members, E2f1-5, contain the pocket protein binding domain and interact with Rb proteins to control cell cycle progression, whereas E2f6-8 are thought to work independently of pocket proteins (Chen et al., 2009b; Christensen et al., 2005).

E2f1 was originally discovered in 1986 as a transcription factor that can bind to the promoter of the E2 gene of adenovirus and subsequently was identified to interact with Rb, leading to define the function of Rb in cell cycle regulation (Bagchi et al., 1991; Kovesdi et al., 1986). In general, E2f1, 2, 3a and 3b (two alternative splicing variants of E2f3 gene)

are categorized as transcriptional activators, which recruit histone acetyl transferase to chromatin when Rb is hyperphosphorylated, leading to the activation of gene transcriptions and the promotion of cell cycle progression (Chong et al., 2009; Takahashi et al., 2000).

E2f1-3 therefore accumulates at G1 phase of cells and decreases expression levels during

G0 phase (Leone et al., 2000; Moberg et al., 1996; Slansky et al., 1993). Mechanistically, after dissociating from Rb, free E2f activators may dimerize with their dimerization partner

(DP) proteins to potentiate their transcriptional activity by increasing the affinity of DNA binding. The E2f consensus sites are conserved on promoters of genes required for S phase entry, including cyclin A and E, thymidine kinase, and DNA polymerase α (Dick and

Dyson, 2006). As such, deregulation of E2f activators are able to induce postmitotic cells to enter cell cycle (Lukas et al., 1996), while deletion of E2f1, 2 and 3 forces proliferating cells to exit cell cycle (Wu et al., 2001).

In contrast, E2f4 and 5 are classified as transcriptional repressors, as negative regulators of cell cycle progression and are predominantly expressed in the G0 phase.

Overexpression of E2f4 or E2f5 has not been shown to either overcome cell cycle arrest or promote cell proliferation, but lacking E2f4 and E2f5 in fibroblasts causes cells to permanently remain in a cell cycle state (Gaubatz et al., 2000; Mann and Jones, 1996).

Unlike the activator E2f1-3, repressor E2f4 does not have a nuclear localization sequence

(NLS) within its structure, even though it has a nuclear export signals (NES) (McClellan and Slack, 2007). The absence of this NLS, retains E2f4 primarily in the cytoplasm of cycling cells. However, upon depletion of mitogen stimulation or cell cycle arrest, E2f4 dimerizes with a DP protein and forms a complex with p130, which then translocates into the nucleus to occupy promoters of target genes (Gaubatz et al., 2001; Lee et al., 2011). In

addition, this complex of E2f4 and p130 mediates the G0 phase of cell cycle through the recruitment of HDACs in repressing cell cycle genes (Balciunaite et al., 2005). Conversely, during the transition of G1/S, the levels of Rb and p107 increase along with a decrease in p130. This leads E2f4 to switch its partner protein from p130 to p107 and Rb which thereby suppress its repressive role in cell cycle progression of proliferating cells (Moberg et al.,

1996).

E2f5 shares a highly homologous structure with E2f4 (72 % amino acid identity), as compared to E2f1-3 (35 % amino acid identity) (Vaishnav et al., 1998). Unlike E2f4, E2f5 however contains a nuclear localization sequence in the N-terminus, which allows E2f5 to stay in the nucleus and prevent its association with Rb family proteins or DP proteins.

Interestingly, E2f5 is predominantly expressed in the cytoplasm of proliferating/undifferentiated cells. However, once cells differentiate, E2f5 is subjected to active nuclear transport and increase in expression, followed by interaction with p130 and

HDAC1, which leads to cell cycle withdrawal (Vaishnav et al., 1998).

I. 4-2B Cell cycle restriction point: G1/S transition

Aside from being the first tumour suppressor gene to be cloned, Rb has been identified as a negative regulator of cell proliferation since 1987 (Lee et al., 1987). For example, viral oncoproteins interact with Rb to disrupt the complex of Rb/E2f, subsequently freeing E2f to promote the cell to undergo G1/S transition, while

overexpression of Rb leads to cell cycle arrest (DeCaprio et al., 1988; Goodrich et al., 1991).

The repressive role of Rb proteins in cell cycle is mediated by at least two mechanisms: (i) suppression of activator E2f function through binding to its transactivation domain

(Flemington et al., 1993); (ii) recruitment of HDACs and other chromatin remodeling complexes, including methylases and SWItch/Sucrose NonFermentable (SWI/SNF) complex, to E2f-binding sites (Dyson, 1998; Harbour and Dean, 2000). Upon mitogenic stimulation, such as in response to insulin or growth hormone, complex of D-type cyclins with Cdk4 or Cdk6 can directly phosphorylate Rb in the early G1 phase, and subsequently,

E-type cyclins, which associate with Cdk2 can further phosphorylate Rb in the late G1 phase. This sequential phosphorylation of Rb is required for complete inactivation of Rb and its dissociation it from E2f, which allows cell cycle progression through the G1/S transition (Chen et al., 2009b; Harbour et al., 1999) (Figure I-4).

Free E2f transcription factors activate genes that are required for S phase entry and later can be phosphorylated by complexes of A-type cyclins and Cdk2 to inhibit the DNA- binding activity as a “shut-down” procedure in the late S phase when it is no longer necessary for further transactivation (Kitagawa et al., 1995). As cyclin A is one of E2f1 target genes, this S phase regulation develops into a negative feedback loop upon turning off the transcription machinery and thereby facilitating the cell cycle to progress to the G2 phase. Conversely, repressors E2f6-8 accumulate during G1-S phase by E2f transactivation and replace activator E2f1-3 at promoters of target genes to inactivate transcription in late

Figure I- 4 The regulation of Rb in cell cycle control. Rb recruits chromatin remodelling complexes to repress E2f transactivation in resting cells at G0 phase. Mitogenic signals increase D-type cyclins. Upon mitogenic signal, complexes of D-type cyclins with Cdk4 or Cdk6 can directly phosphorylate Rb in the early G1 phase, and subsequently, complexes of E-type cyclins with Cdk2 can further phosphorylate Rb in the late G1 phase. This sequential phosphorylation of Rb leads to complete inactivation of Rb and its dissociation from E2f and dimerization protein (DP) which allows cell cycle progression to occur through the G1/S transition and mitosis phase.

S phase. These findings demonstrate atypical repressor function of E2f6-8 through a pocket protein-independent mechanism which may also play a role in switching off S phase transcription.

I. 4-2C Cell apoptosis

Activating E2f family members are sufficient to induce cell proliferation but interestingly, overexpression of E2f is usually accompanied by increased cell apoptosis.

This paradoxical effect of E2f on cell survival is thought to be an intrinsic mechanism for protection against deregulation of the Rb pathway (Morgenbesser et al., 1994). Of all E2f family members, E2f1 is the most potent family member that participates in the induction of apoptosis. E2f2 and E2f3 are initially considered as non-essential factors for induction of apoptosis (DeGregori et al., 1997). However, subsequent reports showed that these two activating E2f members might retain a reduced propensity to mediate a lesser degree of cell death as compared to the induction observed by E2f1 (Moroni et al., 2001; Vigo et al.,

1999).

Upon Rb deficiency or loss, E2f1 can stabilize p53 protein and induce cell apoptosis

(Zhu et al., 1999). Mechanistically, E2f1 transactivates tumour suppressor Arf, which interacts with MDM2 to inhibit the E3 ubiquitin ligase’ ability to target p53 for degradation

(Zhang et al., 1998). This E2f1-Arf signal prevents p53 from undergoing degradation by the ubiquitin-proteasome system, thereby leading to p53 accumulation and promotion of

apoptosis (Honda and Yasuda, 1999). In addition to increased p53 stability, E2f1 may also cooperate with p53 to induce apoptosis in the absence of Arf. E2f1 is able to transactivate apoptosis-stimulating protein of p53 1 and 2 (ASPP1 and ASPP2), which act as co- activators that increase p53 transcriptional activity of pro-apoptotic genes, such as apoptotic protease activating factor 1 (Apaf1) and BH3-only proteins, p53-upregulated modulator of apoptosis (PUMA) and NOXA (Latin for damage) (Iaquinta and Lees, 2007;

Samuels-Lev et al., 2001).

On the other hand, E2f1 may undergo an atypical pathway to promote apoptosis through a p53-independent mechanism, by upregulation of transactivation of p73 (TAp73)

(Ginsberg, 2002). p73 is a p53 homologous gene and shares similar features in structure and function with p53 (Kaghad et al., 1997; Ramadan et al., 2005). p73 is a complex protein and expressed as two functionally-opposing isoforms: (i) transactivating p73 (TAp73), which induces cell apoptosis through its N-terminus and (ii) deltaN p73 (DNp73), which lacks the N-terminal domain and serves an anti-apoptotic function due to inhibition to its own variant TAp73 and p53 (Grob et al., 2001).

Expression of p73 is not regulated by either Arf or MDM2 but is controlled by E2f1

(Irwin et al., 2000). In response to Rb loss, E2f1 increases TAp73 levels, which induces the expression of PUMA, leading to Bax mitochondrial translocation and cytochrome c release for apoptosis (Irwin et al., 2000; Melino et al., 2004). Moreover, E2f1 may also directly target other apoptotic genes, including caspase 7, caspase 3 and pro-apoptotic Bcl-

2 family, leading to the induction of cell death without p53 regulation (Ginsberg, 2002).

I. 4-2D Cell differentiation: cell fate decision

Given Rb's role as a cell cycle repressor, deletion or mutations in Rb are strongly associated with tumourigenesis and are widely found in human cancers (Cobrinik, 2005).

In addition to its role a tumour suppressor, Rb is also thought to participate in differentiation and apoptosis in a cell-type and context-dependent manner (Wikenheiser-

Brokamp, 2006). Thus, on top of the established complex role of Rb in regulating multiple cellular processes, growing evidence over the last decade suggests a new role of Rb to function as a molecular switch for cell fate control.

Rb was first identified as a cell identity switch in white/brown fat cell differentiation.

Rb inactivation in mouse embryo fibroblasts or white preadipocytes results in expression of a brown adipocyte gene profile with the presence of uncoupling protein 1. These cells ultimately differentiate into fat cells with brown fat characteristics (Hansen et al., 2004).

This propensity for brown over white adipocyte differentiation is also observed in adult primary white preadipocytes. The underlying molecular mechanism was thought to be a consequence of the repression of peroxisome proliferator-activated receptor γ (Ppar γ) coactivator-1 α (PGC-1α), an important transcription factor involved in the induction of genes involved in thermogenesis and mitochondrial biogenesis (Scime et al., 2005). In

2010, building on this novel role of Rb in preadipocyte differentiation, the first in vivo evidence of Rb in cell fate switch was shown in mesenchymal progenitor cells. Specifically,

Rb was implicated in the cell fate determination between adipogenic and osteogenic specification (Calo et al., 2010).

Rb loss in mesenchymal progenitors impairs osteogenesis as evidenced by reduced calcified bone matrix at mouse embryonic day 18.5 (E18.5). In contrast, these Rb-deficient mesenchymal cells become more adipogenic, shown by an expanded brown fat compartment (Calo et al., 2010). In line with these findings, Rb was found to cooperate with the repressive E2f, E2f4, to suppress the expression of master adipogenic factor Pparγ, showing the direct role of Rb in determining the adipogenic cell fate. Moreover, Rb may promote bone development through binding with the osteogenic factor, runt-related transcription factor x 2 (Runx2), to potentiate its transcriptional activity (Calo et al., 2010).

I. 5 Focal Adhesion Kinase

I. 5-1 Structure and Function of FAK

Focal adhesion kinase (FAK) is a ubiquitously expressed 125-KDa non-receptor protein tyrosine kinase (Schaller et al., 1992). Though FAK was identified as one of the substrates of oncogenic protein Src, it is now well-established that FAK play an essential role at focal adhesions where integrin receptor mediates signals from extracellular matrix proteins into intracellular signals that regulate cell proliferation, survival, migration, and invasion (Hanks et al., 2003) (Figure I-5).

I. 5-1-A The N-terminal FERM domain of FAK

FAK is composed of three domains: a central catalytic domain flanked by large N- and C-terminal non-catalytic domains. The N-terminal band 4.1, ezrin, radixin, moesin homology (FERM) domain contains three subdomains and binds to the cytoplasmic domain of transmembrane growth receptors, such as the integrin receptor, epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor (PDGFR). The

FERM domain can also facilitate the nuclear translocation of FAK to enhance gene transcription for cell cycle progression (Zhao et al., 2003) and migration (McKean et al.,

2003). This nuclear import of FAK is induced by a post-translational modification of a small ubiquitin-related modifier (SUMO) at Lys152 of the FERM domain (Kadare et al.,

2003). In addition, the FERM domain can interact with p53 to inhibit apoptosis

(Golubovskaya et al., 2005; Golubovskaya et al., 2008). Through this direct binding, FAK interferes with the transactivity and apoptotic activity of p53 by altering the functions of

MDM2 and Bax. FAK is further proposed to be a scaffold protein of p53 and MDM2, which promotes the association of p53 and MDM2 and increases the turnover rate of p53 to facilitate cell survival (Lim et al., 2008a).

Figure I- 5 FAK domain structure and phosphorylation sites. The N-terminal FERM domain of FAK may interact with growth receptors, p53 and contains a SUMOlation site at Lys residue 152. Tyrosine residue 197 located in proline- rich region acts as a SH2-binding site. Once SH2-containing proteins, such as Src, is recruited, the tyrosine residues, 576 and 577, are subsequently phosphorylated by Src, resulting in fully catalytically activated FAK. The C-terminal FAT domain of FAK interacts with integrin-associated proteins, such as focal adhesion proteins, talin and paxillin. The FAT domain also mediates the interaction with p130Cas to further control cell motility.

I. 5-1-B The C-terminal FAT domain of FAK

The C-terminal focal adhesion-targeting (FAT) domain consists of four helix bundles and ~100 residue sequences designated for protein-protein interaction (Mitra et al.,

2005). Two proline-rich (PR) regions within the FAT domain function as biding sites for

Src-Homology (SH)3-domain containing proteins (Lim et al., 2004). SH3-containing proteins mediate the binding of FAK with the adaptor protein p130Cas to promote actin cytoskeleton dynamics and cell migration machinery (Chodniewicz and Klemke, 2004).

The FAT domain also promotes the colocalization of FAK with integrins at the focal adhesion sites through binding to other focal adhesion proteins, such as paxillin and talin

(Schlaepfer et al., 2004).

I. 5-1-C The central kinase domain of FAK

The kinase domain demonstrates a bi-lobed structure: a small N-terminal lobe and a large C-terminal lobe. In inactive state, the FERM domain displays a three-lobed structure to bind with the C-terminal lobe of the kinase domain on Phe596, forming an auto-inhibited conformation (Frame et al., 2010). This auto-inhibition protects the activation loop

(residues 564-592) of the kinase domain from phosphorylation by Src. Interestingly, once the FERM domain binds with a heterologous partner, such as growth receptor or insulin- like growth factor I receptor, the key Tyr397 residue becomes auto-phosphorylated, which is located in the linker region connecting the FERM and kinase domain (Frame et al., 2010;

Hall et al., 2011). This auto-phosphorylation creates a high affinity binding site for SH2

domain-containing proteins and exposes the activation loop, by disrupting the interaction of the FERM and the kinase domain. Subsequently, the Tyr576 and Tyr577 residues located in the activation loop are phosphorylated by Src resulting in a fully catalytically activated FAK (Lietha et al., 2007).

I. 5-2 Actions of FAK

I. 5-2A Signalling of Extracellular Matrix/FAK in cell motility

FAK activation is initiated by integrin clustering to promote auto-phosphorylation at

Tyr397, followed by serial phosphorylation events at multiple tyrosine residues located within the catalytic kinase domain of FAK (Schaller et al., 1995). Activated FAK associates with Src to form a complex that is able to phosphorylate various FAK target proteins to mediate cytoskeleton reorganization, such as p130Cas (Crk-associated substrate) and paxillin (Hildebrand et al., 1995). Upon ECM/integrin stimulation, FAK can interact with the SH3-domain of p130Cas and further promote tyrosine phosphorylation of p130Cas

(Cary et al., 1998). Once phosphorylated, p130Cas may couple with the SH2 domains, including Crk, to promote subsequent signalling, which ultimately results in the activation of Rac1 which then induces actin cytoskeleton remodelling, lamellipodia formation and cell motility (Mielenz et al., 2001). In addition to p130Cas, FAK can phosphorylate the focal adhesion protein paxillin at Tyr31 and Tyr118, which are required for the localization of paxillin to focal adhesions and cell migration (Petit et al., 2000).

I. 5-2B Signalling of FAK in cell proliferation

Focal adhesion-dependent stimulation could integrate signals from integrin and growth factors, such as PDGF or epidermal growth factor (EGF), to coordinate cell growth and survival (Hanks et al., 2003; Sieg et al., 2000). As such, disruption of FAK activates p53, a cell cycle progression inhibitor, in endothelial cells during mouse embryogenesis (Ilic et al., 2003). In addition to the intrinsic regulators of cell cycle machinery such as Rb family members, externals signals such as mitogens and extracellular matrix (ECM) proteins also affect cell cycle progression by activating G1 phase required proteins, Cdk4/6 and Cdk2

(Assoian and Schwartz, 2001). Cell cycle regulating proteins, p27 and cyclin D1 were shown to be required for FAK-dependant cell cycle progression in glioblastoma cells (Ding et al., 2005). Interestingly, FAK-dependent mitogenic signalling has also been found to mediate cyclin D1-dependent Rb phosphorylation by activating Rac (Klein et al., 2009).

These reports suggest that FAK is critical not only for cell motility but also for cell survival and proliferation.

I. 5-2C Signalling of FAK in insulin signalling

FAK has also been identified as a critical mediator of insulin signalling (Bisht and

Dey, 2008; Bisht et al., 2007; Bisht et al., 2008), participating in insulin receptor (IR) phosphorylation (El Annabi et al., 2001) and activating PI3K/Akt (Lebrun et al., 1998; Xia et al., 2004) by phosphorylating the p85 subunit of PI3K.

Previous studies have shown that knock-down of FAK using in vivo RNA interference results in hepatic and muscle insulin resistance leading to glucose intolerance

(Bisht et al., 2008). Similarly, glucose uptake and insulin sensitivity are restored by increasing the levels of FAK in cultured skeletal muscle cells (Bisht et al., 2007). FAK has also been shown to modulate insulin-induced actin remodeling, which could mediate translocation of glucose transporters to the cell membrane (Bisht and Dey, 2008; Huang et al., 2006). Furthermore, PTEN and SHIP2, both of which are phosphatases and negative regulators of insulin signalling, can dephosphorylate FAK to impair insulin action (Gupta and Dey, 2009). In addition to insulin signalling, signals from the extracellular matrix have been shown to improve the survival of cultured β-cells. Interestingly, FAK has been shown to mediate this signalling at least in part by decreasing caspase 8 activation (Hammar et al.,

2004). Collectively, FAK can potentially regulate cell cycle, insulin action and cytoskeleton reorganization, which have prompted us to investigate these molecules in pancreatic β-cells in vivo.

Chapter II: Thesis Objectives and Hypotheses

Pancreatic β-cell deficiency is the common underlying cause for both type 1 and type

2 diabetes (Nichols and Cooke, 2009; Prentki and Nolan, 2006; Rhodes, 2005). β-cells were once thought to be post-mitotic adynamic cells; however it is now well appreciated that these cells indeed have the potential to re-enter the cell cycle in response to increased insulin demand resulting from metabolic disorders (Weir et al., 2001). Therefore, evaluation of cell cycle regulation in β-cells is essential for better understanding of pathogenesis and prevention of diabetes.

The tumour suppressor protein Rb plays a critical role in cell cycle exit and differentiation of many tissues (Poznic, 2009); however appears to be dispensable in postmitotic cells (Wirt et al., 2010). Indeed, Rb has a minor role in well-differentiated β-cells in regulating cell mass and function as shown in Rb knockout islets driven by rat insulin promoter (Vasavada et al., 2007). However, the effect of Rb during islet development and in proliferating β-cells is not known. Previous studies have shown that Rb’s downstream molecules E2f1 an E2f2 are required for normal pancreatic islet function and homeostasis

(Fajas et al., 2004; Iglesias et al., 2004). Interestingly, Cdk4-Rb-E2f pathway has been shown to directly regulate insulin secretion through modulating energy-sensing molecule

Kir6.2 expression, the key component of potassium ATP-dependent channel (Annicotte et al., 2009). Together the Rb-E2f pathway may play a critical role in diabetes pathogenesis through its regulation in pancreatic β-cells proliferation and/or cell death, in addition to their secretory function.

The first objective of this thesis was to define the essential in vivo role of Rb in pancreatic islet homeostasis. This work described in Chapter III of this thesis examines the role of Rb in islet cell homeostasis by using in vivo genetic approach using Pdx1 driven

Cre-loxP recombinase system to generate the pancreas-specific Rb deletion mice and in vitro α-cell line, α-TC, and β-cell line, INS-1. We hypothesized that Rb has direct physiological role in the regulation of β-cell cycle, apoptosis and function, as well as in the development of α-cells that together govern glucose homeostasis.

The second objective of this thesis was to assess the individual and combined roles of Rb and its homolog p107 in pancreatic islets homeostasis. In Chapter IV, we showed that Rb loss in islet progenitors have opposite effects in α- and β-cell mass, which displays the same opposite effects that GLP-1 has on promoting β-cell proliferation while suppressing α-cells. Analogues of GLP-1 hormone are used therapeutically to antagonize these processes of diabetes development. However the mechanism by which GLP-1 mediates this divergent dual effect in α- and β-cell mass was unknown. We therefore hypothesized that Rb and its homologs are critical regulators to divergently mediate GLP-

1 actions on α- and β-cells and govern islet cell mass to maintain islet homeostasis. In the second study of this thesis, we used an in vivo genetic approach using pancreas-specific Rb deficient mice as described in objective 1 and bred them to with whole body p107 deleted mice to generate pancreatic Rb/p107 double knockout mice. In vitro α-TC and INS-1 cells were used for analyses of cell-specific mechanisms.

In addition to the direct regulators of cell cycle machinery such as Rb family members, externals signals such as mitogens and ECM proteins also affect cell cycle progression

(Assoian and Schwartz, 2001). Effects of ECM depend on the integrin-mediated signalling into the cell, known as focal adhesion contact (Schaller et al., 1992). Focal Adhesion

Kinase (FAK) is an important factor that is involved in focal contacts (Schaller et al., 1992).

Interestingly, FAK-dependent mitogenic signalling has been found to mediate cyclin D1-

dependent Rb phosphorylation through activating Rac (Klein et al., 2009), which suggests

FAK to be critical not only for cell motility but also for proliferation through an Rb- dependent mechanism. Previous studies have shown that FAK is involved in insulin- induced actin filament reorganization (Bisht and Dey, 2008), glucose transporter translocation in skeletal muscle cells (Huang et al., 2006), and regulation of cell cycle progression (Assoian and Schwartz, 2001; Klein et al., 2009). However, the role of FAK in pancreatic β-cells was unknown.

The final objective of this thesis was to investigate the role of FAK in the regulation of β-cell proliferation and glucose homeostasis. We have been taken an in vivo genetic approach using RIP (rat insulin promoter) driven Cre-loxP recombination system to evaluate the essential role of FAK in pancreatic β-cells. We hypothesized that FAK is directly involved in the regulation of cell proliferation and insulin exocytosis that govern

β-cell homeostasis and function under physiological and diabetic condition.

Chapter III: Materials and Methods

III. 1 Mouse Protocol

All mice were housed in a pathogen-free animal facility with a 12-h light-dark cycle and fed standard irradiated rodent chow ad libitum 5% (vol/vol) fat; Harlan Tekad,

Indianapolis, IN, USA). All animal experimental protocols were approved by the Animal

Care Facility of Ontario Cancer Institute and Toronto General Research Institute.

Chapter IV－Pdx1-Cre+ mice (The Jackson Laboratory) were bred to Rbfl/fl mice (a kind gift provided by Dr. Eldad Zacksenhaus, University of Toronto, Toronto) (Ciavarra and Zacksenhaus, 2010) to generate Pdx1-Cre:Rb+/fl, which were then intercrossed to generate pancreas-specific Rb knockout mice, Pdx1-Cre:Rbfl/fl (p-RbKO). Pdx1-Cre:Rb+/+ littermates were used as controls. Genotype for Cre and Rb genes were determined by PCR using tail DNA. All mice were maintained on a mixed C57 Black 6;129/Sv genetic background.

Chapter V－Pancreas-specific Rb knockout mice, Pdx1-Cre:Rbfl/fl (p-RbKO), were generated as previously described in Chapter IV (Cai et al., 2013). p-RbKO mice were bred to p107-/- whole body knockout mice (a kind gift provided by Dr. Eldad Zacksenhaus)

(Jiang et al., 1997) to generate pancreatic Rb/p107 double knockout mice, Pdx1-Cre:Rbfl/fl/ p107KO, (p-DKO) mice. Pdx1-Cre:Rb+/+/p107+/+ littermates were used as controls.

Genotype for Cre and Rb genes were determined by PCR using tail DNA. All mice were maintained on a mixed C57 Black 6;129/Sv genetic background.

Chapter VI－ RIPcre+ mice (Postic et al., 1999) were bred to Fakfl/fl mice (a kind gift provided by Dr. Louis Reichardt, University of California, San Francisco) to generate

RIPcre+fak+/fl, which were then intercrossed to generate β-cell specific FAK knock-out mice (RIPcre+fakfl/fl). RIPcre+fak+/+ littermates were used as controls and both male and female mice were used in similar number for all experiments with the exception of STZ experiments, where only male mice were used to avoid potential confounding effects of estrogen in β-cells (Le May et al., 2006). Genotypes for Cre and Fak genes were determined by PCR using ear clip DNA.

III. 2 DNA extraction

Pdx1-Cre:Rb/ p107 strain －To genotype for Rb, p107 and Cre, tail samples obtained from 10-day-old mice were used for DNA extraction. Each tail sample was digested by tail buffer in 700 µL (25 mM Tris pH 7.5; 50 mM EDTA, 1% SDS) plus 35

µL proteinase K (0.5 mg/mL, Merck) and incubated at 55 ̊C overnight. Thereafter, we used phenol/chloroform (USB Coporation, Cleveland, OH, USA) for DNA extraction. Each digested sample was added to 700 µL phenol/chloroform and centrifuged at 14,000 rpm for 5 minutes. The supernatant was then transferred into a new eppendorf tube and 100% ethanol added for DNA participation at - 20 ̊C overnight. After the precipition of DNA, samples were centrifuged at 14,000 rpm for 15 minutes and then washed with 70 % ethanol, air dried, and resuspended in 70 µL of autoclaved double distilled H2O.

RIPcre:Fak strain － To genotype for Fak and Cre, ear clip samples obtained from

10-day-old mice were used for DNA extraction. Each ear sample was digested by ear buffer

in 47 µL plus 3 µL proteinase K and incubated at 55 ̊C overnight. Once digested, 950 µL of autoclaved double distilled H2O was added to each sample.

III. 3 PCR genotyping

The Pdx1-Cre:Rb/ p107 mice were genotyped with the following primer sequences:

Rb: 5’- GGC GTG TGC CAT CAA TG-3’and 5’-CTC AAG AGC TCA GAC TCA TGG-

3’. The final PCR products were 235 base pairs for the wild-type allele and 285 base pairs for the floxed allele. For the protocol of Rb PCR, the melting temperature was 94°C for 30 seconds, the annealing temperature was 55°C for 30 seconds and the primer extension phase was 72°C for 50 seconds, for 30 cycles.

For the p107 PCR amplification, we used the following primers for genotypeing:

5’ TCG TGA GCG GAT AGA AAG-3’, 5’-GTG TCC AGC AGA AGT TA-3’ and 5’-

CCG CTT CCA TTG CTC AGC GG-3’. The amplification program of p107: the melting temperature was 94°C for 60 seconds, the annealing temperature was 55°C for 60 seconds and the primer extension phase was 72°C for 60 seconds, for 35 cycles. The final PCR products were 513 base pairs for the wild-type allele and 386 base pairs for the knockout allele.

The RIPcre:Fak strain genotype was genotyped with the following primer sequences: 5’- GAG AAT CCA GCT TTG GCT GTT G-3’ and 5’-GAA TGC TAC AGG

AAC CAA ATA AC-3’. The final PCR products were 290 base pairs for wild-type allele and 400 base pairs for floxed allele. For the protocol of Fak PCR, the melting temperature

was 94°C for 45 seconds, the annealing temperature was 62°C for 60 seconds and the primer extension phase was 72°C for 60 seconds, for 35 cycles.

The Cre gene was detected with the following primer sequences: 5'-GGC AGT

AAA AAC TAT CCA GCA A -3' and 5'- GTT ATA AGC AAT CCC CAG AAA TG-3'.

The final PCR product was 250 base pairs. For the PCR amplification programme of Cre, the melting temperature was 95°C for 30 seconds, the annealing temperature was 64°C for

30 seconds, and the primer extension phase was 72°C for 30 seconds, for 40 cycles.

All primers were synthesized by Eurofins MWG Operon (Alabama, USA). PCR products were separated on 1% agarose gel and stained with 1 µg/mL ethidium bromide and visualized by UV light.

