USO09725399B2

(12) United States Patent (10) Patent No.: US 9,725,399 B2 Petrie et al. (45) Date of Patent: Aug. 8, 2017

(54) LPID COMPRISING LONG CHAN (51) Int. Cl. POLYUNSATURATED FATTY ACDS C07C 69/587 (2006.01) CIIB I/O (2006.01) (71) Applicants: Commonwealth Scientific and (Continued) Industrial Research Organisation, (52) U.S. Cl. Acton, Australian Capital Territory CPC ...... C07C 69/587 (2013.01); A23D 9/00 (AU): Nuseed Pty Ltd, Laverton North, (2013.01); A61K 36/31 (2013.01): CIIB I/10 Victoria (AU); Grains Research and (2013.01); A61 K 2.236/00 (2013.01) Development Corporation, Barton, (58) Field of Classification Search Australian Capital Territory (AU) CPC ...... C12N 15/8247; CO7C 69/587 See application file for complete search history. (72) Inventors: James Robertson Petrie, Goulburn (AU); Surinder Pal Singh, Downer (56) References Cited (AU); Pushkar Shrestha, Lawson U.S. PATENT DOCUMENTS (AU); Jason Timothy McAllister, Portarlington (AU); Robert Charles De 4,399.216 A 8, 1983 Axel et al. Feyter, Monash (AU); Malcolm David 5,004,863. A 4, 1991 Umbeck Devine, Vernon (CA) (Continued) (73) Assignees: COMMONWEALTH SCIENTIFIC FOREIGN PATENT DOCUMENTS AND INDUSTRIAL RESEARCH AU 667939 1, 1994 ORGANISATION, Campbell (AU): AU 200059710 B2 12/2000 NUSEED PTY LTD, Laverton North (Continued) (AU); GRAINS RESEARCH AND DEVELOPMENT CORPORATION, Barton (AU) OTHER PUBLICATIONS Ruiz-Lopez, N. et al., “Metabolic engineering of the omega-3 long (*) Notice: Subject to any disclaimer, the term of this chain polyunsaturated fatty acid biosynthetic pathway into trans patent is extended or adjusted under 35 genic plants' Journal of Experimental botany, 2012, vol. 63, pp. U.S.C. 154(b) by 0 days. 2397-2410. (Continued) (21) Appl. No.: 14/575,756 Primary Examiner – Yate K Cutliff (22) Filed: Dec. 18, 2014 (74) Attorney, Agent, or Firm — John P. White; Gary J. Gershik; Cooper & Dunham LLP (65) Prior Publication Data (57) ABSTRACT US 2015/O166928 A1 Jun. 18, 2015 The present invention relates to extracted plant lipid or microbial lipid comprising docosahexaenoic acid, and/or (30) Foreign Application Priority Data docosapentaenoic acid, and processes for producing the extracted lipid. Dec. 18, 2013 (AU) ...... 2O139.05033 Jun. 27, 2014 (AU) ...... 2O14902471 33 Claims, 10 Drawing Sheets

. Y 8:3AS.215 (ALA) --

8,,2, 3 (SA; 2:3:4,7

\ 2:SAS8, 4. EPAs - J & &i. : & :: 3. 3.9 (3A) -- 4:59,3,5,8,2;

22:6.4,, , 3.3f. A s----- 24:33.8125.8.2. 3-oxiciatic US 9,725,399 B2 Page 2

(51) Int. Cl. 7,081,356 B2 7/2006 Putten et al. A6 IK 36/3 (2006.01) 7,091,005 B2 8, 2006 Petrukhin et al. 7,109,392 B1 9/2006 Broglie et al. A23D 9/00 (2006.01) 7,135,614 B1 1 1/2006 DeBonte et al. 7,135,623 B1 11/2006 Rusing et al. 7,148,336 B2 12/2006 Fillatti (56) References Cited 7,179,647 B2 2/2007 Lerchl et al. 7,189,559 B2 3/2007 Damude et al. U.S. PATENT DOCUMENTS 7,192,762 B2 3/2007 Macool et al. 7,198.937 B2 4/2007 Xue et al. 33: A 38; Nike a 7,208,297 B2 4/2007 Mukerji et al. k --- 7,211,418 B2 5/2007 Metz et al. 5,177,010 A 1/1993 Goldman et al. 7.211,656 B2 5/2007 Mukerji et al. A 'g R 1 7,214,853 B2 5/2007 Facciotti et al. 5.4553 A 9, 1995 tral 7,217,856 B2 5 2007 Weaver et al. 5,463,174. A 10/1995f Moloney11 et all et al. 7,241,6197,220,897 B2 7/20075 2007 Mukerji et al. 3. A $39. East etal 7,244,563 B2 7/2007 Cahoon et al. 5,545,818. A 8/1996 McBride et al. 7,247.461 B2 7/2007 Metz et al. 5,552.306 A 9, 1996 Th 1 7.256,033 B2 8/2007 Damude et al. 5569.834. A 10/1996 E. cal 7,262,343 B1 8, 2007 DeBonte et al. - W - Inchee et al. 7,271,315 B2 9/2007 Metz et al. 5,589,617 A leg N. et l 7,273,746 B2 9/2007 Yadav et al. is: A :1922 sA. tal 7,402,735 B2 7/2008 Browse et al. 5663,068 A 9/1997 Thomas et al. 79. R: $39. Myers al 5,668,299 A 9/1997 Debonte et al. 763, 5 36 CE." 5,683,898 A 11/1997 Yazawa et al. 7.550.286 B2 6/2009 Damude et al 5,689,050 A 11/1997f Thomash et al.1 7.550,651- - W B2 6/2009 Damude et al. 5,789,220 A 3. Thomas et 7,589.253 B2 9/2009 Green et al. 3.65 A SE S. .." 7,615,679 B2 11/2009 Lerchl et al. 5855347 A 1, 1999 list al. 7,619, 105 B2 11/2009 Green et al. w--/ 7,659,120 B2 2/2010 Yadav et al. 5,869,617 A SE VE et 7,659,247 B2 2/2010 Kretschmar et al. 3.3% A RE E. al 7,709,239 B2 5 2010 Damude et al. 5952,544 A 9, 1999 E. 7.714,185 B2 5/2010 Napier et al. 5968.809 A 10, 1999 Knutzon et al 7,736,884 B2 6/2010 Gunnarsson et al. 5972664 A 10/1999 Knutzon et al. 7,807,8497,777,098 B2 10/20108/2010 CirpusSingh et et al.al. SR A 58 A. 1 7,834,248 B2 11/2010 Green et al. 6100447 A 8/2000 St. et al. 7,834,250 B2 11/2010 Singh et al. 6.136,574. A 10/2000 RNAc al 7,838,651 B2 11/2010 Picataggio et al. 6.140.486 A 10/2000 Facciottietal. 23S R: 1588 El 6,194,167 B1 2/2001 Browse et al. 7,871.804 B2 1, 2011 C il 6,329,518 B1 12/2001 Green et al. 7879.50 B3 220 SNR, al 6,342,658 B1 1/2002 DeBonte et al. w - 6,355.861 B1 3f2002 Thomas 7,901928 B2 3/2011 Yadav et al. 6,372,965 B1 4/2002 Lightner et al. 3. R. 358: SE 6,403,349 B1 6/2002 Mukerji et al. 8084,074 B2 12/2011 Ki il 6,410,288 B1 6/2002 Knutzon et al. 8.106,326 B2 1/2012 Syl. 6.428,990 B1 8/2002 Mukerji et al. 858.392 B1 4/2012 SE et al. 6.432,6846.459,018 B1 10,8/2002 2002 MukerjiKnutzon et al. 8,288,572k - w B2 10/2012 Singh et al. 6.492.108 B1 12/2002 Hillman et al. 3:42 E: 838. SE et al 6,541,257 B2 4/2003 Lemaux et al. E. : : Sight al. 6,566,583 B1 5/2003 Facciotti et al. 8,778,644 B2 7/2014 Singhetal 6,589,767 B1 7/2003 Knutzon et al. 8.809.559 B2 8, 2014 Petrie et al. 6,620,986 B1 9/2003 McKeon et al. sw 6,635,451 B2 10/2003 Mukerji et al 8,816,106 B2 8/2014 Damcevski et al. 6677145 B2 1/2004 Mukerji et al. 8,816,111 B2 8, 2014 Petrie et al. 6,683.232 B1 1/2004 Th 8,853,432 B2 10/2014 Singh et al. 6,686.185 B. 32004 | Net al 8,921,652 B2 12/2014 Liu et al. 6.825,017 B1 1/2004 Browse et al. 8,946,460 B2 2/2015 Petrie et al. f in et al 2001 OO23259 A1 9, 2001 Slabas et al. 6,825,335 B1 11 2. Marinet d 2002/0009779 A1 1/2002 Meyers et al. 6,838,594 B1 1/2005 Kinney et al. 2002/0042933 A1 4/2002 Browse et al. 6,858.416 B2 2/2005 Mukerji et al. 2002/0065406 A1 5/2002 Meyers 6,875,5956,864,077 B1B2 4?3/2005 2005 CahoonKloek et et all al. 2002/0076.786 A1 6, 2002 Curtis et al. 6.88492 B2 4/2005 S. et il 2002/0107373 A1 8, 2002 Curtis et al. 6897.050 B1 5/2005 E. et al. 2002/0108147 A1 8, 2002 Thomas 6,913,916 Bf 7/2005 NEli et al 2002/011 1307 A1 8/2002 GluckSmann et al. 6,936,728- K - B2 8, 2005 SomervilleJet al.et al. 2002/0115178 A1 8/2002 Meyers et al. 6.958.229 B2 10, 2005 Suzuki et al. 2002/0138874 A1 9/2002 Mukerji et al. 6,967.243 B2 11/2005 Debonte et al. 2002/0146784 A1 10, 2002 Suzuki et al. 7,001,772 B2 2/2006 Roessler et al. 2002/0156254 A1 10/2002 Qiu et al. 7,045,683 B2 5/2006 Mukerji et al. 2002/0170090 A1 11/2002 Browse et al. 7,067.285 B2 6/2006 Mukerji et al. 2002/0194641 A1 12/2002 Metz et al. 7,067,722 B2 6/2006 Fillatti 2003/0033633 A1 2/2003 Lightner et al. 7,070,970 B2 7/2006 Mukerji et al. 2003, OO77747 A1 4, 2003 Hillman et al. US 9,725,399 B2 Page 3

(56) References Cited 2006/0218668 A1 9/2006 Cirpus et al. 2006/0246556 Al 11/2006 Napier et al. U.S. PATENT DOCUMENTS 2007/0028326 A1 2/2007 Cirpus et al. 2007/0059.730 A1 3, 2007 Curtis et al. 2003/OO79250 A1 4, 2003 Filatti 2007, OO61921 A1 3/2007 Graham et al. 2003/0082754 A1 5/2003 Mukerji 2007/O118929 A1 5/2007 Damude et al. 2003, OO84480 A1 5, 2003 Filatti 2007, 01630O2 A1 7/2007 DeBonte et al. 2003/0101486 A1 5/2003 Facciotti et al. 2007/0192902 A1 8/2007 Qiu et al. 2003/0104596 A1 6/2003 Mukerji et al. 2007/0220634 Al 9, 2007 Metz 2003/0115632 A1 6, 2003 Lardizabal et al. 2007/0224661 Al 9, 2007 Cirpus et al. 2003/O131379 A1 7/2003 Debonte et al. 2007/0238648 A1 10/2007 Brownlie et al. 2003/0134400 A1 7/2003 Mukerji et al. 2007/0244192 A1 10, 2007 Metz 2003. O152983 A1 8/2003 Napier et al. 2007.0245431 A1 10, 2007 Metz et al. 2003/0157144 A1 8/2003 Mukerji et al. 2007/0259355 A1 1 1/2007 Luy et al. 2003. O159164 A1 8/2003 Kopchick et al. 2007,0261138 A1 11/2007 Graham et al. 2003/O159173 A1 8, 2003 Wolter et al. 2007/0270494 A1 11/2007 Metz et al. 2003/0163844 A1 8/2003 Lightner et al. 2007,0294790 A1 12/2007 Graham et al. 2003. O163845 A1 8/2003 Mukerji et al. 2008/OOO5811 A1 1/2008 Metz et al. 2003/0166207 A1 9, 2003 Roessler et al. 2008/0022422 A1 1/2008 Weaver et al. 2003/0167525 A1 9/2003 Mukerji et al. 2008/0057495 A1 3/2008 Ohyama 2003/0172398 A1 9, 2003 Browse 2008, OO63691 A1 3/2008 Ursin et al. 2003/0172399 A1 9, 2003 Filatti 2008/0076166 A1 3/2008 Cirpus et al. 2003/0177508 A1 9/2003 Mukerji et al. 2008/0155705 A1 6/2008 Zank et al. 2003/0190733 A1 10/2003 Mukerji et al. 2008.0160.054 A1 7, 2008 Heinz et al. 2003/01962.17 A1 10/2003 Mukerji et al. 2008/0214667 Al 9, 2008 Das et al. 2004/OOO95O1 A1 1/2004 Curtis et al. 2008, 0220 143 A1 9/2008 Kinney et al. 2004/00498.05 A1 3f2004 Lerchl et al. 2008, 0220500 A1 9, 2008 Winther et al. 2004.0053234 A1 3, 2004 Winther et al. 2008/0241133 A1 10/2008 Curtis et al. 2004.0053379 A1 3, 2004 Lerchl et al. 2008/0254.191 A1 10/2008 Damude et al. 2004/0067226 A1 4/2004 Petrukhin et al. 2008/0254195 A1 10, 2008 Damude et al. 2004f0078845 A1 4/2004 Thomas 2008/0260929 A1 10/2008 Ursin et al. 2004/0086899 A1 5, 2004 Winther et al. 2009/0093.033 Al 4, 2009 Luy et al. 2004/0098762 A1 5, 2004 Filatti 2009/0158462 A1 6/2009 Cirpus et al. 2004/011 1763 Al 6, 2004 Heinz et al. 2009/0222951 A1 9/2009 Cirpus et al. 2004/0132654 A1 7/2004 Kumpe et al. 2009/0253.188 Al 10/2009 Zhu et al. 2004/O157221 A9 8, 2004 Curtis et al. 2009/0320161 A1 12/2009 McGonigle et al. 2004/0172682 Al 9/2004 Kinney et al. 2010.0088776 Al 4, 2010 Bauer et al. 2004/O180414 A1 9, 2004 Putten et al. 2010/0092.640 A1 4/2010 Ursin et al. 2004/O195512 A1 10, 2004 Crosetto 2010, O189868 A1 7/2010 Damude et al. 2004/0221335 A1 11/2004 Shewmaker et al. 2010/0227924 Al 9, 2010 Cirpus et al. 2004/0224413 A1 11/2004 Cahoon et al. 2011/0015415 A1 1/2011 Singh et al. 2004/O235127 A1 11/2004 Metz et al. 2011 OO16585 A1 1/2011 Periera et al. 2005/0003442 A1 1/2005 Mukerji et al. 2011/0039010 A1 2/2011 Reinet al. 2005/0005328 A1 1/2005 Mukerji et al. 2011/0054198 A1 3/2011 Singh et al. 2005.0005329 A1 1/2005 Mukerji et al. 2011/0059204 A1 3/2011 Jackson et al. 2005/0009140 A1 1/2005 Mukerji et al. 2011/0059496 A1 3/2011 Zhu et al. 2005/0089865 A1 4/2005 Napier et al. 2011/019052 Al 8, 2011 Damcevski et al. 2005.0089879 A1 4/2005 Feussner et al. 2011/0201065 A1 8/2011 Singh et al. 2005/0089981 A1 4/2005 Napier et al. 2011/0218348 Al 9, 2011 Zhou et al. 2005, 0100995 A1 5, 2005 Weaver et al. 2011/0269983 Al 11/2011 Kinney et al. 2005, 0112719 A1 5/2005 Roessler et al. 2011/0314725 Al 12/2011 Petrie et al. 2005, 0164.192 A1 7/2005 Graham et al. 2012fOO16144 A1 1/2012 Petrie et al. 2005, 0166271 A1 7, 2005 Feubner et al. 2012/0041218 A1 2/2012 Singh et al. 2005/0214761 A1 9, 2005 Lerch1 et al. 2012 0083615 A1 4/2012 Singh et al. 2005/0239171 A1 10, 2005 Mitterer et al. 2012/0215018 A1 8/2012 Singh et al. 2005/0262.588 A1 11/2005 Dehesh et al. 2013/0060053 A1 3/2013 Singh et al. 2005/0262589 A1 11/2005 Filatti 2013/0338387 A1 12/2013 Petrie et al. 2005/0262591 A1 11/2005 Debonte et al. 2013/0338388 Al 12/2013 Petrie et al. 2013/0309772 A1 11/2005 K. et al. 2014/OO11247 A1 1/2014 Singh et al. 2005/0266440 A1 12, 2005 Metz et al. 2014/0314727 A1 10/2014 Singh et al. 2005/0273883 A1 12/2005 Metz et al. 2015. OO18571 A1 1/2015 Petrie et al. 2005/0273884 A1 12/2005 Metz et al. 2015.OO45567 A1 2/2015 Damcevski et al. 2005/0273885 A1 12/2005 Singh et al. 2015,0045569 A 2.2015 Petrie et al. 2006/0014268 A1 1/2006 Suzuki et al. 2015/0087849 A1 3/2015 Singh et al. 2006, OO78973 A1 4/2006 Renz et al. 2015,02O3788 A1 7/2015 Petrie et al. 2006/0094088 A1 5/2006 Picataggio et al. 2015,0374654 A1 12/2015 Petrie et al. 2006/0094092 A1 5/2006 Damude et al. 2016,0177220 A1 6, 2016 Petrie et al. 2006/0094.102 A1 5, 2006 Xue et al. 2006/0110806 A1 5, 2006 Damude et al. FOREIGN PATENT DOCUMENTS 2006/0115881 A1 6, 2006 Damude et al. 2006/0117414 A1 6/2006 Qiu et al. 2006, O156435 A1 7, 2006 Ursin et al. A. 2009: B2 358. 2006, O168687 A1 7, 2006 Renz et al. AU 776447 9, 2004 2006/0174376 Al 8, 2006 Renz et al. AU 2007 276257 1, 2008 2006,019 1042 A1 8, 2006 Flatti CA 209.2588 9, 1994 2006/0195939 A1 8, 2006 Damude et al. EP 275957 T 1988 2006/0205047 A1 9, 2006 Putten et al. EP 256223 2, 1998 2006/0206961 A1 9/2006 Cirpus et al. GB 1206483.8 4/2012 2006/0206963 A1 9, 2006 Voelker et al. GB 12221842 12/2012 US 9,725,399 B2 Page 4

(56) References Cited WO WO O3,099.216 12/2003 WO WO O3 (102138 A2 12/2003 FOREIGN PATENT DOCUMENTS WO WO 2004.005442 1, 2004 WO WO 2010/O232O2 3, 2004 JP 2000217582 8, 2000 WO WO 2004/057 001 T 2004 JP 2001095588 4/2001 WO WO 2004/071467 A2 8, 2004 JP 2001145.490 5, 2001 WO WO 2004/087.180 A1 10, 2004 JP 200116978O 6, 2001 WO WO 2004/101757 11 2004 JP 2003116566 4/2003 WO WO 2005/007845 A2 1, 2005 WO WO 84,02913 8, 1984 WO WO 2005/O12316 A2 2, 2005 WO WO 87/05327 9, 1987 WO WO 2005/083053 A2 9, 2005 WO WO 89,05852 6, 1989 WO WO 2005/083093 A2 9, 2005 WO WO 91/O2O71 2, 1991 WO WO 2005/097982 A2 10, 2005 WO WO 91/1398O 9, 1991 WO WO 2005/098O33 A1 10, 2005 WO WO 93,06712 4f1993 WO WO 2005,103253 11/2005 WO WO 93,23545 A1 11, 1993 WO WO 2005,103253 A1 11, 2005 WO WO95/15389 6, 1995 WO WO 2005/118814 12/2005 WO WO95/23230 8, 1995 WO WO 2006/008099 1, 2006 WO WO 96/10074 4f1996 WO WO 2006/019.192 2, 2006 WO WO 96/21022 A2 T 1996 WO WO 2006/064317 A1 6, 2006 WO WO 97.06269 2, 1997 WO WO 2006/069936 T 2006 WO WO 97.21340 6, 1997 WO WO 2005/080578 A2 9, 2006 WO WO 97.37033 10, 1997 WO WO 2006/127655 11 2006 WO WO 97/48814 12/1997 WO WO 2007/005882 A2 1, 2007 WO WO 98.01565 A1 1, 1998 WO WO 2007/042510 4/2007 WO WO 98.18952 A1 5, 1998 WO WO 2007/092460 A2 8, 2007 WO WO 98.39.468 A1 9, 1998 WO WO 2007/0963.87 8, 2007 WO WO 98,46765 A1 9, 1998 WO WO 2007,127381 11/2007 WO WO 98.45461 10, 1998 WO WO 2007/133425 11/2007 WO WO 98,46763 A1 10, 1998 WO WO 2007 137788 12/2007 WO WO 98,46764 10, 1998 WO WO 2008/009600 A1 1, 2008 WO WO 98,55625 A1 12, 1998 WO WO 2008/022963 2, 2008 WO WO 98.56239 A1 12, 1998 WO WO 2008/O25068 6, 2008 WO WO99/05265 2, 1999 WO WO 2008/128241 10, 2008 WO WO 99/14314 3, 1999 WO WO 2009/O162O2 2, 2009 WO WO99, 16890 4f1999 WO WO 2009/017821 2, 2009 WO WO 99,33958 A2 7, 1999 WO WO O3,O78639 9, 2009 WO WO99/49050 A2 9, 1999 WO WO 2009/129582 10/2009 WO WO 99,616O2 A1 12, 1999 WO WO 2010/OO95OO 1, 2010 WO WO 99,64614 A2 12, 1999 WO WO 2010/057246 5, 2010 WO WO 99,646.16 A2 12, 1999 WO WO 2010, 147900 A1 12/2010 WO WOOOf 12720 A3 3, 2000 WO WO 2011, 146524 11/2011 WO WOOOf 20602 A2 4, 2000 WO WO 2013/O16546 1, 2013 WO WOOOf 20603 A1 4, 2000 WO WO 2013,153404 10, 2013 WO WOOO/21557 A1 4/2000 WO WO 2013, 185184 A2 12/2013 WO WOOOf 40705 A2 T 2000 WO WOOOf 42.195 A2 T 2000 WO WOOO,521.83 9, 2000 OTHER PUBLICATIONS W W 83. A1 23.9 Petrie, J.R. et al., “Metabolic engineering plant seed with fish WO WOOO,75341 A1 12/2000 oil-like levels of DHA’”. PLoS One 2012. vol. 7, e49 165, published WO WO O1/O2591 A1 1, 2001 online Nov. 7, 2012. WO WO 01/04636 A1 1, 2001 International Search Report, mailed Mar. 20, 2015 in connection W. W88 EA 38 with PCT International Application No. PCT/AU2014/050433, filed WO WO O1/20001 3, 2001 Dec. 18, 2014. WO WO O1/38484 5, 2001 Mallory et al (2002) “The amplicon-plus system for high-level WO WO O1/38512 5, 2001 expression of transgenes in plants' Nat. Biotech. 20:622-625. WO WO O1/385 12 A2 5, 2001 Mansour, M.P. et al., (1999) “The Fatty Acid and Sterol Compo WO WO O1/44485 A1 6, 2001 sition of Five Marine Dinoflagellates,” Journal of Phycology, 35(4): WO WO O1, 59 128 8, 2001 T10-720. WO WO O1,66758O1/7O777 A2 9, 2001 Marangoni and Rousseau (1995) “Engineering& 8 triacylglycerols: The WO WOO 1/75069 A1 10, 2001 role of interesterification' Trends in Food Science & Technology 6, WO WO O1/92489 A2 12/2001 329-335. WO WO O1/96363 12/2001 Marquardt et al., (2000) “cDNA cloning, genomic structure, and WO WO O2/O84O1 1, 2002 chromosomal localization of three members of the human fatty acid WO WO O2,08401 A2 1, 2002 desaturase family.” Genomics, 66(2): 175-183. WO WO O2/26946 A2 4/2002 Marekov et al. (2009) Sterol composite of rapeseed varieties intro WO WO 02/081668 10, 2002 WO WO 02/081668 A3 10, 2002 duced in Bulgaria. Bulgarian Journal of Agricultural Science, 15(2): WO WO O2/O817O2 A1 10, 2002 119-122. WO WO O2/O83869 A3 10, 2002 Matzke et al. (2001) “RNA: Guiding Gene Silencing Science WO WO O2/O83870 A2 10, 2002 293:1080-1083. WO WO O2/O90493 A2 11/2002 Medlin, L.K., et al., (1996) “Genetic Characterization of Emiliania WO WO O2/O92540 A1 11, 2002 huxleyi (Haptophyta).” Journal of Marine Systems, 9: 13-31. WO WO O3,064596 A2 8, 2003 Meesapyodsuk et al. (2007) Primary structure, regioselectivity, and WO WO O3,O93482 11/2003 evolution of the membrane-bound fatty acid desaturases of WO WO 03/0934.82 A2 11/2003 Claviceps purpurea, J Biol Chem 282: 20191-20199. US 9,725,399 B2 Page 5

(56) References Cited Park and Jeong (2005) “Cloning and Functional Expression of cDNA Encoding Pheromone A9 Acyl-CoA Desaturase of the OTHER PUBLICATIONS Tobacco Cutworm, Spodoptera litura (Lepidoptera: Noctuidae)” Entomological Research, 35(4):253-263. Meng et al. (2008) “Hibiscus chlorotic ringspot virus coat protein Parker-Barnes, J.M., at al., (2000) “Identification and Characteriza inhibits trans-acting Small interfering RNA biogenesis in tion of an Enzyme Involved in the Elongation of n-6 and n-3 Arabidopsis” J. Gen. Virol. 89:2349-2358. Polyunsaturated Fatty Acids.” Proceedings of the National Acad Metz, J.G., et al., (2001) “Production of Polyunsaturated Fatty emy of Sciences of the United States of America, 97(15): 8284 Acids by Polyketide Synthases in Both Prokaryotes and 8289. Eukaryotes,” Science, 293(5528): 290-293. Pereira, S.L., et al., (2004) “A Novel omega3-Fatty Acid Desaturase Meyer, A., et al., (2003) “Biosynthesis of Docosahexaenoic Acid in Involved in the Biosynthesis of Eicosapentaenoic Acid.” The Bio Euglena gracilis: Biochemical and Molecular Evidence for the chemical Journal, 378 (Pt 2): 665-671. Involvement of a A4-Fatty Acyl Group Desaturase.” Biochemistry, Passorn et al (1999) “Heterologous Expression of Mucor rouxii 42(32): 9779-9788. A12-Desaturase Gene in Saccharomyces cerevisiae' Biochemical Meyer, A., et al., (2004) "Novel Fatty Acid Elongases and Their Use and Biophysical Research Communications 263, 47-51. for the Reconstitution of Docosahexaenoic Acid Biosynthesis.” Pereira et al. (2004b) Identification of two novel microalgal Journal of Lipid Research, 45(10): 1899-1909. enzymes involved in the conversion of the omegas-fatty acid, Michaelson, L.V., et al., (1998) “Isolation of a A5-Fatty Acid eicosapentaenoic acid, into docosahexaenoic acid, Biochem. J. Desaturase Gene From Mortirella alpina.” The Journal of Biological 384:357-366. Chemistry, 273(30): 19055-19059. Petrie et al. (2010a) Metabolic engineering of omega-3 long-chain Michaelson, L.V., et al., (1998) “Functional Identification of a Fatty polyunsaturated fatty acids in plants using an acyl-CoA Delta6 Acid A5 Desaturase Gene From Caenorhabditis elegans.” Federa desaturase with omegas-preference from the marine microalga tion of European Biochemical Societies Letters, 439(3): 215-218. Micromonas pusilla, Metab. Eng. 12:233-240. Mitchell, A.G. and Martin, C., (1995) “A Novel Cytochrome Petrie et al. (2012) Transgenic production of arachidonic acid in b5-Like Domain is Linked to the Carboxyl Terminus of the Sac oilseeds, Transgenic Res. 21:139-147. charomyces cerevisiae A-9 Fatty Acid Desaturase.” The Journal of Petrie et al. (2011) “Expanding the docosahexaenoic acid food web Biological Chemistry 270(50): 29766-29772. for Sustainable production: engineering lower plant pathways into Moreau et al. (1998) “Lipid Trafficking in Plant Cells' Progress Lip. higher plants' AoB Plants Article plr011 (doi:10.1093/aobpla ReS. 37:371-391. plr011. Morimoto et al. (2005) Hot Topic: Endogenous Production of n-3 and n-6 Fatty Acids in Mammalian Cells. J. Dairy Sci., 88:1142 Petrie et al. (2012) "Metabolic Engineering Plant Seeds with Fish 1146. Oil-Like Levels of DHA’ PLoS One, vol. 7, No. 10, e49165. Morita, N., et al., (2000) “Biosynthesis of Fatty Acids in the Petrie, J.R. et al., “Metabolic engineering Camelina sativa with fish Docosahexaenoic Acid-Producing Bacterium Moritella marina oil-like levels of DHA, PLoS One, Jan. 2014, vol. 9, p. e85061. Strain MP-1.” Biochemical Society Transactions, 28(6): 943-945. Petrie et al. (2010) “Rapid expression of transgenes driven by Mortimer, R. K., & Johnston, J. R. (1986). Genealogy of principal seed-specific constructs in leaf tissue: DHA production' Plant strains of the yeast genetic stock center. Genetics, 113, 35-43. Methods 6:8 (pp. 1-6). Moto, K., Suzuki, M. G., Hull, J. J., Kurata, R., Takahashi, S., Petrie et al. (2010) “Isolation and Characterisation of a High Yamamoto, M., ... Matsumoto, S. (2004). Involvement of a bifunc Efficiency DeSaturase and Elongases from Microalgae for Trans tional fatty-acyl desaturase in the biosynthesis of the silkmoth, genic LC-PUFA Production' Mar Biotechnol 12:430-438. Bombyx mori, sex pheromone. PNAS, 101(23), 8631-8636. Petrie et al. (2013) “Engineered oilseed crops with fish oil DHA Murata, N., & Wada, H. (1995). Acyl-lipid desaturases and their levels” Inform, 24(10):648-652. importance in the tolerance and acclimatization to cold of cyano Pereira et al. (2004) “Identification of two novel microalgal bacteria. Biochem. J., 308, 1-8. enzymes involved in the conversion of the co3-fatty acid, Napier, J.A., et al., (1998) “Identification of a Caenorhabditis eicosapentaenoic acid, into docosahexaenoic acid Biochem. J. elegans A6-Fatty-Acid-Desaturase by Heterologous Expression in 384-357-366. Saccharomyces cerevisiae.” The Biochemical Journal, 330(Pt 2): Perriman, R., et al., (1992) “Extended Target-Site Specificity for a 611-614. Hammerhead Ribozyme.” Gene, 113(2): 157-163. Napier, J.A., et al., (1999) “A Growing Family of Cytochrome Peyou-Ndi et al. (2000) Identification and Characterization of an b5-Domain Fusion Proteins,” Trends in Plant Science, 4(1): 2-4. Animal A12 Fatty Acid Desaturase Gene by Heterologous Expres Napier, J.A., et al., (1999) “Plant Desaturases: Harvesting the Fat of sion in Saccharomyces cerevisiae. Archives of Biochemistry and the Land,” Current Opinion in Plant Biology, 2(2): 123-127. Biophysics, vol. 376, No. 2, pp. 399-408. Napier (2007) “The Production of Unusual Fatty Acids in Trans Potenza et al. (2004) “Targeting Transgene Expression in Research, genic Plants” Ann. Rev. Plant. Biol. 58:295-319. Agricultural, and Environmental Applications: Promoters Used in Needleman, S. B., & Wunsch, C. D. (1970). A general method Plant Transformation. In Vitro Cell Dev Biol Plant 40:1-22. applicable to the search for similarities in the amino acid sequence Qi, B., et al., (2002) “Identification of a cDNA Encoding a Novel of two proteins. J. Mol. Biol. 48, 443-453. C18-A9 Polyunsaturated Fatty Acid-Specific Elongating Activity Niedzetal (1995) “Green fluorescent protein: an in vivo reporter of From the Docosahexaenoic Acid (DHA)-Producing Microalga, plant gene expression' Plant Cell Reports 14:403-406. Isochrysis galbana.” Federation of European Biochemical Societies Nishizawa et al. (2003) “A C-terminal sequence of soybean Letters, 510(3): 159-165. b-conglycinin a' Subunit acts as a vacuolar sorting determinant in Qi, et al., (2004) “Production of Very Long Chain Polyunsaturated Seed cells' Plant J. 34:647-659. Omega-3 and Omega-6 Fatty Acids in Plants', Nature Biotechnol Okuley at al. Arabidopsis FAD2 Gene Encodes the Enzyme that is ogy 22:739-745 (published online May 16, 2004). Essential for Polyunsaturated Lipid Synthesis. Plant Cell, 1994, Qiu, X. Reed, D. W., Hong, H., MacKenzie, S. L., & Covello, P. S. 6:147-158. (2001). Identification and analysis of a gene from Calendula Ohlrogge and Browse (1995) “Lipid Biosynthesis' Plant Cell officinalis encoding a fatty acid conjugase. Plant Physiology, 125, 7.957-97O. 847-855. Ohlrogge and Jaworski (1997) Regulation of Fatty Acid Synthesis. Qiu, X., et al., (2001) “Identification of a A4 Fatty Acid Desaturase Annu Rev Plant Physiol Plant Mol Biol. 48: 109-136. From Thraustochytrium sp. Involved in the Biosynthesis of Ow et al. (1986) “Transient and Stable Expression of the Firefly Docosahexanoic Acid by Heterologous Expression in Sac Luciferase Gene in Plant Cells and Transgenic Plants' Science charomyces cerveisiae and Brassica juncea.” The Journal of Bio 234:856-859. logical Chemistry, 276(34): 31561-31566. US 9,725,399 B2 Page 6