III. 4 In vivo metabolic studies and hormone measurements

Glucose tolerance tests (GTT) were performed on overnight-fasted (14–16 hours) mice by intraperitoneal (i.p.) injection of glucose (1 g/kg of body weight) and blood glucose levels were measured at 0, 15, 30, 45, 60, and 120 minutes after glucose injection by glucose meter (Precision Xtra, Abbott Laboratories). Insulin tolerance tests (ITT) were performed on overnight-fasted mice using human recombinant insulin (Novolin R, Novo

Nordisk) at a dose of 1U/ kg of body weight, and blood glucose levels were measured at 0,

15, 30, 45 and 60 minutes. Glucose stimulated insulin secretion (GSIS) was measured on overnight-fasted mice after i.p. injection of glucose (3 g/kg of body weight), from saphenous vein blood samples at 0, 2, 10, and 30 minutes after glucose injection. Serum

samples were assayed for insulin by ELISA according to manufacturer’s protocol (Crystal

Chem, Downers Grove). A 0.5 cc tuberculin syringe with a 27-gauge needle was used for all glucose and insulin injections.

III. 5 Multiple low-dose streptozotocin (MLDS): induction of type 1 diabetes (Chapter IV and VI)

The multiple low-dose streptozotocin (STZ) (MLDS) was used to induce diabetes in mice. 50 mg of STZ purchased from Sigma was dissolved in 2.5 mL of 0.1 M citrate buffer (pH 4.5) and 2.5 mL of PBS (pH 7.4), resulting in a final concentration of 0.01 mg/µL. Mice were injected intraperitoneally at a dose of 40 mg STZ per kg of body weight for 5 consecutive days. Only male mice were used to avoid potential confounding effects of estrogen on β-cells (Le May et al., 2006). A 0.5 cc tuberculin syringe with a 27-gauge needle was used for STZ injections.

III. 6 Immunohistochemistry and immunofluorescent staining

Pancreas was isolated from mice as described in previous studies (Choi et al., 2011b;

Choi et al., 2010). In brief, pancreas was isolated and fixed in 4% paraformaldehyde in 0.1

M PBS (pH 7.4) overnight at room temperature. Fixed samples were dehydrated and embedded into paraffin blocks by the University Health Network Pathology Research

Program (PRP). Paraffin embedded 7 µm thick sections at three levels 150 μm apart were

prepared for staining. Insulin (DAKO) immunostaing was performed on pepsin treated pancreatic sections. Ki67 (DAKO), glucagon (Cell Signaling), GLUT2 (Millipore),

Neurogenin 3 (Ngn3), NK6 homeobox 1 (Nkx6.1), Cytokeratin 19 (Developmental Studies

Hybridoma Bank), neurogenic differentiation 1 (NeuroD1) (Abcam), and muscoloaponeurotic fibrosarcoma oncogene family proteins A (MafA) (Bethyl) immunostaining were performed on citrate buffer-treated pancreatic sections.

Immunofluorescent images were obtained by Zeiss inverted fluorescent microscope

(Advanced Optical Microscopy Facility, Toronto, Ontario, Canada).

III. 7 Terminal deoxynucleotidyl transferase dUTP nick end labeling

(TUNEL)

Islet cell apoptosis was assessed by TUNEL assay (Roche Biochemicals) according to manufacturer’s protocol. Pancreatic sections were dewaxed followed by incubation in

20 µg/µl proteinase K (Roche Biochemicals) in 10 mM Tris-HCl pH 7.4 for 20 minutes in a 37°C waterbath and 10 minute incubation at room temperature. Following wash in autoclaved double distilled water, pancreatic sections were incubated with blocking buffer for 30 minutes at room temperature. Glucagon or insulin primary antibodies were applied on sections for co-staining α- and β-cells respectively. The primary antibody incubation duration was 2 hours at room temperature followed by washing with PBS. Fluorescent- conjugated secondary antibodies were then incubated for 1 hour at room temperature.

TUNEL reaction reagent was then added on sections in a humidified chamber for 40

minutes at 37°C. Sections were washed by PBS and mounted with DAPI-containing media.

The images were obtained and visualized by Zeiss inverted fluorescent microscope

(Advanced Optical Microscopy Facility, Toronto, Ontario, Canada).

III. 8 Islet morphometry

Pancreatic α-, β-, δ-, PP- and ε-cell area were measured by glucagon, insulin, somatostain, pancreatic polypeptide and ghrelin immunostained pancreatic sections using

ScanScope ImageScope system at 20x magnification and analyzed with ImageScope software version 9.0.19.1516 (Aperio Technologies). Cell mass was calculated by β- or α- cell area multiplied by whole pancreas weight. Ki67 positive cells were manually counted on immunohistochemically stained pancreatic sections as percentages of total islet cells.

Pancreatic sections were stained with hematoxylin and eosin (H&E) and imaged by light microscopy (Leica Microsystems Inc.).

III. 9 Islet isolation

Pancreatic islets were isolated from anesthetized mice. The common bile duct was clamped by pinch forceps to block the entrance to duodenum. 3 mL of collagenase type V (3mg/mL, Sigma) were injected through the common bile duct into the pancreatic duct, resulting in pancreas inflation. The inflated pancreas was removed and digested by

incubating with another 10 mL collagenase type V solution at 37°C for 10 minutes. After the digestion, reaction was stopped by iced Hank’s balanced salt solution (HBSS). Digested pancreatic tissue was washed with HBSS for several times, then the tissue was filtered with a gauze mesh. A dissecting microscope was used for handpicking islets in RPMI-1640 media, containing 10% fetal bovine serum (FBS), 100 units/mL penicillin and 100 µL/mL streptomycin.

III. 10 Islet insulin content (Chapter IV and VI)

Isolated islets were incubated overnight in RPMI 1640 media without glucose

(Gibco), then stimulation with 2.5 mM or 15 mM glucose-containing media took place for

30 minutes and then acid/ethanol extraction was performed for insulin content as previously described (Choi et al., 2011a; Choi et al., 2010). Serum and media samples were assayed for insulin by ELISA (Crystal Chem, Downers Grove).

III. 11 Chromatin immunoprecipitation (ChIP) (Chapter IV)

Chromatin immunoprecipitation (ChIP) was performed with EpiTect Chip One-

Day Kit (Qiagen) according to the manufacturer’s protocol, and quantified by quantitative real-time PCR (q-RT-PCR) using EpiTect Chip qPCR Primer Assay For Mouse Arx

(Qiagen).

III. 12 Cell culture, siRNA transfection, exendin-4 treatment and adenovirus infection (Chapter IV and V)

Insulinoma cells (INS-1) (a kind gift provided by Dr. Tianru Jin, University of

Toronto, Toronto) were cultured in T-75 tissue culture flasks (Sarstedt) in RPMI 1640 medium (GIBCO) supplemented with 11.1 mM D-glucose, 2 mM L-glutamine, 10 mM HEPES, 1 mMsodium pyruvate, 50 μM 2-mercaptoethanol, 1% (vol/vol) penicillin streptomycin and 10% (vol/vol) FBS under a humidified condition of 95% air and 5%

CO2 at 37 °C. Simian virus 40 T-antigen induced glucagonoma cells (α–TC) (a kind gift provided by Dr. Tianru Jin) were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% (vol/vol) FBS, and 1% (vol/vol) penicillin and streptomycin. Cells were starved for 2 hours in FBS-free culture medium and treated with 10 nM recombinant exendin-4 (Bachem) in culture medium. Cell protein lysates were collected for Western blot at indicated times. Cells were transfected with Rb, p107, E2f transcription factor 1

(E2f1) or scramble negative control Silencer Select siRNA (Ambion, catalog # s72763, s232934, s201266 and s4390843 respectively) by Lipofectamine RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s reverse transfection protocol. Cells were infected with recombinant adenovirus-CMV-Rb (Vector Biolabs, pfu=1010) at a multiplicity of infection (MOI) of 100 for 24 hours.

III. 13 Western blotting

Protein lysates of isolated islets, liver, muscle, and hypothalami were isolated and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and immunoblotted with antibodies for FAK, insulin receptor (IR), insulin receptor substrate 2

(IRS2), pIRS1/2, phosho-paxillin (Tyr 118), Bcl-XL, cyclin dependent kinase (CDK) 5, talin, Rb, p107, E2f1, p53, p21, p27, Mdm2 (Santa Cruz Biotecnology), phosho-IR (Tyr

1158/1162/1163) (BioSource), paxillin (BioLegend), Bcl-2 (Calbiochem), phospho-AKT

(Ser 473), AKT, p53, phospho-ERK1/2 (Thr202/Tyr 204), ERK1/2, PDX-1, cleaved caspase 3, cyclin D1, PCNA and GAPDH (Cell Signaling), glucose transporter 2 (Glut2)

(Upstate), Ngn3 (Developmental Studies Hybridoma Bank) as previously described (Choi et al., 2011a; Choi et al., 2010; Wang et al., 2010). The signal densities of Western blots were quantified by Image J software.

III. 14 Propidium iodide staining and flow cytometry (Chapter IV and V)

Control and siRNA transfected cells were washed with PBS and stained with membrane impermeant dye propidium iodide (PI) for 10 minute at room temperature.

Fluorescent images were obtained by Olympus IX71 microscope configured for phase contrast microscopy and fluorescence imaging with a QImaging Retiga EXi camera and

Micro-manager 1.3 software (MMstudio Version 1.3.37). For flow cytometry, control and siRNA transfected cells were collected in cold 70% ethanol for overnight fixation at – 20

°C. The fixed cells were washed by ice-cold PBS, treated with RNase (Sigma-Aldrich) and

1 % Triton X-100, and then stained with PI for 1 hour. Cell cycle analyses were determined by cell nuclear DNA content using BD Biosciences FACS Caliburs (Princess Margaret

Hospital Flow Cytometry Facility).

III. 15 Cell, mouse and human RNA extraction and quantitative real- time PCR (Chapter IV and V)

RNA from cells or isolated islets was isolated with RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol. RNA was reverse transcribed by random primers using M-MLV (Invitrogen). Human islets were isolated from individuals with or without type 2 diabetes using the Edmonton protocol (Shapiro et al., 2000) and provided by the

ABCC Human Islet Distribution Program (University of Alberta). Islet donation was approved by the local institutional ethical review board. Detailed information of human islet isolation was provided as previously described (Basford et al., 2012). Human islet

RNA was extracted by RNeasy Mini Plus Kit (Qiagen) according to the manufacturer’s protocol. cDNA was obtained from the isolated RNA samples by M-MLV reverse transcriptase kit (Sigma) with the Oligo(dt) 12-18 primers (Invitrogen). q-RT-PCR was performed with 7900HT Fast-Real Time PCR System (Applied Biosystem) with SYBR

Green master mix reagent (Applied Biosystem) and appropriate amounts (10-20 ng) of

RNA as the template. Primer sequences are listed in Table 1.

III. 16 Administration of exendin-4 (Chapter V)

Synthetic exendin-4 (EX) (Sigma) was prepared in PBS for administration. EX was administered twice a day by intraperitoneal injection, at 9 AM and 5PM, for 3 consecutive days at a dose of 24 nmol/kg of body weight as previously described (Choi et al., 2009).

III. 17 Transmission electron microscopy (Chapter VI)

Pancreatic islets were isolated from 4-8 week old mice by collagenase digestion and cultured in RPMI 1640 medium without glucose for 1 hour. Islets were then stimulated with 15 mM glucose containing medium or saline for 2 minutes and fixed in Karnovsky style fixative at 4oC for overnight fixation as previously described (Kwan and Gaisano,

2005). Sections were imaged by Hitachi H7000 transmission electron microscope at an accelerating voltage of 75 kV.

III. 18 F-actin dynamics and co-localization of focal adhesion proteins

(Chapter VI)

Table 1: Primer sequences for quantitative real-time PCR

Gene Forward (5'-3') Reverse (5'-3') Arf CATGTTGTTGAGGCTAGAGAGG TCGAATCTGCACCGTAGTTG Arx TCACCCTGCGCTTGATTC AAAAGAGCCTGCCAAATGC Bak AATGGCATCCGGACAAGGAC TGTTCCTGCTGGTGGAGGTA Bax AGGGTTTCATCCAGGATCGAGCAG ATCTTCTTCCAGATGGTGAGCGAG Bcl-xl GACAGAAGATCATGCCGTCC GGTACCAATGGCACTTCAAG Ccnd1 CTGGCCATGAACTACCTGGA GTCACACTTGATCACTCTGG Ccne CTGAGAGATGAGCACTTTCTG GAGCTTATAGACTTCGCACACCT E2f1 GAGGCTGGATCTGGAGACTG AAGAAGCGTTTGGTGGTCAG E2f2 TCCGCAAGAAGTCCAAAA AC GGGAGCAACTCTGAATGAGC E2f3 AGGGCCCATTGAGGTTTACT GAGGCCAGAGGAGAGAGG TT E2f4 CAAGAACTGGACCAGCACAA AGGGTATCTCCAGCAAAGCA E2f5 CACTCAGGGCCTATCCATGT GGAAGGCTGTGTGAGGTCAT Insulin TCAAGCAGCACCTTTGTGGT AGCTCCAGTTGTGCCACTTGT Kir6.2 TTGGAGGCGTGGTAGAAAC GGT GTG GGC ACT TTA ATG GT Ngn3 CTGGAGTGGGAGGTAGTGGA TGGAGCGAGAGTTTGATGTG Noxa GAACGCGCCAGTGAACCCAA CTTTGTCTCCAATCCTCCGG p21 GCAGATCCACAGCGATATCC CAACTGCTCACTGTCCACGG p27 AAGGGCCAACAGAACAGAAG GGATGTCCATTCAATGGAGTC P53 CACAGCGTGGTGGTACCTTA TCTTCTGTACGGCGGTCTCT Pax4 CTTCCCAGTCCCCACAGTAA AACCCTCACCGTGTCTTCAG Pax6 AGTTCTTCGCAACCTGGCTA GTGTTCTCTCCCCTCCTTC Pdx1 GAAATCCACCAAAGCTCACG ACGGGTCCTCTTGTTTTCCT Puma CCTCAGCCCTCCCTGTCACCAG CCGCCGCTCGTACTGCGCGTTG Rb TACACTCTGTGCACGCCTTC TTCACCTTGCAGATGCCATA Actin ACTGGGACGACATGGAGAAG GGGGTGTTGAAGGTCTCAAA

To detect F-actin, cells were fixed with Z-FIX (Anatech Ltd., Battle Creek, MI) and stained with Alexa Fluor 488-conjugated phalloidin (Invitrogen). β-cells were identified by insulin immunostaining (Santa Cruz Biotechnology). Cell images were captured with a

Zeiss AxioCamHRm and acquired with AxioVision 4.8 imaging software (Carl Zeiss

MicroImaging). Data were analyzed using ImageJ software (v1.41o, NIH) by averaging the two peak-intensity line scans following image background subtraction.

For intracellular Ca2+ measurements, islets were incubated for 45 minutes with 3

μM Fura-2-AM (Invitrogen) and 0.06% pluronic acid (Invitrogen) in an extracellular calcium imaging solution as previously described (Dai et al., 2011). Islets were then imaged in fresh imaging solution with 0.5 mM glucose and without Fura-2-AM or pluronic acid at

37oC with constant bath perfusion. Glucose (11 mM) and KCl (20 mM) were increased as indicated, and NaCl concentration was reduced as required. Fluorescence recordings were obtained every 5 seconds. Images were analyzed with Image Pro Plus v6.2 (Media

Cybernetics) or Ratio Cam software (Metamorph).

For localization of phosphorylated paxillin detection, cells were washed with PBS and fixed in 2% paraformaldehyde. Cells were co-immunostained using anti-phospho-

Paxillin and either anti-SNAP25 or anti-Syntaxin 1 (Sigma-Aldrich). Images were captured and co-localization coefficience analyses were performed using a laser scanning confocal imaging system (LSM510) equipped with LSM software (Carl Zeiss, Oberkochen,

Germany).

III. 19 Electrophysiology (Chapter VI)

Standard whole-cell technique with sine+DC lockin function of an EPC10 amplifier and Patchmaster software (HEKA Electronics, Lambrecht/Pfalz, Germany) was used with experiments performed at 32-35ºC as previously described (Dai et al., 2011). β-cells were identified by size and the presence of a voltage-gated Na+ current that inactivated at approximately –90 mV (except when TTX is present).

III. 20 Statistical analysis

Data were presented as mean ± standard errors of the mean (S.E.M.) and were analyzed by two-tailed independent-sample Student’s t-test or one-way ANOVA with post hoc Tukey least significant difference test, as appropriate. P-values < 0.05 were considered statistically significant. *p< 0.05; **p< 0.01; ***p< 0.001.

Chapter IV: Rb in pancreatic progenitors controls α-

and β-cell fate

Erica P. Cai, Xiaohong Wu, Stephanie A. Schroer, Andrew J. Elia, M. Cristina

Nostro, Eldad Zacksenhaus and Minna Woo

Reproduced in part from Proc Natl Acad Sci U S A. (2013) 110(36):14723-8.

Contributions E.P.C. generated and analyzed research data and prepared the manuscript. X.W. performed GTT and ITT experiments. S.A.S. performed islet isolations. A.J.E. isolated fetal pancreas and prepared pancreatic sections. M.C.N., E.Z. and M.W. designed experiments, contributed to discussion and interpretation of the data, and reviewed and edited the manuscript.

IV.1 Introduction

Pancreatic α- and β-cells control glucose homeostasis through glucagon and insulin hormones that have opposing effects (Nadal et al., 1999). Pancreatic islet cell mass is achieved through a rapid surge of neogenesis and proliferation that occurs during the perinatal period (Bouwens et al., 1994). However, this plasticity declines significantly in the postnatal period (Bonner-Weir, 2000a), resulting in a limited ability of islets to regenerate in adulthood (Prentki and Nolan, 2006). However, molecular mechanisms that govern both neogenesis and proliferation in islet cells remain elusive. Better understanding of these processes may allow for development of novel therapeutic strategies to treat diabetes.

During embryogenesis, the pancreas develops from foregut endoderm progenitors, which start expressing pancreatic and duodenal homeobox 1 (Pdx1) at E8.5 (Guz et al.,

1995). Islet endocrine cells derive from Neurogenin3 (Ngn3)-expressing precursors located in the pancreatic epithelium at E8.75 (Villasenor et al., 2008). Once islet precursors adopt a cell identity by producing α- or β-cell hormones, these cells become post-mitotic, after which only a limited number (<10%) of differentiated cells re-enter cell cycle and contribute to prenatal islet expansion (Dor et al., 2004; Hellerstrom and Swenne, 1991).

Neogenesis, a proliferation process of undifferentiated precursors, is the main mode through which rapid islet expansion is achieved in the late phase of fetal development

(Bouwens et al., 1994). However, neogenesis declines rapidly in the postnatal period and

Ngn3-expressing islet precursor cells become virtually absent by one week of age in mice

(Gu et al., 2002; Wang et al., 1995). Thereafter, the majority of islets are maintained in a non-cycling state without the ability to readily self-replicate.

The Retinoblastoma tumor suppressor (Rb) functions as a major gatekeeper of cell cycle progression from G1 to S phase and is required for maintaining cells in the non- cycling, quiescent stage (Cobrinik, 2005). Rb inhibits cell cycle progression by binding to transcription factors such as E2f and inhibiting their transactivation (Cobrinik, 2005). Rb phosphorylation leads to its dissociation from E2f and transcription of E2f-regulated genes that are required for S phase entry (Muller et al., 1997). In addition to cell cycle regulation,

Rb controls multiple other cellular processes including differentiation (Lipinski and Jacks,

1999), senescence (Dasgupta et al., 2006) and apoptosis (Chau and Wang, 2003) in a highly cell-specific and context-dependent manner (Nahle et al., 2002; Wikenheiser-Brokamp,

2006). While Rb is critical in regulating cell cycle entry in proliferating cells, its role in post-mitotic cells is more limited. For example, Rb deficiency in proliferating myoblasts induces increased proliferation and apoptosis (Zacksenhaus et al., 1996) whereas Rb deficiency in post-mitotic muscle fibres does not lead to any defects (Huh et al., 2004). Rb has also been shown to control cell lineage commitment in several cell types including mesenchymal stem cells (Calo et al., 2010) and preadipocytes (Scime et al., 2005). In the pancreas, Rb has been shown to play a minor role in well-differentiated β-cells as evidenced by mice with rat insulin promoter-Cre driven Rb deletion (Vasavada et al., 2007).

However, E2f1 is required for normal pancreatic islet function and homeostasis (Fajas et al., 2004; Iglesias et al., 2004). E2f1 can directly regulate insulin secretion through modulating Kir6.2 expression, a key component of the potassium ATP-dependent channel

(Annicotte et al., 2009). While these results suggest a role for Rb in islet development and function, the effect of Rb disruption in proliferating islet precursors was unknown.

To address this issue, we deleted Rb in Pdx1-expressing pancreatic progenitors.

Remarkably, as opposed to the minor effects of Rb deletion in post-mitotic β-cells, disruption of Rb in pancreatic progenitors had a profound effect on both pancreatic α- and

β-cell fates. Rb deficiency led to increased Ngn3 and neurogenic differentiation 1

(NeuroD1) expression in islets, which represent multipotent endocrine islet cells. These

Rb-deficient precursors showed enhanced β-cell differentiation during embryogenesis.

Furthermore, Ngn3 expression persisted postnatally in Rb-deficient islets which was associated with increased β-cell mass. In contrast, Rb-deficient islet precursors failed to differentiate into mature α-cells due to repression of an α-cell developmental gene, aristaless related homeobox (Arx), resulting in reduced α-cell mass. These opposing effects on α- and β-cell differentiation and survival resulting from Rb loss led to improved glucose homeostasis and protection against diabetes.

IV. 2 Mouse Models and Experimental Design

We have deleted Rb in Pdx1-expressing proliferating islet progenitor cells using

Cre-loxP system, yielding Pdx1-Cre+Rbfl/fl (p-RbKO) mice. To assess direct effects of Rb in β- and α-cells, we exploited INS-1 and α-TC cell lines respectively and used siRNA strategies to manipulate Rb expression. Cultured cell protein and RNA were extracted and used to examine the expression levels of proteins and genes involved in cell apoptosis and

proliferation. Flow cytometry was used for cell cycle analyses after Rb knockdown by siRNA.

In vivo, we performed GTT, ITT and GSIS to measure glucose tolerance, peripheral insulin sensitivity and glucose-stimulated insulin secretion. We performed morphometric analyses on pancreatic sections to measure α-, β, PP, and δ-cell mass following immunostaining for glucagon, insulin, pancreatic peptide and somatostatin respectively.

We isolated fetal pancreas at embryonic day E16.5 for analyses of islet cell differentiation and development by immunofluorescent staining. We also used q-RT-PCR to measure the expression levels of Pax4, Arx and Ngn3 to assess the role of Rb in the regulation of pancreatic islet development. To assess for direct regulation of Rb-E2f1 in

Arx gene expression, chromatin immunoprecipitation (ChIP) was performed. E2f1-specific antibody was used to precipitate E2f1 bound promoter DNA sequence from Rb-knocked- down α-cells. q-RT-PCR was then performed to detect the expression of Arx gene.

We performed Ki67 immunostaining in the pancreatic sections to assess islet-cell proliferation. To evaluate the effects of Rb deletion, we used western blotting to measure the levels of proteins and genes involved in survival or apoptosis. Since Rb family proteins can control E2f genes (Polager and Ginsberg, 2008), we will also measure E2f gene family members, E2f1-5 by q-RT-PCR.

We used TUNEL to assess the presence of apoptotic cells in pancreatic sections. The percentage of TUNEL-positive islet cells was quantified, which elucidated the role of Rb in controlling cell death. We used streptozotocin (STZ)-induced diabetes model to evaluate whether islet-specific Rb deletion could provide diabetes protection by enhancing β-cell

proliferation or inhibiting cell death in diabetic conditions. Mice were injected with STZ

(40mg/kg) for 5 consecutive days and we measured weekly random blood glucose levels.

α- and β-cell area, and their apoptosis and proliferation were measured at 14 days post STZ injection.

IV. 3 Results

IV. 3-1 Rb-deficiency in islet precursors promotes β-cell fate through differentiation and neogenesis

To investigate the physiologic role of Rb in regulating islet cell fate, we deleted Rb in

Pdx1-expressing pancreatic progenitor cells using the Cre-loxP recombination system

(Herrera, 2000), yielding Pdx1-Cre+Rbfl/fl mice, denoted herein as pancreas-specific Rb knockout (p-RbKO) mice (Figure IV-1). To elucidate whether Rb is involved in regulating islet cell differentiation, we first examined the islet cell population in fetal pancreas at embryonic day 16.5 (E16.5), when multipotent islet precursors are developing into single- hormone-expressing differentiated endocrine cells. Intriguingly, we observed an increase in Ngn3 expression in islets of p-RbKO pancreata at E16.5 compared to littermate controls

(Figure IV-2A and B). The increase in this key determinant of endocrine lineage was observed along with another critical downstream islet differentiation factor NeuroD1

Figure IV- 1 Rb specific deletion expression in mouse islets. Rb protein expression in islets, liver, muscle and hypothalamus; n=3 per genotype.

Figure IV- 2 Increased islet precursors in p-RbKO mice. (A, B) Representative images (A) and quantification (B) of Insulin/glucagon, insulin/Ngn3, insulin/NeuroD1, insulin/Nkx6.1 and insulin/MafA co- immunofluorescent images of E16.5 mouse pancreatic sections. Ins= insulin; Glu= glucagon; n=3-4. Scale bar, 40 µm.

(Figure IV-2A and B). To examine islet development into β-cell lineage, we next assessed for β-cell differentiation markers, NK6 homeobox 1 (Nkx6.1) and muscoloaponeurotic fibrosarcoma oncogene family proteins A (MafA), which were also increased (Figure IV-

2A and B). All of these developmental markers also had high proportion of cells that co- expressed insulin (Figure IV-2A and B), which together indicated that Rb deficiency in pancreatic progenitors led to an increase in the number of endocrine precursors and enhanced differentiation into β-cells.

Expression of Ngn3 persisted postnatally up to 4 wks of age in p-RbKO mice in contrast to littermate controls where Ngn3 was undetectable at this age (Figure IV-3A and

B). Consistent with this gene expression profile, Ngn3-expressing islet cells were present in 4-8 wk-old p-RbKO mice and these cells co-expressed insulin (Figure IV-3C and D).

These results suggest that Rb in islet precursors plays a critical role in regulating Ngn3 expression and the preserved Ngn3+ cell population is capable of differentiating into mature

β-cells in the absence of Rb.

Ngn3 can activate downstream homeodomain-containing transcription factor, paired box 4 (Pax4) (Smith et al., 2003), which can act as a repressor of Arx that together mediate proper endocrine islet cell specification (Collombat et al., 2005). Consistent with the findings in fetal p-RbKO pancreas, the increased Ngn3 level was associated with significant induction of Pax4 expression in neonatal p-RbKO pancreas (Figure IV-3E). In addition, expression of Pdx1 and MafA, which are also required for β-cell specification, were significantly elevated (Figure IV-3E). In keeping with these increases in β-cell neogenesis and differentiation markers, p-RbKO pancreata exhibited an increase in single or small clusters of insulin-expressing cells in close proximity to pancreatic ducts (Figure

Figure IV- 3 Increased islet neogenic markers in p-RbKO mice. (A) P1 pancreatic Ngn3 mRNA levels; n=5. (B) Ngn3 islet mRNA levels in 4 wk-old mice; cycle threshold value for control Ngn3 levels were set at 40, the limit of detection, ND= non-detected; n=5. (C, D) Quantification (C) and representative images (D) of Ngn3/insulin co-immunostained pancreatic sections in 4-8 wk-old mice; n=3. (E) Pax4, Pdx1 and MafA mRNA levels from P1 pancreas; n=5. Scale bar, 40 µm.

Figure IV- 4 Increased postnatal neogenesis in p-RbKO mice. (A) Insulin immunostained images on 4 wk-old mouse pancreatic sections; n=3. (B) Cytokeratin 19/insulin co-immunofluorescent images of 4 wk-old mouse pancreatic sections; n=3. (C) Islet number per pancreatic area in p-RbKO mice compared to control; 4-22 wks, islets containing < 20 cells, 20-200 cells or > 200 cells counted as small, medium or large respectively; n= ~60 islets per animal were counted from 8 mice per genotype.Scale bar, 40 µm.

IV-4A), where endocrine progenitor cells are known to arise (Bouwens et al., 1994), and co-expressed the ductal maker cytokeratin 19 (Figure IV-4B). Furthermore, we observed an increase in the number of small islets (Figure IV-4C). Together, these data demonstrate an increase in Ngn3+ precursor cell population leading to increased β-cell differentiation during embryogenesis and increased postnatal β-cell neogenesis in p-RbKO mice.

IV. 3-2 Rb ablation disrupts α-cell development

As Pax4 specifically favours commitment to β-cell lineage during pancreas development, we asked whether the increased Pax4 in fetal Rb-deficient islets might direct

α-cells to transdifferentiate into β-cells. To assess for this possibility, we co-stained glucagon with the β-cell differentiation marker MafA on fetal pancreata. Remarkably, ~40

% of Glu+ cells co-expressed MafA in p-RbKO pancreata at E16.5, showing an adoption of β-cell identity in α-cells along with an increase in insulin and Nkx6.1 co-expression

(Figure IV-5A). These results suggest conversion of α-cell to β-cell in p-RbKO embryos, which may at least in part have contributed to the decreased α-cell mass observed in neonatal p-RbKO mice (Figure IV-5B). To further investigate whether Rb had a direct role in regulating α-cell differentiation, we searched for E2f-binding sites in α-cell developmental genes. Interestingly, we found a conserved E2f1 binding site in exon 2 of the human, mouse and rat Arx gene, which encodes a transcription factor that promotes α- cell fate (Figure IV-6A). To determine whether Rb and E2f regulate Arx, we knocked down

Figure IV- 5 Effects of Rb on α–cell mass and development. (A) Insulin/MafA, glucagon/MafA and insulin/Nkx6.1 stained E16.5 pancreatic sections; n=3-4. (B) Insulin/glucagon stained P1 pancreatic sections and α-cell mass; n=3-4.