(56) References Cited Sayanova et al. (2006) A bifunctional Delta12.Delta 15-desaturase from Acanthamoeba castellanii directs the synthesis of highly OTHER PUBLICATIONS unusual n-1 series unsaturated fatty acids, J Biol Chem 281: 36533-36541. Reddy, A.S., et al., (1993) “Isolation of a A6-Desaturase Gene From Sayanova et al. (2006) Identification of Primula "front-end” the Cyanobacterium synechocystis sp. Strain PCC6803 by Gain-of desaturases with distinct n-6 or n-3 Substrate preferences, Planta Function Expression in Anabaena sp. Strain PCC7120.” Plant 224:1269-1277. Molecular Biology, 27: 293-300. Sayanova, O. Haslam, R., Caleron, M. V., & Napier, J. A. (May Riddervold et al (2002) “Biochemical and molecular 2007). Cloning and characterization of unusual fatty acid characterization of house cricket (Acheta domesticus, Orthoptera: desaturases from Anemone leveillei: identification of an acyl-coen Gryllidae) A9 desaturase' Insect Biochemistry and Molecular Biol Zyme A Co A-desaturase responsible for the synthesis of sciadonic ogy 32, 1731-1740. acid. Plant Physiology, 144, 455-467. Robert et al., Metabolic engineering of Arabidopsis to produce Sayanova et al., The role of delta (6)-desaturase acyl-carrier speci nutritionally important DHA in seed oil, Functional Plant Biology, ficity in the efficient synthesis of long-chain polyunsaturated fatty acids in transgenic plants. Plant Biotechnology Journal. (2012) 2005, vol. 32, p. 473–479 (Abstract Only). 10:195-206. Robert et al. (2009) Isolation and characterisation of a delta5-fatty Schubert et al. (2004) “Silencing in Arabidopsis T-DNA acid elongase from the marine microalga Pavlova Saline, Marine Transformants: The Predominant Role of a Gene-Specific RNA Biotech 11:410-418. Sensing Mechanism versus Position Effects' Plant Cell 16:2561 Rodriguez, S., Hao, G., Liu, W., Pina, B., Rooney, A. P. Camps, 2572. F. . . . Fabrias, G. (2004). Expression and evolution of A and A' Sen et al., (2007) Developments in Directed Evolution for Improv desaturase genes in the moth Spodoptera littoralis. Insect Biochem ing Enzyme Functions. Appl Biochem Biotechnol. 143:212-223. istry and Molecular Biology, 34, 1315-1328. Serra, M., Gauthier, L. T., Fabrias, G., & Buist, P. H. (2006). A' Romero et al... An epoxygenase metabolite of arachidonic acid 5.6 desaturases of Trichoplusia ni and Spodoptera littoralis exhibit dual epoxy-eicosatrienoic acid mediates angiotensin-induced natriuresis catalytic behaviour. Insect Biochemistry and Molecular Biology, 36. in proximal tubular epithelium. Advances in Prostaglandin, 822-825. Thromboxane and Leukotriene Research, 1991, 21:205-208. Shanklin, J., & Cahoon, E. B. (1998). Desaturation and related Rose et al. (1998) “Consensus-degenerate hybrid oligonucleotide modifications of fatty acids. Annu. Rev. Plant Physiol. Plant Mol. primers for amplification of distantly related sequences' Nucleic Biol. 49, 611-641. Acids Res. 26:1628-1635. Shanklin et al.. Eight histidine residues are catalytically essential in Ruiz-Lopez et al. (2012) “Enhancing the accumulation of omega-3 a membrane-associated iron enzyme, Stearoyl-coa desaturase, and long chain polyunsaturated fatty acids in transgenic Arabidopsis are conserved in alkane hydroxylase and Xylene monooxygenase. Biochemistry, 1994, 33:12787-12794. thaliana via iterative metabolic engineering and genetic crossing Shippy, R., et al., (1999) “The Hairpin Ribozyme Discovery, Transgenic Res, 21:1233-1243. Mechanism, and Development for Gene Therapy,” Molecular Bio Ruiz-López et al., (2012) Metabolic engineering of the omega-3 technology, 12(1): 117-129. long chain polyunsaturated fatty acid biosynthetic pathway into Shocket et al., Tung tree DGAT1 and DGAT2 have nonredundant transgenic plants. Journal of Experimental Botany, 63(7): 2397 functions in triacylglycerol biosynthesis and are localized to differ 2410. ent subdomains of the endoplasmic reticulum. Plant Cell, 2006, Ryckebosch et al. (2012) “Microalgae as an alternative source of 18:2294-2313. omega-3 long chain polyunsaturated fatty acids' Lipid Technology, Simopoulos, A.P. (2000) “Symposium: Role of Poultry Products in 24(6): 128-130. Enriching the Human Diet With N-3 PUFA. Poultry Science, 79: Saito, T., et al., (2000) “A Second Functional A5 Fatty Acid 961-970. Desaturase in the Cellular Slime Mould Dictyostelium discoideum.” Simopoulus, A. P. (2000). Human requirement for N-3 polyunsatu European Journal of Biochemistry, 267(6): 1813-1818. rated fatty acids. Poultry Science, 79(7), 961-970. Sato et al. (2004) Production of gamma-Linolenic Acid Stearidonic Singh, S., et al., (2001) "Transgenic Expression of A A 12 Acid in Seeds of Marker-Free Transgenic Soybean, CropSci. 44: Epoxygenase Gene in Arabidopsis Seeds Inhibits Accumulation of 646-652. Linoleic Acid, Planta, 212: 872-879. Saha et al. (2006) “Cytosolic Triacylglycerol Biosynthetic Pathway Singh et al. (2005) Metabolic engineering of new fatty acids in in Oilseeds. Molecular Cloning and Expression of Peanut Cytosolic plants, Curr. Opin. in Plant Biol. 8:197-203. Diacylglycerol Acyltransferase' Plant Physiol. 141: 1533-1543. Slater et al., Metabolic engineering of Arabidopsis and Brassica Sakuradani, E., et al., (1999) “A6-Fatty Acid Desaturase From an poly(3-hydroxybutyrate-co-3-hydroxyvalerate) copolymer pro Arachidonic Acid-Producing Mortierella Fungus. Gene Cloning and duction, Nature Biotechnology, Oct. 1999, vol. 12, 1011-1016. Its Heterologous Expression in a Fungus, Aspergillus, Gene, Smith, N. A., et al., (2000) "Total Silencing By Intron-Spliced Hairpin RNAs.” Nature, 407(6802): 319-320. 238(2): 445-453. Smith, C. R., Jr. (1971). Occurrence of unusual fatty acids in plants. Sakuradani et al (2005) “A novel fungal (O3-desaturase with wide Progress in the Chemistry of Fats and Other Lipids, 11, 137. Substrate specificity from arachidonic acid-producing Mortierella 139-177. alpina 1S-4” Appl Microbiol Biotechnol 66: 648-654. Smith, M. A., Moon, H., Chowrira, G., & Kunst, L. (2003). Sayanova, O.V., et al., (1997) “Expression of a Borage Desaturase Heterologous expression of a fatty acid hydroxylase gene in devel cDNA Containing an N-Terminal Cytochrome b5 Domain Results oping seeds of Arabidopsis thaliana. Planta, 217. 507-516. in the Accumulation of High Levels of A6-Desaturated Fatty Acids Speranza and Macedo (2012) 'Lipase-mediated production of spe in Transgenic Tobacco.” Proceedings of the National Academy of cific lipids with improved biological and physicochemical proper Sciences of the United States of America, 94(8): 4211-4216. ties” Process Biochemistry 47, 1699-1706. Sayanova, O.V., et al., (1999) “Histidine-41 of the Cytochrome b5 Sperling, P. et al., (2000) “A Bifunctional A6-Fatty Acyl Domain of the Borage A6 Fatty Acid Desaturase is Essential for Acetylenase/Desaturase From the Moss Ceratodon purpureus,' Enzyme Activity.” Plant Physiology, 121(2): 641-646. European Journal of Biochemistry, 267(12): 3801-3811. Sayanova, O.V., et al., (2003) “Identification of Primula Fatty Acid Sperling, P. and Heinz, E., (2001) "Desaturases Fused to Their A6-Desaturases with n-3 Substrate Preferences.' Federation of Electron Donor.” European Journal of Lipid Science and Technol European Biochemical Societies, 542: 100-10. ogy, 103(3): 158-180. Sayanova, O.V. and Napier, J.A. (2004) “Eicosapentaenoic Acid: Sperling et al. (2001) Functional identification of a delta8 Biosynthetic Routes and the Potential for Synthesis in Transgenic sphingolipid desaturase from Borago officinalis, Arch. Biochm. Plants.” Phytochemistry, 65(2): 147-158. Biophys. 388:293-8. US 9,725,399 B2 Page 7

(56) References Cited Untergasser et al. (2012) "One-Step Agrobacterium Mediated Transformation of Eight Genes Essential for Rhizobium Symbiotic OTHER PUBLICATIONS Signaling Using the Novel Binary Vector System pHUGE”. PLoS One, vol. 7, No. 10, e47885. Sprecher, H., et al., (1995) “Reevaluation of the Pathways for the Valvekens, D., et al., (1988) “Agrobacterium tumefaciens-Mediated Biosynthesis of Polyunsaturated Fatty Acids,” Journal of Lipid Transformation of Arabidopsis thaliana Root Explants by Using Research, 36(12): 2471-2477. Kanamycin Selection.” Proceedings of the National Academy of Spychalla, J.P. et al., (1997) “Identification of an animal omega-3 Sciences of the United States of America, 85(15) 5536-5540. Fatty Acid Desaturase by Heterologous Expression in Arabidopsis,” van de Loo, F. J., Broun, P., Turner, S., & Somerville, C. (Jul. 1995). Proceedings of the National Academy of Sciences of the United An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl States of America, 94(4): 1142-1147. Stålberg, K., et al., (1993) "Deletion Analysis of a 2S Seed Storage desaturase homolog. Proc. Natl. Acad. Sci. USA. 92, 6743-6747. Protein Promoter of Brassica napus in Transgenic Tobacco.” Plant Venegas-Calerón etal (2010) “An alternative to fish oils: Metabolic Molecular Biology, 23(4): 671-683. engineering of oil-seed crops to produce omega-3 long chain Stalker et al (1988) “Purification and Properties of a Nitrilase polyunsaturated fatty acids' Progress in Lipid Research 49, 108 Specific for the Herbicide Bromoxynil and Corresponding Nucleo 119. tide Sequence Analysis of the bXn Gene” J. Biol. Chem. 263:6310 Voinnet et al., (2003) “An enhanced transient expression system in 6314. plants based on Suppression of gene silencing by the p19 protein of Stanley-Samuelson et al (1998) “Fatty Acids in Insects: Composi tomato bushy stunt virus' Plant J. 33:949-956. tion, Metabolism, and Biological Significance' Archives of Insect Volkman, J.K., et al., (1989) “Fatty Acid and Lipid Composition of Biochemistry and Physiology 9:1-33. 10 Species of Microalgae Used in Mariculture,” Journal of Experi Stukey, J. E., McDonough, V. M., & Martin, C. E. (1990). The mental Marine Biology and Ecology, 128(3): 219-240. OLE1 gene of Saccharomyces cerevisiae encodes the A9 fatty acid Vrinten et al. (2013) Biosynthesis of Long Chain Polyunsaturated desaturase and can be functionally replaced by the rat Stearoyl-CoA Fatty Acids in the Marine Ichthyosporean Sphaeroforma arctica. desaturase gene. The Journal of Biological Chemistry, 265(33), Lipids, 48:263-274. 20144-20149. Wada et al (1993) “The desA Gene of the Cyanobacterium Sujatha and Sailaja, Stable genetic transformation of castor (Ricinus synechocystis sp. Strain PCC6803 is the Structural Gene for A12 communis L.) via Agrobacterium tumefaciens-mediated gene trans Desaturase” Journal of Bacteriology 175(18):6056-6058. fer using embryo axes from mature seeds. Plant Cell Rep. 2005, 23:803-810. Wagner et al. (1992) "Coupling of adenovirus to transferrin Stymine, S., & Appelqvist, L. (1978). The biosynthesis of linoleate polylysine/DNA complexes greatly enhances receptor-mediated from oleoyl-CoA via oleoyl-phosphatidylcholine in microsomes of gene delivery and expression of transfected genes' Proc. Natl. Acad. developing safflower seeds. Eur: J. Biochem, 90, 223-229. Sci., USA 89:6099-6103. Suiyun et al. (2004) “Introgression of Salt-tolerance from somatic Wallis, J.G. and Browse, J., (1999) “The A8-Desaturase of Euglena hybrids between common wheat and Thinopyrum ponticum” Plant gracilis: An Alternate Pathway for Synthesis of 20-Carbon Polyun Science 773-779. saturated Fatty Acids.” Archives of Biochemistry and Biophysics, Takeyama, H., et al., (1997) “Expression of the Eicosapentaenoic 365(2): 307-316. Acid Synthesis Gene Cluster From Shewanella sp. in a Transgenic Wang, M.B., et al., (1997) “Intron-Mediated Improvement of a Marine Cyanobacterium, Synechococcus sp.” Microbiology, 143(Pt Selectable Marker Gene for Plant Transformation Using 8): 2725-2731. Agrobacterium Tumefaciens,” Journal of Genetics & Breeding, 51: Thompson, J. D., Gibson, T. J. Plewniak, F. Jeanmougin, F. & 325-334. Higgins, D. G. (1997). The CLUSTAL X windows interface: Wang and Hildebrand (1988) “Biosynthesis and Regulation of flexible strategies for multiple sequence alignment aided by quality Linolenic Acid in Higher Plants' Plant Physiol. Biochem. 26(6), analysis tools. Nucleic Acids Research, 25(24), 4876-4882. 777-792 Thillet et al (1988) "Site-directed Mutagenesis of Mouse Waterbury, J.B. and Willey, J.M., (1988) “Isolation and Growth of Dihydrofolate Reductase” J. Biol. Chem 263:12500-12508. Marine Planktonic Cyanobacteria.” Methods of Enzymology, 167: Tanaka, M., et al., (1999) “Isolation of Clustered Genes That Are 100-105. Notably Homologous to the Eicosapentaenoic Acid Biosynthesis Waterhouse, P.M., et al., (1998) “Virus Resistance and Gene Silenc Gene Cluster From the Docosaehexaenoic Acid-Producing Bacte ing in Plants Can Be Induced by Simultaneous Expression of Sense rium vibrio marinus Strain MP-1.” Biotechnology Letters, 21 (11): and Antisense RNA.” Proceedings of the National Academy of 939-945. Sciences of the United States of America. 95(23): 13959-13964. Tonon, T., et al., (2003) “Identification of a Very Long Chain Watts, J.L. and Browse, J., (1999) “Isolation and Characterization of Polyunsaturated Fatty Acid A4-Desaturase From the Microalga a A5-Fatty Acid Desaturase From Caenorhabditis elegans.” Pavlova lutheri.” Federation of European biochemical Societies, Archives of Biochemistry and Biophysics, 362(1): 175-182. 553(3): 440-444. Watts and Browse (1999b) “A Palmitoyl-CoA-Specific A9 Fatty Toriyama et al., Haploid and diploid plant regeneration from Acid Desaturase from Caenorhabditis elegans' Arch. Biochem. protoplasts of anther callus in rice. Theor Appl Genet, 1986, Biophys. 362:175-182. 73:16-19. Williams, J.G.K. and Szalay, A.A. (1983) "Stable Integration of Trautwein, E.A. (2001) “n-3 Fatty Acids—Physiological and Tech Foreign DNA Into the Chromosome of the Cyanobacterium nical Aspects for Their Use in Food.” European Journal of Lipid synechococcus R2,” Gene, 24(1): 37-51. Science and Technology, 103(1): 45-55. Whitney et al (2003) “Functional characterisation of two Truksa et al., (2006) “Metabolic Engineering of Plants to Produce cytochrome b5-fusion desaturases from Anemone leveillei : the Very Long-Chain Polyunsaturated Fatty Acids'. Transgenic unexpected identification of a fatty acid A6-desaturase' Planta 217: Research, 15:131-137. 983-992. TsevegSuren et al., (2003) “Isomers of hexadecenoic and Whittle, E., Cahoon, E. B., Subrahmanyam, S., & Shanklin, J. hexadecadienoic acids in Androspace Septentrionalis (Primulaceae) (2005). A multifunctional acyl-acyl carrier protein desaturase from seed oil” Lipids 38(11): 1173-1178. Hedera helix L. (English ivy) can synthesize 16- and 18-carbon Tvrdik, P. et al., (2000) “Role of a New Mammalian Gene Family monoene and diene products. The Journal of Biological Chemistry, in the Biosynthesis of Very Long Chain Fatty Acids and 280(31), 28.169-28176. Sphingolipids.” The Journal of Cell Biology, 149(3): 707-717. Wolff, R. L., et al., (1999) “Arachidonic Eicosapentaenoic, and Tzfira & Citovsky (2006) “Agrobacterium-mediated genetic trans Biosynthetically Related Fatty Acids in the Seed Lipids from a formation of plants: biology and biotechnology”. Curr. Opin. Bio Primitive Gymnosperm. Agathis robusta” Lipids, 34(10): 1083 tech. 17:147-154. 1097. US 9,725,399 B2 Page 8

(56) References Cited Oct. 17, 2011 Response to Apr. 6, 2011 Communication from the Examining Division, filed in connection with European Application OTHER PUBLICATIONS No EPO573.3657.O. Sep. 24, 2012 Response to Mar. 14, 2012 Communication from the Wood (2009) A leaf-based assay using interchangeable design Examining Division, filed in connection with European Application principles to rapidly assemble multistep recombinant pathways, No EPO573.3657.O. Plant Biotechnol J. 7:914-24. Communication from the Examining Division issued by the Euro Wu et al. (2005) Stepwise engineering to produce high yields of pean Patent Office on Nov. 9, 2012 in connection with European very long-chain polyunsaturated fatty acids in plants, Nat. Biotech. Patent Application No. 05733.657.0. 23:1013-1017. Jan. 3, 2013 Response, filed in connection with European Patent Yang at al. (2003) “Expression and localization of human lysozyme Application No. 05733.657.0. in the endosperm of transgenic rice' Planta 216:597-603. May 16, 2013 Response filed in connection with European Patent Yazawa, K., (1996) “Production of Eicosapentaenoic Acid From Application No. 05733.657.0. Aug. 20, 2015 Communication of a Notice of Opposition, issued in Marine Bacteria.” Lipids, 31: S297-300. connection with European Patent Application No. 05733.657.0. Yu, R., et al., (2000) “Production of Eicosapentaenoic Acid by a including a list of documents cited by the Opponent. Recombinant Marine Cyanobacterium, Synechococcus sp., Lipids, Apr. 5, 2013 Response filed in connection with European Patent 35(10): 1061-1064. Application No. 10184533.7. Zank, T.K., et al., (2002) “Cloning and Functional Characterization European Search Report, issued by the European Patent Office on of an Enzyme Involved in the Elongation of A6-Polyunsaturated Jul. 15, 2011 in connection with European Patent Application No. Fatty Acids From the Moss Physcomitrella patens.” The Plant 111552824. Journal, 31(3): 255-268. Extended European Search Report, issued by the European Patent Zhang et al. (2006) “Cucumber mosaic virus-encoded 2b suppressor Office on Oct. 25, 2011 in connection with European Patent Appli inhibits Arabidopsis argonautel cleavage activity to counter plant cation No. 111552824. defense” Genes & Development 20:3255-3268. Sep. 7, 2012 Amendment after receipt of European Search Report, Zhang, Q., et al. (2004) “Identification and Characterization of a filed in connection with European Patent Application No. 11155282. Novel A6-Fatty Acid Desaturase Gene From Rhizopus arrhizus.” 4. Federation of European Biochemical Societies Letters, 556(1-3): Mar. 11, 2013 Office Action, issued in connection with European 81-85. Patent Application No. 111552824. Zhang et al. (2007a) Identification of a novel bifunctional delta12/ Dec. 27, 2013 Response, filed in connection with European Patent delta15 fatty acid desaturase from a basidiomycete, Coprinus Application No. 111552824. cinereus TD#822-2, FEBS Letters 581: 315-319. Aug. 21, 2014 Examination Report, issued in connection with European Patent Application No. 111552824. Zhang et al. (2008) Identification and characterization of a novel Jun. 26, 2015 Response to Examination Report filed in connection yeast omegas-fatty acid desaturase acting on long-chain n-6 fatty with European patent application 11155282.4. acid substrates from Pichia pastoris, Yeast 25: 21-27. European Search Report, issued by the European Patent Office on Zhou, X. and Christie, P.J., (1997) “Suppression of Mutant Pheno Jul. 15, 2011 in connection with European Patent Application No. types of the Agrobacterium tumefaciens VirB11 ATPase by Over 111553640. production of VirB Proteins,” Journal of Bacteriology, 179(18): Extended European Search Report, issued by the European Patent 5835-5842. Office on Oct. 25, 2011 in connection with European Patent Appli Zhou et al. (2007) “Isolation and characterization of genes from the cation No. 111553640. marine microalga Pavlova Salina encoding three front-end Sep. 10, 2012 Amendment after receipt of European Search Report, desaturases involved in docosahexaenoic acid biosynthesis' filed in connection with European Patent Application No. 11155364. Phytochemistry 68,785-796. O. Zhou et al (2008) “Isolation and functional characterization of two Feb. 13, 2013 OfficeAction issued in connection with European independently-evolved fatty acid A12-desaturase genes from Patent Application No. 111553640. insects' Insect Molecular Biology 17(6), 667-676. Dec. 4, 2013 Response, filed in connection with European Patent Zhou, X., Robert, S. Singh, S., & Green, A. (2005). Heterologous Application No. 111553640. production of GLA and SDA by expression of an Echium Aug. 13, 2014 Examination Report, issued in connection with plantagineum A6-desaturase gene. Plant Science, 170, 665-673. European Patent Application No. 111553640. Zipfel et al. (2006) “Perception of the Bacterial PAMPEF-Tu by the European Search Report, issued by the European Patent Office on Receptor EFR Restricts Agrobacterium-Mediated Transformation” Oct. 25, 2011 in connection with European Patent Application No. Ce11 125:749-760. 11155266.7. Notification of European publication number issued Jan. 31, 2007 in Extended European Search Report and Opinion issued Feb. 10, connection with European Patent Application No. 0573.3657.0. 2012 in connection with corresponding European Divisional Patent Supplementary European Search Report issued Apr. 1, 2008 in Application No. 11155266.7. connection with European Patent Application No. 0573.3657.0. Rule 69 EPC Communication issued Mar. 19, 2012 in connection Commincation Pursuant to Article 94(3) EPC issued Feb. 12, 2009 with European Divisional Patent Application No. 11155266.7. in connection with European Patent Application No. 0573.3657.0. Jan. 3, 2013 Response filed in connection with European Patent Response to Communication from the Examining Division, filed Application No. 11155266.7. Oct. 22, 2009 in connection with European Application No. EP Examination Report, issued by the Australian Patent Office on Sep. O573.3657.O. 6, 2012 in connection with Australian Patent Application No. Communication from the Examining Division issued by the Euro 2O11232757. pean Patent Office on Aug. 18, 2010 in connection with European Sep. 6, 2013 Response to Australian Examination report, filed in Application No. EP 05733657.0. connection with Australian Patent Application No. 2011232757. Response to Communication from the Examining Division, filed Jan. 9, 2014 Office Action, issued in connection with Australian Feb. 3, 2011 in connection with European Application No. EP Patent Application No. 2013204296. O573.3657.O. Jul. 1, 2015 Response to second Office Action, filed in connection Communication from the Examining Division issued by the Euro with Australian Patent Application No. 2013204296. pean Patent Office on Apr. 6, 2011 in connection with European May 8, 2015 Response to Office Action, filed in connection with Application No. EP 05733657.0. Vietnamese Patent Application No. 1-2015-00134. Examination Report issued Mar. 14, 2012 in connection with Aug. 13, 2013 Response to Chinese Office Action, filed in connec corresponding European Patent Application No. 0573.3657.0. tion with Chinese Patent Application No. 2012 100061398. US 9,725,399 B2 Page 9

(56) References Cited Nov. 1, 2013 Office Action, issued in connection with Canadian Patent Application No. 2,563,875. OTHER PUBLICATIONS May 1, 2014 Response to Examination Report, filed in connection with Canadian Patent Application No. 2,563,875. Australian Examination Report issued Nov. 16, 2009 in connection Mar. 29, 2012 Extended European Search Report and Search with Australian Patent Application No. 2005235627. Opinion issued in connection with European Patent Application No. Australian Examination Report issued Mar. 14, 2011 in connection O9827O358. with Australian Patent Application No. 2005235627. Oct. 29, 2012 Response to European Search Opinion filed in Response to Australian Examination Report filed Feb. 25, 2011 in connection with European Patent Application No. 09827035.8. connection with Australian Patent Application No. 2005235627. Apr. 11, 2014 Response to Examination Report, filed in connection Response to Australian Examination Report filed Apr. 19, 2011 in with European Patent Application No. 09827035.8. connection with Australian Patent Application No. 2005235627. Jul. 10, 2014 Third Party Observations, filed in connection with Australian Examination Report issued May 16, 2011 in connection European Patent Application No. 09827035.8. Apr. 7, 2015 Response to the Oct. 13, 2014 Office Action filed in with Australian Patent Application No. 2005235627. connection with European patent application 09827035.8. Response to Australian Examination Report filed Jun. 14, 2011 in Aug. 13, 2015 Third Examination Report European Patent Appli connection with Australian Patent Application No. 2005235627. cation No. 098.27035.8. Chinese Examination Report issued Apr. 10, 2009 in connection Jan. 21, 2016 Response, filed in connection with European Patent with Chinese Patent Application No. 20058.0020696.3. Application No. EP09827035.8. Response to Chinese Examination Report filed Jul. 21, 2009 in Jun. 16, 2016 Summons to Oral Proceedings, issued in connection connection with Chinese Patent Application No. 20058.0020696.3. with European Patent Application No. 09827035.8. Chinese Examination Report issued Apr. 30, 2010 in connection Jun. 8, 2012 Australian Examination Report issued in connection with Chinese Patent Application No. 20058.0020696.3. with Australian Patent Application No. 20093.17860. Response to Chinese Examination Report filed Sep. 15, 2010 in Dec. 9, 2013 Response filed in connection with Australian Patent connection with Chinese Patent Application No. 20058.0020696.3. Application No. 2009317860. Nov.30, 2011 Request for Re-Examination filed in connection with Jan. 15, 2014 Office Action issued in connection with Australian Chinese Patent Application No. 20058.0020696.3, including English Patent Application No. 20093.17860. language translation of Submitted claims. Feb. 7, 2014 Response filed in connection with Australian Patent Aug. 18, 2011 Decision of Rejection issued by the Chinese Patent Application No. 2009317860. Office in connection with Chinese Patent Application No. Jan. 22, 2014 Office Action, issued in connection with Australian 200580020696.3 Patent Application No. 2013204254. Response to Notification of Re-Examination filed on Oct. 18, 2012 Jan. 22, 2014 Office Action, issued in connection with Australian in connection with Chinese Patent Application No. 20058.0020696. Patent Application Nc. 2013204270. 3, including English language. Mar. 19, 2015 Response to First Examination Report filed in Oct. 18, 2012 Request for Reexamination filed in connection with connection with Australian Patent Application No. 2013204270. Chinese Patent Application No. 20058.0020696.3. Sep. 10, 2013 Office Action issued in connection with Chilean Jan. 29, 2013 Office Action issued in connection with Chinese Patent Application No. 1162-2011. Patent Application No. 2012 10006139.8. Dec. 19, 2013 Response filed in connection with Chilean Patent Aug. 13, 2013 Response to Chinese Office Action, filed in connec Application No. 1162-2011, including English Language. tion with Chinese Patent Application No. 2012 10006139.8. Jul. 22, 2014 Office Action, issued in connection with Chilean Nov. 21, 2013 Office Action, issued in connection with Chinese Patent Application No. 1162-2011, including English language. Patent Application No. 2012 10006139.8. Jan. 14, 2013 Chinese First Office Action issued in connection with Jun. 25, 2014 Third Office Action, issued in connection with Chinese Patent Application No. 200980 154876.9. Chinese Patent Application No. 2012 10006139.8, including English Sep. 16, 2013 Office Action issued in connection with Chinese language translation. Patent Application No. 200980 154876.9. Jan. 20, 2015 Response to Office Action, filed in connection with May 21, 2014 Chinese Third Office Action, issued in connection Chinese patent application 2012 10006139.8. with Chinese Patent Application No. 200980 154876.9. Aug. 10, 2015 Fifth Office Action issued in connection with Chinese Mar. 9, 2015 Response to Office Action filed in connection with Patent Application No. 2012 10006139.8, including English lan Chinese Patent Application 200980 154876.9, including Engligh guage translation. language translation. Aug. 6, 2014 First Office Action, issued in connection with Chinese Jul. 6, 2015 Chinese Fifth Office Action issued in connection with Patent Application No. 2013 10392524.5. Chinese Patent Application No. 200980 154876.9, including English Dec. 22, 2014 Response, filed in connection with Chinese Patent language translation. Application No. 2013 10392524.5. Jan. 27, 2016 Decision of Rejection, issued in connection with Mar. 30, 2015 Second Office Action, issued in connection with Chinese Patent Application No. 200980 154876.9, including English Chinese Patent Application No. 2013 10392524.5, including English Language Translation. language translation. Jun. 22, 2011 New Zealand Examination Report issued in connec May 22, 2015 Response to Second Office Action, issued in con tion with New Zealand Patent Application No. 593,097. nection with Chinese Patent Application No. 2013 10392524.5. Dec. 11, 2012 Response to New Zealand Examination Report filed Sep. 7, 2015 Decision of Reject, issued in connection with Chinese in connection with New Zealand Patent Application No. 593,097. Patent Application No. 201310392524.5, including English lan Jan. 3, 2013 New Zealand Examination Report issued in connection guage translation. with New Zealand Patent Application No. 593,097. Brazilian Technical Opinion issued Mar. 1, 2012 in connection with Jan. 8, 2013 Response to New Zealand Examination Report filed in corresponding Brazilian Patent Application No. PI 0510132-8. connection with New Zealand Patent Application No. 593,097. Response filed to Brazilian Technical Opinion filed Mar. 29, 2012 May 13, 2014 First Japanese Office Action, issued in connection in connection with corresponding Brazilian Patent Application No. with Japanese Patent Application No. 2011-535.839. PI 0510132-8. Aug. 13, 2014 Response to First Japanese Office Action, filed in Nov. 21, 2011 Examination report issued in connection with Cana connection with Japanese Patent Application No. 2011-535.839. dian Patent Application No. 2,563,875. Mar. 3, 2015 Office Action, issued in connection with Japanese May 22, 2012 Response to Examination Report, filed in connection application 2011-535.839, including English language translation. with Canadian Patent Application No. 2,563,875. Nov. 2, 2015 Pretrial reexamination report, issued in connection Nov. 23, 2012 Office Action issued in connection with Canadian with Japanese Patent Application No. 2011-535.839, including Eng Patent Application No. 2,563,875. lish language translation. US 9,725,399 B2 Page 10

(56) References Cited marine gene discovery to Sustainable sources of health-benefitting oils' presented by Peter Nichols, first author, Peter Nichols, 21 OTHER PUBLICATIONS slides. Jul. 13, 2012 presentation at the 20th International conference on Supplemental European Search Report and Search Opinion issued plant lipids at Seville, Spain, entitled "Metabolic engineering plant Jun. 24, 2010 in connection with European Patent Application No. seeds with fish oil-like levels of DHA’ presented by James Petrie, O7784.864.6. first author, James Petrie, 41 slides. Response filed to European Search Opinion on Jan. 19, 2011 in Jul. 16, 2012 presentation at the Australian Institute of Food Science connection with European Patent Application No. 07784864.6. and Technology, Annual Meeting, 2012 at Adelaide, Australia, European Examination Report issued Jul. 18, 2011 in connection entitled “New Sustainable land plant sources of long-chain omega-3 with European Patent Application No. 07784864.6. oils' presented by Peter Nichols, first author, Peter Nichols, 26 Response filed to European Examination Report on May 15, 2012 slides. in connection with European Patent Application No. 07784864.6. Aug. 2, 2012 presentation at the UniGateway, Business breakfast Written Submissions, Amended description pages, Main and AR1 series at Melbourne, Australia, entitled “Trends and sustainability of claims filed Sep. 4, 2014 in relation to corresponding European LC omega-3 oils from wild and farmed fish, and Progress with new Patent Application No. 07784864.6. land plant sources' presented by Peter Nichols, first author, Peter Result of Consultation from EPO dated Sep. 15, 2014 in relation to Nichols, 10 slides. corresponding European Patent Application No. 07784864.6. Sep. 26, 2012 presentation at the ComBio-Plants and Human Revised written submissions filed Sep. 16, 2014 in relation to Nutrition Symposium, 2012 at Adelaide, Australia, entitled “Creat corresponding European Patent Application No. 07784864.6. ing Land Plant-Based Sustainable Sources of Essential Long Chain Amended claims filed Sep. 16, 2014 in relation to corresponding Omega-3 Fatty Acids' presented by Peter Nichols, first author, European Patent Application No. 07784864.6. James Petrie, 24 slides. Apr. 1, 2015 Summons to Oral Proceedings, issued in connection Oct. 9, 2012 presentation at the Invited seminar, Department of with European Patent Application No. 07784864.6. Plant Science, University of Tasmania at Hobart, Australia, entitled Australian Examination Report issued Jul. 25, 2012 in connection “The Omega-3 Oils story—Sources of Long-chain Omega-3: A with Australian Patent Application No. 2007291937. Sustainable Future” presented by Peter Nichols, first author, Peter Aug. 1, 2014 Response to First Canadian Office Action, filed in Nichols, 39 slides. connection with Canadian Patent Application No. 2,661,697. Nov. 14, 2012 presentation at the Novel sources of omega-3, Feb. 4, 2014 Office Action, issued in connection with Canadian Copenhagen 2012 at Copenhagen, Denmark, entitled "Metabolic Patent Application No. 2,661,697. engineering plant seeds with fish oil-like levels of DHA’ presented Aug. 22, 2014 Office Action, issued in connection with Canadian by James Petrie, first author, James Petrie, 35 slides. Patent Application No. 2,661,697. Mar. 13, 2013 presentation at the Invited seminar, The Biological New Zealand Examination Report issued Jul. 29, 2010 in connec Club, Hobart at Hobart, Australia, entitled “The Omega-3 Oils tion with New Zealand Patent Application No. 575809. story—Sources of Long-chain Omega-3: A Sustainable Future” Response filed to New Zealand Examination Report filed Dec. 23. presented by Peter Nichols, first author, Peter Nichols, 39 slides. 2011 in connection with New Zealand Patent Application No. International Search Report issued Jun. 23, 2005 in connection with 575809. PCT International Application No. PCT/AU05/000571, filed Apr. New Zealand Examination Report issued Jan. 24, 2012 in connec 22, 2005. tion with New Zealand Patent Application No. 575809. Written Opinion issued Jun. 23, 2005 in connection with PCT Chinese Office Action issued May 17, 2011 in connection with International Application No. PCT/AU2005/000571, filed Apr. 22, Chinese Patent Application No. 200780040245.5, including English 2005. Language translation. International Search Report issued Nov. 21, 2007 in connection with Response filed to Chinese Office Action on Nov. 30, 2011 in International Application No. PCT/AU200700 1242, filed Aug. 29. connection with Chinese Patent Application No. 200780040245.5, 2007 (CSIRO). including English Language translation of claims. PCT International Preliminary Report on Patentability issued Oct. Second Chinese Office Action issued Jun. 6, 2012 in connection 25, 2006 for PCT International Application Publication No. WO with Chinese Patent Application No. 200780040245.5, including 2005, 103253. English Language translation. Written Opinion of the International Searching Authority issued Response filed to Second Chinese Office Action on Oct. 22, 2012 in Nov. 21, 2007 in connection with International Application No. connection with Chinese Patent Application No. 200780040245.5. PCT/AU200700 1242, filed Aug. 29, 2007 (CSIRO). Third Chinese Office Action issued Feb. 17, 2013 in connection with Supplementary European Search Report, issued Feb. 5, 2016 in Chinese Patent Application No. 200780040245.5, including English connection with European Patent Application No. 13803782.5. Language translation. Feb. 23, 2016 Communication, issued in connection with European Response filed to Chinese Office Action on Jul. 4, 2013 in connec Patent Application No. 13803782.5. tion with Chinese Patent Application No. 200780040245.5. May 12, 2016 Response to the Feb. 23, 2016 Rule 70(2) and 70a(2) Feb. 23, 2015 First Examiner's Report, issued in connection with Communication, filed in connection with European Patent Appli Canadian Patent Application No. 2,884.237. cation No. 13803782.5. Nov. 25, 2015 Office Action, issued in connection with Canadian Jun. 1, 2016 Communication Pursuant to Article 94(3) EPC, issued Patent Application 2,743,880. in connection with European Patent Application No. 13803782.5. May 25, 2016 Response to Examiner's Report, filed in connection NCBI Nucleotide Database Accession No. GenBank DQ923084. with Canadian Patent Application 2,743,880. Ricinus communis type 2 acyl-CoA diacylglycerol acyltransferase Mar. 7, 2012 presentation at the CSIRO Marine and Atmospheric mRNA, complete cols. Published Sep. 1, 2007. Research. Science Forum, Hobart (poster presentation) at Hobart, NCBI Nucleotide Database Accession No. GenBank DQ356682, Australia, entitled “New Land Plants Containing Long-chain Vernicia fordii type 2 diacylglycerol acyltransferase (DGAT2) Omega-3 Oils' presented by Peter Nichols, first author, Peter mRNA, complete cols. Published Sep. 13, 2006. Nichols. Meyer et al. (2003) GenBank Accession No. AY278558, NCBI, pp. Jun. 8, 2012 presentation at the GOED Exchange at Boston, MA, 1-2. entitled "An Update from Australia: A Global Leader in Long-Chain Tonon et al. (2003) GenBank Accession No. AY332747, NCBI, pp. Omega-3” presented by Peter Nichols, first author, Peter Nichols, 34 1-2. slides. Qiu at al. (2001) GenBank Accession No. AF489589, NCBI, pp. Jul. 2, 2012 presentation at the Australian Marine Scientists Asso 1-2. ciation, Annual Meeting, 2012 at Hobart, Australia, entitled “New Thurmond at al. (2001) GenBank Accession No. AF3.91543, NCBI. Land Plants With Long-Chain Omega-3 Oils: A journey from pp. 1-2. US 9,725,399 B2 Page 11

(56) References Cited Leonard et al. (2000) GenBank Accession No. AF231981, NCBI. pp. 1-2. OTHER PUBLICATIONS Aki et al. (2001) GenBank Accession No. AB071985, NCBI, pp. 1-2. Cho at al. (1999) GenBank Accession No. AF199596, NCBI, pp. 1 Aki et al. (2001) GenBank Accession No. AB071986, NCBI, pp. 2. 1-2. Sanger Institute. (2003) GenBank Accession No. NM 069350, Tvrdik et al. (1999) GenBank Accession No. AF 170907, NCBI, pp. NCBI, pp. 1-4. 1-2. Knutzon et al. (1998) GenBank Accession No. AF067654, NCBI, Tvrdik et al. (1999) GenBank Accession No. AF 170908, NCBI, pp. pp. 1-2. 1-2. Hong at al. (2001) GenBank Accession No. AF419297, NCBI, pp. Agaba et al. (2004) GenBank Accession No. AF532782, NCBI, pp. 1-2. 1-2. Saito at al. (1999) GenBank Accession No. AB022097, NCBI, pp. Lo et al. (2003) GenBank Accession No. NM 199532, NCBI, pp. 1-2. 1-2. Wilkinson et al. (1996) GenBank Accession No. Z68749, NCBI, pp. Domergue et al. (2002) GenBank Accession No. AY082392, NCBI. 1-8. pp. 1-2. Mukerji et al. (2002) GenBank Accession No. AX464802, NCBI. Qiu et al. (2003) GenBank Accession No. AF489588, NCBI, pp. pp. 1. 1-2. Qi et al. (2001) GenBank Accession No. AF390.174, NCBI, pp. 1-2. Kajikawa et al. (2004) GenBank Accession No. AY583465, NCBI. GenBank accession AAF19262, Benveniste (1998). pp. 1-2. Genbank accession AAL37626, Qi et al. (2001). Stohr et al. (1998) GenBank Accession No. NM 013402, NCBI, GenBank accession AAM09687, Qiu et al. (2001). GenBank accession AAR20444, Periera et al. (2003). 3. (1999) GenBank Accession No. NM 019699, NCBI, pp. GenBank accession AAT85661, Kajikawa et al. (2004). GenBank accession AAV67797, Meyer et al. (2004). Suns et al. (1998) GenBank Accession No. Z70271, NCBI, GenBank accession AAV67799, Meyer et al. (2004). GenBank accession AAV67800, Meyer et al. (2004). Ava et al. (1996) GenBank Accession No. U79010, NCBI, pp. GenBank accession AAW70 157, Domergue and Heinz (2004). GenBank accession AAW70 159, Domergue and Heinz (2004). Mio et al. (2001) GenBank Accession No. AY055117, NCBI, pp. GenBank accession AAX 14505, Tonon et al. (2004). GenBank accession AAY15135, Zhou et al. (2005). Mio et al. (2001) GenBank Accession No. AY055118, NCBI, pp. GenBank accession AAY15136, Zhou et al. (2005). GenBank accession ABC18313, Huang and Jiang (2005). sanova et al. (2003) GenBank Accession No. AY234127, NCBI, GenBank accession ABC18314, Huang and Jiang (2005). pp. 1-2. GenBank accession ABL63813, Zhang et al. (2006). Sayanova et al. (2003) GenBank Accession No. AF536525, NCBI. Genbank accession ABL96296, Zhou et al. (2006). pp. 1-2. GenBank accession A6094747. Grigoriev et al. (2007). Sperling et al. (1999) GenBank Accession No. AJ250735, NCBI, GenBank accession ABP49078, Li et al. (2007). pp. 1-2. GenBank accession ABR67690, Niu at al. (2007). Kajikawa et al. (2004) GenBank Accession No. AY583463, NCBI. GenBank accession AY746357, Domergue and Heinz (2004). pp. 1-2. GenBank accession BAD 11952, Oura and Kajiwara (2003). Knutzon et al. (1998) GenBank Accession No. AF110510, NCBI. Genbank accession BAD91495, Sakuradani et al. (2004). pp. 1-2. GenBank accession CAD58540. Napier et al. (2002). Kobayashi et al. (1998) GenBank Accession No. AB020032, NCBI. GenBank accession CAI58897, Zank et al. (2005). GenBank accession CAJ30869, Cirpus et al. (2005). 3. al (2001) GenBank Accession No. AF419296, NCBI, pp. GenBank accession CAL23339, Cirpus et al. (2006). GenBank accession CAL55414. (2012). A. et al. (2000) GenBank Accession No. AB052086, NCBI, pp. GenBank accession CAM55882, Cirpus (2006). GenBank accession EDQ92231, Kuo et al. (2007). bing et al. (2003) GenBank Accession No. AY320288, NCBI, pp. GenBank accession XP 001416454. Grigoriev et al. (2007). GenBank accession XP 001421073 Grigoriev et al. (2007). Snegie et al. (2002) GenBank Accession No. AY082393, NCBI, File History of U.S. Pat. No. 7,807,849. Singh et al., issued Oct. 5, 2010 (U.S. Appl. No. 11/112,882, filed Apr. 22, 2005). Rasa al. (1993) GenBank Accession No. L11421, NCBI, pp. File History of U.S. Patent Application Publication No. 2011/ 0015415. Singh, et al., published Jan. 20, 2011 (U.S. Appl. No. ins et al. (2000) GenBank Accession No. AF309556, NCBI, 12/661,978, filed Mar. 26, 2010. File History of U.S. Patent Application Publication No. 2012 Wife al. (1991) GenBank Accession No. AF139720, NCBI, pp. 0041218, Singh et al., published Feb. 16, 2012, (U.S. Appl No. 13/243,747, filed Sep. 23, 2011. fish et al. (1999) GenBank Accession No. AF133728, NCBI, pp. File History of U.S. Pat. No. 7,834,250, Singh et al., issued Nov. 16, 2010 (U.S. Appl. No. 1 1/587,092, filed Oct. 20, 2006). Nade Sequencing project and Gernome Sequencing Center, File History of U.S. Pat. No. 7,932,438, Singh et al., issued (U.S. (2003) GenBank Accession No. NM 069288, NCBI, pp. 1-3. Appl. No. 12/945,708, filed Nov. 12, 2010. Zank et al. (2002) GenBank Accession No. AF428243, NCBI, pp. File History of U.S. Patent Application Publication No. 2011/ 0201065. Singh et al., published Aug. 18, 2011 (U.S. Appl. No. kinawa et al. (2004) GenBank Accession No. AY583464, NCBI, 13/093,252, filed Apr. 25, 2011. File History of U.S. Pat. No. 8,158,392. Singh et al., issued Apr. 17. R et al. (1999) GenBank Accession No. AF206.662, NCBI, pp. 2012 (U.S. Appl. No. 13/311,240, filed Sep. 23, 2011. File History of U.S. Patent Application Publication No. 2011/ is et. (2003) GenBank Accession No. AX951565, NCBI, pp. 0 190521. Damcevski et al., published Aug. 4, 2011 (U.S. Appl. No. 12/310,645, filed Feb. 16, 2011. hein et al. (2001) GenBank Accession No. AX214454, NCBI, pp. File History of U.S. Appl. No. 12/989,405, Zhou et al., filed May 16, 1. 2011. US 9,725,399 B2 Page 12

(56) References Cited The C. Elegans Sequencing Consortium, (1998) "Genome Sequence of the Nematode C. elegans: A Platform for Investigating OTHER PUBLICATIONS Biology.” Science, 282(5396): 2012-2018. Agaba, M., et al., (2004) "Zebrafish cDNA Encoding Multifunc File History of U.S. Pat. No. 7,589.253, Green et al., issued Sep. 15, tional Fatty Acid Elongase Involved in Production of 2009 (U.S. Appl. No. 09/981,124, filed Oct. 17, 2011. Eicosapentaenoic (20:5n-3) and Docosahexaenoic (22:6n-3) File History of U.S. Pat. No. 7,834,248, Green et al., issued Nov. 16, Acids.” Marine Biotechnology, 6(3): 251-261. 2010 (U.S. Appl. No. 1 1/699,817, filed Jan. 30, 2007. Akiyama, H., et al., (1998) “A Novel Plasmid Recombination File History of U.S. Patent Application No. 2012-0016144. Singh et Mechanism of the Marine Cyanobacterium Synechococcus sp. al., Jan. 19, 2012 (U.S. Appl. No. 13/129,940, filed Sep. 30, 2011. PCC7002, DNA Research, 5(6): 327-334. File History of U.S. Patent Application No. 2014-0314727. Singh et Akiyama, H., et al., (1998) “Nucleotide Sequence of Plasmid pAQ1 al., Oct. 23, 2014 (U.S. Appl. No. 14/323,512, filed Jul. 3, 2014. of Marine Cyanobacterium Synechococcus sp. PCC7002.” DNA File History of U.S. Patent Application No. 2015-0087849, Singh et Research, 5(2): 127-129. al., Mar. 26, 2015 (U.S. Appl. No. 14/503,002, filed Sep. 30, 2014. Al-Mariri et al. (2002) “Yersinia enterocolitica as a Vehicle for a File History of U.S. Patent Application No. 2015-0203788, Petrie et Naked DNA Vaccine Encoding Brucella abortus Bacterioferritin or al., Jul. 23, 2015 (U.S. Appl. No. 14?600,653, filed Jan. 20, 2015. P39 Antigen” Infect. Immun. 70: 1915-1923. File History of U.S. Patent Application No. 2015-0045569, Petrie et Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z. al., Feb. 12, 2015 (U.S. Appl. No. 14/464,510, filed Aug. 20, 2014. Miller, W., & Lipman, D. J. (1997). Gapped BLAST and PSI Complete File History of U.S. Pat. No. 8,809,559, Petrie et al., BLAST: a new generation of protein database search programs. issued Aug. 19, 2014. Nucleic Acids Research, 25(17), 3389-3402. Complete File History of U.S. Pat. No. 8,816,106, issued Aug. 26. Alvarez et al. (2000) “Silencing of HMW glutenins in transgenic 2014 (Damcevski et al.). wheat expressing extra HMW subunits' Theor Appl Genet 100:319 International Preliminary Report on Patentability, issued May 24, 327. 2011 in connection with PCT International Application Publication Armbrust et al. (2004) The genome of the diatom Thalassiosira No. PCTAU2009/001488. pseudonana: ecology, evolution, and metabolism, Science 306:79 Written Opinion of the International Search Authority, issued Apr. B6. 1, 2010 in connection with PCT International Application Publica Badami, R. C., & Patil, K. B. (1980). Structure and occurrence of tion No. PCTAU2009/001488. unusual fatty acids in minor seed oils. Prog. Lipid Res., 19, 119-153. International Search Report, issued Apr. 1, 2010 in connection with Bafor et al., Biosynthesis of vernoleate (cis-12-ebosyoctadeca-cis PCT International Application Publication No. PCT/AU2009/ 9-enoate) in microsomal preparations from developing endosperm OO1488. of euphorbia lagascae. Archives of Biochemistry and Biophysics. International Search Report issued Jul. 27, 2009 in connection with 1993, 303(1): 145-151. Banas et al. In: Williams, J.P. Molbasher, K.U., Lem, N.W., (Eds.) PCT International Application No. PCT/AU2009/000517. Physiology, biochemistry and molecular biology of plant lipids. Report on Patentability issued Oct. 26, 2010 in connection with PCT Kluwer Academic Publisher, Dordrecht. In Press. “BioSynthesis of International Application No. PCT/AU2009/000517. an Acetylenic Fatty Acid in Microsomal Preparations from Devel Dec. 6, 2013 International Search Report, issued in connection with oping Seeds of Crepis alpina”, 1997, pp. 57-59. PCT International Patent Application No. PCT/AU2013/000639. Bates et al. (2007) “Incorporation of Newly Synthesized Fatty Acids Dec. 6, 2013 Written Opinion of the International Searching Author into Cytosolic Glycerolipids in Pea Leaves Occurs via Acyl Edit ity, issued in connection with PCT International Patent Application ing” J. Biol. Chem. 282:31206-31216. No. PCTAU2013,000639. Baumberger et al. (2007) “The Polerovirus Silencing Suppressor P0 May 13, 2014 International Preliminary Report on Patentability, Targets ARGONAUTE Proteins for Degradation” Curr. Biol. issued in connection with PCT International Patent Application No. 17:1609-1614. PCT/AU2013 (OOO639. Bäumlein, H., et al., (1992) “Cis-Analysis of a Seed Protein Gene Apr. 15, 2014 Demand for International Preliminary Examination, Promoter: The Conservative RY Repeat CATGCATC Within the including substitute claim pp. 164-186, filed in connection with Legumin BOX is Essential for Tissue-Specific Expression of a PCT International Patent Application No. PCT/AU2013/000639. Legumin Gene.” The Plant Journal. 2(2): 233-239. PCT International Search Report issued Apr. 1, 2010 for PCT Bäumlein, H., et al., (1991) “A Novel Seed Protein Gene From Vicia International Application Publication No. WO 2010/057246. faba is Developmentally Regulated in Transgenic Tobacco and U.S. Appl. No. 1 1/587,092, Oct. 20, 2006, Singh et al. Arabidopsis Plants.” Molecular and General Genetics, 225(3): 459 U.S. Appl. No. 13/448,107, Apr. 16, 2012, Singh et al. 467. U.S. Appl. No. 12/661,978, Mar. 6, 2010, Singh et al. Beaudoin, et al., “Production of C20 polyunsaturated fatty acids U.S. Appl. No. 13/093,252, Apr. 25, 2011, Singh et al. (PUFAs) by pathway engineering: identification of a PUFA elongase U.S. Appl. No. 13/011,779, Jan. 21, 2011, Liu et al. component from Caenorhabditis elegans'. Biochemical Society U.S. Appl. No. 12/989,405, May 16, 2011, Zhou et al. Transactions, vol. 28, Part 6, p. 661-663. U.S. Appl. No. 12/310,645, Feb. 16, 2011, Damcevski et al. Beaudoin, F., et al., (2000) “Heterologous Reconstitution in Yeast of U.S. Appl. No. 13/129,940, May 18, 2011, Petrie et al. the Polyunsaturated Fatty Acid Biosynthetic Pathway.” Proceedings U.S. Appl. No. 13/011,773, Jan. 21, 2011, Liu et al. of the National Academy of Sciences of the United States of U.S. Appl. No. 13/243,747, Sep. 23, 2011, Singh et al. America. 97(12): 6421-6426. U.S. Appl. No. 13/171,032, Jun. 28, 2011, Petrie et al. Beclin et al. (2002) “A Branched Pathway for Transgene-Induced U.S. Appl. No. 13/311,240, Dec. 5, 2011, Singh et al. RNA Silencing in Plants’ Curr. Biol. 12:684-688. U.S. Appl. No. 13/651.275, Oct. 12, 2012, Singh et al. Berberich, T. et al., (1998) “Two Maize Genes Encoding Omega-3 Abbadi, A., et al., (2001) "Transgenic Oilseeds as Sustainable Fatty Acid Desaturase and Their Differential Expression to Tem Source of Nutritionally Relevant C20 and C22 Polyunsaturated perature.” Plant Molecular Biology, 36(2): 297-306. Fatty Acids?” European Journal of Lipid Science and Technology, Blee et al., Regio-and stereoselectivity of cytochrome P-450 and 103(2): 106-113. peroxygenase-dependent formation of CIS-12, 13-epoxy-9(Z)— Abbadi, A., at al., (2004) “Biosynthesis of Very-Long-Chain Poly octadecenoic acid (vernolic acid) in euphorbia lagascae. Biochemi unsaturated Fatty Acids in Transgenic Oilseeds: Constraints on cal and Biophysical Research Communications, 1993, 197 (2):778 Their Accumulation.” The Plant Cell, 16(10): 2734-3748. T84. Abdullah, R., Cocking, E. C., & Thompson, J. A. (Dec. 1986). Blee et al., Mechanism of reaction of fatty acid hydroperoxides with Efficient plant regeneration from rice protoplasts through somatic soybean peroxygenase. The Journal of Biological Chemistry. 1993, embryogenesis. Biotechnology, 4, 1087-1090. 268(3): 1708-1715. US 9,725,399 B2 Page 13

(56) References Cited Cheng, M., Jarret, R. L., Li, Z., Xing, A., & Demski, J. W. (1996). Production offertile transgenic peanut (Arachis hypogaea L.) plants OTHER PUBLICATIONS using Agrobacterium tumefaciens. Plant Cell Reports, 15, 653-657. Cheng et al. (2010) Towards the production of high levels of Blee and Schuber, Efficient epoxidation of unsaturated fatty acids by eicosapentaenoic acid in transgenic plants: the effects of different a hydroperoxide-dependent oxygenase. The Journal of Biological host species, genes and promoters, Transgenic Res 19: 221-229. Chemistry, 1990, 265(22): 12887-12894. Certik M. and Shimizu S. Biosynthesis and regulation of microbial Bligh and Dyer, Orange-red Flesh in Cod and Haddock. J. Fish. Res. polyunsaturated fatty acid production. J. Biosci Bioeng, 1999; Bd. Canada, 1959, 16(4):449-452. 87(1):1-14. Bolch, C.J.S., et al., (1999) “Genetic, Morphological, and Toxico Chica et al. (2005) Semi-rational approaches to engineering enzyme logical Variation Among Globally Distributed Strains of Nodularia (Cyanobacteria).” Journal of Phycology, 35(2): 339-355. activity: combining the benefits of directed evolution and rational Bolch, C.J.S., et al., (1999) “Genetic Variation Among Strains of the design. Current Opinion in Biothechnology, 16:378-384. Toxic Dinoflagellate Gymnodinium catenatum (Dinophyceae).” Chikwamba et al. (2003) “Localization of a bacterial protein in Journal of Phycology, 35: 356-367. starch granules of transgenic maize kernels' Proc. Natl. Acad. Sci. Bortolamioletal. (2007) “The Polerovirus F Box Protein P0 Targets U.S.A. 100: 11127-11132. ARGONAUTE 1 to Suppress RNA Silencing Euro. J. Biochm. Chinain, M., et al., “Intraspecific Variation in the Dinoflagellate 267:85. Gambierdiscus toxicus (Dinophyceae). I. Isozyme Analysis,” Jour Bouvier (2000) “Identification of neoxanthin synthase as a nal of Phycology, 33: 36-43. carotenoid Eur J. Biochem. 267:6346-6352. Christian and Yu, Cytochrome P-450-dependent monooxygenase Bozak et al., Sequence analysis of ripening-related cytochrome activity in the velvetbean caterpillar, Anticarsia gemmatalis hubner. P-450 cDNAs from avocado fruit. PNAS, 1990, 87:3904-3908. Comparative Biochemistry and Physiology, 1986, 83C(1):23-27. Brodersen at al. (2008) “Widespread Translational Inhibition by Cho, H.P. et al., (1999) “Cloning. Expression, and Nutritional Plant miRNAS and siRNAs Science 320:1185-1190. Regulation of the Mammalian A-6 Desaturase.” The Journal of Brosnan et al. (2007) “Nuclear gene silencing directs reception of Biological Chemistry, 274(1): 471-477. long-distance mRNA silencing in Arabidopsis” Proc. Natl. Acad. Cho, H.P. et al., (1999) “Cloning. Expression, and Fatty Acid Sci. U.S.A. 104:14741-14746. Regulation of the Human A-5 Desaturase.” The Journal of Biologi Broun, P. et al., (1998) “A Bifunctional oleate 12-Hydroxylase: cal Chemistry, 274(52): 37335-37339. Desaturase From Lesquerella fendleri.” The Plant Journal, 13(2): 201-210. Chung et al. (2006) “Effect of 5"UTR introns on gene expression in Brown, M.R., et al., (1997) “Nutritional Properties of Microalgae Arabidopsis thaliana” BMC Genomics 7:120. for Mariculture.” Aquaculture, 151(1): 315-331. Clapp et al., The 16-Kilcdalton N-Terminal Fragment of Human Brown et al. (2002) Limnanthes douglasii lysophosphatidic acid Prolactin is a Potent Inhibitor of Angiogenesis. Endocrinology, acyltransferases: immunological quantification, acyl selectivity and 1993, 133(3): 1292-1299. functional replacement of the Escherichia coli plsC gene, Biochem Clough, S.J. and Bent, A.F., (1998) “Floral Dip: A Simplified J. 364:795-805. Method for Agrobacterium-Mediated Transformation of Browse, J.A. and Slack, C.R., (1981) “Catalase Stimulates Arabidopsis thaliana,” 16(6); 735-743. Linoleate Desaturase Activity in Microsomes From Developing Coleman, A.W. (1977) “Sexual and Genetic Isolation in the Cos Linseed Cotyledons.” Federation of European Biochemical Societ mopolitan Algal Species Pandorina morum.” American Journal of ies Letters, 131(1): 111-114. Botany, 64(3): 361-368. Burgal et al., Metabolic engineering of hydroxy fatty acid produc Coutu et al. (2007) “pORE: a modular binary vector series suited for tion in plants: RcDGAT2 drives dramatic increases in ricinoleate both monocot and dicot plant transformation' Transgenic Res. 16: levels in seed oil. Plant Biotechnology Journal, 2008, 6:819-831. 771-781. Cahoon, E. B., Ripp, K. G. Hall, S. E., & Kinney, A. J. (2001). Cripps, C., Borgeson, C., Blomquist, G. J., & de Renobales, M. Formation of conjugated A.A'-double bonds by A'-oleic-acid (1990). The A'-desaturase from the house cricket, Acheta desaturase-related enzymes. The Journal of Biological Chemistry, domesticus (orthoptera: gryllidae): characterization and form of the 276(4), 2637-2643. Substrate. Archives of Biochemistry and Biophysics, 278(1), 46-51. Cahoon, E. B., Marillia, E., Stecca, K. L., Hall, S. E., Taylor, D.C., Crombie, L., & Holloway, S.J. (1984). Origins of conjugated triene & Kinney, A. J. (2000). Production of fatty acid components of fatty acids. The biosynthesis of calendic acid by Calendula meadowfoam oil in Somatic soybean embryos. Plant Physiology, officinalis. J. Chem. Soc., Chem. Commun., 15, 953-955. 124, 243-251. Crombie, L., & Holloway, S.J. (1985). The biosynthesis of calendic Cahoon, E. B., Shanklin, J., & Ohlrogge, J. B. (1992). Expression acid, octadeca-(8E.10E, 12Z)-trienoic acid, by developing marigold of a coriander desaturase results in petroselinic acid production in seeds: origins of (EEZ) and (ZE,Z) conjugated triene acids in transgenic tobacco. Proc. Natl. Acad. Sci. USA, 89, 11184-11188. higher plants. J. Chem. Soc. Perkin Trans. 1, 2425-2434. Cahoon et al., Conjugated fatty acids accumulate to high levels in Cuperus, F. P. & Derksen, J. T. P. (1996). High value-added phospholipids of metabolically engineered soybean and applications from vernolic acid. In J. Janick (Ed.). Progress in new Arabidopsis seeds. Phytochemistry, 2006, 67(12): 1166-1176. crops (pp. 354-356). Alexandria, VA. ASHS Press. Capdevila et al., Cytochrome P-450 anachidonate oxygenase. Meth Curiel et al. (1992) "High-Efficiency Gene Transfer Mediated by ods in Enzymology, 1990, 187:385-394. Adenovirus Coupled to DNA-Polylysine Complexes' Hum. Gen. Capecchi (1980) “High Efficiency Transformation by Direct Ther. 3:147-154. Microinjection of DNA into Cultured Mammalian Cells' Cell Dafny-Yelin et al., Delivery of Multiple Transgenes to Plant Cells, 22:479-488. Plant Physiology, Dec. 2007, vol. 145, pp. 1118-11128. Chapman et al. (2001) "Transgenic Cotton Plants with Increased Damude et al., (2007) "Engineering Oilseed Plants for a Sustain Seed Oleic Acid Content” Journal of American Chemists' Chem able, Land-Based Source of Long Chain Polyunsaturated Fatty istry; vol. 78 No. 9, 941-947. Acids”. Lipids, 42: 179-185. Chapman et al. (2004) Transgenic Cotton Plants with Increased Damude et al. (2006). Identification of bifunctional delta12/omega3 Seed Oleic Acid Content. Gen. Dev. 18:1179-1186. fatty acid desaturases for improving the ratio of omega} to omega.6 Chen et al. (2004) “Introgression of Salt-Tolerance From Somatic fatty acids in microbes and plants, Proc Natl Acad Sci USA 103: Hybrids Between common Wheat and Thinopyrum Ponticum” Plant 9446-9451. Science 167:773-779. Darji et al. (1997) “Oral Somatic Transgene Vaccination Using Chen et al. (2010) “MISSA is a Highly Efficient in Vivo DNA Attenuated S. typhimurium” Cell 91:765-775. Assembly Method for Plant Multiple-Gene Transformation' Plant Denic and Weissman (2007) A molecular caliper mechanism for Physiology, vol. 153, pp. 41-51. determining very long-chain fatty acid length, Cell 130:663-677. US 9,725,399 B2 Page 14