Figure IV- 6 The regulatory role of Rb/E2f1 on Arx gene expression.

(A) E2f1 candidate binding site on exon 2 of Arx gene on the X chromosome. (B) Chromatin immunoprecipitation (ChIP) assay in Rb siRNA treated α–TC cells. Relative E2f1 occupancy on exon 2 of Arx gene in control and Rb siRNA treated α–TC cells, as assessed by q-RT-PCR. The q-RT-PCR end-product was imaged by agarose electrophoresis; n=3. Rb knockdown efficiency, as assessed by q-RT-PCR, showing 80 ± 4.04 % reduction of Rb in Rb siRNA treated α–TC cells. GAPDH is a negative control. (C, D) mRNA measurements in α–TC cells at 0 (Control) and 48 h after knockdown of Rb, E2f1 or Rb/E2f1 by siRNA or scramble; n=3. (E) P1 pancreatic and 4 wk-old mouse islet Arx mRNA levels; n=5. (F) 16 h fasting serum glucagon levels from 4-8 wk-old mice; n= 5-7.

Rb by siRNA in a pancreatic α-cell line, α-TC, and performed a chromatin immunoprecipitation (ChIP) assay to assess E2f1 recruitment to the Arx promoter. In the absence of Rb, there was an increase in E2f1 binding to exon 2 of Arx (Figure IV-6B), which was associated with a decrease in Arx gene expression (Figure IV-6C). In contrast,

E2f1 or combined Rb and E2f1 knockdown restored Arx levels in α-cells (Figure IV-6D), suggesting that repression of Arx was E2f1 dependent. Consistent with these in vitro findings, gene expression levels of Arx were significantly lower in neonatal pancreata and adult islets of p-RbKO mice compared to control littermates (Figure IV-6E). In line with these findings, we observed a significant reduction in serum glucagon levels in fasting p-

RbKO mice (Figure IV-6F). Thus, Rb loss affects α-cell fate through Arx gene repression, leading to disrupted α-cell specification and possible transdifferentiation to β-cells.

IV. 3-3 Rb deletion in islet precursors leads to increased β-cell mass and function

In accordance with the effects of Rb on α- and β-cell differentiation, neonatal P1 p-

RbKO mice exhibited a significant decrease in α- to β-cell mass ratio (Figure IV-7A) along with an increase in β-cell mass (Figure IV-7B). These effects in α- and β-cells persisted up to 22 wks of age (Figure IV-7A and B) while p-RbKO mice exhibited similar body weight

and pancreas weight as their control littermates (Figure IV-7C-F). Since differentiation of

δ- and pancreatic polypeptide (PP)- cells are also determined by Arx and Pax4, we next measured δ- and PP-cell mass as well as ε-cell mass in p-RbKO mice. Consistent with a previous report (Collombat et al., 2009) where ectopic expression of Pax4 resulted in low

Arx/Pax4 ratio and conversion of Glu+ cells into Ins+ cells without changing δ- and PP-cell mass, we observed similar δ-, PP- and ε-cell mass in p-RbKO mice compared to controls

(Figure IV-7G and H).

Similar to the newborns, adult p-RbKO mice exhibited increased β-cell mass (Figure

IV-7B) along with increased postnatal Ngn3 expression. Interestingly, Ngn3 expression has recently been found in dedifferentiated β-cells under diabetic conditions (Talchai et al.,

2012) or after extreme islet loss (Collombat et al., 2009; Thorel et al., 2010). We next asked whether β-cells in p-RbKO mice underwent normal differentiation, particularly in the presence of persistent postnatal Ngn3 expression. We measured glucose transporter 2

(Glut2), a marker for glucosensing and differentiated β-cells. In contrast to dedifferentiation that occurs in proliferating β-cells (Talchai et al., 2012), Glut2 was expressed on β-cell membrane (Figure IV-8A) of p-RbKO islets. Furthermore, some Ngn3- expressing cells co-expressed Glut2 (Figure IV-8B) and these two proteins remained persistently elevated (Figure IV-8C), which suggest that the increased β-cell mass in p-

RbKO mice are also functional. Consistent with this notion, glucose-stimulated insulin secretion was modestly increased in p-RbKO mice in vivo (Figure IV-8D) and in vitro in isolated Rb-deficient islets (Figure IV-8E), which may at least in part be contributed by the increased β-cell mass. Increased non-fasting insulin levels (Figure IV-8F) and Insulin gene

Figure IV- 7 Increased β–cell mass in p-RbKO mice. (A) α-cell to β-cell area ratio; n=3-7. (B) β-cell mass; n=3-7. (C,D) Similar body weight in (C) Postnatal 1 (P1) neonates and (D) 4-18 wk-old mice and (E,F) pancrease weight per body weight in (E) P1 neonates and (F) 4-8 wk-old mice; n= 8-10 per genotype. (G, H) Similar level of (G) δ-, (H) PP- ε-cell area per pancreatic area in 4-8 wk-old p-RbKO micecompared to control littermates; n=3 per genotype.

Figure IV- 8 Increased β–cell function in p-RbKO mice. (A) Insulin/Glut2 stained pancreatic sections; n=3-4. (B) Ngn3/Glut2 stained pancreatic sections from 2-8 wk-old mice; n=3-4. (C) Protein expression in P1 pancreas and 2 and 4 wk-old islets; n=3. (D) In vivo insulin secretion after glucose stimulation in mice (8 wk- old); n=5. (E) In vitro insulin secretion after glucose stimulation in mice (8 wk-old); n=5. (F) Serum insulin levels from 4-8 wk-old mice; n=5-7. (G) Islet mRNA levels from 4 wk- old mice; n=3. Scale bars, 40 µm.

expression in Rb-deficient islets (Figure IV-8G) also support that these β-cells are functional and are not dedifferentiated. Known determinants of β-cell function including

Pdx1, MafA and Kir6.2, a key component of the KATP channel required for insulin secretion, were also increased in Rb-deficient islets (Figure IV-8G). Together, these data suggest that

Rb controls islet cell fate determination and its loss leads to increased β-cell lineage differentiation, mass and function.

IV. 3-4 Rb has opposing effects on α– and β–cell survival

To further assess the altered α-and β-cell mass in p-RbKO mice, we next investigated direct roles of Rb in respective cell lines in vitro, which would eliminate any confounding secondary paracrine or autocrine effects that may occur in vivo. Interestingly, we observed that Rb was differentially expressed in pancreatic α- and β–cells under basal conditions with higher levels in α-TC cells compared to a β-cell line, INS-1 (Figure IV-9A and B). In both α- and β-cell lines, knockdown of Rb by siRNA led to induction of E2f1 expression

(Figure IV-10A). Interestingly however, this resulted in opposing effects on the tumor suppressor p53. In α-cells, E2f1 induction led to upregulation (or stabilization) of p53

(Figure IV-10A) and this was associated with an increase in apoptosis as assessed by propidium iodide staining (Figure IV-10B) and a ~3-fold increase in apoptotic subG1 fraction, as determined by DNA content using flow cytometry (Figure IV-10C). Consistent with these findings, α-cell number decreased after Rb knockdown (Figure IV-10D).

Figure IV- 9 Differential Rb expression level in α– and β-cells. (A) Rb protein expression in cell lysates of α–TC and INS-1 cells; n=3. (B) Gene expression in cell lysates of α–TC and INS-1 cells , as measured by q-RT-PCR; n=3.

Figure IV- 10 Opposing effects of Rb deletion on α– and β-cells. (A) Protein expression after 48 h siRNA transfection in α–TC and INS-1 cells; n=3-5. (B) Propidium iodine-stained cells were imaged by phase contrast/fluorescent microscopy (original magnification x20, scale bar, 20 µm). (C) Cell cycle analyses by flow cytometry; n=3. (D) Cell count 48 h after siRNA transfection in α–TC and INS-1 cells; n=3-5. (E) Arf mRNA expression in siRNA treated α-TC and INS-1 cells; n=4.

In striking contrast to the induction of p53 in Rb-deficient α-cells, Rb knockdown in the β-cell line, INS-1, led to a decrease in p53 protein expression (Figure IV-10A).

Consistent with this, there was an increase in Rb-deficient β-cells in S phase (Figure IV-

10C) and higher total cell number (Figure IV-10D). To investigate the basis for the opposing changes in levels of p53 in α- and β-cells despite similar rise in E2f1 expression, we measured Arf/p19 expression, a downstream target of E2f1, which regulates p53 stability via mouse double minute 2 (Mdm2) (Zhu et al., 1999). Interestingly, knockdown of Rb led to induction of Arf in α-cells and suppression of Arf in β-cells (Figure IV-10E).

To assess the direct contribution of E2f1 in these opposing effects, we knocked down E2F1.

This abolished the differential effect of Rb knockdown on Arf seen in the two cell types, suggesting that the regulation of Arf by Rb was E2F1 dependent. Interestingly, concomitant knockdown of E2f1 and Rb led to a further decrease in Arf gene expression in α-cells and an increase in β-cells (Figure IV-10E). One possible explanation for these observations is compensatory effect by E2f3, another E2f family member that is also an E2f1 target gene.

E2f3 has been shown to directly repress Arf expression (Aslanian et al., 2004). Together, these results suggest that E2f1 has direct opposing effects on Arf/p19 expression and p53 stability, leading to differential effects on survival of α- and β-cells.

IV. 3-5 p-RbKO mice have increased β-cell mass with improved glucose tolerance

Figure IV- 11 Increased cell proliferation and p53 attenuation in Rb-deficient islets. (A) Ki67/insulin/glucagon staining on 4-8 wks old pancreatic sections; n=~500 α- and β- cells per animal, 5 mice. (B) TUNEL and glucagon staining in pancreatic sections; n=~150 α-cells per animal, 3-5 mice. (C) Insulin/TUNEL stained pancreatic sections from 12 wk- old mice; n=~1000 β-cells per animal, 4 mice. (D) p53 expression in Mdm2 immunoprecipitated cell lysate in 8 wk-old p-RbKO islets; n=3. (E) Protein levels from isolated islets from 8 wk-old p-RbKO and control mice; n=3. (F) Islet RNA was isolated from 4 wk-old mice and mRNA level was analyzed by q-RT-PCR; n=-3-5 per genotype.

Consistent with the in vitro data, Rb deficiency also led to increased β-cell proliferation and α-cell apoptosis in vivo as evident from a higher percentage of Ki67-positive Ins+ cells

(Figure IV-11A) and TUNEL-positive Glu+ cells in p-RbKO islets (Figure IV-11B).

Similar levels of α-cell proliferation (Figure IV-11A) and β-cell apoptosis (Figure IV-11C) were observed in p-RbKO mice and controls. Interestingly, increased α-cell death did not persist in p-RbKO mice with aging (Figure IV-11B), which may explain the remnant albeit low α-cell number in p-RbKO mice.

The increased β-cell proliferation was further associated with Mdm2-p53 interaction in Rb-deficient β-cells. Remarkably, co-immunoprecipitation of Mdm2 and p53 showed a reduction in p53 protein levels, suggesting elevated association between the two proteins in p-RbKO islets (Figure IV-11D). In addition, p21 and p27 protein expression was decreased with an increase in E2f1, Ccne and Ccnd1 transcripts and their respective proteins, E2f1, Cyclin E and D1 in p-RbKO islets compared to controls (Figure IV-11E and F). These results suggest that Rb-deficient islet cells remain in a proliferative state likely due to increased sensitization to growth signals as evidenced by reduced expression of Arf/p19, leading to Mdm2 activation and subsequent p53 degradation to further enhance their survival and replication.

To investigate the physiological effects of pancreatic Rb deletion on glucose homeostasis, we measured glucose levels in p-RbKO mice. These mice had lower blood glucose levels (Figure IV-12A) and significantly improved glucose tolerance compared to control littermates (Figure IV-12B). We attribute this to the increase in pancreatic β-cell mass and function along with a concomitant decrease in α-cell mass rather than changes in

Figure IV- 12 Improved glucose tolerance in p-RbKO mice. (A) Random blood glucose levels; n=10. (B) Glucose tolerance test at 4-8 wks of age; n=11-15. (C) Insulin tolerance test (4-8 wks); n=11-15 per genotype.

insulin sensitivity as p-RbKO mice exhibited similar glucose lowering during ITT as control littermates (Figure IV-12C).

IV. 3-6 p-RbKO mice are protected from STZ-induced diabetes

To investigate whether the increase in β-/α-cell ratio and β-cell function in Rb- deficient islets had a protective effect against diabetes, we administered multiple low doses of STZ, which induces diabetes through β-cell toxicity and secondary α-cell expansion

(Liadis et al., 2005; Takeda et al., 2012). p-RbKO mice were protected from STZ-induced diabetes throughout a 2-month follow-up period after STZ injection (Figure IV-13A).

Similar to the basal state, p-RbKO mice maintained higher β-cell area (Figure IV-13B and

C) and lower α-cell area compared to control mice (Figure IV-13D) after STZ injection.

This was accompanied by a decrease in TUNEL-positive β-cells in p-RbKO mice compared to control littermates (Figure IV-13E) and an increase in islet cell proliferation

(Figure IV-13F). Together, our data demonstrate that Rb deletion in pancreatic progenitor cells leads to a favorable α- to β- ratio and improved glucose homeostasis under physiological conditions as well as under conditions that promote diabetes.

IV. 4 Summary

The adult endocrine pancreas has a very slow turnover (Teta et al., 2005), and maintenance of the β-cell mass is mostly achieved by self-replication of pre-existing β- cells at a very slow rate (Dor et al., 2004). Several studies have attempted to increase endocrine and particularly β-cell proliferation through regulation of cell cycle proteins

(Cozar-Castellano et al., 2004; Kim and Rane, 2011). Specifically, deletion of the cell cycle regulator Rb in differentiated β-cells did not significantly alter β-cell mass (Vasavada et al., 2007). The challenge in defining the role of Rb in different tissues lies in its specificity not only to cell-type but also to precise stages in the cellular differentiation. To understand the role of Rb in both α- and β-cells, we deleted Rb using Pdx1-Cre in pancreatic precursors in their proliferative phase. Using this mutant model, we demonstrate that deletion of Rb in pancreatic progenitors has dramatic effects on Ngn3 expressing islet precursors with a shift toward a β-cell specification and increased expression levels of Pax4, Nkx6.1 and

MafA. In contrast to its effects on β-cells, Pdx1-Cre driven Rb loss led to repression of Arx with conversion of glucagon expressing α-cells into β-cells during the pancreas development. Overall, Rb loss in islet progenitors led to increased islet precursors during islet development with enhanced β-cell differentiation and postnatal β-cell proliferation and neogenesis. On the other hand, α-cell development was compromised along with increased apoptosis of α-cells, resulting in a persistently reduced α/β-cell ratio. These changes in α- and β-cells together contributed to improved glucose homeostasis (Figure

IV-14).

Figure IV- 13 p-RbKO mice display protection against STZ-induced diabetes.

(A) Glucose level 2 months after multiple low dose injection of STZ; n=7. (B) β-cell area in insulin stained pancreatic sections; n=4. (C) Representative images of Insulin/glucagon co-immunostained pancreatic sections. (D) α-cell area quantified by glucagon stained pancreatic sections; n=4. (E) Representative images and quantification of Insulin/TUNEL stained pancreatic sections; n=~1000 β-cells per animal, 4 mice. (F) Ki67 staining on pancreatic sections; n=~1000 islet cells per animal, 3 mice. Pancreatic sections are from mice day 14 after STZ-injection. Scale bars, 40 µm.

Figure IV- 14 Diagram illustrating the mechanisms of Rb regulating pancreatic α- and β-cell differentiation, mass and function.

Chapter V: Pivotal role for Rb and p107 in α- and β-cell

cycle control and response to GLP-1

Erica P. Cai, Xiaohong Wu, Stephanie A. Schroer, Sally Yu Shi, Cynthia T. Luk,

Tharini Sivasubramaniyam, Jara Brunt, Eldad Zacksenhaus and Minna Woo

Status: Under review

Contributions E.P.C. generated and analyzed research data and prepared the manuscript. X.W. performed GTT and ITT experiments. S.A.S. performed islet isolation. S.Y.S. and C.T.L. helped with GTT and genotyping experiments and edited the manuscript. T.S. and J.B. helped with genotyping experiments. E.Z. and M.W. designed experiments, contributed to discussion and interpretation of the data, and reviewed and edited the manuscript.

V. 1 Introduction

Glucose homeostasis is tightly regulated by insulin and glucagon which are exclusively secreted by pancreatic β- and α-cells, respectively (Nadal et al., 1999). As such, establishing proper proportions of β- and α-cell numbers within islets is crucial to meet the challenge of metabolic changes. A reduction in the number and function of insulin- producing β-cells is a pathological hallmark in both type 1 and type 2 diabetes (Cnop et al.,

2005). Pancreatic β-cell regeneration, in principle, can be achieved by neogenesis of islet stem/progenitor cells (Xu et al., 2008) and self-replication of pre-existing β-cells (Dor et al., 2004). However, islet progenitors are rare and virtually absent after birth, at which time the majority of mature islet cells become postmitotic (Dor et al., 2004; Teta et al., 2005), limiting the ability to replenish adult β-cell number. Therefore, increasing research interest has focused on strategies to boost β-cell mass. Better understanding of the genetic mechanisms controlling α- and β-cells proliferation that can properly regulate insulin and glucagon production may lead to potential cure for diabetes.

Cell proliferation is a finely tuned process whereby cell cycle machinery transit cells through specific restriction points of the cell cycle (Knudsen and Knudsen, 2008b).

Pancreatic islet cells in adults mostly stay in quiescent/G1/0 state but they are able re-enter the cell cycle by exogenous stimuli. For example, GLP-1 analog exendin-4 can potently stimulate β-cell proliferation (Kim et al., 2006; Song et al., 2008), which also prevents α- cell expansion (Ellenbroek et al., 2013; Takeda et al., 2012). However the mechanism by which GLP-1 mediates this divergent dual effect in α- and β-cell cycle re-entry and mass control is unknown.

Rb is a tumour suppressor and a well-known gatekeeper of cell cycle exit through its inhibition of E2f transactivation and their target genes (Knudsen and Knudsen, 2008b).

Rb therefore is a viable target for promoting islet cell cycle re-entry. Previous studies have shown that Rb plays a critical role during cell transition from proliferative to differentiated status, but has a limited role once cells exit the cell cycle and become mature (Huh et al.,

2004; Zacksenhaus et al., 1996). In the pancreas, Rb has a minor role in mature β-cells as evidenced by limited effects in mice with Rb deletion via a rat insulin promoter driven Cre transgene (Vasavada et al., 2007). We have recently reported that disruption of Rb driven by Pdx1-Cre in proliferating pancreatic progenitors leads to improved glucose tolerance.

This was mediated through the opposite regulatory role of Rb in controlling α- and β-cell mass. (Cai et al., 2013). Given the same opposite effects that GLP-1 has on promoting β- cell proliferation while suppressing α-cells, we hypothesized that Rb and its homologs are key regulators of islet cell cycle re-entry to divergently mediate GLP-1 actions on α- and

β-cells and govern islet cell mass to maintain islet homeostasis.

To assess the role of Rb in GLP-1-mediated effects in islets, we treated α- and β- cells with exendin-4, which led to a decline in Rb in both α- and β-cells. Interestingly this similar decline resulted in opposite outcomes of cell cycle arrest and proliferation in α- and

β-cells respectively. In contrast, overexpressed Rb in these cells independently led to attenuate the exendin-4-induced actions. These results show that decline in Rb is the central regulator that leads to the beneficial biological effects in α- and β-cells. We further showed a reduction of Rb in islets of humans with diabetes in keeping with the likely proliferative signal, which the islets may be exposed to diabetic conditions. To gain more understanding of the physiological role of Rb and its homolog p107, we generated mice with Rb and

combined Rb/p107 deletion in pancreatic progenitors. Loss of Rb and Rb plus p107 showed improved glucose tolerance and increased β-cell proliferation. Interestingly, as the mice aged, there was a concomitant increase in β-cell apoptosis in Rb/p107-deficient β-cells resulting in net β-cell loss. Similar to the additive effect in β-cells by Rb and p107 loss, α- cell mass was low in p-RbKO which led to further decline in p-DKO islets. However, the low glucagon was unable to overcome the defects of β-cell insufficiency in the older mice.

Together these regulatory effects of Rb family proteins suggested that Rb and its homologs are likely the key regulators of islet cell cycle re-entry to divergently mediate GLP-1 actions on α- and β-cell and govern islet cell mass.

V. 2 Mouse Models and Experimental design

To assess direct effects of Rb and p107 in β- and α-cells, we used INS-1 and α-TC cell lines respectively and employed siRNA and adenoviral strategies to manipulate Rb and p107 expression. INS-1 and α-TC cells were starved for 2 h in FBS-free media and then treated with 10 nM exendin-4. Cultured cell protein and RNA were extracted and used to examine the expression levels of proteins and genes involved in cell apoptosis and proliferation. Flow cytometry was used for cell cycle analyses upon Rb and/or p107 knockdown by siRNA.

For in vivo studies, we used a Cre-loxP system and deleted Rb in islet progenitors yielding Pdx1-Cre+Rbfl/fl (p-RbKO) mice as described in Chapter IV. To also assess for Rb and its homolog, p107, we examined the whole-body p107 knockout mice (p107KO). To

assess the combined effects of Rb and p107, we bred p-RbKO to p107KO to generate

Rb/p107 double-knockout mice (Pdx1-Cre+Rbfl/fl/p107-/-; p-DKO) and examined these mice. We performed GTT and ITT to measure glucose tolerance, peripheral insulin sensitivity. To investigate for β-cell insulin secretion, we performed glucose stimulated insulin secretion (GSIS) after overnight-fast by i.p. glucose injection (3g/kg body weight).

Blood samples from saphenous vein were collected at 0, 2, 30 min. Enzyme-linked immunoabsorbent assay (ELISA) was used to measure the insulin levels.

To evaluate the role of Rb in mediating exendin-4 action on islet cells, mice were injected with exendin-4 twice a day by intraperitoneal injection, at 9 AM and 5PM, for 3 consecutive days at a dose of 24 nmol/kg of body weight. Islet cell proliferation was assessed and manually counted on Ki67-immunohistochemically stained pancreatic sections as percentages of total islet cells. We used TUNEL assay to assess the presence of apoptotic cells in pancreatic sections. We also isolated the islets to measure the expression levels of proteins and genes involved in regulating apoptosis, including cell cycle regulators, caspase 3 activation and Bcl2 family members.

V. 3 Results

V. 3-1 Critical role of Rb decline in mediating exendin-4 action on α- and β-cells

100

GLP-1 is a widely used anti-diabetic agent that is well-known to promote β- cell mass and while attenuating α-cell mass (Kolterman et al., 2003; Takeda et al., 2012).

We asked whether this opposing regulatory role of GLP-1 in α- and β-cell cycle control may be regulated by Rb. We used a β-cell line and an α-cell line, INS-1 and α-TC respectively to examine the effects of exendin-4. Rb protein expression levels decreased in response to exendin-4 in both α- and β-cell lines along with an increase in E2f1 expression

(Figure V-1A and B). Interestingly however, the levels of downstream effectors of E2f1 in these two cell types were remarkably different. In α-TC cells, there was an induction of cell cycle inhibitors, p53, p27 and p21 along with a decrease in cell cycle proteins, cyclin

D1 and cyclin E (Figure V-1A), whereas in INS-1 cells, cell cycle inhibitors were decreased with an increase in cyclin D1 and cyclin E (Figure V-1B). To further understand the mechanism of this divergent molecular effects with a similar suppression of Rb, we next examined for gene expression of Arf, the upstream regulator of p53. Interestingly, Arf levels were induced in both cell types; however, this induction was only transient in β-cells whereas in α-cells, the elevation was sustained, which may explain the divergent p53 levels in the two cell types (Figure V-1C). In order to assess whether Rb suppression was the central mechanism through which exendin-4 exerted its effects, we overexpressed Rb to prevent the exendin-4-mediated Rb suppression. Indeed, all the effects observed in both α- and β-cells in response to exendin-4 treatment were abolished in both cell types in which

Rb was overexpressed, indicating the essential role of Rb suppression in the opposing biological effects of exendin-4 (Figure V-1D and E).

We next administered exendin-4 to mice deficient in Rb and/or its homolog p107 to assess whether Rb family proteins played an essential a role in GLP-1-mediated effects

101

Figure V- 1 Dichotomous role of Rb level is associated with islet cycle control. (A, B) Western blots of α–TC (A) and INS-1 (B) cell lysates at 0, 6 and 24 h of 10 nM exendin-4 (EX) treatment; n=3 per group. (C) Arf mRNA level in α–TC and INS-1 cells at 0, 6 and 24 h of 10 nM exendin-4 (EX) treatment; n=3 per group. (D, E) mRNA expression in Rb adenovirus (Ad-Rb)-infected α-TC (D) and INS-1 (E) cells with 24 h of 10 nM EX treatment; n=3.

102

in islets in vivo. As expected, exendin-4 treatment led to islet cell proliferation in control mice. In contrast, no additional increase in proliferation was seen in islets of mice with Rb deficiency in pancreatic progenitors (Pdx1-Cre+Rbfl/fl, herein referred to as p-Rb knockout

(KO) mice, which we previously showed to exhibit increased β-cell proliferation under basal conditions (Figure V-2A) (Cai et al., 2013). We next assessed whether deletion of p107, a Rb homolog, had an essential role in exendin-4-mediated effects (Figure V-2B). In contrast to p-RbKO, p107KO mice did show an increase in proliferation in response to exendin-4 similar to WT mice, suggesting that Rb, but not p107 suppression was required for its effects (Figure V-2A). We also assessed the combined effects of Rb and p107 deletion and saw a similar lack of additional proliferation that we observed in Rb deficient islets in double deficient (p-DKO) mice. These results support the essential role of Rb but not p107 suppression in mediating biological effects exendin-4 in islets. (Figure V-2A).

V. 3-2 Reduction of Rb but not p107 in islets of humans with diabetes

Individuals with diabetes are known to undergo adaptive islet cell proliferation to overcome insulin resistance (Cerf, 2013). In support of this notion, a recent report has shown an upregulation of cell cycle genes, such as cyclin D1 and Cdk4, in islets of humans with type 2 diabetes (Taneera et al., 2013). Consistent with islets undergoing compensatory proliferation, we found a reduction of Rb in islets from individuals with diabetes compared to controls (Figure V-3). Expression levels of p107 were also reduced, but the difference

103

did not reach statistical significance (Figure V-3). These data suggest that Rb, but not p107, is a critical negative regulator for adaptive β-cell proliferation.

V. 3-3 Unique role of p107 in potentiating effects of Rb-deficiency in regulating islets homeostasis

To gain more understanding of the regulatory role of Rb and its homolog p107, we next assessed whether Rb family members were essential for glucose homeostasis under physiological conditions. We showed previously that p-RbKO mice have improved glucose tolerance and increased β-cell mass (Cai et al., 2013). In contrast, p107KO had a similar glucose tolerance as controls and p-DKO showed improved glucose tolerance to a similar degree as p-RbKO mice at 4-8 wks of age (Figure V-4A). Interestingly, unlike p-RbKO,

β-cell mass was not increased in p-DKO mice (Figure V-4B). While proliferation was similar to Rb deficient mice (Figure V-4C), there was an increase β-cell apoptosis in p-

DKO mice, as shown by the TUNEL and insulin co-immunostaining in addition to cleaved caspase 3 (Figure V-4D and E), which may explain the lack of increase in β-cell mass in p-DKO mice (Figure V-4B). However, there was an enhanced β-cell function in p-DKO mice (Figure V-4F), which may at least in part contribute to the enhanced glucose homeostasis in young p-DKO mice. This improved glucose tolerance in p-DKO was not attributed to changes in insulin sensitivity as shown by similar glucose lowering during

ITT and body weight and compared to control littermates (Figure V-4G and H).

Interestingly, as these p-DKO mice aged, their glucose tolerance worsened whereas p-

RbKO mice consistently maintained better glycemic control (Figure V-4I and J). This

104

Figure V- 2 Exendin-4 administration in Rb- and/or p107-deficient mice. (A) Ki67 positivity quantified by Ki67-stained pancreatic sections; n=~1,000 islet cells per animal, 3-5 mice at 16-20 wks of age; *Comparison between control and p107KO or p- DKO or p-RbKO mice; #Comparison between the genotype group of mice with or without EX administration. (B) p107 and Rb expression in protein lysates of isolated islets, as shown by Western blot; n=3. GAPDH, glyceraldehyde-3phosphate dehydrogenase, as loading control.

105

Figure V- 3 Expression levels of Rb family members in islets from individuals with diabetes. Human islet Rb mRNA level, as measured by q-RT-PCR; n=8 in non-diabetic individual group; n=3 in type 2 diabetic individual group.