(56) References Cited Production of GLA by Heterologous Expression in Yeast and Tobacco.” Lipids, 37(4): 417-426. OTHER PUBLICATIONS Girke, T., et al., (1998) “Identification of a Novel A6-Acyl-Group Desaturase by Targeted Gene Disruption in Physcomitrella patens.” de Renobales, M. Cripps, C., Stanley-Samuelson, D. W., Jurenka, The Plant Journal, 15(1): 39-48. R. A., & Blomquist, G. J. (1987). Biosynthesis of linoleic acid in Gleave (1992) “A versatile binary vector system with a T-DNA insects. Trends in Biochemical Sciences, 12, 364-366. organisational structure conducive to efficient integration of cloned Ding and Voinett (2007) “Antiviral Immunity Directed by Small DNA into the plant genome” Plant Mol. Biol. 20:1203-1207. RNAS' Cell 130:413-426. Glevin et al (2003) “Agrobacterium-Mediated Plant Transforma Dobson, G., & Christie, W. W. (2002). Mass spectrometry of fatty tion: the Biology behind the 'Gene-Jockeying Tool” Microbiol. acid derivatives. Eur: J. Lipid Sci. Technol. 104, 36-43. Mol. Biol. Rev. 67:16-37. Dolferus et al., Differential Interactions of promoter elements in Glick et al. (2008) “Interaction with host SGS3 is required for stress responses of the Arabidopsis adh gene. Plant Physiol, 1994, suppression of RNA silencing by tomato yellow leaf curl virus V2 105:1075-1087. protein’ Proc. Natl. Acad. Sci U.S.A. 105:157-161. Domergue, F., et al., (2002) “Cloning and Functional Characteriza Graham et al. (1973) “Transformation of Rat Cells by DNA of tion of Phaeodactylum Tricornutum Front-End Desaturases Human Adenovirus 5” Virology 54:536-539. Involved in Eicosapentaenoic Acid Biosynthesis.' European Journal Grant, J. E., Cooper, P. A., McAra, A. E., & Frew, T. J. (1995). of Biochemistry, 269(16):4105-4113. Transformation of peas (Pisum sativum L.) using immature coty Domergue et al. In vivo characterization of the first acyl-CoA ledons. Plant Cell Reports, 15, 254-258. A-desaturase from a member of the plant kingdom, the microalga Green, D. et al., “Measurement of hemostatic factors in EDTA Ostreococcus tauri, Biochem J. 2005, 389, 483-490. plasma” Am. J. Clin. Pathol., 2008, 130(5): 811-815. Domergue, F., et al., (2003) “New Insight Into Phaeodactylum Grillot-Courvalin (1999) “Bacteria as gene delivery vectors for tricornutum Fatty Acid Metabolism. Cloning and Functional Char mammalian cells' Curr. Opin. Biotech. 10:477-481. acterization of Plastidial and Microsomal A12-Fatty Acid Guletal. (2006) Sterols and the phytosterol content of oil seed rape Desaturases.” Plant Physiology, 131(4): 1648-1660. (Brassica napus L.). Journal of Cell and Molecular Biology, vol. 5, Domergue et al., (2003), Acyl Carriers Used as Substrates by the pp. 71-79. Desaturases and Elongases Involved in Very Long-chian Polyun Guil-Guerrero, J.L., et al., (2000) "Occurrence and Characterization saturated Fatty Acids Biosynthesis Reconstituted in Yeast, J. Biol. of Oils Rich in Y-Linolenic Acid Part I: Echium Seeds From Chem. 278; 35115-35126. Macaronesia.” Phytochemistry, 53(4): 451-456. Drexler, H., et al. (2003) “Metabolic Engineering of Fatty Acids for Halpin, Gene stacking in transgenic plants—the challenge for 21 Breeding of New Oilseed Crops: Strategies, Problems and First century plant biotechnology, Plant Biotechnology Journal (2005, 3. Results.” Journal of Plant Physiology, 160(7): 779-802. pp. 141-155). Dunoyer et al. (2004) “Probing the MicroRNA and Small Interfer Hamberg and Fahlstadius, On the Specificity of Fatty Acid ing RNA Pathways with Virus-Encoded Suppressors of RNA Epoxygenase in Broad Bean (Vicia faba L.). Plant Physiol, 1992, Silencing” The Plant Cell 16:1235-1250. 99.987-998. Dunstan, G.A., et al., (1994) “Essential Polyunsaturated Fatty Acids Hamilton and Baulcombe (1999) “A Species of Small Antisense From 14 Species of Diatom (Bacillariophyceae).” Phytochemistry, RNA in Posttranscriptional Gene Silencing in Plants' Science 35(1): 155-161. 286:950-952. Dyer et al., Engineering plant oils as high-value industrial feed Haseloff, J. and Gerlach, W.L., (1988) “Simple RNA Enzymes With stocks for biorefining: the need for underpinning cell biology New and Highly Specific Endoribonuclease Activities,” Nature, research. Physiol Plant, 2008, 132:11-22. 334: 585-591. Eglitis et al. (1988) “Retroviral Vectors for Introduction of Genes Hastings, N., et al., (2001) "A Vertebrate Fatty Acid Desaturase into Mammalian Cells' Biotechniques 6:608-614. With A5 and A6 Activities.” Proceedings of the National Academy Engeseth and Stymine, Desaturation of oxygenated fatty acids in of Sciences of the United States of America, 98(25): 14304-14309. lesquerella and other oil seeds. Planta, 1996, 198:238-245. Hao, G., Liu, W. O'Conner, M., & Roelofs, W. L. (2002). Acyl Eigenheer et al (2002) “Isolation and molecular characterization of CoAZ9- and Z10-desaturase genes from a New Zealand leafroller Musca domestica delta-9 desaturase sequences' Insect Molecular moth species, Planotortrix octo. Insect Biochemistry and Molecular Biology 1 1(6):533-542. Biology, 32, 961-966. Fay, L., & Richli, U. (1991). Location of double bonds in polyun Harayama, S. (1998). Artificial evolution by DNA shuffling. Trends Saturated fatty acids by gas chromatography-mass spectrometry in Biotechnology, 16(2), 76-82. after 4.4-dimethyloxazoiline derivatization. Journal of Chromatog Hense et al. (2001) “Eukaryotic expression plasmid transfer from raphy, 541, 89-98. the intracellular bacterium Listeria monocytogenes to host cells' Fennelly et al. (1999) “Mucosal DNA Vaccine Immunization Cell Microbiol. 3:599-609. Against Measles with a Highly Attenuated Shigella flexneri Vector” Heppard et al., Developmental and Growth Temperature Regulation J. Immunol. 162:1603-1610. of Two Different Microsomal (O-6 Desaturase Genes in Soybeans. Fraser et al. (2004) “Expression of the Isochrysis C18-A9 Polyun Plant Physiol, 1996, 110:311-319. Saturated Fatty Acid Specific Elongase Component Alters Hoffman et al (2007) “A Small Membrane-peripheral Region Close Arabidopsis Glycerolipid Profiles' Plant Physiol. 135:859-866. to the Active Center Determines Regioselectivity of Membrane Fritsche, K., Hornung, E. Peitzsch, N., Renz, A., & Feussner, I. bound Fatty Acid Desaturases from Aspergillus nidulans' J. Biol. (1999). Isolation and characterization of a calendic acid producing Chem. 282:26.666-26674. (8,11)-linoleoyl desaturase. FEBS Letters, 462, 249-253. Hoffman et al., (2008) "Metabolic Engineering of co3-Very Long Fuji et al. (2007) “Arabidopsis vacuolar Sorting Mutants (green Chain Polyunsaturated Fatty Acid Production by an Exclusively fluorescent seed) Can Be Identified Efficiently by Secretion of Acyl-CoA-dependent Pathway”. The Journal of Biological Chem Vacuole-Targeted Green Fluorescent Protein in Their Seeds' Plant istry, 283:22352-22362. Ce11 19:597-609. Hong, H., et al., (2002) “Isolation and Characterization of a A5 FA Fujimura et al. (1985) “Regeneration of Rice Plants from Desaturase From Pythium irregulare by Heterologous Expression in Protoplasts' Plant Tissue Culture Lett. 2:74. Saccaromyces cerevisiae and Oilseed Crops.” Lipids, 37(9): 863 Gallagher, J.C., (1980) “Population Genetics of Skeletonema 868. costatum (Bacillariophyceae) in Narragansett Bay,” Journal of Horiguchi, G., et al., (1998) “Developmental Regulation of Genes Phycology, (16)3: 464–474. for Microsome and Plastid Omega-3 Fatty Acid Desaturases in Garcia-Maroto, F., et al., (2002) “Cloning and Molecular Charac Wheat (Triticum aestivum L.).” Plant and Cell Physiology, 39(5): terization of the A6-Desaturase From Two Echium Plant Species: 540-544. US 9,725,399 B2 Page 15

(56) References Cited castor bean seeds which has high homology to the major triglyceride biosynthetic enxyme of fungi and animals. Phytochemistry, 2006, OTHER PUBLICATIONS 67:2541-2549. Kunik et al. (2001) “Genetic transformation of HeLa cells by Horvath et al. (2000) “The production of recombinant proteins in Agrobacterium” Proc. Natl. Acad. Sci. U.S.A. 98:1871-1876. transgenic barley grains” Proc. Natl. Acad. Sci. U.S.A. 97: 1914 Lacroix et al. (2008) “Association of the Agrobacterium T-DNA 1919. protein complex with plant nucleosomes' Proc. Natl. Acad. Sci. Huang, Y, et al., (1999) “Cloning of A12-and A6-Desaturases From U.S.A. 105: 15429-15434. Mortierella alpina and Recombinant Production of Y-Linolenic Acid Laethem et al., Epoxidation of C18 unsaturated fatty acids by in Saccharomyces cerevisiae,” Lipids, 34(7): 649-659. cytochromes P4502C2 and P4502CAA. Drug Metabolism and Huang et al. (2004) “How Insulin Binds: the B-Chain a-Helix Disposition, 1996, 24(6):664-668. Contacts the Ll b-Helix of the Insulin Receptor J. Mol. Biol. Lassner (1995) Lysophosphatidic acid acyltransferase from 341:529-550. meadowfoam mediates insertion of erucic acid at the Sn-2 position Hu et al. (2008) “Microalgal triacylglycerols as feedstocks for of triacylglycerol in transgenic rapeseed oil, Plant Physiol. biofuel production: perspectives and advances' The Plant Journal, 109:1389-94. 54, 621-639. Lechtenberg et al. (2003) “Neither inverted repeat T-DNA configu Ikeda, K., et al., (2002) "Transformation of the Fresh Water Cya rations nor arrangements of tandemly repeated transgenes are nobacterium Synechococcus PCC7942 With the Shuttle-Vector sufficient to trigger transgene silencing” Plant J. 507-517. pAQ-EX1 Developed for the Marine Cyanobacterium Synechococ Lee, M., et al., (1998) “Identification of Non-Heme Diiron Proteins cus PCC7002.” World Journal of Microbiology & Biotechnology, That Catalyze Triple Bond and Epoxy Group Formation.” Science, 18(1): 55-56. 280(5365): 915-918. Inagaki, K., et al., (2002) “Identification and Expression of a Rat Lenihan-Geels at al. (2013) “Alternative Sources of Omega-3 Fats: Fatty Acid Elongase Involved in the Biosynthesis of C18 Fatty Can We Find a Sustainable Substitute for Fish?' Nutrients, 5, Acids.” Bioscience, Biotechnology, and Biochemistry, 66(3): 613 1301-1315. 621. Leonard, A.E., et al., (2000) “cDNA Cloning and Characterization Jiang et al. (2014) Isolation and Characterization of the Diatom of Human A5-Desaturase Involved in the Biosynthesis of Phaeodactylum A5-Elongase Gene for Transgenic LC-PUFA Pro Arachidonic Acid.” The Biochemical Journal, 347(Pt3): 719-724. duction in Pichia pastoris. Mar. Drugs, 12, 1317-1334. Leonard, A.E., et al., (2000) “Cloning of a Human cDNA Encoding Johansen and Carrington (2001) “Silencing on the Spot. Induction a Novel Enzyme Involved in the Elongation of Long-Chain Poly and Suppression of RNA Silencing in the Agrobacterium-Mediated unsaturated Fatty Acids.” The Biochemical Journal, 350(Pt 3): Transient Expression System” Plant Physiol. 126-930-938. 765-77O. Jones, A.V.M. and Harwood, J.L. (1980) “Desaturation of Linoleic Leonard, A.E., et al., (2002) “Identification and Expression of Acid From Exogenous Lipids by Isolated Chloroplasts.” The Bio Mammalian Long-Chain PUFA Elongation Enzymes,” Lipids, 37(8): 733-740. chemical Journal, 190(3): 851-854. Lewis, T. Nichols, P. D., & McMeekin, T. A. (2000). Evaluation of Jostensen et al. (2002) Molecular-phylogenetic, structural and bio extraction methods for recovery of fatty acids from lipid-producing chemical features of a cold-adapted marine ichtyosporean near the microheterotrophs. Journal of Microbiological Methods, 43, 107 animal-fungal divergence, described from in vitro cultures. Europ. 116. J. Protistol., 38, 93-104. Lewsey et al. (2007) “Selective targeting of miRNA-regulated plant Kajikawa, M., et al., (2004) “Isolation and Characterization of development by a viral counter-silencing protein' Plant J. 50:240 A6-Desaturase. An ELO-Like Enzyme and A5-Desaturase From the 252. Liverwort Marchantia polymorpha and Production of Arachidonic Lin et al. (2003) “Efficient linking and transfer of multiple genes by and Eicosapentaenoic Acids in the Methylotrophic Yeast Pichia a multigene assembly and transformation vector system” PNAS, pastoris.” Plant Molecular Biology, 54; 335-352. 100(10): 5962-5967. Kajikawa et al. (2006) Isolation and functional characterization of Lindbo et al. (1993) “Induction of a Highly Specific Antiviral State fatty acid delta5-elongase gene from the liverwort Marchantia in Transgenic Plants: Implications for Regulation of Gene Expres polymorpha L., FEBS Lett 580:149-154. Sion and Virus Resistance Plant Cell 5:1749-1759. Kang et al. (2008) "Coexpression of Elo-like Enzyme and Lo, J., et al., (2003) “15,000 Unique Zebrafish EST Clusters and A4-Desaturases Derived from Thraustochytrium aureum ATCC Their Future Use in Microarray for Profiling Gene Expression 34304 and the Production of DHA and DPA in Pichia pastoris' Patterns. During Embryogenesis,” Genome Research Letter, 13:483-490. 13(3):455-466. Kasschau et al. (2003) “P1/HC-Pro, a Viral Suppressor of RNA Lu et al. An analysis of expressed sequence tags of developing Silencing, Interferes with Arabidopsis Development and miRNA castor endosperm using a full-length cDNA library. BMC Plant Function Devel. Cell 4:205-217. Biol, 2007, 7(42): 1-9. Khozin et al. (1997) “Elucidation of the Biosynthesis of Lu et al. (1993) “High Efficiency Retroviral Mediated Gene Eicosapentaenoic Acid in the Microalga Porphyridium cruentum” Transduction into Single Isolated Immature and Replatable CD343+ Plant Physiol. 114:223-230. Hematopoietic Stem/Progenitor Cells from Human Umbilical Cord Kleiman, R., & Spencer, G. F. (Jan. 1982). Search for new industrial Blood” J. Exp. Med. 178:2089-2096. oils: XVI. umbelliflorae—seed oils rich in petroselinic acid. Journal Office Action, issued Feb. 26, 2016 in connection with U.S. Appl. of the American Oil Chemists' Society. 59(1), 29-38. No. 14/743,531. Knipple, D.C., Rosenfield, C., Nielsen, R. You, K. M., & Jeong, S. Response to Office Action, filed May 26, 2016 in connection with E. (2002). Evolution of the integral membrane desaturase gene U.S. Appl. No. 14/743,531. family in moths and flies. Genetics, 162, 1737-1752. Office Action, issued Aug. 1, 2016 in connection with U.S. Appl. Knutzon, D.S., et al., (1998) “Identification of A5-Desaturase From No. 14/743,531. Mortierella alpina by Heterologous Expression in Bakers' Yeast and Office Action, issued Aug. 8, 2016 in connection with U.S. Appl. Canola,” The Journal of Biological Chemistry, 273(45): 29360 No. 14/975,333. 29366. International Search Report, mailed Jan. 14, 2015 in connection Koziel et al. (1996) "Optimizing expression of transgenes with an with PCT International Application No. PCT/AU2014/050340, filed emphasis on post-transcriptional events' Plant Mol. Biol. 32:393 Jun. 18, 2015. 405. Written Opinion of the International Searching Authority, mailed Kroon et al., Identification and functional expression of a type 2 Jan. 14, 2015 in connection with PCT International Application No. acyl-CoA:diacylglycerol acyltransferase (DGAT2) in developing PCT/AU2014/050340, filed Jun. 18, 2015. US 9,725,399 B2 Page 16

(56) References Cited OTHER PUBLICATIONS Demand for International Preliminary Examination filed on May 14, 2015 in connection with PCT International Application No. PCT/ AU2014/050340, filed Jun. 18, 2015. Letter to the International Preliminary Examination Authority filed on Apr. 27, 2016 in connection with PCT International Application No. PCT/AU2014/050340, filed Jun. 18, 2015. Amended Claims filed on Apr. 27, 2016 in connection with PCT International Application No. PCT/AU2014/050340, filed Jun. 18, 2015. Second Written Opinion of the International Preliminary Examining Authority, mailed May 5, 2016 in connection with PCT Interna tional Application No. PCT/AU2014/050340, filed Jun. 18, 2015. Demand for International Preliminary Examination filed on Oct. 19. 2015 in connection with PCT International Application No. PCT/ AU2014/050433, filed Dec. 18, 2014. Written Opinion of the International Searching Authority, mailed Mar. 20, 2015 in connection with PCT International Application No. PCT/AU2014/050433, filed Dec. 18, 2014. Letter to the International Preliminary Examination Authority filed on Oct. 19, 2015 in connection with PCT International Application No. PCT/AU2014/050433, filed Dec. 18, 2014. Amended Claims filed on Oct. 19, 2015 in connection with PCT International Application No. PCT/AU2014/050433, filed Dec. 18, 2014. Oct. 10, 2016 International Preliminary Report on Patentability for International Patent Application PCT/AU2015/050340.

U.S. Patent Aug. 8, 2017 Sheet 2 of 10 US 9,725,399 B2

U.S. Patent Aug. 8, 2017 Sheet 3 of 10 US 9,725,399 B2

aídva

88 U.S. Patent Aug. 8, 2017 Sheet 4 of 10 US 9,725,399 B2

{i} :crisen: {v: ys, -38 trait is trans eric 8:aisi is is iaiiar:8 se:8

8A ; ;f tota: 38ty sid:

Figure 4 U.S. Patent Aug. 8, 2017 Sheet S of 10 US 9,725,399 B2

33 :A-axis 3-3s,3

3. 3.8 : ; : . : 3.3 : f: i:33

88: 38A-3:8: 388-88:3 U.S. Patent Aug. 8, 2017 Sheet 6 of 10 US 9,725,399 B2

80k ------

sk ------:------

ak icic

s . .x & & is is &Six'ssys'sessessessessessessess's Six Sky S&Six S&S.Y.S.*

Figure 6 U.S. Patent Aug. 8, 2017 Sheet 7 of 10 US 9,725,399 B2

B)

Figure 7 U.S. Patent US 9,725,399 B2

U.S. Patent Aug. 8, 2017 Sheet 9 of 10 US 9,725,399 B2

Keedy : satistsy :

Figure 9 U.S. Patent Aug. 8, 2017 Sheet 10 of 10 US 9,725,399 B2

US 9,725,399 B2 1. 2 LPD COMPRISING LONG CHAIN LA, shown schematically as the upper left part of FIG. 1 POLYUNSATURATED FATTY ACDS (c)6) or the co3 substrate ALA through to EPA, shown as the lower right part of FIG. 1 (c)3). If the initial A6-desaturation REFERENCE TO ASEQUENCE LISTING is performed on the Co6 substrate LA, the LC-PUFA product of the series of three enzymes will be the Co6 fatty acid ARA. This application incorporates-by-reference nucleotide LC-PUFA synthesising organisms may convert ()6 fatty and/or amino acid sequences which are present in the file acids to co3 fatty acids using an (03-desaturase, shown as the named "141218 2251 87180 Sequence Listing GC.txt.” A 17-desaturase step in FIG. 1 for conversion of arachidonic which is 173 kilobytes in size, and which was created Dec. acid (ARA, 20:4()6) to EPA. Some members of the co3-de 17, 2014 in the IBM-PC machine format, having an oper 10 saturase family can act on a variety of Substrates ranging ating system compatibility with MS-Windows, which is from LA to ARA. Plant (03-desaturases often specifically contained in the text file filed Dec. 18, 2014 as part of this catalyse the A15-desaturation of LA to ALA, while fungal application. and yeast co3-desaturases may be specific for the A17 desaturation of ARA to EPA (Pereira et al., 2004a: Zank et FIELD OF THE INVENTION 15 al., 2005). Some reports Suggest that non-specific (D3-de saturases may exist which can convert a wide variety of (06 The present invention relates to lipid comprising docosa Substrates to their corresponding (03 products (Zhang et al., hexaenoic acid and/or docosapentaenoic acid, obtained from 2008). plant cells or microbial cells, and processes for producing The conversion of EPA to DHA in these organisms occurs and using the lipid. by a A5-elongation of EPA to produce DPA, followed by a A4-desaturation to produce DHA (FIG. 1). In contrast, BACKGROUND OF THE INVENTION mammals use the so-called “Sprecher pathway which con verts DPA to DHA by three separate reactions that are Omega-3 long-chain polyunsaturated fatty acids (LC independent of a A4-desaturase (Sprecher et al., 1995). PUFA) are now widely recognized as important compounds 25 The front-end desaturases generally found in plants, for human and animal health. These fatty acids may be mosses, microalgae, and lower animals such as Caenorhab obtained from dietary sources or by conversion of linoleic ditis elegans predominantly accept fatty acid Substrates (LA, 18:2a)6) or C-linolenic (ALA, 18:303) fatty acids, both esterified to the sn-2 position of a phosphatidylcholine (PC) of which are regarded as essential fatty acids in the human substrate. These desaturases are therefore known as acyl-PC, diet. While humans and many other vertebrate animals are 30 lipid-linked, front-end desaturases (Domergue et al., 2003). able to convert LA or ALA, obtained from plant sources to In contrast, higher animal front-end desaturases generally C22 they carry out this conversion at a very low rate. accept acyl-CoA substrates where the fatty acid substrate is Moreover, most modern societies have imbalanced diets in linked to CoA rather than PC (Domergue et al., 2005). Some which at least 90% of polyunsaturated fatty acids (PUFA) microalgal desaturases and one plant desaturase are known are of the Co6 fatty acids, instead of the 4:1 ratio or less for 35 to use fatty acid substrates esterified to CoA (Table 2). ()6:()3 fatty acids that is regarded as ideal (Trautwein, Each PUFA elongation reaction consists of four steps 2001). The immediate dietary source of LC-PUFAs such as catalysed by a multi-component protein complex: first, a eicosapentaenoic acid (EPA, 20:5c)3) and docosahexaenoic condensation reaction results in the addition of a 2C unit acid (DHA, 22:603) for humans is mostly from fish or fish from malonyl-CoA to the fatty acid, resulting in the forma oil. Health professionals have therefore recommended the 40 tion of a B-ketoacyl intermediate. This is then reduced by regular inclusion of fish containing significant levels of NADPH, followed by a dehydration to yield an enoyl LC-PUFA into the human diet. Increasingly, fish-derived intermediate. This intermediate is finally reduced a second LC-PUFA oils are being incorporated into food products and time to produce the elongated fatty acid. It is generally in infant formula, for example. However, due to a decline in thought that the condensation step of these four reactions is global and national fisheries, alternative sources of these 45 Substrate specific whilst the other steps are not. In practice, beneficial health-enhancing oils are needed. this means that native plant elongation machinery is capable Flowering plants, in contrast to animals, lack the capacity of elongating PUFA providing that the condensation enzyme to synthesise polyunsaturated fatty acids with chain lengths (typically called an elongase) specific to the PUFA is longer than 18 carbons. In particular, crop and horticultural introduced, although the efficiency of the native plant elon plants along with other angiosperms do not have the 50 gation machinery in elongating the non-native PUFA Sub enzymes needed to synthesize the longer chain (03 fatty strates may be low. In 2007 the identification and charac acids such as EPA, docosapentaenoic acid (DPA, 22:5c)3) terisation of the yeast elongation cycle dehydratase was and DHA that are derived from ALA. An important goal in published (Denic and Weissman, 2007). plant biotechnology is therefore the engineering of crop PUFA desaturation in plants, mosses and microalgae plants which produce substantial quantities of LC-PUFA, 55 naturally occurs to fatty acid substrates predominantly in the thus providing an alternative source of these compounds. acyl-PC pool whilst elongation occurs to substrates in the LC-PUFA Biosynthesis Pathways acyl-CoA pool. Transfer of fatty acids from acyl-PC mol Biosynthesis of LC-PUFAs in organisms such as microal ecules to a CoA carrier is performed by phospholipases gae, mosses and fungi usually occurs as a series of oxygen (PLAs) whilst the transfer of acyl-CoA fatty acids to a PC dependent desaturation and elongation reactions (FIG. 1). 60 carrier is performed by lysophosphatidyl-choline acyltrans The most common pathway that produces EPA in these ferases (LPCATs) (FIG. 9) (Singh et al., 2005). organisms includes a A6-desaturation, A6-elongation and Engineered Production of LC-PUFA A5-desaturation (termed the A6-desaturation pathway) Most LC-PUFA metabolic engineering has been per whilst a less common pathway uses a A9-elongation, A8-de formed using the aerobic A6-desaturation/elongation path saturation and A5-desaturation (termed the A9-desaturation 65 way. The biosynthesis of Y-linolenic acid (GLA, 18:3()6) in pathway). These consecutive desaturation and elongation tobacco was first reported in 1996 using a A6-desaturase reactions can begin with either the Co6 fatty acid substrate from the cyanobacterium Synechocystis (Reddy and US 9,725,399 B2 3 4 Thomas, 1996). More recently, GLA has been produced in and 20%. An upper limited of 20% was defined because at crop plants such as safflower (73% GLA in seedoil. WO the time it was considered a maximal amount of DHA which 2006/127789) and soybean (28% GLA; Sato et al., 2004). could be produced in plants. However, as described herein, The production of LC-PUFA such as EPA and DHA involves the inventors were surprised to find that levels of DHA in the more complicated engineering due to the increased number total fatty acid content greater than 20% can be obtained. of desaturation and elongation steps involved. EPA produc The inventors also found plant lipid, and plant parts and tion in a land plant was first reported by Qi et al. (2004) who plants for producing lipid comprising DPA in the total fatty introduced genes encoding a A9-elongase from Isochrysis acid content of the extracted lipid of between 7% and 35%, galbana, a A8-desaturase from Euglena gracilis and a particularly in the absence of DHA. A5-desaturase from Mortierella alpina into Arabidopsis 10 Accordingly, in a first aspect the present invention pro yielding up to 3% EPA. This work was followed by Abbadi vides extracted plant lipid, comprising fatty acids in an et al. (2004) who reported the production of up to 0.8% EPA esterified form, the fatty acids comprising oleic acid, palm in flax seed using genes encoding a A6-desaturase and itic acid, ()6 fatty acids which comprise linoleic acid (LA), A6-elongase from Physcomitrella patens and a A5-desatu (03 fatty acids which comprise O-linolenic acid (ALA) and rase from Phaeodactylum tricornutum. 15 docosahexaenoic acid (DHA), and optionally one or more of The first report of DHA production was in WO 04/017467 stearidonic acid (SDA), eicosapentaenoic acid (EPA), where the production of 3% DHA in soybean embryos is docosapentaenoic acid (DPA) and eicosatetraenoic acid described, but not seed, by introducing genes encoding the (ETA), wherein the level of DHA in the total fatty acid Saprolegnia diclina A6-desaturase, Mortierella alpina content of the extracted lipid is between 20.1% and 30% or A6-desaturase, Mortierella alpina A5-desaturase, Sapro between 20.1% and 35%, preferably between 30% and 35%. legnia diclina A4-desaturase, Saprolegnia diclina A17-de In another aspect, the present invention provides extracted saturase, Mortierella alpina A6-elongase and Pavlova plant lipid, comprising fatty acids in an esterified form, the lutheri A5-elongase. The maximal EPA level in embryos fatty acids comprising oleic acid, palmitic acid, (D6 fatty also producing DHA was 19.6%, indicating that the effi acids which comprise linoleic acid (LA), ()3 fatty acids ciency of conversion of EPA to DHA was poor (WO 25 which comprise O-linolenic acid (ALA) and docosahexae 2004/071467). This finding was similar to that published by noic acid (DHA), and optionally one or more of Stearidonic Robert et al. (2005), where the flux from EPA to DHA was acid (SDA), eicosapentaenoic acid (EPA), docosapentaenoic low, with the production of 3% EPA and 0.5% DHA in acid (DPA) and eicosatetraenoic acid (ETA), wherein the Arabidopsis using the Dania rerio A5/6-desaturase, the level of palmitic acid in the total fatty acid content of the Caenorhabditis elegans A6-elongase, and the Pavlova 30 extracted lipid is between about 2% and 16%, and wherein salina A5-elongase and A4-desaturase. Also in 2005, Wu et the level of myristic acid (C14:0) in the total fatty acid al. published the production of 25% ARA, 15% EPA, and content of the extracted lipid, if present, is less than 1%, and 1.5% DHA in Brassica iuncea using the Pythium irregulare wherein the level of DHA in the total fatty acid content of A6-desaturase, a Thraustochytrid A5-desaturase, the Phy the extracted lipid is between 20.1% and 30% or between Scomitrella patens A6-elongase, the Calendula officianalis 35 20.1% and 35%, preferably between 30% and 35%. A 12-desaturase, a Thraustochytrid A5-elongase, the Phy In another aspect, the invention provides extracted lipid, tophthora infestans A17-desaturase, the Oncorhyncus preferably extracted plant lipid or extracted microbial lipid, mykiss LC-PUFA elongase, a Thraustochytrid A4-desaturase comprising fatty acids in an esterified form, the fatty acids and a Thraustochytrid LPCAT (Wu et al., 2005). Summaries comprising oleic acid, palmitic acid, (D6 fatty acids which of efforts to produce oil-seed crops which synthesize (03 40 comprise linoleic acid (LA), ()3 fatty acids which comprise LC-PUFAs is provided in Venegas-Caleronet al. (2010) and O-linolenic acid (ALA) and docosapentaenoic acid (DPA), Ruiz-Lopez et al. (2012). As indicated by Ruiz-Lopez et al. and optionally one or more of stearidonic acid (SDA), (2012), results obtained to date for the production of DHA eicosapentaenoic acid (EPA), and eicosatetraenoic acid in transgenic plants has been no where near the levels seen (ETA), wherein the level of DPA in the total fatty acid in fish oils. More recently, Petrie et al (2012) reported the 45 content of the extracted lipid is between about 7% and 35%. production of about 15% DHA in Arabidopsis thaliana In embodiments of this aspect, the level of DPA in the total seeds, and WO2013/185184 reported the production of fatty acid content of the extracted lipid is about 7%, about certain seedoils having between 7% and 20% DHA. How 8%, about 9%, about 10%, about 12%, about 15%, about ever, there are no reports of production of plant oils having 18%, about 20%, about 22%, about 24%, about 26%, about more than 20% DHA. 50 28%, about 30%, between about 7% and about 28%, There are no reports of the production of DPA in recom between about 7% and about 25%, between about 10% and binant cells to significant levels without concomitant pro 35%, between about 10% and about 30%, between about duction of DHA. Indeed, the present inventors are unaware 10% and about 25%, between about 10% and about 22%, of any published suggestion or motivation to produce DPA between about 14% and 35%, between about 16% and 35%, in recombinant cells without production of DHA. 55 between about 16% and about 30%, between about 16% and There therefore remains a need for more efficient produc about 25%, or between about 16% and about 22%. tion of LC-PUFA in recombinant cells, in particular of DHA In an embodiment of the above aspect. DHA is present at or DPA in seeds of oilseed plants. a level of less than 0.5% of the total fatty acid content of the extracted lipid and more preferably is absent from the total SUMMARY OF THE INVENTION 60 fatty acid content of the lipid. In another aspect, the invention provides extracted lipid, The present inventors have identified methods and plants preferably extracted plant lipid or extracted microbial lipid, for producing lipid with high levels of DHA and/or DPA. As comprising fatty acids in an esterified form, the fatty acids described in WO2013/185184, the present inventors have comprising docosapentaenoic acid (DPA) and/or docosa previously disclosed extracted plant lipid, and plants and 65 hexaenoic acid (DHA), wherein at least 35% of the DPA plant parts for producing Such lipid, comprising DHA in the and/or DHA esterified in the form of triacylglycerol (TAG) total fatty acid content of the extracted lipid of between 7% is esterified at the sn-2 position of the TAG. In an embodi US 9,725,399 B2 5 6 ment, the extracted lipid is further characterised by one or between 0.05% and about 4%, between 0.05% and more or all of (i) it comprises fatty acids comprising oleic about 3%, or between 0.05% and about 2%, acid, palmitic acid, ()6 fatty acids which comprise linoleic vii) the level of stearidonic acid (SDA) in the total fatty acid (LA), (D3 fatty acids which comprise O-linolenic acid acid content of the extracted lipid is less than about (ALA) and optionally one or more of Stearidonic acid 5 10%, less than about 8%, less than about 7%, less than (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic about 6%, less than about 4%, less than about 3%, acid (ETA), (ii) at least about 40%, at least about 45%, at between about 0.05% and about 7%, between about least about 48%, between 35% and about 60%, or between 0.05% and about 6%, between about 0.05% and about 35% and about 50%, of the DPA and/or DHA esterified in 4%, between about 0.05% and about 3%, between the form of triacylglycerol (TAG) is esterified at the sn-2 10 position of the TAG, and (iii) the level of DPA and/DHA in about 0.05% and about 10%, or between 0.05% and the total fatty acid content of the extracted lipid is between about 2%, about 1% and 35%, or between about 7% and 35% or viii) the level of eicosatetraenoic acid (ETA) in the total between about 20.1% and 35%. In embodiments of this fatty acid content of the extracted lipid is less than aspect, the level of DPA and/or DHA in the total fatty acid 15 about 6%, less than about 5%, less than about 4%, less content of the extracted lipid is about 7%, about 8%, about than about 1%, less than about 0.5%, between 0.05% 9%, about 10%, about 12%, about 15%, about 18%, about and about 6%, between 0.05% and about 5%, between 20%, about 22%, about 24%, about 26%, about 28%, about 0.05% and about 4%, between 0.05% and about 3%, or 30%, between about 7% and about 28%, between about 7% between 0.05% and about 2%, and about 25%, between about 10% and 35%, between ix) the level of eicosatrienoic acid (ETrA) in the total fatty about 10% and about 30%, between about 10% and about acid content of the extracted lipid is less than 4%, less 25%, between about 10% and about 22%, between about than about 2%, less than about 1%, between 0.05% and 14% and 35%, between about 16% and 35%, between about 4%, between 0.05% and 3%, or between 0.05% and 16% and about 30%, between about 16% and about 25%, or about 2%, or between 0.05% and about 1%, between about 16% and about 22%. In preferred embodi 25 x) the level of eicosapentaenoic acid (EPA) in the total ments, the extracted lipid is characterised by (i) and (ii), (i) fatty acid content of the extracted lipid is between 4% and (iii) or (ii) and (iii), more preferably all of (i), (ii) and and 15%, less than 4%, less than about 3%, less than (iii). Preferably, the extracted lipid is further characterised about 2%, between 0.05% and 10%, between 0.05% by a level of palmitic acid in the total fatty acid content of and 5%, between 0.05% and about 3%, or between the extracted lipid which is between about 2% and 16%, and 30 0.05% and about 2%, a level of myristic acid (C14:0) in the total fatty acid content xi) if the level of DHA in the total fatty acid content of the of the extracted lipid, if present, is less than 1%. extracted lipid is between 20.1% and 35%, the level of Embodiments of each of the four above aspects are docosapentaenoic acid (DPA) in the total fatty acid described in further detail below. As the skilled person content of the extracted lipid is less than 4%, less than would understand, any embodiments described which are 35 about 3%, less than about 2%, between 0.05% and 8%, broader than the corresponding feature in an above aspect do between 0.05% and 5%, between 0.05% and about 3%, not apply to that aspect. between 5% and 15%, between 5% and 10%, or In an embodiment, the extracted lipid has one or more of between 0.05% and about 2%, the following features xii) the level of DHA in the total fatty acid content of the i) the level of palmitic acid in the total fatty acid content 40 extracted lipid is about 22%, about 24%, about 26%, of the extracted lipid is between about 2% and 18%, about 28%, about 31%, between 20.1% and 29%, between about 2% and 16%, between about 2% and between 20.1% and 28%, between 20.1% and about 15%, or between about 3% and about 10%, 27%, between 20.1% and about 26%, between 20.1% ii) the level of myristic acid (C14:0) in the total fatty acid and about 25%, between 20.1% and about 24%, content of the extracted lipid is less than 6%, less than 45 between 21% and 35%, between 21% and 30%, 3%, less than 2%, less than 1%, or about 0.1%, between 21% and 28%, between 21% and about 26%, iii) the level of oleic acid in the total fatty acid content of or between 21% and about 24%, the extracted lipid is between about 1% and about 30%, xiii) the lipid comprises (D6-docosapentaenoic acid (22: between about 3% and about 30%, between about 6% 5^*-7''') in its fatty acid content, and about 30%, between 1% and about 20%, between 50 xiv) the lipid comprises less than 0.1% of ()6-docosapen about 30% and about 60%, about 45% to about 60%, taenoic acid (22:5^*'''') in its fatty acid content, about 30%, or between about 15% and about 30%, XV) the lipid comprises less than 0.1% of one or more or iv) the level of linoleic acid (LA) in the total fatty acid all of SDA, EPA and ETA in its fatty acid content, content of the extracted lipid is between about 4% and xvi) the level of total saturated fatty acids in the total fatty about 35%, between about 4% and about 20%, between 55 acid content of the extracted lipid is between about 4% about 4% and about 17%, or between about 5% and and about 25%, between about 4% and about 20%, about 10%, between about 6% and about 20%, or between about v) the level of O-linolenic acid (ALA) in the total fatty 6% and about 12%, acid content of the extracted lipid is between about 4% xvii) the level of total monounsaturated fatty acids in the and about 40%, between about 7% and about 40%, 60 total fatty acid content of the extracted lipid is between between about 10% and about 35%, between about about 4% and about 40%, between about 4% and about 20% and about 35%, between about 4% and 16%, or 35%, between about 8% and about 25%, between 8% between about 2% and 16%, and about 22%, between about 15% and about 40% or vi) the level of Y-linolenic acid (GLA) in the total fatty between about 15% and about 35%, acid content of the extracted lipid is less than 4%, less 65 xviii) the level of total polyunsaturated fatty acids in the than about 3%, less than about 2%, less than about 1%, total fatty acid content of the extracted lipid is between less than about 0.5%, between 0.05% and about 7%, about 20% and about 75%, between 30% and 75%, US 9,725,399 B2 7 8 between about 50% and about 75%, about 60%, about xxviii) the fatty acid composition of the lipid is based on 65%, about 70%, about 75%, or between about 60% an efficiency of conversion of ETA to EPA by A5-de and about 75%, saturase of at least about 60%, at least about 70%, at xix) the level of total (O6 fatty acids in the total fatty acid least about 75%, between about 60% and about 99%, content of the extracted lipid is between about 35% and between about 70% and about 99%, or between about about 50%, between about 20% and about 35%, 75% and about 98%, between about 6% and 20%, less than 20%, less than XXix) the fatty acid composition of the lipid is based on an about 16%, less than about 10%, between about 1% and efficiency of conversion of EPA to DPA by A5-elongase about 16%, between about 2% and about 10%, or of at least about 80%, at least about 85%, at least about 10 90%, between about 50% and about 99%, between between about 4% and about 10%, about 85% and about 99%, between about 50% and XX) the level of new co6 fatty acids in the total fatty acid about 95%, or between about 85% and about 95%, content of the extracted lipid is less than about 10%, XXX) if the level of DHA in the total fatty acid content of less than about 8%, less than about 6%, less than 4%, the extracted lipid is between 20.1% and 30% or between about 1% and about 20%, between about 1% 15 between 20.1% and 35%, the fatty acid composition of and about 10%, between 0.5% and about 8%, or the lipid is based on an efficiency of conversion of DPA between 0.5% and 4%, to DHA by A4-desaturase of at least about 80%, at least xxi) the level of total ()3 fatty acids in the total fatty acid about 90%, at least about 93%, between about 50% and content of the extracted lipid is between 36% and about about 95%, between about 80% and about 95%, or 65%, between 36% and about 70%, between 40% and between about 85% and about 95%, about 60%, between about 30% and about 60%, XXXi) the fatty acid composition of the lipid is based on an between about 35% and about 60%, between 40% and efficiency of conversion of oleic acid to DHA and/or about 65%, between about 30% and about 65%, DPA of at least about 10%, at least about 15%, at least between about 35% and about 65%, about 35%, about about 20%, at least about 25%, about 20%, about 25%, 40%, about 45%, about 50%, about 55%, about 60%, 25 about 30%, between about 10% and about 50%, about 65% or about 70%, between about 10% and about 30%, between about xxii) the level of new co3 fatty acids in the total fatty acid 10% and about 25% or between about 20% and about content of the extracted lipid is between 21% and about 30%, 45%, between 21% and about 35%, between about 23% XXXii) the fatty acid composition of the lipid is based on and about 35%, between about 25% and about 35%, 30 an efficiency of conversion of LA to DHA and/or DPA between about 27% and about 35%, about 23%, about of at least about 15%, at least about 20%, at least about 25%, about 27%, about 30%, about 35%, about 40% or 22%, at least about 25%, at least about 30%, at least about 45%, about 40%, about 25%, about 30%, about 35%, about xxiii) the ratio of total (O6 fatty acids: total ()3 fatty acids 40%, about 45%, about 50%, between about 15% and in the fatty acid content of the extracted lipid is between 35 about 50%, between about 20% and about 40%, or about 1.0 and about 3.0, between about 0.1 and about between about 20% and about 30%, 1, between about 0.1 and about 0.5, less than about XXXiii) the fatty acid composition of the lipid is based on 0.50, less than about 0.40, less than about 0.30, less an efficiency of conversion of ALA to DHA and/or DPA than about 0.20, less than about 0.15, about 1.0, about of at least about 17%, at least about 22%, at least about 0.1, about 0.10 to about 0.4, or about 0.2, 40 24%, at least about 30%, about 30%, about 35%, about xxiv) the ratio of new ()6 fatty acids: new co3 fatty acids 40%, about 45%, about 50%, about 55%, about 60%, in the fatty acid content of the extracted lipid is between between about 22% and about 70%, between about about 1.0 and about 3.0, between about 0.02 and about 17% and about 55%, between about 22% and about 0.1, between about 0.1 and about 1, between about 0.1 40%, or between about 24% and about 40%, and about 0.5, less than about 0.50, less than about 45 XXXiv) the total fatty acid in the extracted lipid has less 0.40, less than about 0.30, less than about 0.20, less than 1.5% C20:1, less than 1% C20:1 or about 1% than about 0.15, about 0.02, about 0.05, about 0.1, C20:1, about 0.2 or about 1.0, XXXV) the triacylglycerol (TAG) content of the lipid is at XXV) the fatty acid composition of the lipid is based on an least about 70%, at least about 80%, at least about 90%, efficiency of conversion of oleic acid to LA by A12 50 at least 95%, between about 70% and about 99%, or desaturase of at least about 60%, at least about 70%, at between about 90% and about 99%, least about 80%, between about 60% and about 98%, XXXvi) the lipid comprises diacylglycerol (DAG), which between about 70% and about 95%, or between about DAG preferably comprises DHA and/or DPA, 75% and about 90%, XXXvii) the lipid comprises less than about 10%, less than XXvi) the fatty acid composition of the lipid is based on an 55 about 5%, less than about 1%, or between about efficiency of conversion of ALA to SDA by A6-desatu 0.001% and about 5%, free (non-esterified) fatty acids rase of at least about 30%, at least about 40%, at least and/or phospholipid, or is essentially free thereof, about 50%, at least about 60%, at least about 70%, XXXviii) at least 70%, at least 72% or at least 80%, of the between about 30% and about 70%, between about DHA and/or DPA esterified in the form of TAG is in the 35% and about 60%, or between about 50% and about 60 sn-1 or sn-3 position of the TAG, 70%, XXXiX) the most abundant DHA-containing TAG species XXvii) the fatty acid composition of the lipid is based on in the lipid is DHA/18:3/18:3 (TAG 58:12), the lipid an efficiency of conversion of SDA to ETA acid by comprises tri-DHATAG (TAG 66:18), and A6-elongase of at least about 60%, at least about 70%, xl) the level of DPA in the total fatty acid content of the at least about 75%, between about 60% and about 95%, 65 extracted lipid is about 7%, about 8%, about 9%, about between about 70% and about 88%, or between about 10%, about 12%, about 15%, about 18%, about 20%, 75% and about 85%, about 22%, about 24%, about 26%, about 28%, about US 9,725,399 B2 9 10 31%, between about 7% and about 31%, between about xxi) at least 70% of the DHAesterified in the form of TAG 7% and about 28%, between about 10% and 35%, is in the sn-1 or sn-3 position of the TAG. between about 10% and about 30%, between about XXii) the most abundant DHA-containing TAG species in 10% and about 25%, between about 10% and about the extracted plant lipid is DHA/18:3/18:3 (TAG 22%, between about 14% and 35%, between about 16% 5 58:12), and and 35%, between about 16% and about 30%, between xxiii) the extracted plant lipid comprises tri-DHA TAG about 16% and about 25%, or between about 16% and (TAG 66:18). about 22%, optionally wherein the level of DHA is less In an embodiment, the level of eicosapentaenoic acid than 0.5% of the total fatty acid content of the extracted (EPA) in the total fatty acid content of the extracted plant lipid. 10 lipid is between 0.05% and 10%. In another embodiment, where DHA is present between In another embodiment, the extracted lipid has one or 20.1% and 35%, the level of docosapentaenoic acid (DPA) more of the following features in the total fatty acid content of the extracted plant lipid is i) the level of palmitic acid in the total fatty acid content less than about 4%. of the extracted plant lipid is between 2% and 15%, 15 In a further embodiment, the level of DHA in the total ii) the level of myristic acid (C14:0) in the total fatty acid fatty acid content of the extracted plant lipid is between content of the extracted plant lipid is about 0.1%, 20.1% and 30%. iii) the level of oleic acid in the total fatty acid content of In another embodiment, the extracted lipid is in the form the extracted plant lipid is between 1% and 30%, of an oil, wherein at least about 90%, least about 95%, at iv) the level of linoleic acid (LA) in the total fatty acid least about 98%, or between about 95% and about 98%, by content of the extracted plant lipid is between 4% and weight of the oil is the lipid. 20%, In a preferred embodiment of the first two aspects above, v) the level of O-linolenic acid (ALA) in the total fatty the lipid or oil, preferably a seedoil, has the following acid content of the extracted plant lipid is between 4% features: in the total fatty acid content of the lipid or oil, the and 40%, 25 level of DHA is between about 20.1% and 30% or between vi) the level of Y-linolenic acid (GLA) in the total fatty 20.1% and 35%, the level of palmitic acid is between about acid content of the extracted plant lipid is between 2% and about 16%, the level of myristic acid is less than 0.05% and 7%, about 6%, the level of oleic acid is between about 1% and vii) the level of stearidonic acid (SDA) in the total fatty about 30%, the level of LA is between about 4% and about acid content of the extracted plant lipid is between 30 35%. ALA is present, the level of total saturated fatty acids 0.05% and 10%, in the total fatty acid content of the extracted lipid is between viii) the level of eicosatetraenoic acid (ETA) in the total about 4% and about 25%, the ratio of total ()6 fatty acids: fatty acid content of the extracted plant lipid is less than total ()3 fatty acids in the fatty acid content of the extracted 6%, lipid is between 0.05 and about 3.0, and the triacylglycerol ix) the level of eicosatrienoic acid (ETrA) in the total fatty 35 (TAG) content of the lipid is at least about 70%, and acid content of the extracted plant lipid is less than 4%. optionally the lipid is essentially free of cholesterol and/or x) the extracted plant lipid comprises less than 0.1% of the lipid comprises tri-DHATAG (TAG 66:18). More pref co6-docosapentaenoic acid (22:5^*''''') in its fatty erably, the lipid or oil, preferably a seedoil, additionally has acid content, one or more or all of the following features: at least 70% of xi) the level of new ()6 fatty acids in the total fatty acid 40 the DHA is esterified at the sn-1 or sn-3 position of triacyl content of the extracted plant lipid is less than 10%, glycerol (TAG), ALA is presentata level of between 4% and xii) the ratio of total ()6 fatty acids:total ()3 fatty acids in 40% of the total fatty acid content, GLA is present and/or the the fatty acid content of the extracted plant lipid is level of GLA is less than 4% of the total fatty acid content, between 1.0 and 3.0, or between 0.1 and 1, the level of SDA is between 0.05% and about 10%, the level xiii) the ratio of new co6 fatty acids:new co3 fatty acids in 45 of ETA is less than about 4%, the level of EPA is between the fatty acid content of the extracted plant lipid is 0.05% and about 10%, the level of DPA is between 0.05% between 1.0 and 3.0, between 0.02 and 0.1, or between and about 8%, the level of total monounsaturated fatty acids 0.1 and 1, in the total fatty acid content of the extracted lipid is between xiv) the fatty acid composition of the extracted plant lipid about 4% and about 35%, the level of total polyunsaturated is based on an efficiency of conversion of oleic acid to 50 fatty acids in the total fatty acid content of the extracted lipid DHA of at least 10%, is between about 20% and about 75%, the ratio of new (06 XV) the fatty acid composition of the extracted plant lipid fatty acids: new co3 fatty acids in the fatty acid content of the is based on an efficiency of conversion of LA to DHA extracted lipid is between about 0.03 and about 3.0, prefer of at least 15%, ably less than about 0.50, the fatty acid composition of the xvi) the fatty acid composition of the extracted plant lipid 55 lipid is based on: an efficiency of conversion of oleic acid to is based on an efficiency of conversion of ALA to DHA LA by A12-desaturase of at least about 60%, an efficiency of of at least 17%, conversion of SDA to ETA acid by A6-elongase of at least xvii) the total fatty acid in the extracted plant lipid has less about 60%, an efficiency of conversion of EPA to DPA by than 1.5% C20:1, and A5-elongase of between about 50% and about 95%, an xviii) the triacylglycerol (TAG) content of the extracted 60 efficiency of conversion of DPA to DHA by A4-desaturase of plant lipid is at least 70%, and may be characterised by between about 50% and about 95%, an efficiency of con one or more of the following features version of oleic acid to DHA of at least about 10%. Most xix) the extracted plant lipid comprises diacylglycerol preferably, at least 81% of the DHA is esterified at the sn-1 (DAG) which comprises DHA. or sn-3 position of triacylglycerol (TAG). XX) the extracted plant lipid comprises less than 10% free 65 In a preferred embodiment of the third aspect above, the (non-esterified) fatty acids and/or phospholipid, or is lipid or oil, preferably a seedoil, has the following features: essentially free thereof, in the total fatty acid content of the lipid or oil, the level of US 9,725,399 B2 11 12 DPA is between about 7% and 30% or between about 7% acids:new co3 fatty acids in the fatty acid content of the and 35%, the level of palmitic acid is between about 2% and extracted lipid is between about 0.03 and about 3.0, prefer about 16%, the level of myristic acid is less than 1%, the ably less than about 0.50, the fatty acid composition of the level of oleic acid is between about 1% and about 30%, the lipid is based on: an efficiency of conversion of oleic acid to level of LA is between about 4% and about 35%, ALA is LA by A12-desaturase of at least about 60%, an efficiency of present, the level of total saturated fatty acids in the total conversion of SDA to ETA acid by A6-elongase of at least fatty acid content of the extracted lipid is between about 4% about 60%, an efficiency of conversion of EPA to DPA by and about 25%, the ratio of total (O6 fatty acids:total co3 fatty A5-elongase of between about 50% and about 95%, an acids in the fatty acid content of the extracted lipid is efficiency of conversion of DPA to DHA by A4-desaturase between 0.05 and about 3.0, and the triacylglycerol (TAG) 10 (if present) of between about 50% and about 95%, an content of the lipid is at least about 70%, and optionally the efficiency of conversion of oleic acid to DPA of at least about lipid is essentially free of cholesterol and/or the lipid com 10%. prises tri-DPATAG (TAG 66:15). More preferably, the lipid In the context of the extracted lipid or oil of the invention, or oil, preferably a seedoil, additionally has one or more or the level of DHA and/or DPA in the extracted lipid or oil has all of the following features: at least 70% of the DPA is 15 not been increased, or is substantially the same as, the level esterified at the sn-1 or sn-3 position of triacylglycerol of DHA and/or DPA in the lipid or oil of the plant part or (TAG), ALA is present at a level of between 4% and 40% of microbe prior to extraction. In other words, no procedure has the total fatty acid content, GLA is present and/or the level been performed to increase the level of DHA and/or DPA in of GLA is less than 4% of the total fatty acid content, the the lipid or oil relative to other fatty acids post-extraction. As level of SDA is between 0.05% and about 10%, the level of would be apparent, the lipid or oil may Subsequently be ETA is less than about 4%, the level of EPA is between treated by fractionation or other procedures to alter the fatty 0.05% and about 10%, the level of total monounsaturated acid composition. fatty acids in the total fatty acid content of the extracted lipid In a further preferred embodiment, the lipid or oil, pref is between about 4% and about 35%, the level of total erably a seedoil, has the following features: in the total fatty polyunsaturated fatty acids in the total fatty acid content of 25 acid content of the lipid or oil, the level of DHA is between the extracted lipid is between about 20% and about 75%, the about 20.1% and 30% or between about 20.1% and 35%, the ratio of new ()6 fatty acids:new co3 fatty acids in the fatty level of palmitic acid is between about 2% and about 16%, acid content of the extracted lipid is between about 0.03 and the level of myristic acid is less than about 6% and prefer about 3.0, preferably less than about 0.50, the fatty acid ably less than 1%, the level of oleic acid is between about composition of the lipid is based on: an efficiency of 30 1% and about 30%, the level of LA is between about 4% and conversion of oleic acid to LA by A12-desaturase of at least about 35%. ALA is present, GLA is present, the level of about 60%, an efficiency of conversion of SDA to ETA acid SDA is between about 0.05% and about 10%, the level of by A6-elongase of at least about 60%, an efficiency of ETA is less than about 6%, the level of EPA is between about conversion of EPA to DPA by A5-elongase of between about 0.05% and about 10%, the level of DPA is between about 50% and about 95%, an efficiency of conversion of oleic 35 0.05% and about 8%. acid to DPA of at least about 10%. Most preferably, at least In another preferred embodiment, the lipid or oil, prefer 81% of the DPA is esterified at the sn-1 or sn-3 position of ably a seedoil and more preferably a Brassica seedoil such triacylglycerol (TAG). as mustard oil or canola oil, has the following features: in the In another preferred embodiment of the fourth aspect total fatty acid content of the lipid or oil, the level of DPA above, the lipid or oil, preferably a seedoil, comprising DHA 40 is between about 7% and 35%, the level of palmitic acid is and/or DPA has the following features: in the total fatty acid between about 2% and about 16%, the level of myristic acid content of the lipid or oil, the level of palmitic acid is is less than about 6% and preferably less than 1%, the level between about 2% and about 16%, the level of myristic acid of oleic acid is between about 1% and about 30%, the level is less than 1%, the level of oleic acid is between about 1% of LA is between about 4% and about 35%, ALA is present, and about 30%, the level of LA is between about 4% and 45 the level of SDA is between about 0.05% and about 10%, the about 35%. ALA is present, the level of total saturated fatty level of ETA is less than about 6%, the level of EPA is acids in the total fatty acid content of the extracted lipid is between about 0.05% and about 10%. DHA may or may not between about 4% and about 25%, the ratio of total (O6 fatty be present in the lipid or oil. Preferably, DHA, if present, is acids:total ()3 fatty acids in the fatty acid content of the present at a level of not more than 0.5% of the total fatty acid extracted lipid is between 0.05 and about 3.0, the triacyl 50 content of the lipid or oil and more preferably is absent from glycerol (TAG) content of the lipid is at least about 70%, and the total fatty acid content of the lipid or oil. Optionally, the optionally the lipid comprises tri-DHA TAG (TAG 66:18) lipid is essentially free of cholesterol and/or the lipid com and/or tri-DPATAG (TAG 66:15), wherein at least 35% of prises tri-DPATAG (TAG 66:15). More preferably, the lipid the DPA and/or DHA esterified in the form of triacylglycerol or oil, preferably a seedoil, additionally has one or more or (TAG) is esterified at the sn-2 position of the TAG. More 55 all of the following features: at least 70% of the DPA is preferably, the lipid or oil, preferably a seedoil, additionally esterified at the sn-1 or sn-3 position of triacylglycerol has one or more or all of the following features: ALA is (TAG), ALA is present at a level of between 4% and 40% of present at a level of between 4% and 40% of the total fatty the total fatty acid content, GLA is present and/or the level acid content, GLA is present and/or the level of GLA is less of GLA is less than 4% of the total fatty acid content, the than 4% of the total fatty acid content, the level of SDA is 60 level of SDA is between 0.05% and about 10%, the level of between 0.05% and about 10%, the level of ETA is less than ETA is less than about 4%, the level of EPA is between about 4%, the level of EPA is between 0.05% and about 0.05% and about 10%, the level of total monounsaturated 10%, the level of total monounsaturated fatty acids in the fatty acids in the total fatty acid content of the extracted lipid total fatty acid content of the extracted lipid is between about is between about 4% and about 35%, the level of total 4% and about 35%, the level of total polyunsaturated fatty 65 polyunsaturated fatty acids in the total fatty acid content of acids in the total fatty acid content of the extracted lipid is the extracted lipid is between about 20% and about 75%, the between about 20% and about 75%, the ratio of new co6 fatty ratio of new ()6 fatty acids:new co3 fatty acids in the fatty US 9,725,399 B2 13 14 acid content of the extracted lipid is between about 0.03 and oil, MiscanthusXgiganteus oil, or Miscanthus sinensis oil. In about 3.0, preferably less than about 0.50, the fatty acid a further embodiment, the oil is canola oil, mustard (B. composition of the lipid is based on: an efficiency of juncea) oil, soybean (Glycine max) oil, Camelina saliva oil conversion of oleic acid to LA by A12-desaturase of at least or Arabidopsis thaliana oil. In an alternate embodiment, the about 60%, an efficiency of conversion of SDA to ETA acid 5 oil is a plant oil other than A. thaliana oil and/or other than by A6-elongase of at least about 60%, an efficiency of C. sativa oil. In an embodiment, the plant oil is an oil other conversion of EPA to DPA by A5-elongase of between about than G. max (soybean) oil. In an embodiment, the oil was 50% and about 95%, an efficiency of conversion of oleic obtained from a plant grown under standard conditions, for acid to DPA of at least about 10%. In an embodiment, at least Example as described in Example 1, or from a plant grown 81% of the DPA is esterified at the sn-1 or sn-3 position of 10 triacylglycerol (TAG). Alternatively, at least 35% of the in the field or in a glasshouse under standard conditions. DPA esterified in the form of TAG is esterified at the sn-2 In another aspect, the present invention provides a process position of TAG. for producing extracted plant lipid, comprising the steps of In a further embodiment, the extracted lipid of the inven i) obtaining a plant part comprising lipid, the lipid com tion further comprises one or more sterols, preferably plant 15 prising fatty acids in an esterified form, the fatty acids sterols. comprising oleic acid, palmitic acid, (D6 fatty acids which In another embodiment, the extracted lipid is in the form comprise linoleic acid (LA) and Y-linolenic acid (GLA), (03 of an oil, and comprises less than about 10 mg of sterols/g fatty acids which comprise O-linolenic acid (ALA), Steari of oil, less than about 7 mg of sterols/g of oil, between about donic acid (SDA), docosapentaenoic acid (DPA) and doco 1.5 mg and about 10 mg of sterols/g of oil, or between about sahexaenoic acid (DHA), and optionally one or more of 1.5 mg and about 7 mg of sterols/g of oil. eicosapentaenoic acid (EPA) and eicosatetraenoic acid Examples of sterols which can be in the extracted lipid (ETA), wherein the level of DHA in the total fatty acid include, but are not necessarily limited to, one or more or all content of extractable lipid in the plant part is between of campesterol/24-methylcholesterol, A5-Stigmasterol, ebu 20.1% and 30% or between 20.1% and 35%, and ricol, B-sitosterol/24-ethylcholesterol, A5-avenasterol/isoflu 25 ii) extracting lipid from the plant part, costerol, A7-Stigmasterol/stigmast-7-en-33-ol, and A7-ave wherein the level of DHA in the total fatty acid content of nasterol. the extracted lipid is between 20.1% and 30% or between In an embodiment, the plant species is one listed in Table 20.1% and 35%. 