106

Figure V- 4 Rb/p107 deficiency in islets improves glucose tolerance in young but not old aged mice. (A) Glucose tolerance test at 4-8 wk of age; n= 8 per genotype. (B) β-cell area in insulin-stained pancreatic sections; n=5 per genotype. (C) Ki67 positivity quantified by Ki67-stained pancreatic sections; n=5 per group. (D) TUNEL and insulin staining in pancreatic sections. TUNEL-positive β-cells were pointed by white arrow; n= ~1000 β-cells per animal, 5 mice. (E) Cleaved caspase 3 islet protein level, isolated from 4-8 wk-old mice; n=3 per group. (F) In vivo insulin secretion after glucose stimulation in mice (4-8 wk of age); n= 5 per genotype. (G) Insulin tolerance test at 4-8 wk of age; n=8 per genotype. (H) Similar body weight between control, p107KO, p-DKO and p-RbKO mice; n=10 per genotype. (I) Glucose tolerance test at 18-22 wk of age; n=9 per genotype. (J) Random blood glucose levels; n= 10 per genotype.

107

worsening in glucose homeostasis in older p-DKO mice correlated with reduced β-cell mass (Figure V-4B), as a result of a further increase in β-cell apoptosis along with the diminished β-cell proliferation with aging (Figure V-4C and D). p107KO mice had no changes in β-cell proliferation or apoptosis (Figure V-4C and D), suggesting that that p107 alone does not have any essential roles in β-cell homeostasis. However it has a unique potentiating effect when combined with Rb deficiency in islet progenitors.

We next assessed for the role of p107 in α-cells. We showed previously that Rb deficiency in islet progenitors led to a reduction in α-cell mass. In p-DKO mice, there was a significant further reduction in α-cell mass in both age groups, 4-8 wks and 18-22 wks

(Figure V-5A and B), and this was associated with an increase in α-cell apoptosis, as shown by increased TUNEL-positive glucagon-expressing cells to a greater extent than Rb deficiency alone (Figure V-5C). We have previously shown that Rb has a direct role in α- cell development through regulation in the α-cell fate determinant Arx. While Arx was not changed in p107 deficient islets, this was reduced to a greater extent in p-DKO islets than in Rb-deficient islets (Figure V-5D). These changes in α-cells were in line with a significant reduction in serum glucagon levels in fasting p-DKO mice (Figure V-5E). The significant reduction in α-cells may therefore have contributed to improved glucose tolerance in young p-DKO mice (Figure V-4A and J). However, this was not sufficient to overcome the decline in β-cell mass, ultimately leading to glucose intolerance with aging. Therefore, while loss of p107 alone does not appear to alter islet physiology likely due to compensation by Rb, when combined with Rb appears to render both α- and β-cells more susceptible to apoptosis, ultimately resulting in a decline in β-cell mass and glucose intolerance, and depletion of α- cells does not appear to overcome the worsening glucose homeostasis.

108

V. 3-4 Disruption of Rb and p107 in α- and β-cells leads to deregulation of E2f

Previous studies have suggested that E2f members may have a dose-dependent effect on determining the cell fate to undergo either proliferation or apoptosis (Nahle et al.,

2002; Qin et al., 1994). Indeed, p-DKO islets, at 4-8 wks of age, expressed much higher levels of E2f proteins (Figure V-6A). In particular, E2f1 has been shown to promote apoptosis (DeGregori et al., 1997; Rogoff et al., 2004). This was associated with not only an increase in pro-survival and proliferative signalling such as p-Akt, cyclin E (Ccne) and proliferating cell nuclear antigen (PCNA), but also an increase in cell cycle inhibitors, p53, p27 and p21 (Figure V-6B), along with p53 targets, p53-up-regulated modulator of apoptosis (PUMA) and NOXA (Latin for damage) resulting in increased apoptosis as shown by TUNEL in p-DKO islets compared to controls (Figure V-6C). In contrast, p-

RbKO islets showed reduced levels of PUMA and NOXA (Figure V-6C). In addition, an opposing expression pattern of the anti-apoptotic Bcl-2 family member, Bcl-XL, was observed between p-RbKO and p-DKO islets (Figure V-6C). Together, our data show that combined Rb and p107 deletion leads to a transient increase in cell cycle; however, apoptosis is also increased and this persists which eventually leads to a decline in islet mass and glucose homeostasis.

We next assessed the direct essential role of p107 alone or combined with Rb in α- and β-cells in the absence of any confounding in vivo effects, by using siRNA in respective

109

Figure V- 5 Rb/p107 deficiency in islets leads to reduced α-cell mass.

(A) Insulin/glucagon co-immunofluoresent staining on pancreatic sections; n=3 per group. (B) α- cell area quantified by glucagon-stained pancreatic sections; n=5 per group. (C) TUNEL and glucagon staining in pancreatic sections. TUNEL-positive α-cells were pointed by white arrow; n= ~100 α-cells per control, p107KO and p-RbKO animal, 3-5 mice; n=~50 α-cells per p-DKO animal, 3 mice. (D) 4-8 wk-old mouse islet Arx levels; n= 3 per group. (E) Sixteen-hour fasting serum gucago levels from 4-8 wk-old mice; n=5. *Comparison between control and p-DKO or p-RbKO mice; #Comparison between p-DKO and p-RbKO mice. (Scale bar = 40 µm).

110

Figure V- 6 Deficiency of Rb and p107 in islets leads to increased cell apoptosis. (A, C) Islet RNA was isolated from 4-8 wk-old mice, and mRNA levels measured by q- RT-PCR; n=3 per group. (B) Islet protein expression, isolated from 4-8 wk-old mice; n=3 per group.

111

cell lines. Consistent with the in vivo data, knockdown of p107 in α-TC cells did not lead to appreciable p53 induction (Figure V-7A). However, when p107 and Rb were both knocked down, this led to a much greater p53 induction (Figure V-7A), which was associated with a substantially higher apoptotic SubG1 fraction compared to Rb knockdown alone (Figure V-7B). In INS-1 cells, combined knockdown of Rb and p107 also led to an increase in p53 levels (Figure V-7C), which was also associated with a significant increase in apoptosis

(Figure V-7D). Interestingly, Arf was increased in both α- and β-cells after a combined knockdown of Rb and p107 along with a concomitant rise in E2f1 level (Figure V-7E)

(Honda and Yasuda, 1999). This increase in Arf levels was also present in islets of p-DKO mice which was associated with the increased islet apoptosis (Figure V-7F).

In summary, this study shows for the first time that dichotomous effects of Rb loss in α- and β-cells are required for the dual effects of GLP-1. Cell cycle re-entry of pancreatic

β-cells is promoted by exendin-4 through repression of Rb. In contrast, the exendin-4- mediated decline in Rb results in cell cycle arrest in α-cells. Rb homolog, p107, does not appear to have an essential role in islets; yet a concomitant loss of p107 with Rb appears to render both α- and β-cells more susceptible to apoptosis, likely through deregulation of

E2f. Together, these results reveal the unique role of Rb in GLP-1 actions, with deleterious effects of combined loss of Rb and p107. Low levels of Rb in islets of humans with diabetes further show the potential critical role of Rb in the regulation of β-cell proliferation, illustrating pivotal complex role of Rb and its homolog in the regulation of cell cycle of islet cells which must be better understood for viable treatment strategies to overcome β- cell deficiency and α-cell excess that occur in diabetes.

112

V. 4 Summary

Changes in pancreatic islet cell mass are associated with perturbed carbohydrate metabolism and can further lead to diabetes mellitus. Regeneration of adult endocrine pancreas, particularly β-cells, is the key to overcome dysglycemia in diabetes. Studies have attempted to increase islet cell number through regulation of cell cycle machinery but many failed to identify the cell cycle re-entry switch in islet cells. In this study, we first found that Rb protein expression profile negatively correlates with islet cell proliferative ability.

Rb levels in type 2 diabetic islets and exendin-4 treated β-cells were decreased to promote cell cycle progression though increasing E2f1 activity and cell cycle machinery expression level. In addition, exendin-4 treated α-cells also showed reduced Rb level but this induced cell cycle arrest by increasing cell cycle inhibitors, p53, p27 and p21, which may further provide metabolically favorable effects along with exendin-4-induced β-cell proliferation.

On the other hand, p107, the predominant Rb family member expressed in cycling cells, has a limited role in adult β-cell cycle control; however, loss of p107 plus Rb may drive β- cells from the quiescent state back to cell cycling. Deletion of both Rb and p107 also induces islet cell apoptosis due to E2f1 deregulation (Figure V-8A). This apoptotic effect resulted from induction of p53 and levels of its target pro-apoptotic Bcl-2 genes through an E2f1-Arf-dependent mechanism in response to concomitant loss of Rb/p107.

Collectively, we show for the first time the central role of Rb in the dual effects of GLP-1 actions in α- and β-cells. We also show homeostatic roles of Rb and its homolog p107 that is age dependent. These results showcase that Rb family is required to maintain islet cells

113

in a postmitotic state, such that disruption of Rb proteins promotes α- and β-cell cycle re- entry that renders cells either proliferative or apoptotic depending on the strength of the

E2f1 signal in a cell-specific manner (Figure V-8B).

114

Figure V- 7 Deletion of Rb and p107 in α- and β-cells leads to increased apoptosis through E2f1-Arf activity.

(A) Protein expression in cell lysates of α-TC cells; n=3. E: Protein expression in cell lysates of INS-1 cells; n=3. (B) α-cell cycle analyses by flow cytometry; n=3. (C) Protein expression in cell lysates of INS-1 cells; n=3. (D) β-cell cycle analyses by flow cytometry; n=3. (E) Arf and E2f1 mRNA expression in siRNA treated α-TC and INS-1 cells; n=3. (F) 4-8 wk-old islet Arf mRNA level, as measured by q-RT-PCR; n=3.

115

Figure V- 8 Diagram of Rb family members in regulating islet cell fate. (A) Rb family in controlling cell proliferation and cell apoptosis. (B) Loss of Rb proteins in islet precursors leads to differential effects.

Chapter VI: The in vivo role of FAK in pancreatic β-

cells

Erica P. Cai, Marina Casimir, Stephanie A. Schroer, Cynthia T. Luk, Sally Yu Shi,

Diana Choi, Xiao Qing Dai, Catherine Hajmrle, Aliya F. Spigelman, Dan Zhu,

Herbert Y. Gaisano, Patrick E. MacDonald and Minna Woo

Reproduced in part from Diabetes (2012) 61(7):1708-18.

Contributions E.P.C. generated and analyzed research data and prepared the manuscript. M.C., D.C., X.Q.D., C.H., and A.F.S. generated data of intracellular Ca2+ response, voltage-gated Ca2+ currents and capacitance measurement, and F-actin staining. S.A.S. performed islet isolation. C.T.L., S.Y.S., and D.C. helped with GTT and genotyping experiments and edited the manuscript. D.Z. helped with phosphor-paxillin and syntaxin 1 or SNAP-25 staining. H.Y.G., P.E.M. and M.W. designed experiments, contributed to discussion and interpretation of the data, and reviewed and edited the manuscript.

116

117

VI. 1 Introduction

Focal Adhesion Kinase (FAK) was discovered in 1992 as a non-receptor tyrosine kinase that is involved in integrin signalling (Schaller et al., 1992). Integrins engage with the extracellular matrix (ECM) and recruit FAK to form dynamic structures known as focal adhesions. Signalling between cell adhesion receptors, integrins and the ECM can deliver signals from either intra- or extra-cellular environments to influence tissue development, cell viability and motility. Additionally, FAK, along with Paxillin and Talin, has been shown to regulate intracellular cytoskeleton dynamics (Mitra et al., 2005). Actin reorganization is important during insulin release (Li et al., 1994; Thurmond et al., 2003).

Upon glucose stimulation, the cortical filamentous (F)-actin-organized web is disassembled through depolymerization, permitting insulin granules to approach the plasma membrane and interact with t-SNARE proteins to achieve exocytosis (Thurmond et al., 2003).

The structure of FAK consists of three domains, an N-terminal FERM domain, central kinase domain and C-terminal FAT domain (Lim et al., 2008b). The FERM domain associates with integrin molecules while the tyrosine residue 397 of the FAT domain autophosphorylates upon stimulation by integrins. Activated FAK can subsequently phosphorylate other FAK tyrosine residues and associated SH2 domain-containing proteins, such as Src and the p85 subunit of PI3K (McLean et al., 2005).

In vivo siRNA knock-down of FAK causes insulin resistance in liver and muscle by attenuating phosphorylation of insulin receptor substrate (IRS) 1 (Bisht et al., 2008).

Similarly, antisense FAK in a cultured muscle cell line prevented actin reorganization,

118

resulting in decreased glucose transporter (GLUT) 4 translocation and downregulation of insulin/Akt signalling (Bisht and Dey, 2008); whereas increased FAK expression in an insulin resistant muscle cell line enhanced insulin sensitivity and glucose uptake (Bisht et al., 2007). Recently, phosphorylation of FAK and Paxillin was shown to be crucial for glucose-stimulated insulin secretion in primary β-cells in vitro (Rondas et al., 2011).

However, the in vivo role of FAK in pancreatic β-cells and whole body glucose homeostasis remains unknown.

In the current study, we employed a transgenic mouse model to determine the in vivo role of FAK in pancreatic β-cells. A Cre-loxP recombination system was used with a rat insulin promoter (RIP)-driven Cre transgene which specifically deletes FAK in pancreatic

β-cells. Our results show that β-cell specific FAK knock-out (RIPcre+fakfl/fl) mice exhibit reduced β-cell mass due to increased apoptosis and decreased proliferation under basal conditions. Additionally, mice had β-cell dysfunction, as evidenced by reduced insulin secretion due to suppressed focal adhesion protein, paxillin activation and talin expression, impaired F-actin depolymerization and insulin granule trafficking. Altogether, this study is the first to show an essential in vivo role of FAK in the maintenance of pancreatic β-cell mass and function. Absence of FAK in β-cells leads to abnormal glucose homeostasis due to multiple defects including impaired cell survival, proliferation and function through dysregulated insulin signalling and actin dynamics.

119

VI. 2 Mouse Models and Experimental design

Null mutation of FAK causes embryonic lethality in the early developmental period, supporting the critical role of FAK in multiple cellular processes (Ilic et al., 1995). To gain insight into the in vivo role of FAK in pancreatic β-cell homeostasis, we generated a transgenic mouse model using RIP-driven Cre-loxP recombination system to specifically delete FAK in pancreatic β-cells.

We performed GTT, ITT and GSIS to measure glucose tolerance, peripheral insulin sensitivity and glucose-dependent insulin secretion function. To investigate the mechanism of FAK deletion in the regulation of cell proliferation, we assessed for proteins involved in integrin signalling and in insulin signalling, Western blots have been done on protein lysates of the isolated islets to assess for protein expression and its phsophorylation state using phospho-specific antibodies. To assess for FAK-mediated cell cycle regulation, we measured cell cycle regulator protein levels, which have been shown to be involved in integrin-FAK signalling (Klein et al., 2009). In order to evaluate apoptosis in FAK- deficient islets, we assessed for caspase activation or cleavage and measure protein levels of Bcl-2 family members. To examine the effect of FAK deletion under the diabetic condition, we used STZ-induced diabetes model to examine changes in β-cell area by the insulin-immunostained pancreatic sections and then assess for β-cell apoptosis by TUNEL.

To investigate for insulin exocytosis in FAK-deficient mice, we examined protein localizations of insulin vesicle-associated proteins, SNARE and VAMP proteins, which may be affected by absence of FAK, leading to defects in insulin granule packaging and exocytosis. We also examined glucose transporter 2 (GLUT2) localization and actin

120

filament reorganization by immunofluorescence for elucidating whether FAK could regulate cytoskeleton and glucose sensitivity in β-cells. Lastly, we performed transmission electron microscopy (TEM) to visualize the insulin vesicle distribution under basal and glucose-stimulated conditions.

VI. 3 Results

VI. 3-1 Specific deletion of FAK in β-cells and glucose homeostasis

FAK was efficiently deleted in pancreatic islets of RIPcre+fakfl/fl mice as confirmed by Western blot (Fig. 1A). A minimal residual expression of FAK protein in islets likely represents expression in non-β-cells. Insulin promoter activity has also been shown to be present in the hypothalamus (Wicksteed et al., 2010); therefore, FAK expression levels were also examined in isolated hypothalami in addition to other metabolic tissues including the liver and skeletal muscle. We confirmed that FAK expression was not diminished in these tissues in RIPcre+fakfl/fl mice compared to RIPcre+fak+/+ littermates (Figure VI-1A).

RIPcre+fakfl/fl mice were healthy and born at the expected Mendelian ratio. Body weight was similar between RIPcre+fakfl/fl and RIPcre+fak+/+ littermates (Figure VI-1B).

We next assessed the effects of FAK deletion in the pancreatic β-cells on glucose homeostasis. Random blood glucose levels, measured in 4-8-week and 12-18-week-old mice, showed an increase in RIPcre+fakfl/fl compared to their RIPcre+fak+/+ littermates in both age groups (Figure VI-2A). We then performed glucose tolerance tests, which

121

Figure VI- 1 Specific deletion of FAK in the pancreatic β-cells. (A) FAK expression in protein lysates of isolated islets of RIPcre+fakfl/fl mice and the expression was not affected in liver, muscle and hypothalamus between RIPcre+fakfl/fl (black bars) and RIPcre+fak+/+ mice (white bars), as shown by Western blot, n=3 per genotype. (B) Similar body weight between RIPcre+fak+/+ (white bars) and RIPcre+fakfl/fl mice (black bars), n>10 per genotype. +,+/+: RIPcre+fak+/+; +,-/-: RIPcre+fakfl/fl.

122

demonstrated similar fasting blood glucose levels but impaired glucose tolerance in

RIPcre+fakfl/fl mice compared to RIPcre+fak+/+ controls in both age groups (Figure VI-2B).

To investigate whether the impaired glucose tolerance was due to changes in peripheral insulin sensitivity, insulin tolerance tests were performed. The results showed similar blood glucose lowering after insulin injection between RIPcre+fak+/+ and RIPcre+fakfl/fl mice in both age groups (Figure VI-2C), which suggests that the impaired glucose tolerance in

RIPcre+fakfl/fl mice was not due to changes in peripheral insulin sensitivity, but rather due to defects in β-cell mass and/or function. These results show that FAK in β-cells plays an essential role in regulating glucose homeostasis.

VI. 3-2 Reduced β-cell mass in RIPcre+fakfl/fl mice due to decreased proliferation and increased apoptosis

β-cell area was measured by morphometric assessment on insulin-immunostained pancreatic sections. RIPcre+fakfl/fl mice showed reduced β-cell area relative to pancreatic area and β-cell mass compared to RIPcre+fak+/+ controls in both age groups (Figure VI-

3Aand B). Diminished β-cell mass in RIPcre+fakfl/fl mice could arise from changes in β- cell proliferation or viability. Immunostaining for Ki67, a marker of proliferation, on pancreatic sections showed a decreased number of Ki67 positive cells in islets of

RIPcre+fakfl/fl mice compared to littermate RIPcre+fak+/+ controls (Figure VI-3C). We next examined for apoptosis and observed an increase in cleaved (activated) caspase 3

123

Figure VI- 2 FAK deficiency in β-cells leads to glucose intolerance. (A) Increased random blood glucose levels in RIPcre+fakfl/fl mice (black bars) compared to RIPcre+fak+/+ (white bars), n=5 per genotype. (B) RIPcre+fakfl/fl mice display glucose intolerance compared to RIPcre+fak+/+ littermates in both age groups, as assessed by glucose tolerance test, n=7-10 per genotype. (C) Similar peripheral insulin sensitivity as assessed by insulin tolerance test between RIPcre+fak+/+ and RIPcre+fakfl/fl mice, n=10 per genotype. White triangles: 4-8 week old RIPcre+fak+/+; black triangles: 4-8 week old RIPcre+fakfl/fl; white squares: 12-18 week old RIPcre+fak+/+; black squares: 12-18 week old RIPcre+fakfl/fl. *, Comparison between 4-8 week old RIPcre+fak+/+ and RIPcre+fakfl/fl islets. #, Comparison between 12-18 week old RIPcre+fak+/+ and RIPcre+fakfl/fl islets. +,+/+: RIPcre+fak+/+; +,-/-: RIPcre+fakfl/fl.

124

Figure VI- 3 Reduced cell mass in FAK-deficient β-cells due to decreased proliferation and enhanced susceptibility to apoptosis. (A) Insulin-immunostained pancreatic sections and β-cell area per pancreatic area; RIPcre+fakfl/fl mice (black bars); RIPcre+fak+/+ littermates (white bars), n=5 per genotype. Scale bars=200 μm. (B) β-cell mass; n=3-5 per genotype. (C) Pancreatic islet circled by dashed line and Ki67 positive cells pointed by black arrow. Percentage of Ki67 positive islet cells (original magnification X40), n= ~3000 β-cell per animal from six 4-8 week old mice per genotype were counted. (D) Caspase (Casp) 3 activation as assessed by caspase 3 cleavage by Western blot of protein lysates of islets isolated from 4-8 week old mice; n=3 per genotype. (E) Increased β-cell apoptosis in RIPcre+fakfl/fl mice in basal state or after 2 day injection of multiple low doses of STZ as assessed by TUNEL (original magnification X40), n= ~1000 β-cell per animal were counted from three to five 6-8 week old male mice per genotype. (F) RIPcre+fakfl/fl mice (black diamond) were more susceptible to hyperglycemia than RIPcre+fak+/+ littermates (white diamond) after 2 day but diminished at 14 day post injection of multiple low doses of STZ as shown by random blood glucose levels, n=3-4 per genotype. +,+/+: RIPcre+fak+/+ (White bars); +,-/-: RIPcre+fakfl/fl (black bars).

125

expression in isolated islets and TUNEL positive insulin immunostained cells in pancreatic sections of RIPcre+fakfl/fl mice compared to RIPcre+fak+/+ controls (Figure VI-3D and E), indicating increased β-cell apoptosis under basal conditions. This, combined with reduced

β-cell proliferation in islets of RIPcre+fakfl/fl mice, is likely responsible for the decreased

β-cell mass. In order to assess whether deletion of FAK in β-cells would also render these cells more susceptible to apoptotic stimuli, we challenged these mice with multiple low doses of STZ. Indeed, RIPcre+fakfl/fl mice were more susceptible to hyperglycemia than

RIPcre+fak+/+ littermates (Figure VI-3F). An increase in random blood glucose levels of

RIPcre+fakfl/fl mice persisted post STZ injections and remained significantly higher than

RIPcre+fak+/+ controls throughout the 14 day period post STZ injections. This was likely due to an increase in susceptibility to β-cell apoptosis, as evidenced by increased TUNEL positive β-cells in the pancreas of RIPcre+fakfl/fl mice compared to RIPcre+fak+/+ littermate controls (Figure VI-3E).

VI. 3-3 FAK-deficient pancreatic β-cells show intact islet architecture but reduced insulin signalling

Given the role of FAK in integrin signalling and cell adhesion, linking communication between the ECM and the intracellular actin cytoskeleton, we next examined islet architecture in RIPcre+fakfl/fl mice. Murine islets are characterized by a spherical structure containing insulin producing β-cells in the core and other endocrine cells, α, ε, δ and PP

126

cells, in the periphery (Baetens et al., 1979). By hematoxylin and eosin staining and insulin- glucagon fluorescent co-immunostaining, islet architecture appeared intact in RIPcre+fakfl/fl mice (Figure VI-4A), and α–cell area and mass were similar between RIPcre+fakfl/fl and

RIPcre+fak+/+ mice (Figure VI-4B). Given the role of FAK in integrin and insulin/PI3K signalling, we next assessed expression of signalling mediators in these pathways in isolated islets under basal conditions. Insulin and integrin signalling are regarded as critical molecular pathways in regulating pancreatic β-cell proliferation, viability and function

(Kulkarni et al., 1999; Riopel et al., 2011). We observed that insulin signalling was suppressed in the islets of RIPcre+fakfl/fl mice as evidenced by a significant reduction in phosphorylation levels of IR, IRS1/2 and Akt (Figure VI-4C). Some target proteins of this signalling pathway relevant for cell cycle and apoptosis in β-cells (Ding et al., 2005; Hui and Perfetti, 2002; Lim et al., 2008a), cyclin D1, p53, p27 and Pancreatic and duodenal homeobox (PDX) 1, were also affected (Figure VI-4D). In addition, reduced phosphorylation of ERK1/2, the main effector of integrin signalling, was also found in islets of RIPcre+fakfl/fl mice. Interestingly, studies have shown that ERK is required for cell growth through regulating cyclin-dependent kinase (Cdk) 5 expression and activation

(Harada et al., 2001). Furthermore, Cdk5/ERK signalling has been shown to activate Bcl-

2/Bcl-XL expression to prevent apoptosis in neuronal cells (Wang et al., 2006). Here we

+ fl/fl found reduced Cdk5, Bcl-2 and Bcl-XL expression levels in RIPcre fak islets (Figure VI-

4D), suggesting that FAK plays a critical role in β-cell survival through regulating multiple signalling pathways that are involved in cell proliferation and apoptosis.

127

Figure VI- 4 Islet architecture and signal transduction pathways. (A) Maintained islet architecture in RIPcre+fakfl/fl islets as assessed by hematoxylin and eosin (H&E) staining and insulin/glucagon immunofluorescent co-staining on pancreatic sections from 4-8 week old mice (original magnification X20), n=3 per group. Scale bars=40 μm. (B) α-cell area were quantified by glucagon-immunostained pancreatic sections and α-cell mass, n=3 per genotype. (C) Protein analysis by Western blot showed that RIPcre+fakfl/fl islets have attenuated phosphorylated IR, IRS1/2, AKT compared to RIPcre+fak+/+ littermates. (D) Protein analysis by Western blot showed that RIPcre+fakfl/fl islets have attenuated ERK1/2 (ERK1 was referred to p44 as presented in the upper band of the Western blot image and ERK2 was referred to p42 as presented in the bottom band of the image), cyclin D1, CDK5, Bcl-2, Bcl-XL as well as PDX1, but increased expression of cell cycle inhibitors, p53 and p27 compared to RIPcre+fak+/+ littermates. Islets were isolated from 4-8 week old mice and used for Western blot analysis. Quantification analyses in right panel (white bars = RIPcre+fak+/+; black bars= +,-/-: RIPcre+fakfl/fl), n=3 per genotype.

128

VI. 3-4 Impaired glucose-stimulated insulin secretion with normal

GLUT2 and Ca2+ response in FAK–deficient β-cells

Insufficiency in either β-cell mass and/or function can lead to impaired glucose tolerance. Thus, we next examined whether FAK is also essential for β-cell function.

Random plasma insulin level was decreased in RIPcre+fakfl/fl mice (Figure VI-5A) but similar insulin content was maintained within similarly sized islets (Figure VI-5B). To further investigate β-cell function, we measured glucose-stimulated insulin secretion and found reduced insulin secretion in response to glucose in vitro (Figure VI-5C). Phase I and phase II insulin secretion were also suppressed in vivo in RIPcre+fakfl/fl mice (Figure VI-

5D). In response to glucose, multiple critical steps take place in β-cells, starting with glucose transport through glucose transporter (GLUT) 2, followed by glucose metabolism and generation of ATP, resulting in closing of ATP-sensitive potassium (KATP) channels.

Subsequent cell membrane depolarization activates voltage dependent calcium channels

(VDCC) causing the influx of calcium ions that in turn stimulates insulin granule trafficking and exocytosis.

To investigate which aspects of glucose-stimulated insulin secretion were affected by absence of FAK, we first examined levels of GLUT2. Expression and distribution of

GLUT2 in β-cells was similar between those of RIPcre+fakfl/fl and RIPcre+fak+/+ mice

(Figure VI-5E). Furthermore, intracellular Ca2+ homeostasis, as evidenced by baseline Ca2+ levels and response to glucose (11 mM), was similar between RIPcre+fak+/+ and

RIPcre+fakfl/fl islets (Figure VI-6A and B). There was however an increase in the Ca2+-

129

Figure VI- 5 Reduced insulin secretion in FAK-deficient β-cells with normal GLUT2 expression. (A) Reduced random insulin level in RIPcre+fakfl/fl (black bar) compared to RIPcre+fak+/+ littermates (white bar), n=6 per genotype. (B) Insulin content and (C) insulin secretion in response to glucose (2.5 mM or 15 mM), in group of 10 handpicked similar sized islets, was equal between RIPcre+fak+/+ (white bar) and RIPcre+fakfl/fl (black bar) islets, n=4 per genotype. (D) Reduced insulin secretion in vivo after glucose stimulation in RIPcre+fakfl/fl (black triangles) compared to RIPcre+fak+/+ littermates (white triangles), n=5-6 per genotype. (E) Normal expression and distribution of GLUT2 on RIPcre+fakfl/fl islets, as assessed by insulin/GLUT2 immunofluorescent co-staining (original magnification X20), n=3 per genotype. Scale bars=40 μm. All mice used in experiments between 4 and 8 weeks of age. +,+/+: RIPcre+fak+/+; +,-/-: RIPcre+fakfl/fl.