14. Such as canola, and the level of sterols are about the same In a further aspect, the present invention provides a as that listed in Table 14 for that particular plant species. The 30 process for producing extracted plant lipid, comprising the plant species may be mustard (B. juncea) or C. saliva and comprise a level of sterols about that found in wild-type steps of mustard or C. saliva extracted oil, respectively. i) obtaining a plant part comprising lipid, the lipid com In an embodiment, the extracted plant lipid comprises one prising fatty acids in an esterified form, the fatty acids or more or all of campesterol/24-methylcholesterol, A5-stig 35 comprising oleic acid, palmitic acid, (D6 fatty acids which masterol, eburicol, B-sitosterol/24-ethylcholesterol, A5-ave comprise linoleic acid (LA) and Y-linolenic acid (GLA), (03 nasterol/isoflucosterol, A7-Stigmasterol/stigmast-7-en-33-ol, fatty acids which comprise O-linolenic acid (ALA), Steari and A7-avenasterol, or which has a sterol content essentially donic acid (SDA), docosapentaenoic acid (DPA) and doco the same as wild-type canola oil. sahexaenoic acid (DHA), and optionally one or more of In an embodiment, the extracted lipid has a sterol content 40 eicosapentaenoic acid (EPA) and eicosatetraenoic acid essentially the same as wild-type canola oil, mustard oil or (ETA), wherein the level of palmitic acid in the total fatty C. saliva oil. acid content of the extracted lipid is between about 2% and In an embodiment, the extracted lipid comprises less than 16%, and wherein the level of myristic acid (C14:0) in the about 0.5 mg of cholesterol/g of oil, less than about 0.25 mg total fatty acid content of the extracted lipid, if present, is of cholesterol/g of oil, between about 0 mg and about 0.5 mg 45 less than 1%, and wherein the level of DHA in the total fatty of cholesterol/g of oil, or between about 0 mg and about 0.25 acid content of extractable lipid in the plant part is between mg of cholesterol/g of oil, or which is essentially free of 20.1% and 30% or between 20.1% and 35%, and cholesterol. ii) extracting lipid from the plant part, In a further embodiment, the lipid is an oil, preferably oil wherein the level of DHA in the total fatty acid content of from an oilseed. Examples of such oils include, but are not 50 the extracted lipid is between 20.1% and 30% or between limited to, Brassica sp. oil such as for example canola oil or 20.1% and 35%. mustard oil, Gossypium hirsutum oil, Linum usitatissimum In a further aspect, the present invention provides a oil, Helianthus sp. oil, Carthamus tinctorius oil, Glycine process for producing extracted plant lipid, comprising the max oil, Zea mays oil, Arabidopsis thaliana oil, Sorghum steps of bicolor oil, Sorghum vulgare oil, Avena saliva oil, Trifolium 55 i) obtaining a plant part comprising lipid, the lipid com sp. oil, Elaesis guineenis oil, Nicoriana benthamiana oil, prising fatty acids in an esterified form, the fatty acids Hordeum vulgare oil, Lupinus angustifolius oil, Oryza saliva comprising oleic acid, palmitic acid, (D6 fatty acids which oil, Oryza glaberrima oil, Camelina saliva oil, Crambe comprise linoleic acid (LA), ()3 fatty acids which comprise abyssinica oil, MiscanthusXgiganteus oil, or Miscanthus O-linolenic acid (ALA), Stearidonic acid (SDA), docosapen Sinensis oil. More preferably, the oil is a Brassica sp. oil, a 60 taenoic acid (DPA) and docosahexaenoic acid (DHA), and Camelina saliva oil or a Glycine max (soybean) oil. In an optionally one or more of eicosapentaenoic acid (EPA) and embodiment the lipid comprises or is Brassica sp. oil Such eicosatetraenoic acid (ETA), wherein the level of palmitic as Brassica napus oil or Brassica juncea oil, Gossypium acid in the total fatty acid content of the extracted lipid is hirsutum oil, Linum usitatissimum oil, Helianthus sp. oil, between about 2% and 16%, and wherein the level of Carthamus tinctorius oil, Glycine max oil, Zea mays oil, 65 myristic acid (C14:0) in the total fatty acid content of the Elaesis guineenis oil, Nicoriana benthamiana oil, Lupinus extracted lipid, if present, is less than 1%, and wherein the augustifolius oil, Camelina sativa oil, Crambe abyssinica level of DHA in the total fatty acid content of extractable US 9,725,399 B2 15 16 lipid in the plant part is between 20.1% and 30% or between In an embodiment of the above aspect, the invention 20.1% and 35%, and provides a process for producing extracted plant lipid or ii) extracting lipid from the plant part, microbial lipid, comprising the steps of i) obtaining a plant part or microbial cells comprising wherein the level of DHA in the total fatty acid content of 5 lipid, the lipid comprising fatty acids in an esterified form, the extracted lipid is between 20.1% and 30% or between wherein the lipid has a fatty acid composition comprising 20.1% and 35%. oleic acid, palmitic acid, ()6 fatty acids which comprise In an embodiment of the three above aspect, the invention linoleic acid (LA), ()3 fatty acids which comprise O-lino provides a process for producing extracted plant lipid, lenic acid (ALA) and docosahexaenoic acid (DPA), and one comprising the steps of 10 or more of Stearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), wherein (i) the level i) obtaining a plant part comprising lipid, the lipid com of DPA in the total fatty acid content of the extracted lipid prising fatty acids in an esterified form, wherein the lipid has is between 7% and 30% or between 7% and 35%, preferably a fatty acid composition comprising oleic acid, palmitic between 30% and 35%, (ii) the level of palmitic acid in the acid, (D6 fatty acids which comprise linoleic acid (LA), (03 15 total fatty acid content of the extracted lipid is between 2% fatty acids which comprise O-linolenic acid (ALA) and and 16%, (iii) the level of myristic acid (C14:0) in the total docosahexaenoic acid (DHA), and one or more of Steari fatty acid content of the extracted lipid is less than 6%, donic acid (SDA), eicosapentaenoic acid (EPA), docosapen preferably less than 1%. (iv) the level of oleic acid in the taenoic acid (DPA) and eicosatetraenoic acid (ETA). total fatty acid content of the extracted lipid is between 1% wherein (i) the level of DHA in the total fatty acid content and 30%, (v) the level of linoleic acid (LA) in the total fatty of the extracted lipid is between 20.1% and 30% or between acid content of the extracted lipid is between 4% and 35%, 20.1% and 35%, preferably between 30% and 35%, (ii) the (vi) the level of C-linolenic acid (ALA) in the total fatty acid level of palmitic acid in the total fatty acid content of the content of the extracted lipid is between 4% and 40%, (vii) extracted lipid is between 2% and 16%, (iii) the level of the level of eicosatrienoic acid (ETrA) in the total fatty acid myristic acid (C14:0) in the total fatty acid content of the 25 content of the extracted lipid is less than 4%. (viii) the level extracted lipid is less than 1%, (iv) the level of oleic acid in of total saturated fatty acids in the total fatty acid content of the total fatty acid content of the extracted lipid is between the extracted lipid is between 4% and 25%, (ix) the ratio of 1% and 30%, (v) the level of linoleic acid (LA) in the total total (O6 fatty acids: total co3 fatty acids in the fatty acid fatty acid content of the extracted lipid is between 4% and content of the extracted lipid is between 0.05 and 1, (x) the 35%, (vi) the level of C-linolenic acid (ALA) in the total 30 triacylglycerol (TAG) content of the lipid is at least 70%, fatty acid content of the extracted lipid is between 4% and and (xi) at least 70% of the DPA esterified in the form of 40%, (vii) the level of eicosatrienoic acid (ETrA) in the total TAG is in the sn-1 or sn-3 position of the TAG and fatty acid content of the extracted lipid is less than 4%. (viii) ii) extracting lipid from the plant part, the level of total saturated fatty acids in the total fatty acid wherein the level of DPA in the total fatty acid content of the content of the extracted lipid is between 4% and 25%, (ix) 35 extracted lipid is between about 7% and 30% or between 7% the ratio of total (O6 fatty acids: total co3 fatty acids in the and 35%, preferably between 30% and 35%. Preferably, at fatty acid content of the extracted lipid is between 0.05 and least 81% or at least 90% of the DPA esterified in the form 1, (x) the triacylglycerol (TAG) content of the lipid is at least of TAG is in the sn-1 or sn-3 position of the TAG. 70%, and (xi) at least 70% of the DHA esterified in the form In another aspect, the present invention provides a process of TAG is in the sn-1 or sn-3 position of the TAG, and 40 for producing extracted lipid, comprising the steps of i) obtaining cells, preferably a plant part comprising the ii) extracting lipid from the plant part, cells or microbial cells, comprising lipid, the lipid compris wherein the level of DHA in the total fatty acid content of ing fatty acids in an esterified form, the fatty acids com the extracted lipid is between about 20.1% and 30% or prising docosapentaenoic acid (DPA) and/or docosahexae between 20.1% and 35%, preferably between 30% and 35%. 45 noic acid (DHA), wherein at least 35% of the DPA and/or Preferably, at least 81% or at least 90% of the DHAesterified DHA esterified in the form of triacylglycerol (TAG) is in the form of TAG is in the sn-1 or sn-3 position of the TAG. esterified at the sn-2 position of the TAG, and In a further aspect, the invention provides a process for ii) extracting lipid from the cells, producing extracted plant lipid or microbial lipid, compris wherein at least 35% of the DPA and/or DHA esterified in ing the steps of 50 the form of triacylglycerol (TAG) in the total fatty acid i) obtaining a plant part or microbial cells comprising content of the extracted lipid is esterified at the sn-2 position lipid, the lipid comprising fatty acids in an esterified form, of the TAG. In an embodiment, the extracted lipid produced the fatty acids comprising oleic acid, palmitic acid, (D6 fatty by the process is further characterised by one or more or all acids which comprise linoleic acid (LA), ()3 fatty acids of (i) it comprises fatty acids comprising oleic acid, palmitic which comprise O-linolenic acid (ALA) and docosapentae 55 acid, (D6 fatty acids which comprise linoleic acid (LA), (03 noic acid (DPA), and optionally one or more of stearidonic fatty acids which comprise O-linolenic acid (ALA) and acid (SDA), eicosapentaenoic acid (EPA), and eicosatetra optionally one or more of Stearidonic acid (SDA), eicosa enoic acid (ETA), wherein the level of DPA in the total fatty pentaenoic acid (EPA), and eicosatetraenoic acid (ETA), (ii) acid content of the lipid of the plant part or microbial cells at least about 40%, at least about 45%, at least about 48%, between about 7% and 35%, and 60 between 35% and about 60%, or between 35% and about 50%, of the DPA and/or DHA esterified in the form of ii) extracting lipid from the plant part or microbial cells, triacylglycerol (TAG) is esterified at the sn-2 position of the wherein the level of DPA in the total fatty acid content of the TAG, and (iii) the level of DPA and/DHA in the total fatty extracted lipid is between about 7% and 35%. In an embodi acid content of the extracted lipid is between about 1% and ment, the level of DPA in the total fatty acid content of the 65 35%, or between about 7% and 35% or between about extracted lipid is between about 7% and 20%, or between 20.1% and 35%. In embodiments of this aspect, the level of 20.1% and 35%. DPA and/or DHA in the total fatty acid content of the US 9,725,399 B2 17 18 extracted lipid is about 7%, about 8%, about 9%, about 10%, would understand, any embodiments described which are about 12%, about 15%, about 18%, about 20%, about 22%, broader than the corresponding feature in an above aspect do about 24%, about 26%, about 28%, about 30%, between not apply to that aspect. about 7% and about 28%, between about 7% and about 25%, In an embodiment, the plant part is a seed, preferably an between about 10% and 35%, between about 10% and about oilseed. Examples of such seeds include, but are not limited 30%, between about 10% and about 25%, between about to, Brassica sp., Gossypium hirsutum, Linum usitatissimum, 10% and about 22%, between about 14% and 35%, between Helianthus sp., Carthamus tinctorius, Glycine max, Zea about 16% and 35%, between about 16% and about 30%, mays, Arabidopsis thaliana, Sorghum bicolor, Sorghum vul between about 16% and about 25%, or between about 16% gare, Avena saliva, Trifolium sp., Elaesis guineenis, Nico and about 22%. In preferred embodiments, the extracted 10 tiana benthamiana, Hordeum vulgare, Lupinus angustifo lipid is characterised by (i) and (ii), (i) and (iii) or (ii) and lius, Oryza saliva, Oryza glaberrima, Camelina sativa, or (iii), more preferably all of (i), (ii) and (iii). Preferably, the Crambe abyssinica, preferably a Brassica sp. seed, a C. extracted lipid is further characterised by a level of palmitic saliva seed or a G. max (soybean) seed, more preferably a acid in the total fatty acid content of the extracted lipid Brassica napus, B. juncea or C. saliva seed. In an embodi which is between about 2% and 16%, and a level of myristic 15 ment, the plant part is a seed, preferably an oilseed such as acid (C14:0) in the total fatty acid content of the extracted Brassica sp. Such as Brassica napus or Brassica juncea, lipid, if present, is less than 1%. Gossypium hirsutum, Linum usitatissimum, Helianthus sp., In an embodiment of the above aspect, the invention Carthamus tinctorius, Glycine max, Zea mays, Elaesis provides a process for producing extracted lipid, comprising guineenis, Nicotiana benthamiana, Lupinus angustifolius, the steps of Camelina sativa, or Crambe abyssinica, preferably a Bras i) obtaining cells, preferably a plant part comprising the sica napus, Biuncea or C. saliva seed. In an embodiment, cells or microbial cells, comprising lipid, the lipid compris the seed is canola seed, mustard seed, soybean seed, Cam ing fatty acids in an esterified form, the fatty acids com elina sativa seed or Arabidopsis thaliana seed. In an alter prising docosapentaenoic acid (DPA) and/or docosahexae nate embodiment, the seed is a seed other than A. thaliana noic acid (DHA), and further comprising oleic acid, palmitic 25 seed and/or other than C. sativa seed. In an embodiment, the acid, (D6 fatty acids which comprise linoleic acid (LA), (03 seed is a seed other than Soybean seed. In an embodiment, fatty acids which comprise O-linolenic acid (ALA), and one the plant part is Brassica sp. seed. In an embodiment, the or more of Stearidonic acid (SDA), eicosapentaenoic acid seed was obtained from a plant grown under standard (EPA), and eicosatetraenoic acid (ETA), wherein (i) the level conditions, for Example as described in Example 1, or from of palmitic acid in the total fatty acid content of the extracted 30 a plant grown in the field or in a glasshouse under standard lipid is between 2% and 16%, (ii) the level of myristic acid conditions. (C14:0) in the total fatty acid content of the extracted lipid In another embodiment, the seed comprises at least about is less than 1%, (iii) the level of oleic acid in the total fatty 18 mg, at least about 22 mg, at least about 26 mg, between acid content of the extracted lipid is between 1% and 30%, about 18 mg and about 100 mg, between about 22 mg and (iv) the level of linoleic acid (LA) in the total fatty acid 35 about 70 mg, about 80 mg, between about 30 mg and about content of the extracted lipid is between 4% and 35%, (v) the 80 mg. or between about 24 mg and about 50 mg. of DHA level of C-linolenic acid (ALA) in the total fatty acid content and/or DPA per gram of seed. of the extracted lipid is between 4% and 40%, (vi) the level In a further embodiment, the plant part such as a seed of eicosatrienoic acid (ETrA) in the total fatty acid content comprises exogenous polynucleotides encoding one of the of the extracted lipid is less than 4%. (vii) the level of total 40 following sets of enzymes; saturated fatty acids in the total fatty acid content of the i) an (03-desaturase, a A6-desaturase, a A5-desaturase, a extracted lipid is between 4% and 25%. (viii) the ratio of A4-desaturase, a A6-elongase and a A5-elongase, total (O6 fatty acids: total co3 fatty acids in the fatty acid ii) a A15-desaturase, a A6-desaturase, a A5-desaturase, a content of the extracted lipid is between 0.05 and 1, (ix) the A4-desaturase, a A6-elongase and a A5-elongase, triacylglycerol (TAG) content of the lipid is at least 70%, 45 iii) a A12-desaturase, a A6-desaturase, a A5-desaturase, a and (x) at least 35% of the DPA and/or DHA esterified in the A4-desaturase, a A6-elongase and an A5-elongase, form of triacylglycerol (TAG) is esterified at the sn-2 iv) a A12-desaturase, a (03-desaturase and/or a A15 position of the TAG, and desaturase, a A6-desaturase, a A5-desaturase, a A4-desatu ii) extracting lipid from the plant part, rase, a A6-elongase and an A5-elongase, wherein at least 35% of the DPA and/or DHA esterified in 50 V) an (03-desaturase, a A8-desaturase, a A5-desaturase, a the form of triacylglycerol (TAG) in the total fatty acid A4-desaturase, a A9-elongase and an A5-elongase, content of the extracted lipid is esterified at the sn-2 position vi) a A15-desaturase, a A8-desaturase, a A5-desaturase, a of the TAG. A4-desaturase, a A9-elongase and a A5-elongase, The step of obtaining the plant part or microbial cells may vii) a A12-desaturase, a A8-desaturase, a A5-desaturase, a comprise harvesting plant parts, preferably seed, from plants 55 A4-desaturase, a A9-elongase and an A5-elongase, that produce the plant parts, recovery of the microbial cells viii) a A12-desaturase, a (03-desaturase and/or a A15 from cultures of Such cells, or obtaining the plant parts or desaturase, a A8-desaturase, a A5-desaturase, a A4-desatu microbial cells by purchase from a producer or Supplier, or rase, a A9-elongase and an A5-elongase, and wherein each by importation. The process may comprise a step of deter polynucleotide is operably linked to one or more promoters mining the fatty acid composition of the lipid in a sample of 60 that are capable of directing expression of said polynucle the plant parts or microbial cells, or of the extracted lipid. otides in a cell of the plant part. In a preferred embodiment, the extracted lipid obtained by In a further embodiment, the plant part Such as a seed or a process of the invention has, where relevant, one or more recombinant cells Such as microbial cells comprise exog of the features defined herein, for example as defined above enous polynucleotides encoding one of the following sets of in relation to the first four aspects. 65 enzymes; Embodiments of each of the five above aspects are i) an (D3-desaturase and/or a A15-desaturase, a A6-desatu described in further detail below. As the skilled person rase, a A5-desaturase, a A6-elongase and a A5-elongase, US 9,725,399 B2 19 20 ii) a A12-desaturase, a A6-desaturase, a A5-desaturase, a In an embodiment, the A12-desaturase also has (D3-de A6-elongase and an A5-elongase, saturase and/or A15-desaturase activity, i.e. the activities are iii) a A12-desaturase, a (03-desaturase and/or a A15 conferred by a single polypeptide. Alternatively, the A12 desaturase, a A6-desaturase, a A5-desaturase, a A6-elongase desaturase does not have (O3-desaturase activity and does not and an A5-elongase, have A15-desaturase activity i.e. the A12-desaturase is a iv) an (03-desaturase and/or a A15-desaturase, a A8-de separate polypeptide to the polypeptide having to3-desatu saturase, a A5-desaturase, a A9-elongase and a A5-elongase, rase activity and/or A15-desaturase. V) a A12-desaturase, a A8-desaturase, a A5-desaturase, a In yet a further embodiment, the plant part such as a seed A9-elongase and an A5-elongase, or recombinant cells Such as microbial cells have one or 10 more or all of the following features: vi) a A12-desaturase, a (03-desaturase and/or a A15 i) the A12-desaturase converts oleic acid to linoleic acid desaturase, a A8-desaturase, a A5-desaturase, a A9-elongase in one or more cells of the plant part or in the recombinant and an A5-elongase, cells with an efficiency of at least about 60%, at least about and wherein each polynucleotide is operably linked to one or 70%, at least about 80%, between about 60% and about more promoters that are capable of directing expression of 95%, between about 70% and about 90%, or between about said polynucleotides in a cell of the plant part or the cells. 75% and about 85%, In an embodiment, if the plant part or cells comprise lipid ii) the co3-desaturase converts ()6 fatty acids to co3 fatty comprising fatty acids in an esterified form, the fatty acids acids in one or more cells of the plant part or in the comprising docosapentaenoic acid (DPA) and/or docosa recombinant cells with an efficiency of at least about 65%, hexaenoic acid (DHA), wherein at least 35% of the DPA at least about 75%, at least about 85%, between about 65% and/or DHA esterified in the form of triacylglycerol (TAG) and about 95%, between about 75% and about 91%, or is esterified at the sn-2 position of the TAG, the the plant part between about 80% and about 91%, Such as a seed or recombinant cells Such as microbial cells iii) the A6-desaturase converts ALA to SDA in one or comprise an exogenous polynucleotide encoding an 1-acyl more cells of the plant part or in the recombinant cells with glycerol-3-phosphate acyltransferase (LPAAT), wherein the 25 an efficiency of at least about 20%, at least about 30%, at polynucleotide is operably linked to one or more promoters least about 40%, at least about 50%, at least about 60%, at that are capable of directing expression of the polynucle least about 70%, between about 30% and about 70%, otide in a cell of the plant part or the cells. In a further between about 35% and about 60%, or between about 50% embodiment, the cells comprises exogenous polynucleotides and about 70%, encoding one of the following sets of enzymes; 30 iv) the A6-desaturase converts linoleic acid to Y-linolenic i) an 1-acyl-glycerol-3-phosphate acyltransferase acid in one or more cells of the plant part or in the (LPAAT), an ()3-desaturase, a A6-desaturase, a A5-desatu recombinant cells with an efficiency of less than about 5%, rase, a A6-elongase, a A5-elongase and optionally a A4-de less than about 2.5%, less than about 1%, between about Saturase, 0.1% and about 5%, between about 0.5% and about 2.5%, or ii) an 1-acyl-glycerol-3-phosphate acyltransferase 35 between about 0.5% and about 1%, (LPAAT), a A15-desaturase, a A6-desaturase, a A5-desatu v) the A6-elongase converts SDA to ETA in one or more rase, a A6-elongase, a A5-elongase and optionally a A4-de cells of the plant part or in the recombinant cells with an Saturase, efficiency of at least about 60%, at least about 70%, at least iii) an 1-acyl-glycerol-3-phosphate acyltransferase about 75%, between about 60% and about 95%, between (LPAAT), a A12-desaturase, a A6-desaturase, a A5-desatu 40 about 70% and about 80%, or between about 75% and about rase, a A6-elongase, an A5-elongase and optionally a A4-de 80%, Saturase, vi) the A5-desaturase converts ETA to EPA in one or more iv) an 1-acyl-glycerol-3-phosphate acyltransferase cells of the plant part or in the recombinant cells with an (LPAAT), a A12-desaturase, a co3-desaturase and/or a A15 efficiency of at least about 60%, at least about 70%, at least desaturase, a A6-desaturase, a A5-desaturase, a A6-elongase 45 about 75%, at least about 80%, at least about 90%, between and an A5-elongase and optionally a A4-desaturase, about 60% and about 95%, between about 70% and about V) an 1-acyl-glycerol-3-phosphate acyltransferase 95%, or between about 75% and about 95%, (LPAAT), an ()3-desaturase, a A8-desaturase, a A5-desatu vii) the A5-elongase converts EPA to DPA in one or more rase, a A9-elongase, an A5-elongase and optionally a A4-de cells of the plant part or in the recombinant cells with an Saturase, 50 efficiency of at least about 80%, at least about 85%, at least vi) an 1-acyl-glycerol-3-phosphate acyltransferase about 90%, between about 50% and about 90%, or between (LPAAT), a A15-desaturase, a A8-desaturase, a A5-desatu about 85% and about 95%, rase, a A9-elongase, a A5-elongase and optionally a A4-de viii) the A4-desaturase converts DPA to DHA in one or Saturase, more cells of the plant part or in the recombinant cells with vii) an 1-acyl-glycerol-3-phosphate acyltransferase 55 an efficiency of at least about 80%, at least about 90%, at (LPAAT), a A12-desaturase, a A8-desaturase, a A5-desatu least about 93%, between about 50% and about 95%, rase, a A9-elongase, an A5-elongase and optionally a A4-de between about 80% and about 95%, or between about 85% Saturase, and about 95%, viii) an 1-acyl-glycerol-3-phosphate acyltransferase ix) the efficiency of conversion of oleic acid to DHA or (LPAAT), a A12-desaturase, a co3-desaturase and/or a A15 60 DPA in one or more cells of the plant part or in the desaturase, a A8-desaturase, a A5-desaturase, a A9-elongase, recombinant cells is at least about 10%, at least about 15%, an A5-elongase and optionally a A4-desaturase, at least about 20%, at least about 25%, about 20%, about wherein each polynucleotide is operably linked to one or 25%, about 30%, between about 10% and about 50%, more promoters that are capable of directing expression of between about 10% and about 30%, between about 10% and said polynucleotides in the cell. Preferably, the LPAAT can 65 about 25%, or between about 20% and about 30%, use a C22 polyunsaturated fatty acyl-CoA substrate Such as x) the efficiency of conversion of LA to DHA or DPA in DHA-CoA and/or DPA-CoA. one or more cells of the plant part or in the recombinant cells US 9,725,399 B2 21 22 is at least about 15%, at least about 20%, at least about 22%, fragment thereof, or an amino acid sequence which is at least at least about 25%, at least about 30%, about 25%, about 50% identical to SEQ ID NO:9, 30%, about 35%, between about 15% and about 50%, iv) the A6-elongase comprises amino acids having a between about 20% and about 40%, or between about 20% sequence as provided in SEQ ID NO:16, a biologically and about 30%, active fragment thereof such as SEQID NO:17, or an amino xi) the efficiency of conversion of ALA to DHA or DPA acid sequence which is at least 50% identical to SEQ ID in one or more cells of the plant part or in the recombinant NO:16 and/or SEQ ID NO:17, cells is at least about 17%, at least about 22%, at least about V) the A5-desaturase comprises amino acids having a 24%, at least about 30%, about 30%, about 35%, about 40%, sequence as provided in SEQ ID NO:20, a biologically between about 17% and about 55%, between about 22% and 10 active fragment thereof, or an amino acid sequence which is about 35%, or between about 24% and about 35%, at least 50% identical to SEQ ID NO:20, xii) one or more cells of the plant part or the recombinant vi) the A5-elongase comprises amino acids having a cells comprise at least about 25%, at least about 30%, sequence as provided in SEQ ID NO:25, a biologically between about 25% and about 40%, or between about 27.5% 15 active fragment thereof, or an amino acid sequence which is and about 37.5%, more (03 fatty acids than corresponding at least 50% identical to SEQ ID NO:25, and cells lacking the exogenous polynucleotides, vii) the A4-desaturase comprises amino acids having a xiii) the A6-desaturase preferentially desaturates C-lino sequence as provided in SEQ ID NO:28, a biologically lenic acid (ALA) relative to linoleic acid (LA), active fragment thereof, or an amino acid sequence which is Xiv) the A6-elongase also has A9-elongase activity, at least 50% identical to SEQ ID NO:28. XV) the A12-desaturase also has A15-desaturase activity, In an embodiment, the plant part Such as a seed or the Xvi) the A6-desaturase also has A8-desaturase activity, recombinant cells Such as microbial cells further comprise(s) Xvii) the A8-desaturase also has A6-desaturase activity or an exogenous polynucleotide encoding a diacylglycerol does not have A6-desaturase activity, acyltransferase (DGAT), monoacylglycerol acyltransferase xviii) the A15-desaturase also has co3-desaturase activity 25 (MGAT), glycerol-3-phosphate acyltransferase (GPAT), on GLA, 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) pref xix) the (O3-desaturase also has A15-desaturase activity on erably an LPAAT which can use a C22 polyunsaturated fatty LA, acyl-CoA substrate such as DHA-CoA and/or DPA-CoA, XX) the co3-desaturase desaturates both LA and/or GLA, acyl-CoA:lysophosphatidylcholine acyltransferase (LP xxi) the co3-desaturase preferentially desaturates GLA 30 CAT), phospholipase A (PLA), phospholipase C (PLC), relative to LA, phospholipase D (PLD), CDP-choline diacylglycerol cho XXii) one or more or all of the desaturases, preferably the line phosphotransferase (CPT), phosphatidylcholine diacyl A6-desaturase and/or the A5-desaturase, have greater activ ity on an acyl-CoA Substrate than a corresponding acyl-PC glycerol acyltransferase (PDAT), phosphatidylcholine:dia Substrate, 35 cylglycerol choline phosphotransferase (PDCT), acyl-CoA XXiii) the A6-desaturase has greater A6-desaturase activity synthase (ACS), or a combination of two or more thereof. on ALA than LA as fatty acid Substrate, In another embodiment, the plant part Such as a seed or the XXiv) the A6-desaturase has greater A6-desaturase activity recombinant cells Such as microbial cells further comprise(s) on ALA-CoA as fatty acid Substrate than on ALA joined to an introduced mutation or an exogenous polynucleotide the sn-2 position of PC as fatty acid substrate, 40 which down regulates the production and/or activity of an XXV) the A6-desaturase has at least about a 2-fold greater endogenous enzyme in a cell of the plant part selected from A6-desaturase activity, at least 3-fold greater activity, at least FAE1, DGAT, MGAT, GPAT, LPAAT, LPCAT, PLA, PLC, 4-fold greater activity, or at least 5-fold greater activity, on PLD, CPT, PDAT, a thioesterase such as FATB, or a A12 ALA as a Substrate compared to LA, desaturase, or a combination of two or more thereof. XXVi) the A6-desaturase has greater activity on ALA-CoA 45 In a further embodiment, at least one, or all, of the as fatty acid Substrate than on ALA joined to the Sn-2 promoters are seed specific promoters. In an embodiment, at position of PC as fatty acid substrate, least one, or all, of the promoters have been obtained from XXvii) the A6-desaturase has at least about a 5-fold greater an oil biosynthesis or accumulation gene Such as a gene A6-desaturase activity or at least 10-fold greater activity, on encoding oleosin, or from a seed storage protein genes such ALA-CoA as fatty acid substrate than on ALA joined to the 50 as a gene encoding conlinin. sn-2 position of PC as fatty acid substrate, In another embodiment, the promoter(s) directing expres XXViii) the desaturase is a front-end desaturase, and sion of the exogenous polynucleotides encoding the A4-de xxix) the A6-desaturase has no detectable A5-desaturase saturase and the A5-elongase initiate expression of the activity on ETA. polynucleotides in developing seed of the plant or the In yet a further embodiment, the plant part such as a seed 55 or the recombinant cell such as microbial cells has one or recombinant cells such as the microbial cells before, or reach more or all of the following features peak expression before, the promoter(s) directing expression i) the A12-desaturase comprises amino acids having a of the exogenous polynucleotides encoding the A12-desatu sequence as provided in SEQID NO:4, a biologically active rase and the (O3-desaturase. fragment thereof, or an amino acid sequence which is at least 60 In a further embodiment, the exogenous polynucleotides 50% identical to SEQ ID NO:4, are covalently linked in a DNA molecule, preferably a ii) the (O3-desaturase comprises amino acids having a T-DNA molecule, integrated into the genome of cells of the sequence as provided in SEQID NO:6, a biologically active plant part or the recombinant cells such as the microbial cells fragment thereof, or an amino acid sequence which is at least and preferably where the number of such DNA molecules 50% identical to SEQ ID NO:6, 65 integrated into the genome of the cells of the plant part or the iii) the A6-desaturase comprises amino acids having a recombinant cells is not more than one, two or three, or is sequence as provided in SEQID NO:9, a biologically active two or three. US 9,725,399 B2 23 24 In yet another embodiment, the plant part comprises at eicosatetraenoic acid (ETA), wherein the level of DPA in the least two different, exogenous polynucleotides each encod total fatty acid content of the extracted lipid is between about ing a A6-desaturase which have the same or different amino 7% and 35%, preferably between 20.1% and 30% or acid sequences. between 20.1% and 35%, thereby producing the methyl or In a further embodiment, the total oil content of the plant ethyl esters of polyunsaturated fatty acids. part comprising the exogenous polynucleotides is at least In another aspect, the present invention provides a process about 40%, at least about 50%, at least about 60%, at least for producing methyl or ethyl esters of docosapentaenoic about 70%, between about 50% and about 80%, or between acid (DPA) and/or docosahexaenoic acid (DHA), the process about 80% and about 100% of the total oil content of a comprising reacting triacylglycerols (TAG) in extracted corresponding plant part lacking the exogenous polynucle 10 plant lipid, or during the process of extraction, with metha otides. In a further embodiment, the seed comprising the nol or ethanol, respectively, wherein the extracted plant lipid exogenous polynucleotides has a seed weight at least about comprises fatty acids in an esterified form, the fatty acids 40%, at least about 50%, at least about 60%, at least about comprising docosapentaenoic acid (DPA) and/or docosa 70%, between about 50% and about 80%, or between about hexaenoic acid (DHA), wherein at least 35% of the DPA 80% and about 100% of the weight of a corresponding seed 15 and/or DHA esterified in the form of TAG is esterified at the lacking the exogenous polynucleotides. sn-2 position of the TAG, thereby producing the methyl or In another embodiment, the lipid is in the form of an oil, ethyl esters of polyunsaturated fatty acids. preferably a seedoil from an oilseed, and wherein at least In a preferred embodiment, the lipid which is used in the about 90%, or about least 95%, at least about 98%, or process of the above three aspects has one or more of the between about 95% and about 98%, by weight of the lipid features defined herein in the context of the extracted lipid is triacylglycerols. or oil of the invention. In a further embodiment, the process further comprises In another aspect, the present invention provides an treating the lipid to increase the level of DHA and/or DPA oilseed plant or part thereof Such as a seed comprising as a percentage of the total fatty acid content. For example, a) lipid in its seed, the lipid comprising fatty acids in an the treatment comprises transesterification. For example, the 25 esterified form, and lipid such as canola oil may be treated to convert the fatty b) exogenous polynucleotides encoding one of the fol acids in the oil to alkyl esters such as methyl or ethyl esters, lowing sets of enzymes; which may then be fractionated to enrich the lipid or oil for i) a A12-desaturase, a (03-desaturase and/or A15-desatu the DHA and/or DPA. In embodiments, the fatty acid rase, a A6-desaturase, a A5-desaturase, a A4-desaturase, composition of the lipid after such treatment comprises at 30 a A6-elongase and an A5-elongase, or least 40%, at least 50%, at least 60%, at least 70%, at least ii) a A12-desaturase, a (03-desaturase and/or A15-desatu 80% or at least 90% DHA and/or DPA. The ratio of rase, a A8-desaturase, a A5-desaturase, a A4-desaturase, DHA: DPA in the lipid after treatment is preferably greater a A9-elongase and an A5-elongase, than 2:1, or alternatively less than 0.5:1. Alternatively, the wherein each polynucleotide is operably linked to one or level of DHA in the total fatty acid content of the lipid after 35 more seed-specific promoters that are capable of directing treatment is less than 2.0% or less than 0.5%, preferably is expression of said polynucleotides in developing seed of the absent from the lipid. plant, wherein the fatty acids comprise oleic acid, palmitic Also provided is lipid, or oil comprising the lipid, pro acid, (D6 fatty acids which comprise linoleic acid (LA) and duced using a process of the invention. Y-linolenic acid (GLA), ()3 fatty acids which comprise In another aspect, the present invention provides a process 40 O-linolenic acid (ALA), Stearidonic acid (SDA), docosapen for producing methyl or ethyl esters of polyunsaturated fatty taenoic acid (DPA) and docosahexaenoic acid (DHA), and acids, the process comprising reacting triacylglycerols in optionally eicosapentaenoic acid (EPA) and/or eicosatetra extracted plant lipid, or during the process of extraction, enoic acid (ETA), and wherein the level of DHA in the total with methanol or ethanol, respectively, wherein the fatty acid content of the lipid of the seed is between 20.1% extracted plant lipid comprises fatty acids esterified in the 45 and 30%, or between 20.1% and 35%, preferably between form of TAG, the fatty acids comprising oleic acid, palmitic 30% and 35%. acid, (D6 fatty acids which comprise linoleic acid (LA), (03 In another aspect, the present invention provides an fatty acids which comprise O-linolenic acid (ALA), and oilseed plant or part thereof Such as a seed comprising docosahexaenoic acid (DHA), and optionally one or more of a) lipid in its seed, the lipid comprising fatty acids in an stearidonic acid (SDA), eicosapentaenoic acid (EPA), 50 esterified form, and docosapentaenoic acid (DPA) and eicosatetraenoic acid b) exogenous polynucleotides encoding one of the fol (ETA), wherein the level of DHA in the total fatty acid lowing sets of enzymes; content of the extracted lipid is between about 20.1% and i) a A12-desaturase, a (03-desaturase and/or A15-desatu 30%, or between 20.1% and 35%, preferably between 30% rase, a A6-desaturase, a A5-desaturase, a A4-desaturase, and 35%, thereby producing the methyl or ethyl esters of 55 a A6-elongase and an A5-elongase, or polyunsaturated fatty acids. ii) a A12-desaturase, a (03-desaturase and/or A15-desatu In another aspect, the present invention provides a process rase, a A8-desaturase, a A5-desaturase, a A4-desaturase, for producing methyl or ethyl esters of polyunsaturated fatty a A9-elongase and an A5-elongase, acids, the process comprising reacting triacylglycerols in wherein each polynucleotide is operably linked to one or extracted plant lipid, or during the process of extraction, 60 more seed-specific promoters that are capable of directing with methanol or ethanol, respectively, wherein the expression of said polynucleotides in developing seed of the extracted plant lipid comprises fatty acids esterified in the plant, wherein the fatty acids comprise oleic acid, palmitic form of TAG, the fatty acids comprising oleic acid, palmitic acid, (D6 fatty acids which comprise linoleic acid (LA), (03 acid, (D6 fatty acids which comprise linoleic acid (LA), (03 fatty acids which comprise O-linolenic acid (ALA), Steari fatty acids which comprise O-linolenic acid (ALA), and 65 donic acid (SDA), docosapentaenoic acid (DPA) and doco docosapentaenoic acid (DPA), and optionally one or more of sahexaenoic acid (DHA), and optionally eicosapentaenoic stearidonic acid (SDA), eicosapentaenoic acid (EPA), and acid (EPA) and/or eicosatetraenoic acid (ETA), and wherein US 9,725,399 B2 25 26 the level of DHA in the total fatty acid content of the lipid In another aspect, the present invention provides a cell, of the seed is between 20.1% and 30%, or between 20.1% preferably a cell in or from a plant Such as an oilseed plant and 35%, preferably between 30% and 35%. or part thereof Such as a seed, or an oilseed plant or part In another aspect, the present invention provides an thereof, or a microbial cell, comprising oilseed plant or part thereof Such as a seed comprising 5 a) fatty acids in an esterified form, the fatty acids com a) lipid in its seed, the lipid comprising fatty acids in an prising docosapentaenoic acid (DPA) and/or docosahexae esterified form, and noic acid (DHA), wherein at least 35% of the DPA and/or b) exogenous polynucleotides encoding one of the fol DHA esterified in the form of triacylglycerol (TAG) is lowing sets of enzymes; esterified at the sn-2 position of the TAG, and i) a A12-desaturase, a (03-desaturase and/or A15-desatu 10 b) exogenous polynucleotides encoding one of the fol rase, a A6-desaturase, a A5-desaturase, a A4-desaturase, lowing sets of enzymes; a A6-elongase and an A5-elongase, or i) an 1-acyl-glycerol-3-phosphate acyltransferase ii) a A12-desaturase, a (03-desaturase and/or A15-desatu (LPAAT), an (03-desaturase, a A6-desaturase, a A5-de rase, a A8-desaturase, a A5-desaturase, a A4-desaturase, Saturase, a A6-elongase, a A5-elongase and optionally a a A9-elongase and an A5-elongase, 15 A4-desaturase, wherein each polynucleotide is operably linked to one or ii) an 1-acyl-glycerol-3-phosphate acyltransferase more seed-specific promoters that are capable of directing (LPAAT), a A15-desaturase, a A6-desaturase, a A5-de expression of said polynucleotides in developing seed of the Saturase, a A6-elongase, a A5-elongase and optionally a plant, wherein the fatty acids comprise oleic acid, palmitic A4-desaturase, acid, (D6 fatty acids which comprise linoleic acid (LA) and iii) an 1-acyl-glycerol-3-phosphate acyltransferase Y-linolenic acid (GLA), ()3 fatty acids which comprise (LPAAT), a A12-desaturase, a A6-desaturase, a A5-de O-linolenic acid (ALA), Stearidonic acid (SDA), docosapen Saturase, a A6-elongase, an A5-elongase and optionally taenoic acid (DPA) and docosahexaenoic acid (DHA), and a A4-desaturase, optionally eicosapentaenoic acid (EPA) and/or eicosatetra iv) an 1-acyl-glycerol-3-phosphate acyltransferase enoic acid (ETA), and wherein the level of DHA in the total 25 (LPAAT), a A12-desaturase, a (03-desaturase and/or a fatty acid content of the lipid of the seed is between 20.1% A 15-desaturase, a A6-desaturase, a A5-desaturase, a and 30%, or between 20.1% and 35%, and wherein the level A6-elongase and an A5-elongase and optionally a of palmitic acid in the total fatty acid content of the lipid is A4-desaturase, between about 2% and 16%, and wherein the level of an 1-acyl-glycerol-3-phosphate acyltransferase myristic acid (C14:0) in the total fatty acid content of the 30 (LPAAT), an (03-desaturase, a A8-desaturase, a A5-de lipid, if present, is less than 1%. Saturase, a A9-elongase, an A5-elongase and optionally In another aspect, the present invention provides an a A4-desaturase, oilseed plant or part thereof Such as a seed comprising lipid vi) an 1-acyl-glycerol-3-phosphate acyltransferase in its seed, or a microbial cell, comprising (LPAAT), a A15-desaturase, a A8-desaturase, a A5-de a) lipid comprising fatty acids in an esterified form, and 35 Saturase, a A9-elongase, a A5-elongase and optionally a b) exogenous polynucleotides encoding one of the fol A4-desaturase, lowing sets of enzymes; vii) an 1-acyl-glycerol-3-phosphate acyltransferase i) a A12-desaturase, a (03-desaturase and/or A15-desatu (LPAAT), a A12-desaturase, a A8-desaturase, a A5-de rase, a A6-desaturase, a A5-desaturase, a A6-elongase Saturase, a A9-elongase, an A5-elongase and optionally and an A5-elongase, 40 a A4-desaturase, ii) a A12-desaturase, a (03-desaturase and/or A15-desatu viii) an 1-acyl-glycerol-3-phosphate acyltransferase rase, a A8-desaturase, a A5-desaturase, a A9-elongase (LPAAT), a A12-desaturase, a (03-desaturase and/or a and an A5-elongase, A 15-desaturase, a A8-desaturase, a A5-desaturase, a iii) a (03-desaturase and/or A15-desaturase, a A6-desatu A9-elongase, an A5-elongase and optionally a A4-de rase, a A5-desaturase, a A6-elongase and an A5-elon 45 Saturase, gase, or wherein each polynucleotide is operably linked to one or iv) a (03-desaturase and/or A15-desaturase, a A8-desatu more promoters that are capable of directing expression of rase, a A5-desaturase, a A9-elongase and an A5-elon said polynucleotides in the cell. Preferably, the LPAAT can gase, use a C22 polyunsaturated fatty acyl-CoA substrate Such as wherein each polynucleotide is operably linked to one or 50 DHA-CoA and/or DPA-CoA and the level of DPA and/or more seed-specific promoters that are capable of directing DHA in the total fatty acid content of the extracted lipid is expression of said polynucleotides in developing seed of the between about 1% and 35%, or between about 7% and 35% plant, or one or more promoters that are capable of directing or between about 20.1% and 35%. In embodiments, at least expression of said polynucleotides in the microbial cell, about 40%, at least about 45%, at least about 48%, between wherein the fatty acids comprise oleic acid, palmitic acid, 55 35% and about 60%, or between 35% and about 50%, of the ()6 fatty acids which comprise linoleic acid (LA) and DPA and/or DHA esterified in the form of triacylglycerol optionally Y-linolenic acid (GLA), ()3 fatty acids which (TAG) is esterified at the sn-2 position of the TAG. comprise O-linolenic acid (ALA), Stearidonic acid (SDA), In embodiments of each of the above five aspects, the and docosapentaenoic acid (DPA), and optionally docosa A 15-desaturase is a fungal A15-desaturase and the co3-de hexaenoic acid (DHA), eicosapentaenoic acid (EPA) and/or 60 saturase is a fungal (D3-desaturase. eicosatetraenoic acid (ETA), and wherein the level of DPA In a preferred embodiment, the oilseed plant, microbial in the total fatty acid content of the lipid of the seed or cell or cell of the invention has, where relevant, one or more microbial cell is between 7% and 35%. In a preferred of the features defined herein, for example as defined above embodiment of this aspect, DHA is present at a level of less in relation to extracted plant lipid, extracted microbial lipid than 0.5% of the total fatty acid content of the lipid of the 65 or a process for the production thereof. seed and of the extracted lipid and more preferably is absent Examples of oilseed plants include, but are not limited to, from the total fatty acid content of the lipids. Brassica sp., Gossypium hirsutum, Linum usitatissimum, US 9,725,399 B2 27 28 Helianthus sp., Carthamus tinctorius, Glycine max, Zea seed, at least about 36 mg per gram seed, at least about 40 mays, Arabidopsis thaliana, Sorghum bicolor, Sorghum vul mg per gram seed, more preferably at least about 44 mg per gare, Avena saliva, Trifolium sp., Elaesis guineenis, Nico gram seed or at least about 48 mg per gram seed, about 80 tiana benthamiana, Hordeum vulgare, Lupinus angustifo mg per gram seed, or between about 30 mg and about 80 mg lius, Oryza saliva, Oryza glaberrima, Camelina saliva, or per gram seed. Crambe abyssinica. In an embodiment, the plant is a Bras In an embodiment, the cell of the invention, the oilseed sica sp. plant, a C. saliva plant or a G. max (soybean) plant. plant of the invention, the Brassica napus, B. juncea or In an embodiment, the oilseed plant is a canola, B. iuncea, Camelina saliva plant of the invention, the plant part of the Glycine max, Camelina saliva or Arabidopsis thaliana plant. invention, or the seed of the invention, can be used to In an alternate embodiment, the oilseed plant is other than A. 10 thaliana and/or other than C. saliva. In an embodiment, the produce extracted lipid comprising one or more or all of the oilseed plant is a plant other than G. max (soybean). In an features defined herein. embodiment, the oilseed plant is in the field, or was grown In yet a further aspect, the present invention provides a in the field, or was grown in a glasshouse under standard method of producing a plant or cell which can be used to conditions, for example as described in Example 1. 