130

Figure VI- 6 Normal Ca+2 response in FAK-deficient β-cells. (A) Intracellular Ca2+ responses, determined by ratiometric Fura-2-AM (Fura-2- acetoxymethyl ester) fluorescence measurements, were similar between RIPcre+fak+/+ and RIPcre+fakfl/fl islets in response to glucose (11 mM) and slightly increased in response to KCl (20 mM). (B) There were no differences in baseline or peak Fura-2-AM ratios, fold increase in response to 11 mM glucose, or the time to peak response between RIPcre+fak+/+ (white bars) and RIPcre+fakfl/fl (black bars) islets, n=3 mice per genotype. (C) Representative traces of voltage-gated Ca2+ currents measured in response to a series of increasing 500 ms depolarizations from -70 mV in single RIPcre+fak+/+ and RIPcre+fakfl/fl β-cells. (D) The current-voltage relationship, normalized to cell size, demonstrates a significant increase in Ca2+ current density (white circles: RIPcre+fak+/+; black circles: RIPcre+fakfl/fl), which likely accounts for the increased intracellular Ca2+ response to KCl seen in panel B, n=15-17 β-cells from three mice each genotype. +,+/+: RIPcre+fak+/+; +,- /-: RIPcre+fakfl/fl.

131

response to KCl in the RIPcre+fakfl/fl islets, as shown in Figure 5A. This was due to an increased density of voltage-dependent Ca2+ current in β-cells from RIPcre+fakfl/fl islets

(Figure VI-6C and D). This increased activity in Ca2+ channels in response to KCl may reflect a compensatory mechanism to overcome insufficient insulin secretion. These results suggest that glucose sensing and Ca2+ response to glucose were normal in FAK-deficient

β-cells.

VI. 3-5 Defective actin dynamics and decreased focal proteins in FAK- deficient β-cells

The normal Ca2+ response to glucose stimulation coupled with impaired insulin secretion in RIPcre+fakfl/fl islets indicate that the functional defect in the islets might be due to impaired insulin granule trafficking. Since FAK is known to regulate the structure and function of F-actin (Mitra et al., 2005), which is a key determinant controlling the access of insulin granules to the plasma membrane (Pigeau et al., 2009), we examined actin regulation in the β-cells of RIPcre+fakfl/fl mice. At low glucose concentration (2.8 mM), F- actin density was normally distributed in β-cells of RIPcre+fak+/+ and RIPcre+fakfl/fl mice

(Figure VI-7A). Importantly, while glucose stimulation decreased cortical actin density in

RIPcre+fak+/+ β-cells, there was no significant effect of glucose on cortical actin density in

β-cells of RIPcre+fakfl/fl mice. To further investigate this absent effect, we next examined paxillin and talin which are focal proteins that regulate actin dynamics. These proteins can associate with FAK and form a linkage between integrin and F-actin filaments

132

Figure VI- 7 Deletion of FAK in β-cells results in impaired actin depolymerisation and reduced phosphorylated paxillin and talin expression levels. (A) F-actin, detected by staining with Alexa Fluor 488-conjugated phalloidin, was depolymerized by high glucose (16.7 mM) in β-cells from RIPcre+fak+/+ but not RIPcre+fakfl/fl mice (white bars = RIPcre+fak+/+; black bars = RIPcre+fakfl/fl). Cells were confirmed as β-cells by positive immunostaining for insulin (not shown). The peak intensity of F-actin staining at the plasma membrane was quantified and expressed as arbitrary units (a.u.), n=72-115 β-cells from three mice each genotype. (B) Reduced talin expression in RIPcre+fakfl/fl islets compared to RIPcre+fak+/+ littermates, n=3 per genotype. (C) Suppressed phosphorylation of paxillin expression with or without glucose stimulation (15 mM) in RIPcre+fakfl/fl islets as assessed by western blot, n=3 per genotype. +,+/+: RIPcre+fak+/+; +,-/-: RIPcre fakfl/fl. Western blotting quantification analyses presented in below panel.

133

(Le Clainche and Carlier, 2008). We observed reduced expression levels of talin in

RIPcre+fakfl/fl islets (Figure VI-7B). Paxillin can be directly activated by FAK and in our

RIPcre+fakfl/fl islets,we showed suppressed paxillin activity as evidenced by reduced phosphorylation at tyrosine 118 in both basal and glucose-stimulated conditions (Figure

VI-7C). In response to glucose, phospho-paxillin has been shown to colocalize with t- soluble N-ethylmaleimide attachment protein receptors (SNARE) proteins, synaptosomal- associated protein (SNAP)-25 and syntaxin 1, in primary β-cells (Rondas et al., 2011).

Consistent with the reduced phospho-paxillin expression by western blot, RIPcre+fakfl/fl β- cells showed reduced phospho-paxillin, which were colocalized with SNAP-25 or syntaxin

1 at the plasma membrane (Figure VI-8). These results demonstrate that the defect in glucose stimulated insulin secretion is likely due to impaired glucose-dependent depolymerization of cortical actin through defective focal protein dynamics in β-cells of

RIPcre+fakfl/fl mice.

VI. 3-6 FAK-deficient β-cells have impaired insulin granule trafficking

Actin-formed dense web beneath the plasma membrane blocks insulin secretion by providing a barrier for the movement of insulin granules under low glucose concentrations

(Nevins and Thurmond, 2003; Orci et al., 1972). Upon glucose stimulation, actin undergoes depolymerization allowing the granules to dock and fuse with the plasma membrane resulting in insulin release. Our results in Figure VI-7 and 8 show that cytoskeleton actin depolymerization was impaired in FAK-deficient β-cells, which suggest that insulin

134

Figure VI- 8 Reduced co-localization of paxillin and t-SNARE proteins in FAK- deficient β-cells. β-cells were stimulated by glucose (15 mM) for 20 min and stained for phospho-paxillin (green) and syntaxin 1 or SNAP-25 (red). n=3 per genotype. Scale bars=5 μm. All mice used in experiments between 4 and 8 weeks of age. +,+/+: RIPcre+fak+/+; +,-/-: RIPcre+fakfl/fl.

135

granule trafficking might be hampered due to defective actin dynamics. To assess insulin granule trafficking, we examined insulin granule localization in the RIPcre+fakfl/fl β-cells by electron microscopy. A previous study indicates that insulin granules that reside within

0.2 μm of the plasma membrane can be morphologically considered docked granules

(Gomi et al., 2005). We found that under basal conditions, there were fewer insulin granules near the plasma membrane (<0.2 μm) in the β-cells of RIPcre+fakfl/fl mice compared to RIPcre+fak+/+ mice (Figure VI-9A and B). Upon glucose stimulation, the number of membrane-associated granules in RIPcre+fak+/+ β-cells increased significantly as expected, whereas in FAK-deficient β-cells, this failed to occur. Consistent with the notion that knockout of FAK results in fewer docked insulin granules at the plasma membrane of β-cells, we observed a reduced exocytotic response in single β-cells from

RIPcre+fakfl/fl islets in response to a series of ten membrane depolarizations from -70 to 0 mV (Figure VI-10A and B), demonstrating that FAK may regulate actin dynamics in vivo to control insulin granule trafficking and insulin secretion in pancreatic β-cells.

VI. 4 Summary

In this Chapter VI, we show that RIPcre+fakfl/fl mice have reduced β-cell mass and exhibit a defect in glucose-stimulated insulin secretion, which together result in impaired glucose tolerance. These RIPcre+fakfl/fl mice exhibited glucose intolerance without changes in insulin sensitivity. Reduced β-cell viability and proliferation resulting in decreased β-

136

cell mass was observed in these mice, which was associated with attenuated insulin/Akt and ERK1/2 signalling and increased caspase 3 activation. FAK-deficient β-cells exhibited impaired insulin secretion with normal glucose sensing and preserved Ca2+ influx in response to glucose, whereas reduced number of docked insulin granules and insulin exocytosis were found which was associated with a decrease in focal proteins, paxillin and talin, and an impairment in actin depolymerisation (Figure VI-11).

137

Figure VI- 9 Impaired insulin granule trafficking in FAK-deficient β-cells leads to reduce number of docked insulin granules. (A) Electron micrographs of β-cell sections (scale bar: 500 nm). Black dashed lines indicate a distance of 200 nm from the plasma membrane, showing that β-cells of RIPcre+fakfl/fl mice have a fewer number of insulin granules docked at the plasma membrane in both saline-treated or glucose-treated (15 mM) conditions. (B) Quantification of relative granule distribution and density in the first 2 μm region adjacent to the plasma membrane, n=,~ 2000 insulin granules from 12-15 β-cells were counted from three mice per genotype. *, Comparison between saline-treated RIPcre+fak+/+ and RIPcre+fakfl/fl islets. #, Comparison between glucose-treated RIPcre+fak+/+ and RIPcre+fakfl/fl islets *,# p< 0.05, **, ## p< 0.01. Results represent mean ± S.E. All mice used in experiments between 4 and 8 weeks of age. +,+/+: RIPcre+fak+/+; +,-/-: RIPcre+fakfl/fl.

138

Figure VI- 10 Impaired exocytotic responses in FAK-deficient β-cells. (A) Representative capacitance responses elicited from single β-cells from RIPcre+fak+/+ and RIPcre+fakfl/fl mice in response to a series of ten 500 ms depolarizations from -70 to 0 mV. (B) Averaged data demonstrates an impaired exocytotic response in β-cells from the RIPcre+fakfl/fl mice (black circles) compared with those from RIPcre+fak+/+ mice (white circles), n=18-24 β-cells from three mice each genotype. All mice used in experiments between 4 and 8 weeks of age. +,+/+: RIPcre+fak+/+; +,-/-: RIPcre+fakfl/fl.

139

Figure VI- 11 Diagram illustrating the mechanisms of FAK regulating pancreatic β- cell proliferation and function.

Chapter VII: Discussion and Future Perspectives

Reproduced in part from Proc Natl Acad Sci U S A. (2013) 110(36):14723-8,

Diabetes. (2012) 61(7):1708-18 and Cell Cycle. (2014) 13(6): 873-4.

140

141

VII. 1 The role of Rb and p107 in pancreatic α- and β-cells and glucose homeostasis

Deletion of Rb in mature β-cells results in mildly increased E2f2 expression while cell proliferation and apoptosis are unaffected (Harb et al., 2009; Vasavada et al., 2007).

However, Rb deletion combined with p130 causes cells to further upregulate E2f2 expression leading to increased β-cell proliferation. Interestingly, this was associated with p53-induced apoptosis, leading to a net loss of β-cell mass and hyperglycemia (Harb et al.,

2009). In contrast, we showed in Chapter IV that deletion of Rb earlier in development in proliferating Pdx1-positive pancreatic progenitors led to an increase not only in E2f2 but also in E2f1, and this resulted in increased β-cell proliferation without concomitant increase in β-cell apoptosis. These data suggest that E2f1 and E2f2 have distinct effects on p53 regulation resulting in divergent outcomes in β-cell mass and function. E2f1 has also been shown to regulate transcription of Kir6.2, thereby affecting insulin secretion (Annicotte et al., 2009). Here we observed enhanced β-cell function in p-RbKO mice and this is likely at least in part due to increased Kir6.2. In addition to increased β-cell mass in p-RbKO, decreased α-cell mass likely also played a major role in the improvement of their glucose homeostasis. This may also explain the more improved glucose tolerance observed in our p-RbKO mice compared to the RIP-driven Rb deleted mice which did not have Rb disrupted in α-cells (Vasavada et al., 2007).

Interestingly, we show in Chapter V that combined deletion of Rb and p107 in proliferating islets does not exert additional proliferative effect compared with loss of Rb

142

alone in β-cells, but induces a concomitant increase in cell apoptosis instead. These variable outcomes after loss of Rb family members may directly result from the differential expression profile of the downstream effectors of Rb proteins, the E2f family (Iaquinta and

Lees, 2007). We have shown in Chapter IV that the expression level of endogenous Rb was different in α- and β-cells and this might explain the opposing effects observed in Rb- deficient α- and β-cells through differential effect on E2f1 (Cai et al., 2013). In α-cells, Rb deficiency led to ~5-fold increased E2f1 levels, resulting in increased cell apoptosis. In contrast, a less dramatic ~2-fold induction of E2f1 in Rb-deleted β-cells led to increased cell proliferation without concomitant cell death. Similarly, fibroblasts induced with mild elevation in E2f1 levels resulted in increased cell proliferation, but with an excessive increase in the expression of E2f1, these cells became apoptotic through activation of p53- dependent caspase signalling (Nahle et al., 2002). These findings suggest that E2f1 may have a dose-dependent effect on determining cell fate to undergo either proliferation or apoptosis.

Consistent with the notion of the dose-dependent effect of E2f1, we showed in

Chapter V, that combined deletion of Rb and p107 in β-cells induced a greater increase in

E2f1 expression compared with loss of Rb alone, which led to an increase not only in proliferation but also in apoptosis. These data show that this highly elevated, deregulated

E2f1 levels likely were responsible for the phenotype in the double deficient β-cells. Indeed,

E2f1 has been considered to be different from other E2f members by this pro-apoptotic activity (DeGregori et al., 1997; Rogoff et al., 2004). Therefore the unique tendency of

E2f1 in promoting cell death led to the increased susceptibility of Rb/p107-deficient β-cells to apoptosis. This persistently increased cell apoptosis concomitant with a reduction in

143

proliferation resulted in net loss of β-cell mass in older p-DKO mice with aging, leading to the loss of the phenotype of the improved glucose homeostasis observed in the young p-

DKO mice. These data show the importance of the clear understanding of each of the Rb family members and their combined effects for short and long term effects of these genes in glucose homeostasis.

VII. 2 The role of combined Rb and p107 deficiency in α-cells

In Chapter IV, the low α-cell mass was observed in Rb-deficient mice through a direct suppressive role of E2f1 on Arx in determining cell fate specification and postnatal survival

(Cai et al., 2013). In Chapter V, we found that combined loss of Rb and p107 in α-cells increases susceptibility of cells to apoptosis to a greater extent, as evidenced by a ~2-fold increase in α-cell apoptosis in p-DKO mice compared to p-RbKO mice (25% versus 12%).

This increased effect in α-cell death suggests that Rb family proteins likely cooperate to regulate α-cell survival. Importantly, this dramatically decreased α-cell mass in p-DKO mice likely contributed to improving glucose homeostasis in young mice given that only mildly increased β-cell function was observed in p-DKO mice. Moreover, reduction in α- cell mass likely protected from the effects of β-cell loss in aged p-DKO mice, as shown by a similar level of glucose tolerance compared to controls.

144

VII. 3 The role of Rb in pancreatic α- and β-cell proliferation and apoptosis during the postnatal period

Postnatal Ngn3 expression has been linked with islet cell dedifferentiation (Talchai et al., 2012); however, Ngn3 has also been described in adult human islets, mouse islets and immortalized β-cell line Min6 under normal conditions (Dror et al., 2007). Interestingly, in these latter conditions, Ngn3 was expressed primarily in the cytoplasm rather than in the nucleus. During postnatal β-cell neogenesis, cytoplasmic Ngn3+ cells differentiate into nuclear Ngn3+ cells and later co-express insulin to finally become Ins+ cells (Baeyens et al., 2006; Dominguez-Bendala et al., 2005). This evidence indicates that the localization of

Ngn3 may signify a specific state within the differentiation process of β-cells. In Chapter

IV, Our p-RbKO mice showed increased Ngn3+ islet precursor population and displayed an increase in both nuclear and cytoplasmic Ngn3 expression postnatally, which may indicate a neogenic process leading to increased differentiation into functional β-cells, as shown by Ngn3+ cells co-expressing Glut2 and insulin. In α-cells, we show for the first time that loss of Rb resulted in accelerated apoptosis, cell cycle inhibition and a decrease in differentiation. After knockdown of Rb in α-TC cells, E2f1 levels increased dramatically, which was followed by persistent increase in Arf and this led to an increase in p53. In contrast, Arf was decreased in Rb-deficient β-cells with a less dramatic rise of E2f1 and this resulted in an overall decrease in p53 at least in part due to Mdm2-mediated

145

degradation. These results illustrate the fine-tuning of multiple downstream effectors that are orchestrated by Rb in determining final cell fate.

VII. 4 The role of Rb in pancreatic α- and β-cell lineage commitment

Rb has been shown to regulate cell lineage commitment (Calo et al., 2010) in the development of various tissues (Swiss and Casaccia, 2010). Here we illustrate a novel role of Rb in cell fate choice between pancreatic α- and β-cells. During pancreas development, the transcription factor Arx is detected at E9.5 and this specifies α-cell lineage (Collombat et al., 2005). As such, Arx deficient mice exhibit a complete absence of α-cells and proportionally increased β- and δ-cell number (Collombat et al., 2003). Interestingly, ectopic expression of Pax4 in Pdx1- or Pax6-expressing cells resulted in islet endocrine precursors and differentiated α-cells to adopt a β-cell identity (Collombat et al., 2009).

Accordingly, Arx suppression in our p-RbKO mice was associated with Pax4 induction, favouring differentiation of islet precursors to a β-cell identity. In Chapter IV, our data indicate that E2f1 is a direct repressor of Arx gene expression, and E2f1 induction upon Rb loss leads to disrupt α-cell development. E2f1 can both activate and repress different genes, and has been shown to similarly repress the gene for androgen receptor (Valdez et al., 2011) and urokinase-type PA (Koziczak et al., 2000). In addition, E2f1 can autoregulate and

146

activate itself when Rb is absent (Johnson et al., 1994). Together the results presented in

Chapter IV showed that Rb loss led to an induction of E2f1 and repression of Arx resulting in a decrease of α-cell differentiation which contributed to a decrease in its cell mass.

VII. 5 The regulation of E2f1, Arf and p53 in pancreatic α- and

β-cells by Rb family members in determining cell survival

Loss of Rb and/or its homolog can lead to different degrees of E2f1 induction which in turn can lead to distinct expression profiles of its downstream effectors. This then can determine the specific islet cell fate. In Chapter IV, different extent in the induction of the

E2f1 target, Arf, in Rb-deficient α- and β-cells was associated with an opposing effect on

α- and β-cell survival (Cai et al., 2013).

In Chapter V, we observed similar expression patterns of Arf in exendin-4 treated

α- and β-cells as in Rb deficiency, suggesting that the Rb-E2f1 pathway is the key target of exendin-4 in determining α- and β-cell fate. Interestingly, there was a transient induction of Arf in exendin-4 treated β-cells but this returned to baseline levels after 24 h exposure, whereas Arf levels persisted in α-cells in response to exendin-4 treatment. These results show a dynamic change of Arf in α- and β-cells possibly reflecting a dose-dependent effect of E2f1 in regulating islet cell fate.

147

In Chapter V, we showed that a combined deletion of Rb and p107 in islets led to a marked elevation in E2f1, to a greater extent than in single deficiencies. This was associated with a corresponding marked elevation of Arf and p53 levels, and their targets p53-inducible BH3-only proteins, PUMA and NOXA, and subsequent activation of caspase 3. In sharp contrast, loss of Rb alone reduced levels of these two pro-apoptotic proteins, Arf and p53 in β-cells, resulting in increased proliferation and survival. On the other hand, it has been suggested that pro-survival factors such as Bcl-2 and Bcl-XL may protect Rb-deficient cells against autophagy and apoptosis (Ciavarra and Zacksenhaus,

2010; Hemmati et al., 2002). These findings may provide an alternative perspective to interpret the increased proliferative response of β-cells in p-RbKO mice, as shown by an increase in Bcl-XL expression. Collectively, we have shown that pancreatic β-cells are capable of re-entering the cell cycle when Rb is removed during early stages of differentiation, yet combined removal of Rb and p107 sensitizes both α and β-cells to cell death signals perhaps from marked induction of E2f1, leading to eventual β-cell loss which overrides cell proliferation with aging.

VII. 6 The potential role of Rb in cell fate regulation and metabolic homeostasis

148

Loss of Arx and/or Pax4, overexpression of Pax4 (Collombat et al., 2005; Collombat et al., 2009) or β-cell ablation by pancreatic duct ligation or diphtheria-toxin (Chung et al.,

2010; Thorel et al., 2010) can force pre-existing islet cells to reprogram into a new identity to compensate for α- or β-cell loss. However this raises another issue - can the reprogrammed cells function normally after adopting a new identity? Interestingly, reports show that β-cells reprogrammed from α-cells still have glucagon granules that coexist with insulin granules (Chung et al., 2010; Thorel et al., 2010). Ectopic expression of Pax4 by

Pdx1 or Pax6 promoter led to β-cell expansion but this only protected against diabetes in juvenile mice (< 4 wk-old) whereas older mice had worsened glucose tolerance (Collombat et al., 2009). Furthermore, islet cells from older mice did not undergo more proliferation

(Chung et al., 2010; Collombat et al., 2009; Thorel et al., 2010). These observations suggest that islet cells that undergo fate respecification perinatally may not provide long-term solutions for improving glucose tolerance. In contrast, our p-RbKO mice in Chapter IV show an increase in postnatal β-cell neogenesis and display a skewing towards β-cell differentiation. Importantly, these favourable features were associated with an increase in cell proliferation which persisted into adulthood, leading to improved glucose tolerance and protection against diabetes.

Previous work has demonstrated that a role for Rb in cell fate specification appears to provide metabolically favourable outcome in other tissues. For example, in preadipocytes, Rb deletion leads to an increase in brown adipogenesis but this propensity disappears in mature adipocytes. Rb deletion in adult adipocytes increases mitochondrial activation in both white and brown fat tissues and enhances whole body energy expenditure, protecting against diabetes but without any change in brown adipogenesis (Dali-Youcef et

149

al., 2007). Similarly, Rb deletion in pancreatic progenitors leads to a metabolically favourable cell lineage commitment and enhanced β-cell neogenesis to improve glucose tolerance (Cai et al., 2013). However, when Rb is deleted in already differentiated β-cells, these favourable findings are not observed (Vasavada et al., 2007). These results suggest that Rb has essential regulatory roles in cell fate in the early progenitor or precursor cells but has a limited or redundant roles in mature cells. Together, our data show a new function of Rb in islet cell lineage commitment and fate choice, and reveal an emerging role of Rb in metabolic regulation.

VII. 7 The potential role of Rb in cell regeneration

Whether cells undergo apoptosis or proliferation in response to loss of Rb family members is a complex but critical issue to understand in different tissues. In the pancreas, defining the role of Rb proteins will translate into unique therapeutic strategies for diabetes through promoting postmitotic islet cells into cell cycle. Indeed, a recent report has demonstrated that another cell type, muscle cells, which is also typically non-proliferative and postmitotic can become regenerative by inactivating Rb and Arf (Pajcini et al., 2010).

In line with these observation, it has also been shown that expansion of stem cell population may indeed be restricted by the Rb pathway (Sage, 2012). Data shown in Chapter V of this thesis in mouse islets further support the notion that differentiated mammalian cells still

150

retain the capacity to re-enter cell cycle and this regenerative ability may be largely controlled by activities of Rb proteins.

VII. 8 The role of FAK in the regulation of β-cell mass

Genome-wide association studies (GWAS) have identified cyclin-dependent kinase

(CDK) 5 regulatory subunit associated protein -like 1 (CDKAL) 1 as one of the genes associated with the development of type 2 diabetes (Petrie et al., 2011). A recent report indicates that siRNA knock-down of CDK5 expression in rat INS β-cell line leads to enhanced apoptosis through decreased activation of FAK, resulting in attenuation of the

PI3K/Akt survival pathway (Daval et al., 2011). ERK is required for CDK5 expression

(Harada et al., 2001) and CDK5/ERK pathway is responsible for upregulation of anti- apoptotic protein Bcl-2 and Bcl-XL (Wang et al., 2006). Consistent with these observations,

FAK deletion in β-cells leads to increased susceptibility of apoptosis, suggesting

FAK/ERK/CDK5 signalling to be crucial for β-cell survival. Furthermore, decreased phosphorylated FAKSer732 expression was observed in pancreas sections of humans with type 2 diabetes (Daval et al., 2011), in line with the view that the activity of FAK is important for β-cell survival and may play a causal role in the development of type 2 diabetes. Our results presented here further support the notion that reduced FAK activity in β-cells can play a role in diabetes pathogenesis.

151

VII. 9 The role of FAK in β-cell function

During the process of glucose-stimulated insulin secretion, pancreatic β-cells have been observed undergo focal adhesion remodeling similar to the events that occur during cell migration (Rondas et al., 2011). Upon glucose stimulation, paxillin is phosphorylated by activated FAK and both of these activated focal proteins migrate to the plasma membrane at the newly formed filopodia in primary β-cells (Rondas et al., 2011).

Interestingly, phospho-paxillin has been shown to connect with F-actin at focal adhesions

(Nakamura et al., 2000). Together, actin dynamics is a complex process, which is critical for glucose-stimulated insulin secretion (Li et al., 1994; Nevins and Thurmond, 2003). Here we show that FAK can regulate focal protein dynamics, which in turn can control cortical

F-actin depolymerization in response to glucose. Additionally phosphorylation of paxillin has been also considered to be important in globular (G)-actin/F-actin transition (Tang et al., 2003). In this study, we found reduced phospho-paxillin levels in basal and glucose- stimulated conditions in RIPcre+fakfl/fl islets and decreased co-localization of phospho- paxillin with plasma membrane t-SNARE proteins SNAP-25 and syntaxin 1 in

RIPcre+fakfl/fl β-cells. These SNARE proteins are thought to be involved in regulating insulin granule fusion to the plasma membrane (Jewell et al., 2010) and are linked to actin cytoskeleton (Jewell et al., 2008). Thus, in response to glucose, FAK phosphorylates and activates paxillin, which localizes with t-SNAREs to regulate cortical F-actin depolymerization, in turn facilitating insulin granule trafficking and exocytosis.

152

Talin acts as the key component for integrin-actin linkage and focal adhesion assembly (Giannone et al., 2003). Talin can directly bind to integrin cytoplasmic tails and

FAK by its N-terminal head domain and actin filament by either N- or C-terminal rod domains (Le Clainche and Carlier, 2008). Down-regulation of talin expression by siRNA in HeLa cells slows the kinetics of cell spreading and prolongs the process time of β1 integrin maturation (Albiges-Rizo et al., 1995), which can up-regulate Bcl-2 expression

(Zhang et al., 1995) and has been identified as critical factor for maintaining β-cell survival and function (Riopel et al., 2011). These studies suggest that talin may play an important role not only in cytoskeleton remodelling but also in cell proliferation. Talin expression levels can be modulated by mechanical stimuli through nitric-oxide synthase activity

(Tidball et al., 1999), which has been shown to be induced by the integrin/FAK/Src/ERK pathway to regulate cell migration (Ajizian et al., 1999; Gupta and Vlahakis, 2009).

Accordingly, we observed reduced talin expression in the RIPcre+fakfl/fl islets, suggesting that FAK is essential in regulating talin expression, and β-cell function by affecting actin dynamics and β-cell viability.

VII. 10 Conclusion remarks

The studies presented in this thesis provide new perspectives to the role of cell cycle regulators in pancreatic islet cell biology. Previous studies have shown that deletion of Rb or p107 in differentiated β-cells does not cause cell cycle re-entry or any discernible effect;

153

however, our studies are the first to define the role of Rb and p107 in proliferating pancreatic progenitors. In the first study, we show that Rb is a critical determinant of pancreatic α- and β-cell fate through distinct mechanisms whereby Rb plays a dichotomous role in these two opposing endocrine cells. Rb loss in islet progenitors increased Ngn3- expressing precursors with enhanced β-cell differentiation and neogenesis. On the other hand, Arx repression in Rb-deficient α-cells decreased differentiation. Rb deficiency in both α- and β-cells led to an induction of E2f1 but divergent regulation of p53 levels which led to further postnatal α-cell loss but expansion of functional β-cells, resulting in improved glucose homeostasis and diabetes protection.

In the second study, we show for the first time that dichotomous activity of Rb proteins in α- and β-cells is required for the dual effect of GLP-1 on islet cells. Cell cycle re-entry of pancreatic β-cells is promoted by exendin-4 to increased cell cycle machinery by decreasing Rb activity. An opposite signal in α-cells is induced to cell cycle arrest, resulting from Rb decline in response to exendin-4. Rb homolog, p107, alone did not reveal any essential roles in islet cells, likely due to compensation by other Rb members; yet a concomitant loss of p107 and Rb attenuated the metabolically beneficial features resulting from Rb deficiency alone. The effect of combined deletion led to deleterious effects on both α- and β-cells perhaps due to E2f1 deregulation, resulting in increased cell apoptosis and eventual reduction in both α- and β-cell mass. These results reveal a unique and novel mechanism through which Rb regulation mediates GLP-1 actions. Along with the low Rb present in islets of humans with diabetes, our data together show the critical role of Rb in the regulation of α- and β-cell cycle, viability and differentiation. Thus better understanding

154

of the role of Rb family in islet cells may provide insight to novel treatment strategies to overcome β-cell deficiency and α-cell excess that occur in diabetes.

In addition to the direct intrinsic regulators of cell cycle, we also revealed the role of

FAK, a unique signalling molecule that converge signalling from extrinsic factors such as the ECM or growth factors to mediate survival and function in pancreatic β-cells. In the third study, we show for the first time that FAK is required for the maintenance of both pancreatic β-cell mass and function in vivo, such that in its absence, glucose homeostasis is perturbed. We show that deletion of FAK in β-cells results in impaired cell proliferation, survival and function. The reduced insulin exocytosis in the absence of FAK is likely due to defects in actin reorganization through impaired focal protein dynamics resulting in insufficient insulin granule trafficking. We demonstrate in vivo that FAK has a critical dual role in regulating both β-cell viability and cell function, and may also be a potential therapeutic target for diabetes.