15 produce extracted lipid of the invention, the method com In an embodiment, one or more of the desaturases used in prising a process of the invention or present in a cell, or plant or part a) assaying the level of DHA and/or DPA in lipid pro thereof of the invention, is capable of using an acyl-CoA duced by one or more plant parts Such as seeds or recom substrate. In a preferred embodiment, one or more of the binant cells such as microbial cells from a plurality of plants A6-desaturase, A5-desaturase, A4-desaturase and A8-desatu or recombinant cells such as microbial cells, each plant or rase, if present, is capable of using an acyl-CoA substrate, recombinant cell Such as a microbial cell comprising one or preferably each of the i) A6-desaturase, A5-desaturase and more exogenous polynucleotides encoding one of the fol A4-desaturase or ii) A5-desaturase, A4-desaturase and lowing sets of enzymes; A8-desaturase is capable of using an acyl-CoA substrate. In i) an (03-desaturase, a A6-desaturase, a A5-desaturase, a an embodiment, a A12-desaturase and/oran ()3-desaturase is 25 A4-desaturase, a A6-elongase and a A5-elongase, capable of using an acyl-CoA Substrate. The acyl-CoA ii) a A15-desaturase, a A6-desaturase, a A5-desaturase, a substrate is preferably an ALA-CoA for A6-desaturase, A4-desaturase, a A6-elongase and a A5-elongase, ETA-CoA for A5-desaturase, DPA-CoA for A4-desaturase, iii) a A12-desaturase, a A6-desaturase, a A5-desaturase, a and ETrA-CoA for A8-desaturase, oleoyl-CoA for the A12 A4-desaturase, a A6-elongase and an A5-elongase, desaturase, or one or more of LA-CoA, GLA-CoA, and 30 iv) a A12-desaturase, a (03-desaturase or a A15-desatu ARA-CoA for (03-desaturase. rase, a A6-desaturase, a A5-desaturase, a A4-desaturase, In an embodiment, mature, harvested seed of the plant has a A6-elongase and an A5-elongase, a DHA and/or DPA content of at least about 28 mg per gram V) an (03-desaturase, a A8-desaturase, a A5-desaturase, a seed, preferably at least about 32 mg per gram seed, at least A4-desaturase, a A9-elongase and an A5-elongase, about 36 mg per gram seed, at least about 40 mg per gram 35 vi) a A15-desaturase, a A8-desaturase, a A5-desaturase, a seed, more preferably at least about 44 mg per gram seed or A4-desaturase, a A9-elongase and a A5-elongase, at least about 48 mg per gram seed, about 80 mg per grain vii) a A12-desaturase, a A8-desaturase, a A5-desaturase, a seed, or between about 30 mg and about 80 mg per gram A4-desaturase, a A9-elongase and an A5-elongase, seed. viii) a A12-desaturase, a co3-desaturase or a A15-desatu In a further aspect, the present invention provides a 40 rase, a A8-desaturase, a A5-desaturase, a A4-desaturase, Brassica napus, B. juncea or Camelina sativa plant which is a A9-elongase and an A5-elongase, capable of producing seed comprising DHA and/or DPA, iX) an (03-desaturase, a A6-desaturase, a A5-desaturase, a wherein mature, harvested seed of the plant has a DHA A6-elongase and a A5-elongase, and/or DPA content of at least about 28 mg per gram seed, X) a A15-desaturase, a A6-desaturase, a A5-desaturase, a preferably at least about 32 mg per gram seed, at least about 45 A6-elongase and a A5-elongase, 36 mg per gram seed, at least about 40 mg per gram seed, Xi) a A12-desaturase, a A6-desaturase, a A5-desaturase, a more preferably at least about 44 mg per gram seed or at A6-elongase and an A5-elongase, least about 48 mg per gram seed, about 80 mg per gram seed, xiii) a A12-desaturase, a co3-desaturase or a A15-desatu or between about 30 mg and about 80 mg per gram seed. rase, a A6-desaturase, a A5-desaturase, a A6-elongase In another aspect, the present invention provides a plant 50 and an A5-elongase, or cell of a plant of the invention comprising the exogenous Xiv) a A12-desaturase, a co3-desaturase or a A15-desatu polynucleotides defined herein. rase, a A8-desaturase, a A5-desaturase, a A9-elongase Also provided is a plant part, preferably a seed, or and an A5-elongase, recombinant cells such as microbial cells which has one or wherein each polynucleotide is operably linked to one or more of the following features 55 more promoters that are capable of directing expression of i) is from a plant of the invention, said polynucleotides in a cell of a plant part or recombinant ii) comprises lipid as defined herein, or cell, and iii) can be used in a process of the invention. b) identifying a plant or recombinant cell, from the In yet another aspect, the present invention provides plurality of plants or recombinant cells, which can be used mature, harvested Brassica napus, B. juncea or Camelina 60 to produce extracted plant lipid or cell lipid of the invention sativa seed comprising DHA and/or DPA and a moisture in one or more of its parts, and content of between about 4% and about 15% by weight, c) optionally, producing progeny plants or recombinant preferably between about 6% and about 8% by weight or cells from the identified plant or recombinant cell, or seed between about 4% and about 8% by weight, more preferably therefrom. between about 4% and about 6% by weight, wherein the 65 In an embodiment, the plant or recombinant cell further DHA and/or DPA content of the seed is at least about 28 mg comprises an exogenous polynucleotide encoding an per gram seed, preferably at least about 32 mg per gram LPAAT as defined herein. US 9,725,399 B2 29 30 Preferably, the progeny plant is at least a second or third of the invention, the seed of the invention, or the plant, plant generation removed from the identified plant, and is pref cell, plant part or seed of the invention. Preferably, the lipid erably homozygous for the one or more polynucleotides. or oil is purified to remove contaminants such as nucleic acid More preferably, the one or more polynucleotides are pres (DNA and/or RNA), protein and/or carbohydrate, or pig ent in the progeny plant at only a single insertion locus. That 5 ments such as chlorophyll. The lipid or oil may also be is, the invention provides Such a method which can be used purified to enrich the proportion of TAG, for example by as a screening method to identify a plant or seed therefrom removal of free fatty acids (FFA) or phospholipid. from a plurality of transformed candidate plants or seeds, In an embodiment, the lipid or oil is obtained by extrac wherein the identified plant or its progeny plant produces tion of oil from an oilseed. Examples of oil from oilseeds lipid of the invention, preferably in its seed. Such a plant or 10 include, but are not limited to, canola oil (Brassica napus, progeny plant or its seed is selected if it produces lipid of the Brassica rapa Ssp.), mustard oil (Brassica iuncea), other invention, in particular having the specified DHA level Brassica oil, sunflower oil (Helianthus annus), linseed oil and/or DPA level, or is not selected if it does not produce (Linum usitatissimum), soybean oil (Glycine max), safflower lipid of the invention. oil (Carthamus tinctorius), corn oil (Zea mays), tobacco oil In an embodiment, the exogenous polynucleotide(s) pres 15 (Nicotiana tabacum), peanut oil (Arachis hypogaea), palm ent in a cell Such as a microbial cell, or plant or past thereof oil, cottonseed oil (Gossypium hirsutum), coconut oil (Co as defined herein, become stably integrated into the genome cos nucifera), avocado oil (Persea americana), olive oil of the cell, plant or the plant part such as seed. Preferably, (Olea europaea), cashew oil (Anacardium occidentale), the exogenous polynucleotide(s) become stably integrated macadamia oil (Macadamia intergrifolia), almond oil into the genome of the cell, plant or plant part such as seed (Prunus amygdalus) or Arabidopsis seed oil (Arabidopsis at a single locus in the genome, and is preferably homozy thaliana). gous for the insertion. More preferably, the plant, plant part In an embodiment, a cell (recombinant cell) of, or used in, or seed is further characterised in that it is lacking exogenous the invention is a microbial cell such as a cell suitable for polynucleotides other than one or more T-DNA molecules. fermentation, preferably an oleaginous microbial cell which That is, no exogenous vector sequences are integrated into 25 is capable of accumulating triacylglycerols to a level of at the genome other than the T-DNA sequences. least 25% on a weight basis. Preferred fermentation pro In an embodiment, before step a) the method includes cesses are anaerobic fermentation processes, as are well introducing the one or more exogenous polynucleotides into known in the art. Suitable fermenting cells, typically micro one or more cells of the plant. organisms are able to ferment, i.e., convert, Sugars, such as Also provided is a plant produced using a method of the 30 glucose or maltose, directly or indirectly into the desired invention, and seeds of Such plants. fatty acids. Examples of fermenting microorganisms include In an embodiment, the plant of the invention is both male fungal organisms, such as yeast. As used herein, “yeast and female fertile, preferably has levels of both male and includes Saccharomyces spp., Saccharomyces cerevisiae, female fertility that are at least 70% relative to, or preferably Saccharomyces Carlbergensis, Candida spp., Kluveromyces are about the same as, a corresponding wild-type plant. In an 35 spp., Pichia spp., Hansenula spp., Trichoderma spp., Lipo embodiment, the pollen produced by the plant of the inven myces Starkey, and preferably Yarrowia lipolytica. tion or the plant produced from the seed of the invention is In a further aspect, the present invention provides fatty 90-100% viable as determined by staining with a viability acid produced by, or obtained from, using the process of the stain. For example, the pollen viability may be assessed as invention, the cell of the invention, the oilseed plant of the described in Example 1. 40 invention, the Brassica sp., Brassica napus, B. juncea, G. In another aspect, the present invention provides a method max or Camelina sativa plant of the invention, the plant part of producing seed, the method comprising, of the invention, the seed of the invention, or the plant, plant a) growing a plant of the invention, or a plant which cell, plant part or seed of the invention. Preferably the fatty produces a part of the invention, preferably in a field as part acid is DHA and/or DPA. The fatty acid may be in a mixture of a population of at least 1000 or 2000 or 3000 such plants 45 of fatty acids having a fatty acid composition as described or in an area of at least 1 hectare or 2 hectares or 3 hectares herein, or may be enriched so that the fatty acid comprises planted at a standard planting density, alternatively in a at least 40% or at least 90% of the fatty acid content of the glasshouse under standard conditions, mixture. In an embodiment, the fatty acid is non-esterified. b) harvesting seed from the plant or plants, and Alternatively, the fatty acid is esterified such as, for c) optionally, extracting lipid from the seed, preferably to 50 example, to a methyl, ethyl, propyl or butyl group. produce oil with a total DHA yield and/or DPA yield of at Also provided is seedmeal obtained from seed of the least 60 kg or 70 kg or 80 kg DHA and/or DPA/hectare. invention or obtained from a plant of the invention. Pre In an embodiment, the plant, plant cell, plant part or seed, ferred seedmeal includes, but not necessarily limited to, or recombinant cell, of the invention has one or more of the Brassica sp., Brassica napus, B. juncea, Camelina sativa or following features 55 Glycine max Seedmeal. In an embodiment, the seedmeal i) its oil is as defined herein, or comprises an exogenous polynucleotide(s) and/or genetic ii) the plant part or seed or recombinant cell is capable of constructs as defined herein. In a preferred embodiment, the being used in a process of the invention. seedmeal retains some of the lipid or oil produced in the seed For example, the seed can be used to produce a plant of from which the seedmeal is obtained, but at a low level (for the invention. The plant may be grown in the field or in a 60 example, less than 2% by weight) after extraction of most of glasshouse under standard conditions, for example as the lipid or oil. The seedmeal may be used as an animal feed described in Example 1, or as an ingredient in food production. In a further aspect, the present invention provides lipid, or In another aspect, the present invention provides a com oil, produced by, or obtained from, using the process of the position comprising one or more of the lipid or oil of the invention, the cell of the invention, the oilseed plant of the 65 invention, the fatty acid of the invention, the cell according invention, the Brassica sp., Brassica napus, B. juncea, G. of the invention, the oilseed plant of the invention, the max or Camelina sativa plant of the invention, the plant part Brassica sp., Brassica napus, B. iuncea, Glycine max or US 9,725,399 B2 31 32 Camelina sativa plant of the invention, the plant part of the The production of the medicament may comprise mixing invention, the seed of the invention, or the seedmeal of the the oil of the invention with a pharmaceutically acceptable invention. In embodiments, the composition comprises a carrier, for treatment of a condition as described herein. The carrier Suitable for pharmaceutical, food or agricultural use, method may comprise firstly purifying the oil and/or trans a seed treatment compound, a fertiliser, another food or feed esterification, and/or fractionation of the oil to increase the ingredient, or added protein or vitamins. level of DHA and/or DPA. In a particular embodiment, the Also provided is feedstuffs, cosmetics or chemicals com method comprises treating the lipid or oil such as canola oil prising one or more of the lipid or oil of the invention, the to convert the fatty acids in the oil to alkyl esters such as fatty acid of the invention, the cell according of the inven methyl or ethyl esters. Further treatment such as fraction tion, the oilseed plant of the invention, the Brassica sp., 10 Brassica napus, B. juncea, Glycine max or Camelina saliva ation or distillation may be applied to enrich the lipid or oil plant of the invention, the plant part of the invention, the for the DHA and/or DPA. In a preferred embodiment, the seed of the invention, the seedmeal of the invention, or the medicament comprises ethyl esters of DHA and/or DPA. In composition of the invention. an even more preferred embodiment, the level of ethyl esters of DHA and/or DPA in the medicament is between 30% and In another aspect, the present invention provides a method 15 of producing a feedstuff, the method comprising mixing one 50%, or at least 80% or at least about 85% or at least 90% or more of the lipid or oil of the invention, the fatty acid of or at least about 95%. The medicament may further com the invention, the cell according of the invention, the oilseed prise ethyl esters of EPA, such as between 30% and 50%, or plant of the invention, the Brassica sp., Brassica napus, B. at least 90%, of the total fatty acid content in the medica juncea, Glycine max or Camelina sativa plant of the inven ment. Such medicaments are suitable for administration to tion, the plant part of the invention, the seed of the invention, human or animal Subjects for treatment of medical condi the seedmeal of the invention, or the composition of the tions as described herein. invention, with at least one other food ingredient. The In another aspect, the present invention provides a method method may comprise steps of blending, cooking, baking, of trading seed, comprising obtaining seed of the invention, extruding, emulsifying or otherwise formulating the feed 25 and trading the obtained seed for pecuniary gain. stuff, or packaging the feedstuff, or of analysing the amount In an embodiment, obtaining the seed comprises cultivat of lipid or oil in the feedstuff. ing plants of the invention and/or harvesting the seed from In another aspect, the present invention provides a method the plants. of treating or preventing a condition which would benefit In another embodiment, obtaining the seed further com from a PUFA, preferably DHA and/or DPA, the method 30 comprising administering to a subject one or more of the prises placing the seed in a container and/or storing the seed. lipid or oil of the invention, the fatty acid of the invention, In a further embodiment, obtaining the seed further com the cell according of the invention, the oilseed plant of the prises transporting the seed to a different location. invention, the Brassica sp., Brassica napus, B. iuncea, In yet another embodiment, the method further comprises Glycine max or Camelina saliva plant of the invention, the 35 transporting the seed to a different location after the seed is plant part of the invention, the seed of the invention, the traded. seedmeal of the invention, the composition of the invention, In a further embodiment, the trading is conducted using or the feedstuff of the invention. In a preferred embodiment, electronic means such as a computer. the PUFA is administered in the form of a pharmaceutical In yet a further aspect, the present invention provides a composition comprising an ethyl ester of the PUFA. The 40 process of producing bins of seed comprising: Subject may be a human or an animal other than a human. a) Swathing, windrowing and/or reaping above-ground Examples of conditions which would benefit from a parts of plants comprising seed of the invention, PUFA include, but are not limited to, elevated serum tri b) threshing and/or winnowing the parts of the plants to glyceride levels, elevated serum cholesterol levels such as separate the seed from the remainder of the plant parts, and elevated LDL cholesterol levels, cardiac arrhythmias, 45 c) sifting and/or sorting the seed separated in step b), and angioplasty, inflammation, asthma, psoriasis, osteoporosis, loading the sifted and/or sorted seed into bins, thereby kidney stones, AIDS, multiple sclerosis, rheumatoid arthri producing bins of seed. tis, Crohn's disease, Schizophrenia, cancer, foetal alcohol In an embodiment, where relevant, the lipid or oil, pref syndrome, attention deficient hyperactivity disorder, cystic erably seedoil, of, or useful for, the invention has fatty levels fibrosis, phenylketonuria, unipolar depression, aggressive 50 about those provided in a Table in the Examples section, hostility, adrenoleukodystophy, coronary heart disease, Such as seed CT136-27-18-2 or CT 136-27-18-19 of Table hypertension, diabetes, obesity. Alzheimer's disease, 10, or the seedoil of Tables 12, 20, 22, 23 or 24. chronic obstructive pulmonary disease, ulcerative colitis, Any embodiment herein shall be taken to apply mutatis restenosis after angioplasty, eczema, high blood pressure, mutandis to any other embodiment unless specifically stated platelet aggregation, gastrointestinal bleeding, endometrio 55 otherwise. sis, premenstrual syndrome, myalgic encephalomyelitis, The present invention is not to be limited in scope by the chronic fatigue after viral infections or an ocular disease. specific embodiments described herein, which are intended Also provided is the use of one or more of the lipid or oil for the purpose of exemplification only. Functionally of the invention, the fatty acid of the invention, the cell equivalent products, compositions and methods are clearly according of the invention, the oilseed plant of the invention, 60 within the scope of the invention, as described herein. the Brassica sp., Brassica napus, B. juncea, Glycine max or Throughout this specification, unless specifically stated Camelina sativa plant of the invention, the plant part of the otherwise or the context requires otherwise, reference to a invention, the seed of the invention, the seedmeal of the single step, composition of matter, group of steps or group invention, the composition of the invention, or the feedstuff of compositions of matter shall be taken to encompass one of the invention for the manufacture of a medicament for 65 and a plurality (i.e. one or more) of those steps, composi treating or preventing a condition which would benefit from tions of matter, groups of steps or group of compositions of a PUFA preferably DHA and/or DPA. matter. US 9,725,399 B2 33 34 The invention is hereinafter described by way of the SEQ ID NO:5—Codon-optimized open reading frame for following non-limiting Examples and with reference to the expression of Pichia pastoris (D3 desaturase in plants. accompanying figures. SEQ ID NO:6—Pichia pastoris ()3 desaturase. SEQID NO:7 Open reading frame encoding Micromonas BRIEF DESCRIPTION OF THE 5 pusilla A6-desaturase. ACCOMPANYING DRAWINGS SEQ ID NO:8—Codon-optimized open reading frame for expression of Micromonas pusilla A6-desaturase in plants, FIG. 1. Aerobic DHA biosynthesis pathways. SEQ ID NO:9—Micromonas pusilla A6-desaturase. FIG. 2. Map of the T-DNA insertion region between the SEQ ID NO:10 Open reading frame encoding Ostreococ left and right borders of plP3416-GA7. RB denotes right 10 cus lucimarinus A6-desaturase. border; LB, left border; TER, transcription terminator/poly SEQ ID NO:11—Codon-optimized open reading frame for adenylation region; PRO, promoter, Coding regions are expression of Ostreococcus lucimarinus A6-desaturase in indicated above the arrows, promoters and terminators plants. below the arrows. Micpu-MD. Micromonas pusilla A6-de SEQ ID NO:12—Ostreococcus lucimarinus A6-desaturase. saturase; Pyrco-A6E. Pyramimonas cordata A6-elongase; 15 SEQ ID NO:13—Ostreococcus tauri A6-desaturase. Pavsa-A5D, Pavlova salina A5-desaturase; Picpa-co3D, SEQID NO:14 Open reading frame encoding Pyramino Pichia pastoris (O3-desaturase; Pavsa-A4D. P. salina A4-de nas cordata A6-elongase. saturase; Lackl-A12D. Lachancea kluyveri A12-desaturase; SEQ ID NO:15 Codon-optimized open reading frame for Pyrco-A5E, Pyramimonas cordata A5-elongase. NOS expression of Pyramimonas cordata A6-elongase in plants denotes the Agrobacterium tumefaciens nopaline synthase (truncated at 3' end and encoding functional elongase). transcription terminator/polyadenylation region; FP1, Bras SEQ ID NO:16—Pyramimonas cordata A6-elongase. sica napus truncated napin promoter; FAE1, Arabidopsis SEQID NO:17 Truncated Pyramimonas cordata A6-elon thaliana FAE1 promoter; Lectin, Glycine max lectin tran gase. Scription terminator/polyadenylation region; Cnl1 and Cnl2 SEQ ID NO:18—Open reading frame encoding Pavlova denotes the Linum usitatissimum conlinin1 or conlinin2 25 salina A5-desaturase. promoter or terminator. MAR denotes the Rb7 matrix SEQ ID NO:19 Codon-optimized open reading frame for attachment region from Nicotiana tabacum. expression of Pavlova salina A5-desaturase in plants, FIG. 3. Map of the T-DNA insertion region between the SEQ ID NO:20 Pavlova sauna A5-desaturase. left and right borders of plP3404. Labels are as in FIG. 2. SEQID NO:21—Open reading frame encoding Pyramino FIG. 4. Oil content (w/w) vs. DHA content, as a percent 30 nas cordata A5-desaturase. age of total fatty acid content of lipid from transgenic SEQ ID NO:22—Pyramimonas cordata A5-desaturase. Arabidopsis thaliana seeds. SEQID NO:23 Open reading frame encoding Pyramino FIG. 5. Positional distribution analysis by NMR on A) nas cordata A5-elongase. Tuna oil and, B) transgenic DHA Arabidopsis seed oil. The SEQ ID NO:24 Codon-optimized open reading frame for peaks labelled DHA-alpha represent the amount of DHA 35 expression of Pyramimonas cordata A5-elongase in plants. present at the sn-1 and sn-3 positions of TAG (with no SEQ ID NO:25—Pyramimonas cordata A5-elongase. positional preference this would equal 66% of total DHA) SEQ ID NO:26—Open reading frame encoding Pavlova whilst the peaks labelled DHA-beta represent the amount sauna A4-desaturase. of DHA present at the sn-2 position of TAG (with no SEQ ID NO:27 Codon-optimized open reading frame for preference this would equal 33% of DHA). 40 expression of Pavlova sauna A4-desaturase in plants, FIG. 6. LC-MS analysis of major DHA-containing tria SEQ ID NO:28—Pavlova sauna A4-desaturase. cylglycerol species in transgenic A. thaliana developing SEQ ID NO:29—Isochrysis galbana A9-elongase. (grey) and mature (black) seeds. The number following the SEQ ID NO:30 Codon-optimized open reading frame for DHA denotes the total number of carbon atoms and total expression of Emiliania huxleyi A9-elongase in plants. number of double bonds in the other two fatty acids. 45 SEQ ID NO:31-Emiliania huxleyi CCMP1516 A9-elon Therefore DHA/34:1 can also be designated TAG 56:7, etc. gase. FIG.7. (A) Basic phytosterol structure with ring and side SEQ ID NO:32—Open reading frame encoding Pavlova chain numbering. (B) Chemical structures of some of the pinguis A9-elongase. phytosterols. SEQ ID NO:33—Pavlova pinguis A9-elongase. FIG. 8. Phylogenetic tree of known LPAATs. 50 SEQ ID NO:34—Open reading frame encoding Pavlova FIG. 9. The various acyl exchange enzymes which trans sauna A9-elongase. fer fatty acids between PC, CoA pools, and TAG pools. SEQ ID NO:35—Pavlova sauna A9-elongase. Adapted from Singh et al. (2005). SEQ ID NO:36—Open reading frame encoding Pavlova FIG. 10. DHA levels in the total fatty acid content of sauna A8-desaturase. seedoil obtained from individual T2 seeds from B. napus 55 SEQ ID NO:37—Pavlova sauna A8-desaturase. seeds transformed with the 1-DNA from the GA7-modB SEQ ID NO:38 V2 viral suppressor. construct. Each dot shows the DHA level in an individual SEQ ID NO:39—Open reading frame encoding V2 viral seed, with each column of dots representing T2 seeds from Suppressor. an individual T1 plant. SEQ ID NO: 40 Arabidopsis thaliana LPAAT2. 60 SEQ ID NO: 41-Limnanthes alba LPAAT. KEY TO THE SEQUENCE LISTING SEQ ID NO: 42 Saccharomyces cerevisiae LPAAT. SEQ ID NO: 43–Micromonas pusilla LPAAT. SEQ ID NO:1 p.JP3416-GA7 nucleotide sequence. SEQ ID NO: 44-Mortierella alpina LPAAT. SEQ ID NO:2 pGA7-mod B nucleotide sequence. SEQ ID NO: 45 - Brassica napus LPAAT. SEQ ID NO:3—Codon-optimized open reading frame for 65 SEQ ID NO: 46 -Brassica napus LPAAT. expression of Lachancea kluyveri A12 desaturase in plants. SEQ ID NO: 47 Phytophthora infestans (O3 desaturase. SEQ ID NO:4—Lachancea kluyveri A12-desaturase. SEQID NO: 48–Thalassiosira pseudonana (O3 desaturase. US 9,725,399 B2 35 36 SEQ ID NO: 49 Pythium irregulare (O3 desaturase. total ()3 fatty acids, has not been significantly altered (for SEQ ID NO’s: 50 to 58 Oligonucleotide primers/probes. example, no greater than a 10% or 5% alteration) when compared to the ratio in the intact seed or cell. In an another DETAILED DESCRIPTION OF THE embodiment, the extracted plant lipid has not been exposed INVENTION to a procedure, such as hydrogenation or fractionation, which may alter the ratio of one or more or all of, oleic acid General Techniques and Definitions to DHA and/or DPA, palmitic acid to DHA and/or DPA, Unless specifically defined otherwise, all technical and linoleic acid to DHA and/or DPA, and total ()6 fatty acids: scientific terms used herein shall be taken to have the same total co3 fatty acids, when compared to the ratio in the intact meaning as commonly understood by one of ordinary skill 10 seed or cell. When the extracted plant lipid of the invention in the art (e.g., in cell culture, molecular genetics, fatty acid is comprised in an oil, the oil may further comprise non-fatty synthesis, transgenic plants, recombinant cells, protein acid molecules Such as sterols. chemistry, and biochemistry). As used herein, the terms “extracted plant oil and “iso Unless otherwise indicated, the protein, cell culture, and lated plant oil” refer to a substance or composition com immunological techniques utilized in the present invention 15 prising extracted plant lipid or isolated plant lipid and which are standard procedures, well known to those skilled in the is a liquid at room temperature. The oil is obtained from a art. Such techniques are described and explained throughout plant or part thereof such as seed. The extracted or isolated the literature in sources such as, J. Perbal, A Practical Guide oil can be a relatively crude composition obtained by, for to Molecular Cloning, John Wiley and Sons (19), J. Sam example, crushing a plant seed, or a more purified compo brook et al., Molecular Cloning: A Laboratory Manual, Cold sition where most, if not all, of one or more or each of the Spring Harbour Laboratory Press (1989), T. A. Brown water, nucleic acids, proteins and carbohydrates derived (editor), Essential Molecular Biology: A Practical Approach, from the plant material have been removed. The composi Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. tion may comprise other components which may be lipid or Hames (editors), DNA Cloning: A Practical Approach, Vol non-lipid. In an embodiment, the oil composition comprises umes 1-4, IRL Press (1995 and 1996), F. M. Ausubel et al. 25 at least about 60%, at least about 70%, at least about 80%, (editors), Current Protocols in Molecular Biology, Greene at least about 90%, or at least about 95% (w/w) extracted Pub. Associates and Wiley-Interscience (1988, including all plant lipid. In an embodiment, extracted oil of the invention updates until present), Ed Harlow and David Lane (editors), has not been blended with another oil such as DHA and/or Antibodies: A Laboratory Manual, Cold Spring Harbour DPA produced by another source (for example, DHA from Laboratory, (1988), and J. E. Coligan et al. (editors), Current 30 fish oil). In an embodiment, following extraction, the ratio of Protocols in Immunology, John Wiley & Sons (including all one or more or all of oleic acid to DHA and/or DPA, updates until present). palmitic acid to DHA and/or DPA, linoleic acid to DHA The term “and/or', e.g., “X and/or Y' shall be understood and/or DPA, and total ()6 fatty acids:total ()3 fatty acids, has to mean either “X and Y” or “X or Y and shall be taken to not been significantly altered (for example, no greater than provide explicit support for both meanings or for either 35 a 10% or 5% alteration) when compared to the ratio in the meaning. intact seed or cell. In an another embodiment, the extracted As used herein, the term “about unless stated to the plant oil has not been exposed to a procedure, such as contrary, refers to +/-10%, more preferably +/-5%, more hydrogenation or fractionation, which may alter the ratio of preferably +/-1% of the designated value. one or more or all of oleic acid to DHA and/or DPA, Throughout this specification the word “comprise', or 40 palmitic acid to DHA and/or DPA, linoleic acid to DHA variations such as “comprises” or “comprising, will be and/or DPA, and total (O6 fatty acids:total ()3 fatty acids, understood to imply the inclusion of a stated element, when compared to the ratio in the intact seed or cell. integer or step, or group of elements, integers or steps, but Extracted plant oil of the invention may comprise non-fatty not the exclusion of any other element, integer or step, or acid molecules Such as sterols. group of elements, integers or steps. 45 As used herein, terms such as “extracted microbial lipid Selected Definitions or “extracted microbial oil have analogous meanings as the As used herein, the terms “extracted plant lipid and corresponding terms “extracted plant lipid and “extracted "isolated plant lipid refer to a lipid composition which has plant oil respectively, with the main difference being the been extracted from, for example by crushing, a plant or part source of the lipid or oil. thereof such as seed. The extracted lipid can be a relatively 50 As used herein, an “oil is a composition comprising crude composition obtained by, for example, crushing a predominantly lipid and which is a liquid at room tempera plant seed, or a more purified composition where most, if not ture. For instance, oil of the invention preferably comprises all, of one or more or each of the water, nucleic acids, at least 75%, at least 80%, at least 85% or at least 90% lipid proteins and carbohydrates derived from the plant material by weight. Typically, a purified oil comprises at least 90% have been removed. Examples of purification methods are 55 triacylglycerols (TAG) by weight of the lipid in the oil. described below. In an embodiment, the extracted or isolated Minor components of an oil Such as diacylglycerols (DAG), plant lipid comprises at least about 60%, at least about 70%, free fatty acids (FFA), phospholipid and sterols may be at least about 80%, at least about 90%, or at least about 95% present as described herein. (w/w) lipid by weight of the composition. The lipid may be As used herein, the term “fatty acid refers to a carboxylic Solid or liquid at room temperature, when liquid it is 60 acid (or organic acid), often with a long aliphatic tail, either considered to be an oil. In an embodiment, extracted lipid of saturated or unsaturated. Typically fatty acids have a carbon the invention has not been blended with another lipid such carbon bonded chain of at least 8 carbon atoms in length, as DHA and/or DPA produced by another source (for more preferably at least 12 carbons in length. Preferred fatty example, DHA from fish oil). In an embodiment, following acids of the invention have carbon chains of 18-22 carbon extraction the ratio of one or more or all of oleic acid to 65 atoms (C18, C20, C22 fatty acids), more preferably 20-22 DHA and/or DPA, palmitic acid to DHA and/or DPA, carbon atoms (C20, C22) and most preferably 22 carbon linoleic acid to DHA and/or DPA, and total ()6 fatty acids: atoms (C22). Most naturally occurring fatty acids have an US 9,725,399 B2 37 38 even number of carbon atoms because their biosynthesis dihomo-y-linoleic acid (DGLA) or eicosatrienoic acid involves acetate which has two carbon atoms. The fatty (ETrA, 20:3A11, 14.17. ()3). It would readily be apparent acids may be in a free state (non-esterified) or in an esterified that the LC-PUFA that is produced according to the inven form Such as part of a triglyceride, diacylglyceride, monoa tion may be a mixture of any or all of the above and may cylglyceride, acyl-CoA (thio-ester) bound or other bound 5 include other LC-PUFA or derivatives of any of these form. The fatty acid may be esterified as a phospholipid such LC-PUFA. In a preferred embodiment, the co3 fatty acids are as a phosphatidylcholine, phosphatidylethanolamine, phos at least DHA and/or DPA, preferably, DPA and DHA, or phatidylserine, phosphatidylglycerol, phosphatidylinositol EPA, DPA and DHA, or EPA and DPA. As extracted from or diphosphatidylglycerol forms. In an embodiment, the the plant, DHA is present in the lipid or oil at a level of fatty acid is esterified to a methyl or ethyl group, Such as, for 10 example, a methyl or ethyl ester of a C20 or C22 PUFA. 20.1-30% or between 20.1% and 35%, preferably between Preferred fatty acids are the methyl or ethyl esters of EPA, 30% to 35% of the total fatty acid composition. For example, DPA or DHA, or the mixtures EPA and DHA, or EPA, DPA DHA is present at a level of between 30.1% and 35% of the and DHA, or EPA and DPA. total fatty acid composition. In an embodiment, the level of “Saturated fatty acids’ do not contain any double bonds or 15 DHA is greater than the level of DPA, more preferably other functional groups along the chain. The term "satu greater than the level of each of EPA and DPA, most rated refers to hydrogen, in that all carbons (apart from the preferably greater than the combined level of EPA and DPA. carboxylic acid —COOH group) contain as many hydro In an alternative embodiment, DPA is present at a level of gens as possible. In other words, the omega (CD) end contains between about 7% and 30% or 35% and DHA is either 3 hydrogens ( CH3-) and each carbon within the chain absent or, if present, is present at a level of less than 2.0%, contains 2 hydrogens (—CH2-). preferably less than 1.0%, more preferably less than 0.5% of “Unsaturated fatty acids are of similar form to saturated the total fatty acid composition and most preferably absent fatty acids, except that one or more alkene functional groups or undetectable. This may be accomplished by the absence exist along the chain, with each alkene Substituting a singly ofa A4-desaturase activity in the cell. In an embodiment, the bonded “ CH2-CH2- part of the chain with a doubly 25 level of DPA is greater than the level of EPA, more prefer bonded “ CH=CH-” portion (that is, a carbon double ably greater than the level of each of EPA and DHA, most bonded to another carbon). The two next carbonatoms in the preferably greater than the combined level of EPA and DHA. chain that are bound to either side of the double bond can In this embodiment, DHA may be absent or, if present, is occur in a cis or trans configuration, preferably in the cis present at a level of less than 0.5% of the total fatty acid configuration. In an embodiment, the lipid or oil or the 30 composition. invention has a fatty acid composition which comprises less Furthermore, as used herein the terms "long-chain poly than 1% fatty acids having a carbon-carbon double bond in unsaturated fatty acid” (LC-PUFA) and “very long-chain the trans configuration (trans fatty acids). polyunsaturated fatty acid (VLC-PUFA) refer to the fatty As used herein, the term “monounsaturated fatty acid acid being in a free state (non-esterified) or in an esterified refers to a fatty acid which comprises at least 12 carbon 35 form Such as part of a triglyceride (triacylglycerol), diacyl atoms in its carbon chain and only one alkene group (carbon glyceride, monoacylglyceride, acyl-CoA bound or other carbon double bond) in the chain. As used herein, the terms bound form. In the triglyceride, the LC-PUFA or VLC "polyunsaturated fatty acid' or “PUFA refer to a fatty acid PUFA such as DHA or DPA may be esterified at the sn-1/3 which comprises at least 12 carbon atoms in its carbon chain or sn-2 positions, or the triglyceride may comprise two or and at least two alkene groups (carbon-carbon double 40 three acyl groups selected from LC-PUFA and VLC-PUFA bonds). acyl groups. For example, the triglyceride may comprise As used herein, the terms "long-chain polyunsaturated DHA or DPA at both of the sn-1 and sn-3 positions. The fatty fatty acid” and “LC-PUPA” refer to a fatty acid which acid may be esterified as a phospholipid Such as a phospha comprises at least 20 carbon atoms in its carbon chain and tidylcholine (PC), phosphatidylethanolamine, phosphatidyl at least two carbon-carbon double bonds, and hence include 45 serine, phosphatidylglycerol, phosphatidylinositol or VLC-PUFAs. As used herein, the terms “very long-chain diphosphatidylglycerol forms. Thus, the LC-PUFA may be polyunsaturated fatty acid” and “VLC-PUPA” refer to a fatty present as a mixture of forms in the lipid of a cell or a acid which comprises at least 22 carbon atoms in its carbon purified oil or lipid extracted from cells, tissues or organ chain and at least three carbon-carbon double bonds. Ordi isms. In preferred embodiments, the invention provides oil narily, the number of carbonatoms in the carbon chain of the 50 comprising at least 75% or at least 85% triacylglycerols, fatty acids refers to an unbranched carbon chain. If the with the remainder present as other forms of lipid such as carbon chain is branched, the number of carbon atoms those mentioned, with at least said triacylglycerols compris excludes those in sidegroups. In one embodiment, the long ing the LC-PUFA. The oil may subsequently be further chain polyunsaturated fatty acid is an ()3 fatty acid, that is, purified or treated, for example by hydrolysis with a strong having a desaturation (carbon-carbon double bond) in the 55 base to release the free fatty acids, or by transesterification, third carbon-carbon bond from the methyl end of the fatty distillation or the like. acid. In another embodiment, the long-chain polyunsatu As used herein, “total (O6 fatty acids” or “total (O6 fatty rated fatty acid is an (D6 fatty acid, that is, having a acid content” or the like refers to the sum of all the (06 fatty desaturation (carbon-carbon double bond) in the sixth car acids, esterified and non-esterified, in the extracted lipid, oil, bon-carbon bond from the methyl end of the fatty acid. In a 60 recombinant cell, plant part or seed, as the context deter further embodiment, the long-chain polyunsaturated fatty mines, expressed as a percentage of the total fatty acid acid is selected from the group consisting of arachidonic content. These ()6 fatty acids include (if present) LA, GLA, acid (ARA, 20:4A5,8,11,14; ()6), eicosatetraenoic acid DGLA, ARA, EDA and (06-DPA, and exclude any co3 fatty (ETA. 20:4A8,11,14, 17, (O3), eicosapentaenoic acid (EPA, acids and monounsaturated fatty acids. The ()6 fatty acids 20:5A5,8,11,14, 17: (1)3), docosapentaenoic acid (DPA, 65 present in the plants, seeds, lipid or oils of the invention are 22:5A7,10,13,16,19, (D3), or docosahexaenoic acid (DHA, all included in the class of polyunsaturated fatty acids 22:6A4,7,10,13,16,19, co3). The LC-PUFA may also be (PUFA). US 9,725,399 B2 39 40 As used herein, “new ()6 fatty acids” or “new co6 fatty the context determines, expressed as a percentage of the total acid content” or the like refers to the sum of all the (06 fatty fatty acid content. These new co3 fatty acids are the co3 fatty acids excluding LA, esterified and non-esterified, in the acids that are produced in the cells, plants, plant parts and extracted lipid, oil, recombinant cell, plant part or seed, as seeds of the invention by the expression of the genetic the context determines, expressed as a percentage of the total constructs (exogenous polynucleotides) introduced into the fatty acid content. These new co6 fatty acids are the fatty cells, and include (if present) SDA, ETrA, ETA, EPA, DPA acids that are produced in the cells, plants, plant parts and and DHA, but exclude ALA and any (D6 fatty acids and seeds of the invention by the expression of the genetic monounsaturated fatty acids. Exemplary total (D3 fatty acid constructs (exogenous polynucleotides) introduced into the contents and new ()3 fatty acid contents are determined by cells, and include (if present) GLA, DGLA, ARA, EDA and 10 conversion of fatty acids in a sample to FAME and analysis ()6-DPA, but exclude LA and any co3 fatty acids and by GC, as described in Example 1. monounsaturated fatty acids. Exemplary total (O6 fatty acid As the skilled person would appreciate, the term “obtain contents and new ()6 fatty acid contents are determined by ing a plant part as a step in the process of the invention can conversion of fatty acids in a sample to FAME and analysis include obtaining one or more plant parts for use in the by GC, as described in Example 1. 15 process. Obtaining the plant part includes harvesting the As used herein, “total ()3 fatty acids” or “total ()3 fatty plant part from a plant Such as with a mechanical harvester, acid content” or the like refers to the sum of all the co3 fatty or purchasing the plant part, or receiving the plant part from acids, esterified and non-esterified, in the extracted lipid, oil, a Supplier. In another example, obtaining a plant part may be recombinant cell, plant part or seed, as the context deter acquiring the plant from someone else who has harvested the mines, expressed as a percentage of the total fatty acid plant part. content. These (03 fatty acids include (if present) ALA, The desaturase, elongase and acyltransferase proteins and SDA, ETrA, ETA, EPA, DPA and DHA, and exclude any ()6 genes encoding them that may be used in the invention are fatty acids and monounsaturated fatty acids. The co3 fatty any of those known in the art or homologues or derivatives acids present in the plants, seeds, lipid or oils of the thereof. Examples of Such genes and encoded protein sizes invention are all included in the class of polyunsaturated 25 are listed in Table 1. The desaturase enzymes that have been fatty acids (PUFA). shown to participate in LC-PUFA biosynthesis all belong to As used herein, “new ()3 fatty acids” or “new co3 fatty the group of so-called “front-end desaturases. Preferred acid content” or the like refers to the sum of all the co3 fatty proteins, or combinations of proteins, are those encoded by acids excluding ALA, esterified and non-esterified, in the the genetic constructs provided herein as SEQ ID NOs: 1 extracted lipid, oil, recombinant cell, plant part or seed, as and 2. TABLE 1. Cloned genes involved in LC-PUFA biosynthesis Protein size Enzyme Type of organism Species Accession Nos. (aas) References A4- Protist Eugiena graciis AY278558 S41 Meyer et al., 2003 desaturase Algae Pavlova lutherii AY332747 445 Tonon et al., 2003 Isochrysis galbania AAV33631 433 Pereira et al., 2004b Pavlova Saina AAY15136 447 Zhou et al., 2007 Thraustochytrid Thraustochytrium aureum AAN75707 515 NA AAN7S708 AAN7S709 AAN7S710 Thraustochytrium sp. AAMO9688 519 Qiu et al. 2001 ATCC21685 A5- Mammals Homo sapiens AF199596 444 Cho et al., 1999b desaturase Leonard et al., 2000b Nematode Caenorhabditis elegans AF11440, 447 Michaelson et al., 1998b; NM 069350 Watts and Browse, 1999b Fungi Mortierella alpina AFO67654 446 Michaelson et al., 1998a; Knutzon et al., 1998 Pythium irregulare AF419297 456 Hong et al., 2002a Dictyostelium discoideum ABO22097 467 Saito et al., 2000 Saprolegnia diclina 470 WOO2O81668 Diatom Phaeodactylum tricornutum AYO82392 469 Domergue et al., 2002 Algae Thraustochytrium sp AF489588 439 Qiu et al., 2001 Thraustochytrium aureum 439 WOO2O81668 Isochrysis galbania 442 WOO2O81668 Moss Marchantia polymorpha AYS83465 484 Kajikawa et al., 2004 A6- Mammals Homo sapiens NM 013402 444 Cho et al., 1999a: desaturase Leonard et al., 2000 Mits musculus NM 019699 444 Cho et al., 1999a Nematode Caenorhabditis elegans Z70271 443 Napier et al., 1998 Plants Borago officinates U79010 448 Sayanova et al., 1997 Echium AYO55117 Garcia-Maroto et al., 2002 AYO55118 Primuia viaii AY234127 453 Sayanova et al., 2003 Anemone ieveiliei AF536525 446 Whitney et al., 2003 Mosses Ceratodon purpureus AJ250735 520 Sperling et al., 2000 Marchantia polymorpha AYS83463 481 Kajikawa et al., 2004 Physcomitrella patens CAA11033 525 Girke et al., 1998 US 9,725,399 B2 41 42 TABLE 1-continued Cloned genes involved in LC-PUFA biosynthesis Protein size Enzyme Type of organism Species Accession Nos. (aas) References Fungi Mortierella alpina AF110510 457 Huang et al., 1999; ABO2OO32 Sakuradani et al., 1999 Pythium irregulare AF419296 459 Hong et al., 2002a Mucor circineioides ABOS2O86 467 NCBI* Rhizopus sp. AY320288 458 Zhang et al., 2004 Saprolegnia diclina 453 WOO2O81668 Diatom Phaeodactylum tricornutum AYO82393 477 Domergue et al., 2002 Bacteria Synechocystis L11421 359 Reddy et al., 1993 Algae Thraustochytrium aureum 456 WOO2O81668 Bifunctional Fish Danio perio AF309556 444 Hastings et al., 2001 A5, A6 desaturase C2O A8- Algae Euglena graciis AF13972O 419 Wallis and Browse, 1999 desaturase Plants Borago officinales AAG43277 446 Sperling et al., 2001 A6-elongase Nematode Caenorhabditis elegans NM 069288 288 Beaudoin et al., 2000 Mosses Physcomitrella patens AF428243 290 Zank et al., 2002 Marchantia polymorpha AYS83464 290 Kajikawa et al., 2004 Fungi Mortierella alpina AF206.662 3.18 Parker-Barnes et al., 2000 Algae Pavliova intiheri 5O1 WO O3078.639 Thraustochytrium AX951S6S 271 WO O3093482 Thraustochytrium sp. AX214.454 271 WOO1591.28 PUFA- Mammals Homo sapiens AF231981 299 Leonard et al., 2000b: elongase Leonard et al., 2002 Rattus norvegicus ABO71985 299 nagaki et al., 2002 Rattus norvegicus** ABO71986 267 nagaki et al., 2002 Mits musculus AF170907 279 Tvrdik et al., 2000 Mits musculus AF170908 292 Tvrdik et al., 2000 Fish Danio perio AFS32782 291 (282) Agaba et al., 2004 Danio perio NM 199532 266 Lo et al., 2003 Worm Caenorhabditis elegans Z68749 309 Abbott et al., 1998 Beaudoin et al., 2000 Algae Thraustochytrium aureum AX464802 272 WO O2O84O1-A2 Pavliova intiheri 320 WO O3078.639 A9-elongase Algae Isochrysis galbania AF3901.74 263 Qi et al., 2002 Euglena graciis 258 WO O8.128241 A5-elongase Algae Ostreococci is tattri AAV67798 300 Meyer et al., 2004 Pyramimonas cordata 268 WO 2010.OS7246 Pavlova sp. CCMP459 AAV33630 277 Pereira et al., 2004b Pavlova sailina AAY1513S 3O2 Robert et al., 2009 Diatom ThalassioSira pseudonana AAV67800 358 Meyer et al., 2004 Fish Oncorhynchus mykiss CAMSS862 295 WOO6,008099 Moss Marchantia polymorpha BAE71129 348 Kajikawa et al., 2006 *http://www.ncbi.nlm.nih.gov **Function not proveninot demonstrated