Chapter VIII: References

155

156

1. Ajizian, S.J., English, B.K., and Meals, E.A. (1999). Specific inhibitors of p38 and extracellular signal-regulated kinase mitogen-activated protein kinase pathways block inducible nitric oxide synthase and tumor necrosis factor accumulation in murine macrophages stimulated with lipopolysaccharide and interferon-gamma. J Infect Dis 179, 939-944. 2. Albert, M.L., Jegathesan, M., and Darnell, R.B. (2001). Dendritic cell maturation is required for the cross-tolerization of CD8+ T cells. Nature immunology 2, 1010-1017. 3. Albiges-Rizo, C., Frachet, P., and Block, M.R. (1995). Down regulation of talin alters cell adhesion and the processing of the alpha 5 beta 1 integrin. J Cell Sci 108 ( Pt 10), 3317-3329. 4. Annicotte, J.S., Blanchet, E., Chavey, C., Iankova, I., Costes, S., Assou, S., Teyssier, J., Dalle, S., Sardet, C., and Fajas, L. (2009). The CDK4-pRB-E2F1 pathway controls insulin secretion. Nat Cell Biol 11, 1017-1023. 5. Apelqvist, A., Li, H., Sommer, L., Beatus, P., Anderson, D.J., Honjo, T., Hrabe de Angelis, M., Lendahl, U., and Edlund, H. (1999). Notch signalling controls pancreatic cell differentiation. Nature 400, 877-881. 6. Ashton-Rickardt, P.G. (2005). The granule pathway of programmed cell death. Critical reviews in immunology 25, 161-182. 7. Aslanian, A., Iaquinta, P.J., Verona, R., and Lees, J.A. (2004). Repression of the Arf tumor suppressor by E2F3 is required for normal cell cycle kinetics. Genes Dev 18, 1413-1422. 8. Assoian, R.K., and Schwartz, M.A. (2001). Coordinate signaling by integrins and receptor tyrosine kinases in the regulation of G1 phase cell-cycle progression. Curr Opin Genet Dev 11, 48-53. 9. Bach, J.F. (1994). Insulin-dependent diabetes mellitus as an autoimmune disease. Endocr Rev 15, 516-542. 10. Baetens, D., Malaisse-Lagae, F., Perrelet, A., and Orci, L. (1979). Endocrine pancreas: three-dimensional reconstruction shows two types of islets of langerhans. Science 206, 1323-1325. 11. Baeyens, L., Bonne, S., German, M.S., Ravassard, P., Heimberg, H., and Bouwens, L. (2006). Ngn3 expression during postnatal in vitro beta cell neogenesis induced by the JAK/STAT pathway. Cell Death Differ 13, 1892-1899. 12. Bagchi, S., Raychaudhuri, P., and Nevins, J.R. (1990). Adenovirus E1A proteins can dissociate heteromeric complexes involving the E2F transcription factor: a novel mechanism for E1A trans-activation. Cell 62, 659-669. 13. Bagchi, S., Weinmann, R., and Raychaudhuri, P. (1991). The retinoblastoma protein copurifies with E2F-I, an E1A-regulated inhibitor of the transcription factor E2F. Cell 65, 1063-1072. 14. Balciunaite, E., Spektor, A., Lents, N.H., Cam, H., Te Riele, H., Scime, A., Rudnicki, M.A., Young, R., and Dynlacht, B.D. (2005). Pocket protein complexes are recruited to distinct targets in quiescent and proliferating cells. Mol Cell Biol 25, 8166-8178. 15. Barg, S., Galvanovskis, J., Gopel, S.O., Rorsman, P., and Eliasson, L. (2000). Tight coupling between electrical activity and exocytosis in mouse glucagon- secreting alpha-cells. Diabetes 49, 1500-1510.

157

16. Barnett, A.H., Eff, C., Leslie, R.D., and Pyke, D.A. (1981). Diabetes in identical twins. A study of 200 pairs. Diabetologia 20, 87-93. 17. Basford, C.L., Prentice, K.J., Hardy, A.B., Sarangi, F., Micallef, S.J., Li, X., Guo, Q., Elefanty, A.G., Stanley, E.G., Keller, G., et al. (2012). The functional and molecular characterisation of human embryonic stem cell-derived insulin-positive cells compared with adult pancreatic beta cells. Diabetologia 55, 358-371. 18. Bisht, B., and Dey, C.S. (2008). Focal Adhesion Kinase contributes to insulin- induced actin reorganization into a mesh harboring Glucose transporter-4 in insulin resistant skeletal muscle cells. BMC Cell Biol 9, 48. 19. Bisht, B., Goel, H.L., and Dey, C.S. (2007). Focal adhesion kinase regulates insulin resistance in skeletal muscle. Diabetologia 50, 1058-1069. 20. Bisht, B., Srinivasan, K., and Dey, C.S. (2008). In vivo inhibition of focal adhesion kinase causes insulin resistance. J Physiol 586, 3825-3837. 21. Bonner-Weir, S. (2000a). Islet growth and development in the adult. J Mol Endocrinol 24, 297-302. 22. Bonner-Weir, S. (2000b). Life and death of the pancreatic beta cells. Trends in endocrinology and metabolism: TEM 11, 375-378. 23. Bonner-Weir, S. (2000c). Perspective: Postnatal pancreatic beta cell growth. Endocrinology 141, 1926-1929. 24. Bouwens, L., and Rooman, I. (2005). Regulation of pancreatic beta-cell mass. Physiol Rev 85, 1255-1270. 25. Bouwens, L., Wang, R.N., De Blay, E., Pipeleers, D.G., and Kloppel, G. (1994). Cytokeratins as markers of ductal cell differentiation and islet neogenesis in the neonatal rat pancreas. Diabetes 43, 1279-1283. 26. Braun, M., Wendt, A., Karanauskaite, J., Galvanovskis, J., Clark, A., MacDonald, P.E., and Rorsman, P. (2007). Corelease and differential exit via the fusion pore of GABA, serotonin, and ATP from LDCV in rat pancreatic beta cells. The Journal of general physiology 129, 221-231. 27. Brubaker, P.L., and Drucker, D.J. (2004). Minireview: Glucagon-like peptides regulate cell proliferation and apoptosis in the pancreas, gut, and central nervous system. Endocrinology 145, 2653-2659. 28. Brunicardi, F.C., Kleinman, R., Moldovan, S., Nguyen, T.H., Watt, P.C., Walsh, J., and Gingerich, R. (2001). Immunoneutralization of somatostatin, insulin, and glucagon causes alterations in islet cell secretion in the isolated perfused human pancreas. Pancreas 23, 302-308. 29. Butler, A.E., Janson, J., Bonner-Weir, S., Ritzel, R., Rizza, R.A., and Butler, P.C. (2003). Beta-cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes. Diabetes 52, 102-110. 30. Cai, E.P., Wu, X., Schroer, S.A., Elia, A.J., Nostro, M.C., Zacksenhaus, E., and Woo, M. (2013). Retinoblastoma tumor suppressor protein in pancreatic progenitors controls alpha- and beta-cell fate. Proc Natl Acad Sci U S A. 31. Calo, E., Quintero-Estades, J.A., Danielian, P.S., Nedelcu, S., Berman, S.D., and Lees, J.A. (2010). Rb regulates fate choice and lineage commitment in vivo. Nature 466, 1110-1114.

158

32. Cary, L.A., Han, D.C., Polte, T.R., Hanks, S.K., and Guan, J.L. (1998). Identification of p130Cas as a mediator of focal adhesion kinase-promoted cell migration. J Cell Biol 140, 211-221. 33. Casiglia, E., Zanette, G., Mazza, A., Donadon, V., Donada, C., Pizziol, A., Tikhonoff, V., Palatini, P., and Pessina, A.C. (2000). Cardiovascular mortality in non-insulin-dependent diabetes mellitus. A controlled study among 683 diabetics and 683 age- and sex-matched normal subjects. European journal of epidemiology 16, 677-684. 34. Cerf, M.E. (2013). Beta cell dynamics: beta cell replenishment, beta cell compensation and diabetes. Endocrine 44, 303-311. 35. Ceriello, A., and Colagiuri, S. (2008). International Diabetes Federation guideline for management of postmeal glucose: a review of recommendations. Diabet Med 25, 1151-1156. 36. Chapman, E.R. (2002). Synaptotagmin: a Ca(2+) sensor that triggers exocytosis? Nat Rev Mol Cell Biol 3, 498-508. 37. Chau, B.N., and Wang, J.Y. (2003). Coordinated regulation of life and death by RB. Nat Rev Cancer 3, 130-138. 38. Chellappan, S.P., Hiebert, S., Mudryj, M., Horowitz, J.M., and Nevins, J.R. (1991). The E2F transcription factor is a cellular target for the RB protein. Cell 65, 1053-1061. 39. Chen, D., Pacal, M., Wenzel, P., Knoepfler, P.S., Leone, G., and Bremner, R. (2009a). Division and apoptosis of E2f-deficient retinal progenitors. Nature 462, 925-929. 40. Chen, H.Z., Tsai, S.Y., and Leone, G. (2009b). Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer 9, 785-797. 41. Chervonsky, A.V., Wang, Y., Wong, F.S., Visintin, I., Flavell, R.A., Janeway, C.A., Jr., and Matis, L.A. (1997). The role of Fas in autoimmune diabetes. Cell 89, 17-24. 42. Chodniewicz, D., and Klemke, R.L. (2004). Regulation of integrin-mediated cellular responses through assembly of a CAS/Crk scaffold. Biochim Biophys Acta 1692, 63-76. 43. Choi, D., Cai, E.P., Schroer, S.A., Wang, L., and Woo, M. (2011a). Vhl is required for normal pancreatic beta cell function and the maintenance of beta cell mass with age in mice. Lab Invest 91, 527-538. 44. Choi, D., Radziszewska, A., Schroer, S.A., Liadis, N., Liu, Y., Zhang, Y., Lam, P.P., Sheu, L., Hao, Z., Gaisano, H.Y., et al. (2009). Deletion of Fas in the pancreatic beta-cells leads to enhanced insulin secretion. Am J Physiol Endocrinol Metab 297, E1304-1312. 45. Choi, D., Schroer, S.A., Lu, S.Y., Cai, E.P., Hao, Z., and Woo, M. (2011b). Redundant role of the cytochrome c-mediated intrinsic apoptotic pathway in pancreatic {beta}-cells. J Endocrinol 210, 285-292. 46. Choi, D., Schroer, S.A., Lu, S.Y., Wang, L., Wu, X., Liu, Y., Zhang, Y., Gaisano, H.Y., Wagner, K.U., Wu, H., et al. (2010). Erythropoietin protects against diabetes through direct effects on pancreatic beta cells. J Exp Med 207, 2831- 2842.

159

47. Chong, J.L., Tsai, S.Y., Sharma, N., Opavsky, R., Price, R., Wu, L., Fernandez, S.A., and Leone, G. (2009). E2f3a and E2f3b contribute to the control of cell proliferation and mouse development. Mol Cell Biol 29, 414-424. 48. Christensen, J., Cloos, P., Toftegaard, U., Klinkenberg, D., Bracken, A.P., Trinh, E., Heeran, M., Di Stefano, L., and Helin, K. (2005). Characterization of E2F8, a novel E2F-like cell-cycle regulated repressor of E2F-activated transcription. Nucleic Acids Res 33, 5458-5470. 49. Chung, C.H., Hao, E., Piran, R., Keinan, E., and Levine, F. (2010). Pancreatic beta-cell neogenesis by direct conversion from mature alpha-cells. Stem Cells 28, 1630-1638. 50. Ciavarra, G., and Zacksenhaus, E. (2010). Rescue of myogenic defects in Rb- deficient cells by inhibition of autophagy or by hypoxia-induced glycolytic shift. J Cell Biol 191, 291-301. 51. Classon, M., and Harlow, E. (2002). The retinoblastoma tumour suppressor in development and cancer. Nat Rev Cancer 2, 910-917. 52. Cnop, M., Welsh, N., Jonas, J.C., Jorns, A., Lenzen, S., and Eizirik, D.L. (2005). Mechanisms of pancreatic beta-cell death in type 1 and type 2 diabetes: many differences, few similarities. Diabetes 54 Suppl 2, S97-107. 53. Cobrinik, D. (2005). Pocket proteins and cell cycle control. Oncogene 24, 2796- 2809. 54. Collombat, P., Hecksher-Sorensen, J., Broccoli, V., Krull, J., Ponte, I., Mundiger, T., Smith, J., Gruss, P., Serup, P., and Mansouri, A. (2005). The simultaneous loss of Arx and Pax4 genes promotes a somatostatin-producing cell fate specification at the expense of the alpha- and beta-cell lineages in the mouse endocrine pancreas. Development 132, 2969-2980. 55. Collombat, P., Mansouri, A., Hecksher-Sorensen, J., Serup, P., Krull, J., Gradwohl, G., and Gruss, P. (2003). Opposing actions of Arx and Pax4 in endocrine pancreas development. Genes Dev 17, 2591-2603. 56. Collombat, P., Xu, X., Heimberg, H., and Mansouri, A. (2010). Pancreatic beta- cells: from generation to regeneration. Seminars in cell & developmental biology 21, 838-844. 57. Collombat, P., Xu, X., Ravassard, P., Sosa-Pineda, B., Dussaud, S., Billestrup, N., Madsen, O.D., Serup, P., Heimberg, H., and Mansouri, A. (2009). The ectopic expression of Pax4 in the mouse pancreas converts progenitor cells into alpha and subsequently beta cells. Cell 138, 449-462. 58. Cozar-Castellano, I., Takane, K.K., Bottino, R., Balamurugan, A.N., and Stewart, A.F. (2004). Induction of beta-cell proliferation and retinoblastoma protein phosphorylation in rat and human islets using adenovirus-mediated transfer of cyclin-dependent kinase-4 and cyclin D1. Diabetes 53, 149-159. 59. Dai, X.Q., Plummer, G., Casimir, M., Kang, Y., Hajmrle, C., Gaisano, H.Y., Manning Fox, J.E., and MacDonald, P.E. (2011). SUMOylation regulates insulin exocytosis downstream of secretory granule docking in rodents and humans. Diabetes 60, 838-847. 60. Dali-Youcef, N., Mataki, C., Coste, A., Messaddeq, N., Giroud, S., Blanc, S., Koehl, C., Champy, M.F., Chambon, P., Fajas, L., et al. (2007). Adipose tissue- specific inactivation of the retinoblastoma protein protects against diabesity

160

because of increased energy expenditure. Proc Natl Acad Sci U S A 104, 10703- 10708. 61. Daneman, D. (2006). Type 1 diabetes. Lancet 367, 847-858. 62. Dasgupta, P., Padmanabhan, J., and Chellappan, S. (2006). Rb function in the apoptosis and senescence of non-neuronal and neuronal cells: role in oncogenesis. Curr Mol Med 6, 719-729. 63. Daval, M., Gurlo, T., Costes, S., Huang, C.J., and Butler, P.C. (2011). Cyclin- dependent kinase 5 promotes pancreatic beta-cell survival via Fak-Akt signaling pathways. Diabetes 60, 1186-1197. 64. de Heer, J., Rasmussen, C., Coy, D.H., and Holst, J.J. (2008). Glucagon-like peptide-1, but not glucose-dependent insulinotropic peptide, inhibits glucagon secretion via somatostatin (receptor subtype 2) in the perfused rat pancreas. Diabetologia 51, 2263-2270. 65. De Marinis, Y.Z., Salehi, A., Ward, C.E., Zhang, Q., Abdulkader, F., Bengtsson, M., Braha, O., Braun, M., Ramracheya, R., Amisten, S., et al. (2010). GLP-1 inhibits and adrenaline stimulates glucagon release by differential modulation of N- and L-type Ca2+ channel-dependent exocytosis. Cell Metab 11, 543-553. 66. DeCaprio, J.A., Ludlow, J.W., Figge, J., Shew, J.Y., Huang, C.M., Lee, W.H., Marsilio, E., Paucha, E., and Livingston, D.M. (1988). SV40 large tumor antigen forms a specific complex with the product of the retinoblastoma susceptibility gene. Cell 54, 275-283. 67. DeGregori, J., Leone, G., Miron, A., Jakoi, L., and Nevins, J.R. (1997). Distinct roles for E2F proteins in cell growth control and apoptosis. Proc Natl Acad Sci U S A 94, 7245-7250. 68. Del Prato, S., and Marchetti, P. (2004). Beta- and alpha-cell dysfunction in type 2 diabetes. Horm Metab Res 36, 775-781. 69. Deng, S., Vatamaniuk, M., Huang, X., Doliba, N., Lian, M.M., Frank, A., Velidedeoglu, E., Desai, N.M., Koeberlein, B., Wolf, B., et al. (2004). Structural and functional abnormalities in the islets isolated from type 2 diabetic subjects. Diabetes 53, 624-632. 70. Diao, J., Asghar, Z., Chan, C.B., and Wheeler, M.B. (2005). Glucose-regulated glucagon secretion requires insulin receptor expression in pancreatic alpha-cells. J Biol Chem 280, 33487-33496. 71. Dick, F., and Dyson, N. (2006). Diverse regulatory functions of the E2F family of transcription factors. In Rb and tumorigenesis (Springer), pp. 59-72. 72. Dimitriadis, G.D., Pehling, G.B., and Gerich, J.E. (1985). Abnormal glucose modulation of islet A- and B-cell responses to arginine in non-insulin-dependent diabetes mellitus. Diabetes 34, 541-547. 73. Ding, Q., Grammer, J.R., Nelson, M.A., Guan, J.L., Stewart, J.E., Jr., and Gladson, C.L. (2005). p27Kip1 and cyclin D1 are necessary for focal adhesion kinase regulation of cell cycle progression in glioblastoma cells propagated in vitro and in vivo in the scid mouse brain. J Biol Chem 280, 6802-6815. 74. Ding, W.G., Renstrom, E., Rorsman, P., Buschard, K., and Gromada, J. (1997). Glucagon-like peptide I and glucose-dependent insulinotropic polypeptide stimulate Ca2+-induced secretion in rat alpha-cells by a protein kinase A- mediated mechanism. Diabetes 46, 792-800.

161

75. Dominguez-Bendala, J., Klein, D., Ribeiro, M., Ricordi, C., Inverardi, L., Pastori, R., and Edlund, H. (2005). TAT-mediated neurogenin 3 protein transduction stimulates pancreatic endocrine differentiation in vitro. Diabetes 54, 720-726. 76. Donath, M.Y., Gross, D.J., Cerasi, E., and Kaiser, N. (1999). Hyperglycemia- induced beta-cell apoptosis in pancreatic islets of Psammomys obesus during development of diabetes. Diabetes 48, 738-744. 77. Donath, M.Y., Storling, J., Maedler, K., and Mandrup-Poulsen, T. (2003). Inflammatory mediators and islet beta-cell failure: a link between type 1 and type 2 diabetes. J Mol Med (Berl) 81, 455-470. 78. Dor, Y., Brown, J., Martinez, O.I., and Melton, D.A. (2004). Adult pancreatic beta-cells are formed by self-duplication rather than stem-cell differentiation. Nature 429, 41-46. 79. Dror, V., Nguyen, V., Walia, P., Kalynyak, T.B., Hill, J.A., and Johnson, J.D. (2007). Notch signalling suppresses apoptosis in adult human and mouse pancreatic islet cells. Diabetologia 50, 2504-2515. 80. Dyson, N. (1998). The regulation of E2F by pRB-family proteins. Genes Dev 12, 2245-2262. 81. Easom, R.A. (2000). Beta-granule transport and exocytosis. Seminars in cell & developmental biology 11, 253-266. 82. Edlund, H. (2002). Pancreatic organogenesis--developmental mechanisms and implications for therapy. Nature reviews Genetics 3, 524-532. 83. Edwards, C.M., Todd, J.F., Mahmoudi, M., Wang, Z., Wang, R.M., Ghatei, M.A., and Bloom, S.R. (1999). Glucagon-like peptide 1 has a physiological role in the control of postprandial glucose in humans: studies with the antagonist exendin 9- 39. Diabetes 48, 86-93. 84. Ehses, J.A., Ellingsgaard, H., Boni-Schnetzler, M., and Donath, M.Y. (2009). Pancreatic islet inflammation in type 2 diabetes: from alpha and beta cell compensation to dysfunction. Arch Physiol Biochem 115, 240-247. 85. Eizirik, D.L., and Mandrup-Poulsen, T. (2001). A choice of death--the signal- transduction of immune-mediated beta-cell apoptosis. Diabetologia 44, 2115- 2133. 86. El Annabi, S., Gautier, N., and Baron, V. (2001). Focal adhesion kinase and Src mediate integrin regulation of insulin receptor phosphorylation. FEBS Lett 507, 247-252. 87. El Ouaamari, A., Kawamori, D., Dirice, E., Liew, C.W., Shadrach, J.L., Hu, J., Katsuta, H., Hollister-Lock, J., Qian, W.J., Wagers, A.J., et al. (2013). Liver- derived systemic factors drive beta cell hyperplasia in insulin-resistant states. Cell reports 3, 401-410. 88. Ellenbroek, J.H., Tons, H.A., Westerouen van Meeteren, M.J., de Graaf, N., Hanegraaf, M.A., Rabelink, T.J., Carlotti, F., and de Koning, E.J. (2013). Glucagon-like peptide-1 receptor agonist treatment reduces beta cell mass in normoglycaemic mice. Diabetologia 56, 1980-1986. 89. Engelgau, M.M., Narayan, K.M., and Herman, W.H. (2000). Screening for type 2 diabetes. Diabetes Care 23, 1563-1580.

162

90. Evans, J.L., Goldfine, I.D., Maddux, B.A., and Grodsky, G.M. (2003). Are oxidative stress-activated signaling pathways mediators of insulin resistance and beta-cell dysfunction? Diabetes 52, 1-8. 91. Faideau, B., Larger, E., Lepault, F., Carel, J.C., and Boitard, C. (2005). Role of beta-cells in type 1 diabetes pathogenesis. Diabetes 54 Suppl 2, S87-96. 92. Fajas, L., Annicotte, J.S., Miard, S., Sarruf, D., Watanabe, M., and Auwerx, J. (2004). Impaired pancreatic growth, beta cell mass, and beta cell function in E2F1 (-/- )mice. J Clin Invest 113, 1288-1295. 93. Finegood, D.T., Scaglia, L., and Bonner-Weir, S. (1995). Dynamics of beta-cell mass in the growing rat pancreas. Estimation with a simple mathematical model. Diabetes 44, 249-256. 94. Flemington, E.K., Speck, S.H., and Kaelin, W.G., Jr. (1993). E2F-1-mediated transactivation is inhibited by complex formation with the retinoblastoma susceptibility gene product. Proc Natl Acad Sci U S A 90, 6914-6918. 95. Frame, M.C., Patel, H., Serrels, B., Lietha, D., and Eck, M.J. (2010). The FERM domain: organizing the structure and function of FAK. Nat Rev Mol Cell Biol 11, 802-814. 96. Franklin, I., Gromada, J., Gjinovci, A., Theander, S., and Wollheim, C.B. (2005). Beta-cell secretory products activate alpha-cell ATP-dependent potassium channels to inhibit glucagon release. Diabetes 54, 1808-1815. 97. Franklin, I.K., and Wollheim, C.B. (2004). GABA in the endocrine pancreas: its putative role as an islet cell paracrine-signalling molecule. The Journal of general physiology 123, 185-190. 98. Freemark, M., Avril, I., Fleenor, D., Driscoll, P., Petro, A., Opara, E., Kendall, W., Oden, J., Bridges, S., Binart, N., et al. (2002). Targeted deletion of the PRL receptor: effects on islet development, insulin production, and glucose tolerance. Endocrinology 143, 1378-1385. 99. Freemark, M., Driscoll, P., Maaskant, R., Petryk, A., and Kelly, P.A. (1997). Ontogenesis of prolactin receptors in the human fetus in early gestation. Implications for tissue differentiation and development. J Clin Invest 99, 1107- 1117. 100. Gaubatz, S., Lees, J.A., Lindeman, G.J., and Livingston, D.M. (2001). E2F4 is exported from the nucleus in a CRM1-dependent manner. Mol Cell Biol 21, 1384-1392. 101. Gaubatz, S., Lindeman, G.J., Ishida, S., Jakoi, L., Nevins, J.R., Livingston, D.M., and Rempel, R.E. (2000). E2F4 and E2F5 play an essential role in pocket protein-mediated G1 control. Mol Cell 6, 729-735. 102. Gee, K.R., Zhou, Z.L., Qian, W.J., and Kennedy, R. (2002). Detection and imaging of zinc secretion from pancreatic beta-cells using a new fluorescent zinc indicator. Journal of the American Chemical Society 124, 776-778. 103. Gerich, J.E. (2000). Physiology of glucose homeostasis. Diabetes Obes Metab 2, 345-350. 104. Giannone, G., Jiang, G., Sutton, D.H., Critchley, D.R., and Sheetz, M.P. (2003). Talin1 is critical for force-dependent reinforcement of initial integrin- cytoskeleton bonds but not tyrosine kinase activation. J Cell Biol 163, 409-419.

163

105. Ginsberg, D. (2002). E2F1 pathways to apoptosis. FEBS Lett 529, 122- 125. 106. Golubovskaya, V.M., Finch, R., and Cance, W.G. (2005). Direct interaction of the N-terminal domain of focal adhesion kinase with the N-terminal transactivation domain of p53. J Biol Chem 280, 25008-25021. 107. Golubovskaya, V.M., Finch, R., Zheng, M., Kurenova, E.V., and Cance, W.G. (2008). The 7-amino-acid site in the proline-rich region of the N-terminal domain of p53 is involved in the interaction with FAK and is critical for p53 functioning. Biochem J 411, 151-160. 108. Gomi, H., Mizutani, S., Kasai, K., Itohara, S., and Izumi, T. (2005). Granuphilin molecularly docks insulin granules to the fusion machinery. J Cell Biol 171, 99-109. 109. Goodrich, D.W., Wang, N.P., Qian, Y.W., Lee, E.Y., and Lee, W.H. (1991). The retinoblastoma gene product regulates progression through the G1 phase of the cell cycle. Cell 67, 293-302. 110. Gopel, S., Zhang, Q., Eliasson, L., Ma, X.S., Galvanovskis, J., Kanno, T., Salehi, A., and Rorsman, P. (2004). Capacitance measurements of exocytosis in mouse pancreatic alpha-, beta- and delta-cells within intact islets of Langerhans. J Physiol 556, 711-726. 111. Grapin-Botton, A. (2005). Ductal cells of the pancreas. The international journal of biochemistry & cell biology 37, 504-510. 112. Grob, T.J., Novak, U., Maisse, C., Barcaroli, D., Luthi, A.U., Pirnia, F., Hugli, B., Graber, H.U., De Laurenzi, V., Fey, M.F., et al. (2001). Human delta Np73 regulates a dominant negative feedback loop for TAp73 and p53. Cell Death Differ 8, 1213-1223. 113. Gromada, J., Franklin, I., and Wollheim, C.B. (2007). Alpha-cells of the endocrine pancreas: 35 years of research but the enigma remains. Endocr Rev 28, 84-116. 114. Grouwels, G., Cai, Y., Hoebeke, I., Leuckx, G., Heremans, Y., Ziebold, U., Stange, G., Chintinne, M., Ling, Z., Pipeleers, D., et al. (2010). Ectopic expression of E2F1 stimulates beta-cell proliferation and function. Diabetes 59, 1435-1444. 115. Gu, G., Brown, J.R., and Melton, D.A. (2003). Direct lineage tracing reveals the ontogeny of pancreatic cell fates during mouse embryogenesis. Mech Dev 120, 35-43. 116. Gu, G., Dubauskaite, J., and Melton, D.A. (2002). Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors. Development 129, 2447-2457. 117. Guariguata, L., Linnenkamp, U., Beagley, J., Whiting, D.R., and Cho, N.H. (2013). Global estimates of the prevalence of hyperglycaemia in pregnancy for 2013 for the IDF Diabetes Atlas. Diabetes research and clinical practice. 118. Gupta, A., and Dey, C.S. (2009). PTEN and SHIP2 regulates PI3K/Akt pathway through focal adhesion kinase. Mol Cell Endocrinol 309, 55-62. 119. Gupta, S.K., and Vlahakis, N.E. (2009). Integrin alpha9beta1 mediates enhanced cell migration through nitric oxide synthase activity regulated by Src tyrosine kinase. J Cell Sci 122, 2043-2054.

164

120. Guz, Y., Montminy, M.R., Stein, R., Leonard, J., Gamer, L.W., Wright, C.V., and Teitelman, G. (1995). Expression of murine STF-1, a putative insulin gene transcription factor, in beta cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121, 11-18. 121. Gyulkhandanyan, A.V., Lu, H., Lee, S.C., Bhattacharjee, A., Wijesekara, N., Fox, J.E., MacDonald, P.E., Chimienti, F., Dai, F.F., and Wheeler, M.B. (2008). Investigation of transport mechanisms and regulation of intracellular Zn2+ in pancreatic alpha-cells. J Biol Chem 283, 10184-10197. 122. Hall, J.E., Fu, W., and Schaller, M.D. (2011). Focal adhesion kinase: exploring Fak structure to gain insight into function. International review of cell and molecular biology 288, 185-225. 123. Hammar, E., Parnaud, G., Bosco, D., Perriraz, N., Maedler, K., Donath, M., Rouiller, D.G., and Halban, P.A. (2004). Extracellular matrix protects pancreatic beta-cells against apoptosis: role of short- and long-term signaling pathways. Diabetes 53, 2034-2041. 124. Hanks, S.K., Ryzhova, L., Shin, N.Y., and Brabek, J. (2003). Focal adhesion kinase signaling activities and their implications in the control of cell survival and motility. Front Biosci 8, d982-996. 125. Hansen, J.B., Jorgensen, C., Petersen, R.K., Hallenborg, P., De Matteis, R., Boye, H.A., Petrovic, N., Enerback, S., Nedergaard, J., Cinti, S., et al. (2004). Retinoblastoma protein functions as a molecular switch determining white versus brown adipocyte differentiation. Proc Natl Acad Sci U S A 101, 4112-4117. 126. Harada, T., Morooka, T., Ogawa, S., and Nishida, E. (2001). ERK induces p35, a neuron-specific activator of Cdk5, through induction of Egr1. Nat Cell Biol 3, 453-459. 127. Harb, G., Vasavada, R.C., Cobrinik, D., and Stewart, A.F. (2009). The retinoblastoma protein and its homolog p130 regulate the G1/S transition in pancreatic beta-cells. Diabetes 58, 1852-1862. 128. Harbour, J.W., and Dean, D.C. (2000). Chromatin remodeling and Rb activity. Curr Opin Cell Biol 12, 685-689. 129. Harbour, J.W., Luo, R.X., Dei Santi, A., Postigo, A.A., and Dean, D.C. (1999). Cdk phosphorylation triggers sequential intramolecular interactions that progressively block Rb functions as cells move through G1. Cell 98, 859-869. 130. Heimberg, H., De Vos, A., Pipeleers, D., Thorens, B., and Schuit, F. (1995). Differences in glucose transporter gene expression between rat pancreatic alpha- and beta-cells are correlated to differences in glucose transport but not in glucose utilization. J Biol Chem 270, 8971-8975. 131. Hellerstrom, C., and Swenne, I. (1991). Functional maturation and proliferation of fetal pancreatic beta-cells. Diabetes 40 Suppl 2, 89-93. 132. Hemmati, P.G., Gillissen, B., von Haefen, C., Wendt, J., Starck, L., Guner, D., Dorken, B., and Daniel, P.T. (2002). Adenovirus-mediated overexpression of p14(ARF) induces p53 and Bax-independent apoptosis. Oncogene 21, 3149-3161. 133. Herrera, P.L. (2000). Adult insulin- and glucagon-producing cells differentiate from two independent cell lineages. Development 127, 2317-2322.

165

134. Hildebrand, J.D., Schaller, M.D., and Parsons, J.T. (1995). Paxillin, a tyrosine phosphorylated focal adhesion-associated protein binds to the carboxyl terminal domain of focal adhesion kinase. Mol Biol Cell 6, 637-647. 135. Hoglund, P., Mintern, J., Waltzinger, C., Heath, W., Benoist, C., and Mathis, D. (1999). Initiation of autoimmune diabetes by developmentally regulated presentation of islet cell antigens in the pancreatic lymph nodes. J Exp Med 189, 331-339. 136. Holst, J.J., Schwartz, T.W., Knuhtsen, S., Jensen, S.L., and Nielsen, O.V. (1986). Autonomic nervous control of the endocrine secretion from the isolated, perfused pig pancreas. Journal of the autonomic nervous system 17, 71-84. 137. Honda, R., and Yasuda, H. (1999). Association of p19(ARF) with Mdm2 inhibits ubiquitin ligase activity of Mdm2 for tumor suppressor p53. EMBO J 18, 22-27. 138. Horwitz, M.S., Bradley, L.M., Harbertson, J., Krahl, T., Lee, J., and Sarvetnick, N. (1998). Diabetes induced by Coxsackie virus: initiation by bystander damage and not molecular mimicry. Nature medicine 4, 781-785. 139. Horwitz, M.S., Ilic, A., Fine, C., Rodriguez, E., and Sarvetnick, N. (2002). Presented antigen from damaged pancreatic beta cells activates autoreactive T cells in virus-mediated autoimmune diabetes. J Clin Invest 109, 79-87. 140. Hosker, J.P., Rudenski, A.S., Burnett, M.A., Matthews, D.R., and Turner, R.C. (1989). Similar reduction of first- and second-phase B-cell responses at three different glucose levels in type II diabetes and the effect of gliclazide therapy. Metabolism 38, 767-772. 141. Huang, D., Khoe, M., Ilic, D., and Bryer-Ash, M. (2006). Reduced expression of focal adhesion kinase disrupts insulin action in skeletal muscle cells. Endocrinology 147, 3333-3343. 142. Huh, M.S., Parker, M.H., Scime, A., Parks, R., and Rudnicki, M.A. (2004). Rb is required for progression through myogenic differentiation but not maintenance of terminal differentiation. J Cell Biol 166, 865-876. 143. Hui, H., and Perfetti, R. (2002). Pancreas duodenum homeobox-1 regulates pancreas development during embryogenesis and islet cell function in adulthood. Eur J Endocrinol 146, 129-141. 144. Iaquinta, P.J., and Lees, J.A. (2007). Life and death decisions by the E2F transcription factors. Curr Opin Cell Biol 19, 649-657. 145. Iglesias, A., Murga, M., Laresgoiti, U., Skoudy, A., Bernales, I., Fullaondo, A., Moreno, B., Lloreta, J., Field, S.J., Real, F.X., et al. (2004). Diabetes and exocrine pancreatic insufficiency in E2F1/E2F2 double-mutant mice. J Clin Invest 113, 1398-1407. 146. Ilic, D., Furuta, Y., Kanazawa, S., Takeda, N., Sobue, K., Nakatsuji, N., Nomura, S., Fujimoto, J., Okada, M., and Yamamoto, T. (1995). Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK- deficient mice. Nature 377, 539-544. 147. Ilic, D., Kovacic, B., McDonagh, S., Jin, F., Baumbusch, C., Gardner, D.G., and Damsky, C.H. (2003). Focal adhesion kinase is required for blood vessel morphogenesis. Circ Res 92, 300-307.

166

148. Irwin, M., Marin, M.C., Phillips, A.C., Seelan, R.S., Smith, D.I., Liu, W., Flores, E.R., Tsai, K.Y., Jacks, T., Vousden, K.H., et al. (2000). Role for the p53 homologue p73 in E2F-1-induced apoptosis. Nature 407, 645-648. 149. Ishihara, H., Maechler, P., Gjinovci, A., Herrera, P.L., and Wollheim, C.B. (2003). Islet beta-cell secretion determines glucagon release from neighbouring alpha-cells. Nat Cell Biol 5, 330-335. 150. Itoh, N., Imagawa, A., Hanafusa, T., Waguri, M., Yamamoto, K., Iwahashi, H., Moriwaki, M., Nakajima, H., Miyagawa, J., Namba, M., et al. (1997). Requirement of Fas for the development of autoimmune diabetes in nonobese diabetic mice. J Exp Med 186, 613-618. 151. Jensen, J., Pedersen, E.E., Galante, P., Hald, J., Heller, R.S., Ishibashi, M., Kageyama, R., Guillemot, F., Serup, P., and Madsen, O.D. (2000). Control of endodermal endocrine development by Hes-1. Nat Genet 24, 36-44. 152. Jewell, J.L., Luo, W., Oh, E., Wang, Z., and Thurmond, D.C. (2008). Filamentous actin regulates insulin exocytosis through direct interaction with Syntaxin 4. J Biol Chem 283, 10716-10726. 153. Jewell, J.L., Oh, E., and Thurmond, D.C. (2010). Exocytosis mechanisms underlying insulin release and glucose uptake: conserved roles for Munc18c and syntaxin 4. Am J Physiol Regul Integr Comp Physiol 298, R517-531. 154. Jiang, Z., Zacksenhaus, E., Gallie, B.L., and Phillips, R.A. (1997). The retinoblastoma gene family is differentially expressed during embryogenesis. Oncogene 14, 1789-1797. 155. Johnson, D.G., Ohtani, K., and Nevins, J.R. (1994). Autoregulatory control of E2F1 expression in response to positive and negative regulators of cell cycle progression. Genes Dev 8, 1514-1525. 156. Jorgensen, M.C., Ahnfelt-Ronne, J., Hald, J., Madsen, O.D., Serup, P., and Hecksher-Sorensen, J. (2007). An illustrated review of early pancreas development in the mouse. Endocr Rev 28, 685-705. 157. Joseph, J.W., Koshkin, V., Saleh, M.C., Sivitz, W.I., Zhang, C.Y., Lowell, B.B., Chan, C.B., and Wheeler, M.B. (2004). Free fatty acid-induced beta-cell defects are dependent on uncoupling protein 2 expression. J Biol Chem 279, 51049-51056. 158. Kadare, G., Toutant, M., Formstecher, E., Corvol, J.C., Carnaud, M., Boutterin, M.C., and Girault, J.A. (2003). PIAS1-mediated sumoylation of focal adhesion kinase activates its autophosphorylation. J Biol Chem 278, 47434- 47440. 159. Kaghad, M., Bonnet, H., Yang, A., Creancier, L., Biscan, J.C., Valent, A., Minty, A., Chalon, P., Lelias, J.M., Dumont, X., et al. (1997). Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell 90, 809-819. 160. Kagi, D., Ho, A., Odermatt, B., Zakarian, A., Ohashi, P.S., and Mak, T.W. (1999). TNF receptor 1-dependent beta cell toxicity as an effector pathway in autoimmune diabetes. J Immunol 162, 4598-4605. 161. Kahn, S.E. (2003). The relative contributions of insulin resistance and beta-cell dysfunction to the pathophysiology of Type 2 diabetes. Diabetologia 46, 3-19.

167

162. Kanno, T., Gopel, S.O., Rorsman, P., and Wakui, M. (2002). Cellular function in multicellular system for hormone-secretion: electrophysiological aspect of studies on alpha-, beta- and delta-cells of the pancreatic islet. Neuroscience research 42, 79-90. 163. Kassem, S.A., Ariel, I., Thornton, P.S., Scheimberg, I., and Glaser, B. (2000). Beta-cell proliferation and apoptosis in the developing normal human pancreas and in hyperinsulinism of infancy. Diabetes 49, 1325-1333. 164. Kawai, K., Suzuki, S., Ohashi, S., Mukai, H., Ohmori, H., Murayama, Y., and Yamashita, K. (1989). Comparison of the effects of glucagon-like peptide-1- (1-37) and -(7-37) and glucagon on islet hormone release from isolated perfused canine and rat pancreases. Endocrinology 124, 1768-1773. 165. Kawamori, D., and Kulkarni, R.N. (2009). Insulin modulation of glucagon secretion: the role of insulin and other factors in the regulation of glucagon secretion. Islets 1, 276-279. 166. Kawamori, D., Kurpad, A.J., Hu, J., Liew, C.W., Shih, J.L., Ford, E.L., Herrera, P.L., Polonsky, K.S., McGuinness, O.P., and Kulkarni, R.N. (2009). Insulin signaling in alpha cells modulates glucagon secretion in vivo. Cell Metab 9, 350-361. 167. Kielgast, U., Holst, J.J., and Madsbad, S. (2011). Antidiabetic actions of endogenous and exogenous GLP-1 in type 1 diabetic patients with and without residual beta-cell function. Diabetes 60, 1599-1607. 168. Kim, M.J., Kang, J.H., Park, Y.G., Ryu, G.R., Ko, S.H., Jeong, I.K., Koh, K.H., Rhie, D.J., Yoon, S.H., Hahn, S.J., et al. (2006). Exendin-4 induction of cyclin D1 expression in INS-1 beta-cells: involvement of cAMP-responsive element. J Endocrinol 188, 623-633. 169. Kim, S.K., and Hebrok, M. (2001). Intercellular signals regulating pancreas development and function. Genes Dev 15, 111-127. 170. Kim, S.Y., and Rane, S.G. (2011). The Cdk4-E2f1 pathway regulates early pancreas development by targeting Pdx1+ progenitors and Ngn3+ endocrine precursors. Development 138, 1903-1912. 171. Kim, W.H., Lee, J.W., Suh, Y.H., Hong, S.H., Choi, J.S., Lim, J.H., Song, J.H., Gao, B., and Jung, M.H. (2005). Exposure to chronic high glucose induces beta-cell apoptosis through decreased interaction of glucokinase with mitochondria: downregulation of glucokinase in pancreatic beta-cells. Diabetes 54, 2602-2611. 172. Kitagawa, M., Higashi, H., Suzuki-Takahashi, I., Segawa, K., Hanks, S.K., Taya, Y., Nishimura, S., and Okuyama, A. (1995). Phosphorylation of E2F-1 by cyclin A-cdk2. Oncogene 10, 229-236. 173. Klein, E.A., Yin, L., Kothapalli, D., Castagnino, P., Byfield, F.J., Xu, T., Levental, I., Hawthorne, E., Janmey, P.A., and Assoian, R.K. (2009). Cell-cycle control by physiological matrix elasticity and in vivo tissue stiffening. Curr Biol 19, 1511-1518. 174. Knudsen, E.S., and Knudsen, K.E. (2008a). Tailoring to RB: tumour suppressor status and therapeutic response. Nat Rev Cancer. 175. Knudsen, E.S., and Knudsen, K.E. (2008b). Tailoring to RB: tumour suppressor status and therapeutic response. Nat Rev Cancer 8, 714-724.

168

176. Kolterman, O.G., Buse, J.B., Fineman, M.S., Gaines, E., Heintz, S., Bicsak, T.A., Taylor, K., Kim, D., Aisporna, M., Wang, Y., et al. (2003). Synthetic exendin-4 (exenatide) significantly reduces postprandial and fasting plasma glucose in subjects with type 2 diabetes. J Clin Endocrinol Metab 88, 3082-3089. 177. Kovesdi, I., Reichel, R., and Nevins, J.R. (1986). Identification of a cellular transcription factor involved in E1A trans-activation. Cell 45, 219-228. 178. Koyama, M., Wada, R., Sakuraba, H., Mizukami, H., and Yagihashi, S. (1998). Accelerated loss of islet beta cells in sucrose-fed Goto-Kakizaki rats, a genetic model of non-insulin-dependent diabetes mellitus. Am J Pathol 153, 537- 545. 179. Koziczak, M., Krek, W., and Nagamine, Y. (2000). Pocket protein- independent repression of urokinase-type plasminogen activator and plasminogen activator inhibitor 1 gene expression by E2F1. Mol Cell Biol 20, 2014-2022. 180. Kristiansen, L.H., Rungby, J., Sondergaard, L.G., Stoltenberg, M., and Danscher, G. (2001). Autometallography allows ultrastructural monitoring of zinc in the endocrine pancreas. Histochemistry and cell biology 115, 125-129. 181. Kulkarni, R.N. (2004). The islet beta-cell. Int J Biochem Cell Biol 36, 365-371. 182. Kulkarni, R.N., Bruning, J.C., Winnay, J.N., Postic, C., Magnuson, M.A., and Kahn, C.R. (1999). Tissue-specific knockout of the insulin receptor in pancreatic beta cells creates an insulin secretory defect similar to that in type 2 diabetes. Cell 96, 329-339. 183. Kulkarni, R.N., Holzenberger, M., Shih, D.Q., Ozcan, U., Stoffel, M., Magnuson, M.A., and Kahn, C.R. (2002). beta-cell-specific deletion of the Igf1 receptor leads to hyperinsulinemia and glucose intolerance but does not alter beta- cell mass. Nat Genet 31, 111-115. 184. Kurts, C., Kosaka, H., Carbone, F.R., Miller, J.F., and Heath, W.R. (1997). Class I-restricted cross-presentation of exogenous self-antigens leads to deletion of autoreactive CD8(+) T cells. J Exp Med 186, 239-245. 185. Kurts, C., Sutherland, R.M., Davey, G., Li, M., Lew, A.M., Blanas, E., Carbone, F.R., Miller, J.F., and Heath, W.R. (1999). CD8 T cell ignorance or tolerance to islet antigens depends on antigen dose. Proc Natl Acad Sci U S A 96, 12703-12707. 186. Kwan, E.P., and Gaisano, H.Y. (2005). Glucagon-like peptide 1 regulates sequential and compound exocytosis in pancreatic islet beta-cells. Diabetes 54, 2734-2743. 187. Le Clainche, C., and Carlier, M.F. (2008). Regulation of actin assembly associated with protrusion and adhesion in cell migration. Physiol Rev 88, 489- 513. 188. Le May, C., Chu, K., Hu, M., Ortega, C.S., Simpson, E.R., Korach, K.S., Tsai, M.J., and Mauvais-Jarvis, F. (2006). Estrogens protect pancreatic beta-cells from apoptosis and prevent insulin-deficient diabetes mellitus in mice. Proc Natl Acad Sci U S A 103, 9232-9237.

169

189. Lebrun, P., Mothe-Satney, I., Delahaye, L., Van Obberghen, E., and Baron, V. (1998). Insulin receptor substrate-1 as a signaling molecule for focal adhesion kinase pp125(FAK) and pp60(src). J Biol Chem 273, 32244-32253. 190. Lee, B.K., Bhinge, A.A., and Iyer, V.R. (2011). Wide-ranging functions of E2F4 in transcriptional activation and repression revealed by genome-wide analysis. Nucleic Acids Res 39, 3558-3573. 191. Lee, E.Y., Yuan, T.L., Danielian, P.S., West, J.C., and Lees, J.A. (2009). E2F4 cooperates with pRB in the development of extra-embryonic tissues. Dev Biol 332, 104-115. 192. Lee, W.H., Bookstein, R., Hong, F., Young, L.J., Shew, J.Y., and Lee, E.Y. (1987). Human retinoblastoma susceptibility gene: cloning, identification, and sequence. Science 235, 1394-1399. 193. Lefebvre, P.J. (1995). Glucagon and its family revisited. Diabetes Care 18, 715-730. 194. Lefebvre, P.J., and Luyckx, A.S. (1979). Glucagon and diabetes: a reappraisal. Diabetologia 16, 347-354. 195. Leibiger, B., Moede, T., Muhandiramlage, T.P., Kaiser, D., Vaca Sanchez, P., Leibiger, I.B., and Berggren, P.O. (2012). Glucagon regulates its own synthesis by autocrine signaling. Proc Natl Acad Sci U S A 109, 20925-20930. 196. Leonardi, O., Mints, G., and Hussain, M.A. (2003). Beta-cell apoptosis in the pathogenesis of human type 2 diabetes mellitus. Eur J Endocrinol 149, 99-102. 197. Leone, G., Nuckolls, F., Ishida, S., Adams, M., Sears, R., Jakoi, L., Miron, A., and Nevins, J.R. (2000). Identification of a novel E2F3 product suggests a mechanism for determining specificity of repression by Rb proteins. Mol Cell Biol 20, 3626-3632. 198. Leung, Y.M., Ahmed, I., Sheu, L., Gao, X., Hara, M., Tsushima, R.G., Diamant, N.E., and Gaisano, H.Y. (2006). Insulin regulates islet alpha-cell function by reducing KATP channel sensitivity to adenosine 5'-triphosphate inhibition. Endocrinology 147, 2155-2162. 199. Li, G., Rungger-Brandle, E., Just, I., Jonas, J.C., Aktories, K., and Wollheim, C.B. (1994). Effect of disruption of actin filaments by Clostridium botulinum C2 toxin on insulin secretion in HIT-T15 cells and pancreatic islets. Mol Biol Cell 5, 1199-1213. 200. Li, Z., Karlsson, F.A., and Sandler, S. (2000). Islet loss and alpha cell expansion in type 1 diabetes induced by multiple low-dose streptozotocin administration in mice. J Endocrinol 165, 93-99. 201. Liadis, N., Murakami, K., Eweida, M., Elford, A.R., Sheu, L., Gaisano, H.Y., Hakem, R., Ohashi, P.S., and Woo, M. (2005). Caspase-3-dependent beta- cell apoptosis in the initiation of autoimmune diabetes mellitus. Mol Cell Biol 25, 3620-3629. 202. Lietha, D., Cai, X., Ceccarelli, D.F., Li, Y., Schaller, M.D., and Eck, M.J. (2007). Structural basis for the autoinhibition of focal adhesion kinase. Cell 129, 1177-1187. 203. Lim, S.T., Chen, X.L., Lim, Y., Hanson, D.A., Vo, T.T., Howerton, K., Larocque, N., Fisher, S.J., Schlaepfer, D.D., and Ilic, D. (2008a). Nuclear FAK

170

promotes cell proliferation and survival through FERM-enhanced p53 degradation. Mol Cell 29, 9-22. 204. Lim, S.T., Mikolon, D., Stupack, D.G., and Schlaepfer, D.D. (2008b). FERM control of FAK function: implications for cancer therapy. Cell Cycle 7, 2306-2314. 205. Lim, Y., Han, I., Jeon, J., Park, H., Bahk, Y.Y., and Oh, E.S. (2004). Phosphorylation of focal adhesion kinase at tyrosine 861 is crucial for Ras transformation of fibroblasts. J Biol Chem 279, 29060-29065. 206. Lin, C.L., and Vuguin, P.M. (2012). Determinants of pancreatic islet development in mice and men: a focus on the role of transcription factors. Horm Res Paediatr 77, 205-213. 207. Ling, Z., Wu, D., Zambre, Y., Flamez, D., Drucker, D.J., Pipeleers, D.G., and Schuit, F.C. (2001). Glucagon-like peptide 1 receptor signaling influences topography of islet cells in mice. Virchows Archiv : an international journal of pathology 438, 382-387. 208. Lipinski, M.M., and Jacks, T. (1999). The retinoblastoma gene family in differentiation and development. Oncogene 18, 7873-7882. 209. Lukas, J., Petersen, B.O., Holm, K., Bartek, J., and Helin, K. (1996). Deregulated expression of E2F family members induces S-phase entry and overcomes p16INK4A-mediated growth suppression. Mol Cell Biol 16, 1047- 1057. 210. Lupi, R., Dotta, F., Marselli, L., Del Guerra, S., Masini, M., Santangelo, C., Patane, G., Boggi, U., Piro, S., Anello, M., et al. (2002). Prolonged exposure to free fatty acids has cytostatic and pro-apoptotic effects on human pancreatic islets: evidence that beta-cell death is caspase mediated, partially dependent on ceramide pathway, and Bcl-2 regulated. Diabetes 51, 1437-1442. 211. Ma, X., Zhang, Y., Gromada, J., Sewing, S., Berggren, P.O., Buschard, K., Salehi, A., Vikman, J., Rorsman, P., and Eliasson, L. (2005). Glucagon stimulates exocytosis in mouse and rat pancreatic alpha-cells by binding to glucagon receptors. Mol Endocrinol 19, 198-212. 212. Macdonald, R.L., and Olsen, R.W. (1994). GABAA receptor channels. Annual review of neuroscience 17, 569-602. 213. Maedler, K., Sergeev, P., Ris, F., Oberholzer, J., Joller-Jemelka, H.I., Spinas, G.A., Kaiser, N., Halban, P.A., and Donath, M.Y. (2002). Glucose- induced beta cell production of IL-1beta contributes to glucotoxicity in human pancreatic islets. J Clin Invest 110, 851-860. 214. Maedler, K., Spinas, G.A., Lehmann, R., Sergeev, P., Weber, M., Fontana, A., Kaiser, N., and Donath, M.Y. (2001). Glucose induces beta-cell apoptosis via upregulation of the Fas receptor in human islets. Diabetes 50, 1683-1690. 215. Maier, L.M., and Wicker, L.S. (2005). Genetic susceptibility to type 1 diabetes. Current opinion in immunology 17, 601-608. 216. Mann, D.J., and Jones, N.C. (1996). E2F-1 but not E2F-4 can overcome p16-induced G1 cell-cycle arrest. Curr Biol 6, 474-483. 217. Maruyama, H., Hisatomi, A., Orci, L., Grodsky, G.M., and Unger, R.H. (1984). Insulin within islets is a physiologic glucagon release inhibitor. J Clin Invest 74, 2296-2299.

171

218. Masson, D., and Tschopp, J. (1985). Isolation of a lytic, pore-forming protein (perforin) from cytolytic T-lymphocytes. J Biol Chem 260, 9069-9072. 219. Mathis, D., Vence, L., and Benoist, C. (2001). beta-Cell death during progression to diabetes. Nature 414, 792-798. 220. McClellan, K.A., and Slack, R.S. (2007). Specific in vivo roles for E2Fs in differentiation and development. Cell Cycle 6, 2917-2927. 221. McKean, D.M., Sisbarro, L., Ilic, D., Kaplan-Alburquerque, N., Nemenoff, R., Weiser-Evans, M., Kern, M.J., and Jones, P.L. (2003). FAK induces expression of Prx1 to promote tenascin-C-dependent fibroblast migration. J Cell Biol 161, 393-402. 222. McLean, G.W., Carragher, N.O., Avizienyte, E., Evans, J., Brunton, V.G., and Frame, M.C. (2005). The role of focal-adhesion kinase in cancer - a new therapeutic opportunity. Nat Rev Cancer 5, 505-515. 223. Melino, G., Bernassola, F., Ranalli, M., Yee, K., Zong, W.X., Corazzari, M., Knight, R.A., Green, D.R., Thompson, C., and Vousden, K.H. (2004). p73 Induces apoptosis via PUMA transactivation and Bax mitochondrial translocation. J Biol Chem 279, 8076-8083. 224. Mielenz, D., Hapke, S., Poschl, E., von Der Mark, H., and von Der Mark, K. (2001). The integrin alpha 7 cytoplasmic domain regulates cell migration, lamellipodia formation, and p130CAS/Crk coupling. J Biol Chem 276, 13417- 13426. 225. Mitra, S.K., Hanson, D.A., and Schlaepfer, D.D. (2005). Focal adhesion kinase: in command and control of cell motility. Nat Rev Mol Cell Biol 6, 56-68. 226. Moberg, K., Starz, M.A., and Lees, J.A. (1996). E2F-4 switches from p130 to p107 and pRB in response to cell cycle reentry. Mol Cell Biol 16, 1436- 1449. 227. Montanya, E., Nacher, V., Biarnes, M., and Soler, J. (2000). Linear correlation between beta-cell mass and body weight throughout the lifespan in Lewis rats: role of beta-cell hyperplasia and hypertrophy. Diabetes 49, 1341-1346. 228. Morgenbesser, S.D., Williams, B.O., Jacks, T., and DePinho, R.A. (1994). p53-dependent apoptosis produced by Rb-deficiency in the developing mouse lens. Nature 371, 72-74. 229. Moroni, M.C., Hickman, E.S., Lazzerini Denchi, E., Caprara, G., Colli, E., Cecconi, F., Muller, H., and Helin, K. (2001). Apaf-1 is a transcriptional target for E2F and p53. Nat Cell Biol 3, 552-558. 230. Mueller, C., Held, W., Imboden, M.A., and Carnaud, C. (1995). Accelerated beta-cell destruction in adoptively transferred autoimmune diabetes correlates with an increased expression of the genes coding for TNF-alpha and granzyme A in the intra-islet infiltrates. Diabetes 44, 112-117. 231. Muller, H., Moroni, M.C., Vigo, E., Petersen, B.O., Bartek, J., and Helin, K. (1997). Induction of S-phase entry by E2F transcription factors depends on their nuclear localization. Mol Cell Biol 17, 5508-5520. 232. Nadal, A., Quesada, I., and Soria, B. (1999). Homologous and heterologous asynchronicity between identified alpha-, beta- and delta-cells within intact islets of Langerhans in the mouse. J Physiol 517 ( Pt 1), 85-93.

172

233. Nahle, Z., Polakoff, J., Davuluri, R.V., McCurrach, M.E., Jacobson, M.D., Narita, M., Zhang, M.Q., Lazebnik, Y., Bar-Sagi, D., and Lowe, S.W. (2002). Direct coupling of the cell cycle and cell death machinery by E2F. Nat Cell Biol 4, 859-864. 234. Nakamura, K., Yano, H., Uchida, H., Hashimoto, S., Schaefer, E., and Sabe, H. (2000). Tyrosine phosphorylation of paxillin alpha is involved in temporospatial regulation of paxillin-containing focal adhesion formation and F- actin organization in motile cells. J Biol Chem 275, 27155-27164. 235. Nakayama, M., Nagata, M., Yasuda, H., Arisawa, K., Kotani, R., Yamada, K., Chowdhury, S.A., Chakrabarty, S., Jin, Z.Z., Yagita, H., et al. (2002). Fas/Fas ligand interactions play an essential role in the initiation of murine autoimmune diabetes. Diabetes 51, 1391-1397. 236. Nevins, A.K., and Thurmond, D.C. (2003). Glucose regulates the cortical actin network through modulation of Cdc42 cycling to stimulate insulin secretion. Am J Physiol Cell Physiol 285, C698-710. 237. Nguyen, N.T., Nguyen, X.M., Lane, J., and Wang, P. (2011). Relationship between obesity and diabetes in a US adult population: findings from the National Health and Nutrition Examination Survey, 1999-2006. Obes Surg 21, 351-355. 238. Nichols, J., and Cooke, A. (2009). Overcoming self-destruction in the pancreas. Curr Opin Biotechnol. 239. Nir, T., and Dor, Y. (2005). How to make pancreatic beta cells--prospects for cell therapy in diabetes. Curr Opin Biotechnol 16, 524-529. 240. Notkins, A.L., and Lernmark, A. (2001). Autoimmune type 1 diabetes: resolved and unresolved issues. J Clin Invest 108, 1247-1252. 241. Onkamo, P., Vaananen, S., Karvonen, M., and Tuomilehto, J. (1999). Worldwide increase in incidence of Type I diabetes--the analysis of the data on published incidence trends. Diabetologia 42, 1395-1403. 242. Orci, L., Gabbay, K.H., and Malaisse, W.J. (1972). Pancreatic beta-cell web: its possible role in insulin secretion. Science 175, 1128-1130. 243. Otani, K., Kulkarni, R.N., Baldwin, A.C., Krutzfeldt, J., Ueki, K., Stoffel, M., Kahn, C.R., and Polonsky, K.S. (2004). Reduced beta-cell mass and altered glucose sensing impair insulin-secretory function in betaIRKO mice. Am J Physiol Endocrinol Metab 286, E41-49. 244. Pajcini, K.V., Corbel, S.Y., Sage, J., Pomerantz, J.H., and Blau, H.M. (2010). Transient inactivation of Rb and ARF yields regenerative cells from postmitotic mammalian muscle. Cell Stem Cell 7, 198-213. 245. Percival, A.C., and Slack, J.M. (1999). Analysis of pancreatic development using a cell lineage label. Exp Cell Res 247, 123-132. 246. Peters, J., Jurgensen, A., and Kloppel, G. (2000). Ontogeny, differentiation and growth of the endocrine pancreas. Virchows Archiv : an international journal of pathology 436, 527-538. 247. Peters, P.J., Borst, J., Oorschot, V., Fukuda, M., Krahenbuhl, O., Tschopp, J., Slot, J.W., and Geuze, H.J. (1991). Cytotoxic T lymphocyte granules are secretory lysosomes, containing both perforin and granzymes. J Exp Med 173, 1099-1109.

173

248. Petit, V., Boyer, B., Lentz, D., Turner, C.E., Thiery, J.P., and Valles, A.M. (2000). Phosphorylation of tyrosine residues 31 and 118 on paxillin regulates cell migration through an association with CRK in NBT-II cells. J Cell Biol 148, 957- 970. 249. Petrie, J.R., Pearson, E.R., and Sutherland, C. (2011). Implications of genome wide association studies for the understanding of type 2 diabetes pathophysiology. Biochem Pharmacol 81, 471-477. 250. Pictet, R.L., Clark, W.R., Williams, R.H., and Rutter, W.J. (1972). An ultrastructural analysis of the developing embryonic pancreas. Dev Biol 29, 436- 467. 251. Pigeau, G.M., Kolic, J., Ball, B.J., Hoppa, M.B., Wang, Y.W., Ruckle, T., Woo, M., Manning Fox, J.E., and MacDonald, P.E. (2009). Insulin granule recruitment and exocytosis is dependent on p110gamma in insulinoma and human beta-cells. Diabetes 58, 2084-2092. 252. Polager, S., and Ginsberg, D. (2008). E2F - at the crossroads of life and death. Trends Cell Biol 18, 528-535. 253. Polager, S., and Ginsberg, D. (2009). p53 and E2f: partners in life and death. Nat Rev Cancer 9, 738-748. 254. Postic, C., Shiota, M., Niswender, K.D., Jetton, T.L., Chen, Y., Moates, J.M., Shelton, K.D., Lindner, J., Cherrington, A.D., and Magnuson, M.A. (1999). Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase. J Biol Chem 274, 305-315. 255. Poznic, M. (2009). Retinoblastoma protein: a central processing unit. J Biosci 34, 305-312. 256. Prentki, M., and Nolan, C.J. (2006). Islet beta cell failure in type 2 diabetes. J Clin Invest 116, 1802-1812. 257. Qin, X.Q., Livingston, D.M., Kaelin, W.G., Jr., and Adams, P.D. (1994). Deregulated transcription factor E2F-1 expression leads to S-phase entry and p53- mediated apoptosis. Proc Natl Acad Sci U S A 91, 10918-10922. 258. Quan, L.T., Tewari, M., O'Rourke, K., Dixit, V., Snipas, S.J., Poirier, G.G., Ray, C., Pickup, D.J., and Salvesen, G.S. (1996). Proteolytic activation of the cell death protease Yama/CPP32 by granzyme B. Proc Natl Acad Sci U S A 93, 1972-1976. 259. Quesada, I., Tuduri, E., Ripoll, C., and Nadal, A. (2008). Physiology of the pancreatic alpha-cell and glucagon secretion: role in glucose homeostasis and diabetes. J Endocrinol 199, 5-19. 260. Rahier, J., Goebbels, R.M., and Henquin, J.C. (1983). Cellular composition of the human diabetic pancreas. Diabetologia 24, 366-371. 261. Ramadan, S., Terrinoni, A., Catani, M.V., Sayan, A.E., Knight, R.A., Mueller, M., Krammer, P.H., Melino, G., and Candi, E. (2005). p73 induces apoptosis by different mechanisms. Biochem Biophys Res Commun 331, 713- 717. 262. Raskin, P., Fujita, Y., and Unger, R.H. (1975). Effect of insulin-glucose infusions on plasma glucagon levels in fasting diabetics and nondiabetics. J Clin Invest 56, 1132-1138.

174

263. Ravier, M.A., and Rutter, G.A. (2005). Glucose or insulin, but not zinc ions, inhibit glucagon secretion from mouse pancreatic alpha-cells. Diabetes 54, 1789-1797. 264. Ravier, M.A., and Rutter, G.A. (2010). Isolation and culture of mouse pancreatic islets for ex vivo imaging studies with trappable or recombinant fluorescent probes. In Mouse Cell Culture (Springer), pp. 171-184. 265. Rhodes, C.J. (2005). Type 2 diabetes-a matter of beta-cell life and death? Science 307, 380-384. 266. Riopel, M., Krishnamurthy, M., Li, J., Liu, S., Leask, A., and Wang, R. (2011). Conditional beta1-integrin-deficient mice display impaired pancreatic beta cell function. J Pathol 224, 45-55. 267. Rogoff, H.A., Pickering, M.T., Frame, F.M., Debatis, M.E., Sanchez, Y., Jones, S., and Kowalik, T.F. (2004). Apoptosis associated with deregulated E2F activity is dependent on E2F1 and Atm/Nbs1/Chk2. Mol Cell Biol 24, 2968-2977. 268. Rolin, B., Larsen, M.O., Gotfredsen, C.F., Deacon, C.F., Carr, R.D., Wilken, M., and Knudsen, L.B. (2002). The long-acting GLP-1 derivative NN2211 ameliorates glycemia and increases beta-cell mass in diabetic mice. Am J Physiol Endocrinol Metab 283, E745-752. 269. Rondas, D., Tomas, A., and Halban, P.A. (2011). Focal adhesion remodeling is crucial for glucose-stimulated insulin secretion and involves activation of focal adhesion kinase and paxillin. Diabetes 60, 1146-1157. 270. Rorsman, P., and Renstrom, E. (2003). Insulin granule dynamics in pancreatic beta cells. Diabetologia 46, 1029-1045. 271. Rorsman, P., Salehi, S.A., Abdulkader, F., Braun, M., and MacDonald, P.E. (2008). K(ATP)-channels and glucose-regulated glucagon secretion. Trends in endocrinology and metabolism: TEM 19, 277-284. 272. Sage, J. (2012). The retinoblastoma tumor suppressor and stem cell biology. Genes Dev 26, 1409-1420. 273. Salam, M.A., Matin, K., Matsumoto, N., Tsuha, Y., Hanada, N., and Senpuku, H. (2004). E2f1 mutation induces early onset of diabetes and Sjogren's syndrome in nonobese diabetic mice. J Immunol 173, 4908-4918. 274. Saltiel, A.R., and Kahn, C.R. (2001). Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414, 799-806. 275. Samuels-Lev, Y., O'Connor, D.J., Bergamaschi, D., Trigiante, G., Hsieh, J.K., Zhong, S., Campargue, I., Naumovski, L., Crook, T., and Lu, X. (2001). ASPP proteins specifically stimulate the apoptotic function of p53. Mol Cell 8, 781-794. 276. Schaller, M.D., Borgman, C.A., Cobb, B.S., Vines, R.R., Reynolds, A.B., and Parsons, J.T. (1992). pp125FAK a structurally distinctive protein-tyrosine kinase associated with focal adhesions. Proc Natl Acad Sci U S A 89, 5192-5196. 277. Schaller, M.D., Otey, C.A., Hildebrand, J.D., and Parsons, J.T. (1995). Focal adhesion kinase and paxillin bind to peptides mimicking beta integrin cytoplasmic domains. J Cell Biol 130, 1181-1187. 278. Schlaepfer, D.D., Mitra, S.K., and Ilic, D. (2004). Control of motile and invasive cell phenotypes by focal adhesion kinase. Biochim Biophys Acta 1692, 77-102.

175

279. Schuit, F., De Vos, A., Farfari, S., Moens, K., Pipeleers, D., Brun, T., and Prentki, M. (1997). Metabolic fate of glucose in purified islet cells. Glucose- regulated anaplerosis in beta cells. J Biol Chem 272, 18572-18579. 280. Scime, A., Grenier, G., Huh, M.S., Gillespie, M.A., Bevilacqua, L., Harper, M.E., and Rudnicki, M.A. (2005). Rb and p107 regulate preadipocyte differentiation into white versus brown fat through repression of PGC-1alpha. Cell Metab 2, 283-295. 281. Scrocchi, L.A., Hill, M.E., Saleh, J., Perkins, B., and Drucker, D.J. (2000). Elimination of glucagon-like peptide 1R signaling does not modify weight gain and islet adaptation in mice with combined disruption of leptin and GLP-1 action. Diabetes 49, 1552-1560. 282. Sekine, N., Cirulli, V., Regazzi, R., Brown, L.J., Gine, E., Tamarit- Rodriguez, J., Girotti, M., Marie, S., MacDonald, M.J., Wollheim, C.B., et al. (1994). Low lactate dehydrogenase and high mitochondrial glycerol phosphate dehydrogenase in pancreatic beta-cells. Potential role in nutrient sensing. J Biol Chem 269, 4895-4902. 283. Shapiro, A.M., Lakey, J.R., Ryan, E.A., Korbutt, G.S., Toth, E., Warnock, G.L., Kneteman, N.M., and Rajotte, R.V. (2000). Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N Engl J Med 343, 230-238. 284. Shimabukuro, M., Ohneda, M., Lee, Y., and Unger, R.H. (1997). Role of nitric oxide in obesity-induced beta cell disease. J Clin Invest 100, 290-295. 285. Shimabukuro, M., Wang, M.Y., Zhou, Y.T., Newgard, C.B., and Unger, R.H. (1998). Protection against lipoapoptosis of beta cells through leptin- dependent maintenance of Bcl-2 expression. Proc Natl Acad Sci U S A 95, 9558- 9561. 286. Sieg, D.J., Hauck, C.R., Ilic, D., Klingbeil, C.K., Schaefer, E., Damsky, C.H., and Schlaepfer, D.D. (2000). FAK integrates growth-factor and integrin signals to promote cell migration. Nat Cell Biol 2, 249-256. 287. Slack, J.M. (1995). Developmental biology of the pancreas. Development 121, 1569-1580. 288. Slansky, J.E., Li, Y., Kaelin, W.G., and Farnham, P.J. (1993). A protein synthesis-dependent increase in E2F1 mRNA correlates with growth regulation of the dihydrofolate reductase promoter. Mol Cell Biol 13, 1610-1618. 289. Sloan, F.A., Bethel, M.A., Ruiz, D., Jr., Shea, A.M., and Feinglos, M.N. (2008). The growing burden of diabetes mellitus in the US elderly population. Arch Intern Med 168, 192-199; discussion 199. 290. Smith, S.B., Gasa, R., Watada, H., Wang, J., Griffen, S.C., and German, M.S. (2003). Neurogenin3 and hepatic nuclear factor 1 cooperate in activating pancreatic expression of Pax4. J Biol Chem 278, 38254-38259. 291. Song, W.J., Schreiber, W.E., Zhong, E., Liu, F.F., Kornfeld, B.D., Wondisford, F.E., and Hussain, M.A. (2008). Exendin-4 stimulation of cyclin A2 in beta-cell proliferation. Diabetes 57, 2371-2381. 292. Sosa-Pineda, B., Chowdhury, K., Torres, M., Oliver, G., and Gruss, P. (1997). The Pax4 gene is essential for differentiation of insulin-producing beta cells in the mammalian pancreas. Nature 386, 399-402.

176

293. Spranger, J., Kroke, A., Mohlig, M., Hoffmann, K., Bergmann, M.M., Ristow, M., Boeing, H., and Pfeiffer, A.F. (2003). Inflammatory cytokines and the risk to develop type 2 diabetes: results of the prospective population-based European Prospective Investigation into Cancer and Nutrition (EPIC)-Potsdam Study. Diabetes 52, 812-817. 294. Stassi, G., De Maria, R., Trucco, G., Rudert, W., Testi, R., Galluzzo, A., Giordano, C., and Trucco, M. (1997). Nitric oxide primes pancreatic beta cells for Fas-mediated destruction in insulin-dependent diabetes mellitus. J Exp Med 186, 1193-1200. 295. Steele, L., Sukhanova, M.J., Xu, J., Gordon, G.M., Huang, Y., Yu, L., and Du, W. (2009). Retinoblastoma family protein promotes normal R8-photoreceptor differentiation in the absence of rhinoceros by inhibiting dE2F1 activity. Dev Biol 335, 228-236. 296. Stoffers, D.A., Kieffer, T.J., Hussain, M.A., Drucker, D.J., Bonner-Weir, S., Habener, J.F., and Egan, J.M. (2000). Insulinotropic glucagon-like peptide 1 agonists stimulate expression of homeodomain protein IDX-1 and increase islet size in mouse pancreas. Diabetes 49, 741-748. 297. Stumvoll, M., Goldstein, B.J., and van Haeften, T.W. (2005). Type 2 diabetes: principles of pathogenesis and therapy. Lancet 365, 1333-1346. 298. Swiss, V.A., and Casaccia, P. (2010). Cell-context specific role of the E2F/Rb pathway in development and disease. Glia 58, 377-390. 299. Taborsky, G.J., Jr., Ahren, B., and Havel, P.J. (1998). Autonomic mediation of glucagon secretion during hypoglycemia: implications for impaired alpha-cell responses in type 1 diabetes. Diabetes 47, 995-1005. 300. Takahashi, Y., Rayman, J.B., and Dynlacht, B.D. (2000). Analysis of promoter binding by the E2F and pRB families in vivo: distinct E2F proteins mediate activation and repression. Genes Dev 14, 804-816. 301. Takeda, Y., Fujita, Y., Honjo, J., Yanagimachi, T., Sakagami, H., Takiyama, Y., Makino, Y., Abiko, A., Kieffer, T.J., and Haneda, M. (2012). Reduction of both beta cell death and alpha cell proliferation by dipeptidyl peptidase-4 inhibition in a streptozotocin-induced model of diabetes in mice. Diabetologia 55, 404-412. 302. Talchai, C., Xuan, S., Lin, H.V., Sussel, L., and Accili, D. (2012). Pancreatic beta cell dedifferentiation as a mechanism of diabetic beta cell failure. Cell 150, 1223-1234. 303. Taneera, J., Fadista, J., Ahlqvist, E., Zhang, M., Wierup, N., Renstrom, E., and Groop, L. (2013). Expression profiling of cell cycle genes in human pancreatic islets with and without type 2 diabetes. Mol Cell Endocrinol 375, 35- 42. 304. Tang, D.D., Turner, C.E., and Gunst, S.J. (2003). Expression of non- phosphorylatable paxillin mutants in canine tracheal smooth muscle inhibits tension development. J Physiol 553, 21-35. 305. Teta, M., Long, S.Y., Wartschow, L.M., Rankin, M.M., and Kushner, J.A. (2005). Very slow turnover of beta-cells in aged adult mice. Diabetes 54, 2557- 2567.

177

306. Thomas, H.E., Trapani, J.A., and Kay, T.W. (2010). The role of perforin and granzymes in diabetes. Cell Death Differ 17, 577-585. 307. Thorel, F., Nepote, V., Avril, I., Kohno, K., Desgraz, R., Chera, S., and Herrera, P.L. (2010). Conversion of adult pancreatic alpha-cells to beta-cells after extreme beta-cell loss. Nature 464, 1149-1154. 308. Thurmond, D.C., Gonelle-Gispert, C., Furukawa, M., Halban, P.A., and Pessin, J.E. (2003). Glucose-stimulated insulin secretion is coupled to the interaction of actin with the t-SNARE (target membrane soluble N- ethylmaleimide-sensitive factor attachment protein receptor protein) complex. Mol Endocrinol 17, 732-742. 309. Tidball, J.G., Spencer, M.J., Wehling, M., and Lavergne, E. (1999). Nitric- oxide synthase is a mechanical signal transducer that modulates talin and vinculin expression. J Biol Chem 274, 33155-33160. 310. Turley, S., Poirot, L., Hattori, M., Benoist, C., and Mathis, D. (2003). Physiological beta cell death triggers priming of self-reactive T cells by dendritic cells in a type-1 diabetes model. J Exp Med 198, 1527-1537. 311. Ueki, K., Okada, T., Hu, J., Liew, C.W., Assmann, A., Dahlgren, G.M., Peters, J.L., Shackman, J.G., Zhang, M., Artner, I., et al. (2006). Total insulin and IGF-I resistance in pancreatic beta cells causes overt diabetes. Nat Genet 38, 583- 588. 312. Unger, R.H. (1983). The Berson memorial lecture. Insulin-glucagon relationships in the defense against hypoglycemia. Diabetes 32, 575-583. 313. Unger, R.H. (1985). Glucagon physiology and pathophysiology in the light of new advances. Diabetologia 28, 574-578. 314. Unger, R.H., and Orci, L. (1977). Role of glucagon in diabetes. Arch Intern Med 137, 482-491. 315. Unger, R.H., and Zhou, Y.T. (2001). Lipotoxicity of beta-cells in obesity and in other causes of fatty acid spillover. Diabetes 50 Suppl 1, S118-121. 316. Vaishnav, Y.N., Vaishnav, M.Y., and Pant, V. (1998). The molecular and functional characterization of E2F-5 transcription factor. Biochem Biophys Res Commun 242, 586-592. 317. Valdez, C.D., Davis, J.N., Odeh, H.M., Layfield, T.L., Cousineau, C.S., Berton, T.R., Johnson, D.G., Wojno, K.J., and Day, M.L. (2011). Repression of androgen receptor transcription through the E2F1/DNMT1 axis. PLoS One 6, e25187. 318. Vasavada, R.C., Cozar-Castellano, I., Sipula, D., and Stewart, A.F. (2007). Tissue-specific deletion of the retinoblastoma protein in the pancreatic beta-cell has limited effects on beta-cell replication, mass, and function. Diabetes 56, 57- 64. 319. Vasavada, R.C., Garcia-Ocana, A., Zawalich, W.S., Sorenson, R.L., Dann, P., Syed, M., Ogren, L., Talamantes, F., and Stewart, A.F. (2000). Targeted expression of placental lactogen in the beta cells of transgenic mice results in beta cell proliferation, islet mass augmentation, and hypoglycemia. J Biol Chem 275, 15399-15406.

178

320. Verdaguer, J., Schmidt, D., Amrani, A., Anderson, B., Averill, N., and Santamaria, P. (1997). Spontaneous autoimmune diabetes in monoclonal T cell nonobese diabetic mice. J Exp Med 186, 1663-1676. 321. Vigo, E., Muller, H., Prosperini, E., Hateboer, G., Cartwright, P., Moroni, M.C., and Helin, K. (1999). CDC25A phosphatase is a target of E2F and is required for efficient E2F-induced S phase. Mol Cell Biol 19, 6379-6395. 322. Villasenor, A., Chong, D.C., and Cleaver, O. (2008). Biphasic Ngn3 expression in the developing pancreas. Dev Dyn 237, 3270-3279. 323. Wang, C.X., Song, J.H., Song, D.K., Yong, V.W., Shuaib, A., and Hao, C. (2006). Cyclin-dependent kinase-5 prevents neuronal apoptosis through ERK- mediated upregulation of Bcl-2. Cell Death Differ 13, 1203-1212. 324. Wang, L., Liu, Y., Yan Lu, S., Nguyen, K.T., Schroer, S.A., Suzuki, A., Mak, T.W., Gaisano, H., and Woo, M. (2010). Deletion of Pten in pancreatic ss- cells protects against deficient ss-cell mass and function in mouse models of type 2 diabetes. Diabetes 59, 3117-3126. 325. Wang, Q., and Brubaker, P.L. (2002). Glucagon-like peptide-1 treatment delays the onset of diabetes in 8 week-old db/db mice. Diabetologia 45, 1263- 1273. 326. Wang, R.N., Bouwens, L., and Kloppel, G. (1996). Beta-cell growth in adolescent and adult rats treated with streptozotocin during the neonatal period. Diabetologia 39, 548-557. 327. Wang, R.N., Kloppel, G., and Bouwens, L. (1995). Duct- to islet-cell differentiation and islet growth in the pancreas of duct-ligated adult rats. Diabetologia 38, 1405-1411. 328. Weir, G.C., Laybutt, D.R., Kaneto, H., Bonner-Weir, S., and Sharma, A. (2001). Beta-cell adaptation and decompensation during the progression of diabetes. Diabetes 50 Suppl 1, S154-159. 329. Wendt, A., Birnir, B., Buschard, K., Gromada, J., Salehi, A., Sewing, S., Rorsman, P., and Braun, M. (2004). Glucose inhibition of glucagon secretion from rat alpha-cells is mediated by GABA released from neighboring beta-cells. Diabetes 53, 1038-1045. 330. Wettergren, A., Wojdemann, M., and Holst, J.J. (1998). Glucagon-like peptide-1 inhibits gastropancreatic function by inhibiting central parasympathetic outflow. Am J Physiol 275, G984-992. 331. Wheeler, M.B., Sheu, L., Ghai, M., Bouquillon, A., Grondin, G., Weller, U., Beaudoin, A.R., Bennett, M.K., Trimble, W.S., and Gaisano, H.Y. (1996). Characterization of SNARE protein expression in beta cell lines and pancreatic islets. Endocrinology 137, 1340-1348. 332. Wicksteed, B., Brissova, M., Yan, W., Opland, D.M., Plank, J.L., Reinert, R.B., Dickson, L.M., Tamarina, N.A., Philipson, L.H., Shostak, A., et al. (2010). Conditional gene targeting in mouse pancreatic ss-Cells: analysis of ectopic Cre transgene expression in the brain. Diabetes 59, 3090-3098. 333. Wierup, N., Sundler, F., and Heller, S. (2013). The islet ghrelin cell. J Mol Endocrinol.

179

334. Wikenheiser-Brokamp, K.A. (2006). Retinoblastoma family proteins: insights gained through genetic manipulation of mice. Cell Mol Life Sci 63, 767- 780. 335. Wirt, S.E., Adler, A.S., Gebala, V., Weimann, J.M., Schaffer, B.E., Saddic, L.A., Viatour, P., Vogel, H., Chang, H.Y., Meissner, A., et al. (2010). G1 arrest and differentiation can occur independently of Rb family function. J Cell Biol 191, 809-825. 336. Wu, L., Timmers, C., Maiti, B., Saavedra, H.I., Sang, L., Chong, G.T., Nuckolls, F., Giangrande, P., Wright, F.A., Field, S.J., et al. (2001). The E2F1-3 transcription factors are essential for cellular proliferation. Nature 414, 457-462. 337. Wu, Y., Liu, C., Sun, H., Vijayakumar, A., Giglou, P.R., Qiao, R., Oppenheimer, J., Yakar, S., and LeRoith, D. (2011). Growth hormone receptor regulates beta cell hyperplasia and glucose-stimulated insulin secretion in obese mice. J Clin Invest 121, 2422-2426. 338. Wu, Z., and Yu, Q. (2009). E2F1-mediated apoptosis as a target of cancer therapy. Curr Mol Pharmacol 2, 149-160. 339. Xia, H., Nho, R.S., Kahm, J., Kleidon, J., and Henke, C.A. (2004). Focal adhesion kinase is upstream of phosphatidylinositol 3-kinase/Akt in regulating fibroblast survival in response to contraction of type I collagen matrices via a beta 1 integrin viability signaling pathway. J Biol Chem 279, 33024-33034. 340. Xiao, X., Chen, Z., Shiota, C., Prasadan, K., Guo, P., El-Gohary, Y., Paredes, J., Welsh, C., Wiersch, J., and Gittes, G.K. (2013). No evidence for beta cell neogenesis in murine adult pancreas. J Clin Invest 123, 2207-2217. 341. Xu, E., Kumar, M., Zhang, Y., Ju, W., Obata, T., Zhang, N., Liu, S., Wendt, A., Deng, S., Ebina, Y., et al. (2006). Intra-islet insulin suppresses glucagon release via GABA-GABAA receptor system. Cell Metab 3, 47-58. 342. Xu, X., D'Hoker, J., Stange, G., Bonne, S., De Leu, N., Xiao, X., Van de Casteele, M., Mellitzer, G., Ling, Z., Pipeleers, D., et al. (2008). Beta cells can be generated from endogenous progenitors in injured adult mouse pancreas. Cell 132, 197-207. 343. Yang, X.D., Tisch, R., Singer, S.M., Cao, Z.A., Liblau, R.S., Schreiber, R.D., and McDevitt, H.O. (1994). Effect of tumor necrosis factor alpha on insulin- dependent diabetes mellitus in NOD mice. I. The early development of autoimmunity and the diabetogenic process. J Exp Med 180, 995-1004. 344. Yi, P., Park, J.S., and Melton, D.A. (2013). Betatrophin: a hormone that controls pancreatic beta cell proliferation. Cell 153, 747-758. 345. Zacksenhaus, E., Jiang, Z., Chung, D., Marth, J.D., Phillips, R.A., and Gallie, B.L. (1996). pRb controls proliferation, differentiation, and death of skeletal muscle cells and other lineages during embryogenesis. Genes Dev 10, 3051-3064. 346. Zhang, C.Y., Baffy, G., Perret, P., Krauss, S., Peroni, O., Grujic, D., Hagen, T., Vidal-Puig, A.J., Boss, O., Kim, Y.B., et al. (2001). Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, beta cell dysfunction, and type 2 diabetes. Cell 105, 745-755.

180

347. Zhang, Y., Xiong, Y., and Yarbrough, W.G. (1998). ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways. Cell 92, 725-734. 348. Zhang, Z., Vuori, K., Reed, J.C., and Ruoslahti, E. (1995). The alpha 5 beta 1 integrin supports survival of cells on fibronectin and up-regulates Bcl-2 expression. Proc Natl Acad Sci U S A 92, 6161-6165. 349. Zhao, C., Wilson, M.C., Schuit, F., Halestrap, A.P., and Rutter, G.A. (2001). Expression and distribution of lactate/monocarboxylate transporter isoforms in pancreatic islets and the exocrine pancreas. Diabetes 50, 361-366. 350. Zhao, J., Bian, Z.C., Yee, K., Chen, B.P., Chien, S., and Guan, J.L. (2003). Identification of transcription factor KLF8 as a downstream target of focal adhesion kinase in its regulation of cyclin D1 and cell cycle progression. Mol Cell 11, 1503-1515. 351. Zhou, Y.P., and Grill, V. (1995). Long term exposure to fatty acids and ketones inhibits B-cell functions in human pancreatic islets of Langerhans. J Clin Endocrinol Metab 80, 1584-1590. 352. Zhu, J.W., DeRyckere, D., Li, F.X., Wan, Y.Y., and DeGregori, J. (1999). A role for E2F1 in the induction of ARF, p53, and apoptosis during thymic negative selection. Cell Growth Differ 10, 829-838.

Chapter IX: Permissions

181

Christine N. Taylor March 4, 2014 Associate Rights and Permissions Erica P. Cai Publications University of Toronto 703-549-1500 ext. 1635 - Tel 101 College Street, Room 10-601D 703-683-2890 - Fax Toronto, ON, Ca nada MSG 1L7 [email protected]

Permission Request Number: CT022014-UOT

Dear Ms. Cai:

We are pleased to grant permission to you to reproduce the following article:

 In Vivo Role of Focal Adhesion Kinase in Regulating Pancreatic β-Cell Mass and Function Through Insulin Signaling, Actin Dynamics, and Granule Trafficking

From: Diabetes®, Vol. 61, 2012; 1708-1718 For use in: Thesis

The permission granted is for a one-time use only for English language as described in this agreement, and is subject to the following conditions:

1. Permission is granted for use in the following formats – Print & Electronic. 2. Each copy containing our material that you reproduce or distribute must bear the following copyright notice: “Copyright 2012 American Diabetes Association From Diabetes®, Vol. 61, 2012; 1708-1718 Reprinted with permission from The American Diabetes Association.” 3. The article will be reprinted exactly as it was originally published. 4. Permission is non-exclusive and the American Diabetes Association reserves the right to grant the same permission to others. 5. This permission agreement is valid for a period of twelve (12) months beginning from the date of this letter.

Sincerely, AGREED: ______

DATE: ______Christine N. Taylor ______We elect not to use this material.

Unless specifically noted here, the permission granted does not include the use of the American Diabetes Association logo or the cover logo of the journal(s). Permission to reproduce material does not permit the above-named entity or the company sponsoring the resulting product to act as an agent of the American Diabetes Association or of the journals(s).

National Office Diabetes Information The Mission of the American 1701 North Beauregard Street call 1-800-DIABETES (1-800-342-2383) Diabetes Association is to prevent and Alexandria, VA 22311 online www.diabetes.org cure diabetes and to improve the lives Tel: 703-549-1500 The Association gratefully accepts gifts through your will. of all people affected by diabetes.