As used herein, the term "front-end desaturase' refers to 45 necessarily imply that a particular enzyme does not possess a member of a class of enzymes that introduce a double bond an activity other than that specifically defined. between the carboxyl group and a pre-existing unsaturated Desaturases part of the acyl chain of lipids, which are characterized As used herein, the term “desaturase' refers to an enzyme structurally by the presence of an N-terminal cytochrome b5 which is capable of introducing a carbon-carbon double domain, along with a typical fatty acid desaturase domain 50 bond into the acyl group of a fatty acid substrate which is that includes three highly conserved histidine boxes (Napier typically in an esterified form such as, for example, acyl et al., 1997). CoA esters. The acyl group may be esterified to a phospho Activity of any of the elongases or desaturases for use in lipid such as phosphatidylcholine (PC), or to acyl carrier the invention may be tested by expressing a gene encoding 55 protein (ACP), or in a preferred embodiment to CoA. the enzyme in a cell Such as, for example, a plant cell or Desaturases generally may be categorized into three groups preferably in Somatic embryos or transgenic plants, and accordingly. In one embodiment, the desaturase is a front determining whether the cell, embryo or plant has an end desaturase. increased capacity to produce LC-PUFA compared to a As used herein, a “A4-desaturase' refers to a protein comparable cell, embryo or plant in which the enzyme is not 60 which performs a desaturase reaction that introduces a expressed. carbon-carbon double bond at the 4' carbon-carbon bond In one embodiment one or more of the desaturases and/or from the carboxyl end of a fatty acid substrate. The “A4 elongases for use in the invention can purified from a desaturase' is at least capable of converting DPA to DHA. microalga, i.e. is identical in amino acid sequence to a Preferably, the “A4-desaturase' is capable of converting polypeptide which can be purified from a microalga. 65 DPA-CoA to DHA-CoA, i.e. it is an acyl-CoA desaturase. In Whilst certain enzymes are specifically described herein an embodiment, the “A4-desaturase' is capable of convert as “bifunctional', the absence of such a term does not ing DPA esterified at the sn-2 position of PC to DHA-PC. US 9,725,399 B2 43 44 Preferably the A4-desaturase has greater activity on DPA converting ALA-CoA to SDA-CoA, i.e. it is an acyl-CoA CoA than on DPA-PC. The desaturation step to produce desaturase. In an embodiment, the “A6-desaturase' is DHA from DPA is catalysed by a A4-desaturase in organ capable of converting ALA esterified at the Sn-2 position of isms other than mammals, and a gene encoding this enzyme PC. Preferably the A6-desaturase has greater activity on has been isolated from the freshwater protist species ALA-CoA than on ALA-PC. The A6-desaturase may also Euglena gracilis and the marine species Thraustochy’rrium have activity as a A5-desaturase, being termed a A5/A6 sp. (Qiu et al., 2001; Meyer et al., 2003). In one embodi bifunctional desaturase, so long as it has greater A6-desatu ment, the A4-desaturase comprises amino acids having a rase activity on ALA than A5-desaturase activity on ETA. sequence as provided in SEQID NO:28, or a Thraustochy Examples of A6-desaturases are listed in Ruiz-Lopez et al. trium sp. A4-desaturase, a biologically active fragment 10 (2012) and Petrie et al. (2010a) and in Table 1 herein. thereof, or an amino acid sequence which is at least 80% Preferred A6-desaturases are from Micromonas pusilla, identical to SEQID NO:28. In an embodiment, a plant, plant Pythium irregulare or Ostreococcus taurii. part (Such as seed) or cell of, or used in, the invention which In an embodiment, the A6-desaturase is further charac produces high levels of DPA, such as 5% to 35% of the total terised by having at least two, preferably all three and extractable fatty acid content is DPA, does not comprise a 15 preferably in a plant cell, of the following: i) greater gene encoding a functional A4-desaturase. A6-desaturase activity on C-linolenic acid (ALA, 18:3A9, As used herein, a “A5-desaturase refers to a protein 12, 15, ()3) than linoleic acid (LA, 18:2A9,12, ()6) as fatty which performs a desaturase reaction that introduces a acid Substrate; ii) greater A6-desaturase activity on ALA carbon-carbon double bond at the 5' carbon-carbon bond CoA as fatty acid substrate than on ALA joined to the sn-2 from the carboxyl end of a fatty acid substrate. In an position of PC as fatty acid substrate; and iii) A8-desaturase embodiment, the fatty acid substrate is ETA and the enzyme activity on ETrA. Examples of such A6-desaturases are produces EPA. Preferably, the “A5-desaturase' is capable of provided in Table 2. TABLE 2 Desaturases demonstrated to have activity on an acyl-CoA substrate Protein Type of Accession size Enzyme organism Species Nos. (aa's) References A6-desaturase Algae Mantonieia CAQ30479 449 Hoffmann et al., 2008 Squamata Osteococcits AAW7O159 456 Domergue et al., 2005 tatiri Micromonas EEH58637 Petrie et al., 2010a pusilia (SEQ ID NO: 7) A5-desaturase Algae Mantonieia CAQ30478 482 Hoffmann et al., 2008 Squamata Plant Anemone NA Sayanova et al., 2007 ieveiei (O3-desaturase Fungi Pythium FW362186.1 359 Xue et al., 2012: aphanidermatiin WO2O08,05456S Fungi Phytophthora FW362214.1 363 Xue et al., 2012: (Oomycete) Soiae WO2O08,05456S Fungi Phytophthora FW3622.13.1 361 Xue et al., 2012: (Oomycete) ranorum WO2O08,05456S converting ETA-CoA to EPA-CoA, i.e. it is an acyl-CoA 45 In an embodiment the A6-desaturase has greater activity desaturase. In an embodiment, the “A5-desaturase' is on an (03 Substrate than the corresponding ()6 Substrate and capable of converting ETA esterified at the sn-2 position of has activity on ALA to produce octadecatetraenoic acid PC. Preferably the A5-desaturase has greater activity on (stearidonic acid, SDA, 18:4A6,9,12,15, ()3) with an effi ETA-CoA than on ETA-PC. Examples of A5-desaturases are ciency of at least 30%, more preferably at least 40%, or most listed in Ruiz-Lopez et al. (2012) and Petrie et al. (2010a) 50 preferably at least 50% when expressed from an exogenous and in Table 1 herein. In one embodiment, the A5-desaturase polynucleotide in a recombinant cell Such as a plant cell, or comprises amino acids having a sequence as provided in at least 35% when expressed in a yeast cell. In one embodi SEQID NO:20, a biologically active fragment thereof, or an ment, the A6-desaturase has greater activity, for example, at amino acid sequence which is at least 80% identical to SEQ 55 least about a 2-fold greater A6-desaturase activity, on ALA ID NO:20. In another embodiment, the A5-desaturase com than LA as fatty acid substrate. In another embodiment, the prises amino acids having a sequence as provided in SEQID A6-desaturase has greater activity, for example, at least NO:22, a biologically active fragment thereof, or an amino about 5 fold greater A6-desaturase activity or at least 10-fold acid sequence which is at least 53% identical to SEQ ID greater activity, on ALA-CoA as fatty acid substrate than on NO:22. In another embodiment, the A5-desaturase is from 60 ALA joined to the sn-2 position of PC as fatty acid substrate. Thraustochytrium sp. or Emiliania huxleyi. In a further embodiment, the A6-desaturase has activity on As used herein, a “A6-desaturase refers to a protein both fatty acid substrates ALA-CoA and on ALA joined to which performs a desaturase reaction that introduces a the sn-2 position of PC. carbon-carbon double bond at the 6' carbon-carbon bond In one embodiment, the A6-desaturase has no detectable from the carboxyl end of a fatty acid substrate. In an 65 A5-desaturase activity on ETA. In another embodiment, the embodiment, the fatty acid substrate is ALA and the enzyme A6-desaturase comprises amino acids having a sequence as produces SDA. Preferably, the “A6-desaturase' is capable of provided in SEQ ID NO:9, SEQ ID NO:12 or SEQ ID US 9,725,399 B2 45 46 NO:13, a biologically active fragment thereof, or an amino ()6 fatty acid substrates to the corresponding (03 fatty acids, acid sequence which is at least 77% identical to SEQ ID with a preference for C20 substrates, i.e. they had stronger NO:9, SEQ ID NO:12 or SEQ ID NO:13. In another A 17-desaturase activity than A15-desaturase activity. These embodiment, the A6-desaturase comprises amino acids hav enzymes lacked A12-desaturase activity, but could use fatty ing a sequence as provided in SEQ ID NO:12 or SEQ ID acids in both acyl-CoA and phospholipid fraction as Sub NO:13, a biologically active fragment thereof, or an amino Strates. acid sequence which is at least 67% identical to one or both In a more preferred embodiment, the fungal (O3-desatu of SEQ ID NO:12 or SEQ ID NO:13. The A6-desaturase rase is the Pichia pastoris (also known as Komagataella may also have A8-desaturase activity. pastoris) (O3-desaturase/A15-desaturase (Zhang et al., 2008; As used herein, a “A8-desaturase refers to a protein 10 Accession No, EF1 16884; SEQID NO: 6), or a polypeptide which performs a desaturase reaction that introduces a which is at least 95% identical thereto. carbon-carbon double bond at the 8” carbon-carbon bond In an embodiment, the co3-desaturase is at least capable of from the carboxyl end of a fatty acid substrate. The A8-de converting one of ARA to EPA, DGLA to ETA, GLA to saturase is at least capable of converting ETrA to ETA. SDA, both ARA to EPA and DGLA to ETA, both ARA to Preferably, the A8-desaturase is capable of converting ETrA 15 EPA and GLA to SDA, or all three of these. CoA to ETA-CoA, i.e. it is an acyl-CoA desaturase. In an In one embodiment, the (03-desaturase has A17-desatu embodiment, the A8-desaturase is capable of converting rase activity on a C20 fatty acid which has at least three ETrA esterified at the sn-2 position of PC. Preferably the carbon-carbon double bonds, preferably ARA. In another A8-desaturase has greater activity on ETrA-CoA than on embodiment, the (p3-desaturase has A15-desaturase activity ETrA-PC. The A8-desaturase may also have activity as a on a C18 fatty acid which has three carbon-carbon double A6-desaturase, being termed a A6/A8 bifunctional desatu bonds, preferably GLA. Preferably, both activities are pres rase, so long as it has greater A8-desaturase activity on ETrA ent. than A6-desaturase activity on ALA. Examples of A8-de As used herein, a “A 12-desaturase' refers to a protein saturases are listed in Table 1. In one embodiment, the which performs a desaturase reaction that introduces a A8-desaturase comprises amino acids having a sequence as 25 carbon-carbon double bond at the 12" carbon-carbon bond provided in SEQ ID NO:37, a biologically active fragment from the carboxyl end of a fatty acid substrate. A 12 thereof, or an amino acid sequence which is at least 80% desaturases typically convert either oleoyl-phosphatidylcho identical to SEQ ID NO:37. line or oleoyl-CoA to linoleoyl-phosphatidylcholine (18:1- As used herein, an “co3-desaturase' refers to a protein PC) or linoleoyl-CoA (18:1-CoA), respectively. The which performs a desaturase reaction that introduces a 30 subclass using the PC linked substrate are referred to as carbon-carbon double bond at the 3rd carbon-carbon bond phospholipid-dependent A12-desaturases, the latter Subclass from the methyl end of a fatty acid substrate. A co3-desatu as acyl-CoA dependent A12-desaturases. Plant and fungal rase therefore may convert LA to ALA and GLA to SDA (all A 12-desaturases are generally of the former Sub-class, C18 fatty acids), or DGLA to ETA and/or ARA to EPA (C20 whereas animal A12-desaturases are of the latter Subclass, fatty acids). Some (O3-desaturases (group I) have activity 35 for example the A12-desaturases encoded by genes cloned only on C18 Substrates, such as plant and cyanobacterial from insects by Zhou et al. (2008). Many other A12 (O3-desaturases. Such (03-desaturases are also A15-desatu desaturase sequences can be easily identified by searching rases. Other (D3-desaturases have activity on C20 substrates sequence databases. with no activity (group II) or some activity (group III) on As used herein, a “A 15-desaturase' refers to a protein C18 substrates. Such (03-desaturases are also A17-desatu 40 which performs a desaturase reaction that introduces a rases. Preferred ()3-desaturases are group III type which carbon-carbon double bond at the 15" carbon-carbon bond convert LA to ALA, GLA to SDA, DGLA to ETA and ARA from the carboxyl end of a fatty acid substrate. Numerous to EPA, such as the Pichia pastoris ()3-desaturase (SEQ ID genes encoding A15-desaturases have been cloned from NO: 6). Examples of c)3-desaturases include those described plant and fungal species. For example, U.S. Pat. No. 5,952, by Pereira et al. (2004a) (Saprolegnia diclina (03-desaturase, 45 544 describes nucleic acids encoding plant A15-desaturases group II), Horiguchi et al. (1998), Berberich et al. (1998) and (FAD3). These enzymes comprise amino acid motifs that Spychalla et al. (1997) (C. elegans (D3-desaturase, group were characteristic of plant A15-desaturases. WO200114538 III). In a preferred embodiment, the co3-desaturase is a describes a gene encoding soybean FAD3. Many other fungal (O3-desaturase. As used herein, a “fungal (O3-desatu A 15-desaturase sequences can be easily identified by search rase' refers to an (03-desaturase which is from a fungal 50 ing sequence databases. Source, including an oomycete source, or a variant thereof As used herein, a “A 17-desaturase' refers to a protein whose amino acid sequence is at least 95% identical thereto. which performs a desaturase reaction that introduces a Genes encoding numerous (D3-desaturases have been iso carbon-carbon double bond at the 17" carbon-carbon bond lated from fungal Sources such as, for example, from Phy from the carboxyl end of a fatty acid substrate. A A 17 tophthora infestans (Accession No. CAJ30870, 55 desaturase is also regarded as an (03-desaturase if it acts on WO2005083053: SEQ ID NO: 47), Saprolegnia diclina a C20 substrate to introduce a desaturation at the (03 bond. (Accession No. AAR20444, Pereira et al., 2004a & U.S. Pat. In a preferred embodiment, the A12-desaturase and/or No. 7,21 1,656), Pythium irregulare (WO2008022963, A 15-desaturase is a fungal A12-desaturase or fungal A15 Group II; SEQID NO: 49), Mortierella alpina (Sakuradani desaturase. As used herein, a “fungal A12-desaturase' or “a et al., 2005: Accession No. BAD91495; WO2006019192), 60 fungal A15-desaturase' refers to a A12-desaturase or A15 Thalassiosira pseudonana (Armbrust et al., 2004. Accession desaturase which is from a fungal source, including an No. XP 002291057; WO2005012316, SEQ ID NO: 48), oomycete source, or a variant thereof whose amino acid Lachancea kluyveri (also known as Saccharomyces kluyveri; sequence is at least 95% identical thereto. Genes encoding Oura et al., 2004: Accession No. AB118663). Xue et al. numerous desaturases have been isolated from fungal (2012) describes ()3-desaturases from the oomycetes 65 sources. U.S. Pat. No. 7,211,656 describes a A12 desaturase Pythium aphanidermatum, Phytophthora sojae, and Phy from Saprolegnia diclina, WO2009016202 describes fungal tophthora ramorum which were able to efficiently convert desaturases from Helobdella robusta, Laccaria bicolor; Lot US 9,725,399 B2 47 48 tia gigantea, Microcoleus chthonoplastes, Monosiga brevi A5-desaturase and A4-desaturases expressed from the GA7 collis, Mycosphaerella fijiensis, Mycospaerella graminicola, construct (Examples 2 and 3) and variants thereof (Example Naegleria gruben, Nectria haematococca, Nematostella 4) are capable of desaturating their respective acyl-CoA vectensis, Phycomyces blakesleeanus, Trichoderma resii, substrates, ETA-CoA and DPA-CoA. Physcomitrella patens, Postia placenta, Selaginella Elongases moellendorffii and Microdochium nivale, WO2005/012316 Biochemical evidence Suggests that the fatty acid elon describes a A12-desaturase from Thalassiosira pseudonana gation consists of 4 steps: condensation, reduction, dehy and other fungi. WO2003/099216 describes genes encoding dration and a second reduction. In the context of this fungal A12-desaturases and A15-desaturases isolated from invention, an “elongase' refers to the polypeptide that Neurospora crassa, Aspergillus nidulans, Botrytis cinerea 10 catalyses the condensing step in the presence of the other and Mortierella alpina. WO2007133425 describes fungal members of the elongation complex, under Suitable physi A15 desaturases isolated from: Saccharomyces kluyveri, ological conditions. It has been shown that heterologous or Mortierella alpina, Aspergillus nidulans, Neurospora homologous expression in a cell of only the condensing crassa, Fusarium graminearum, Fusarium moniliforme and component ('elongase') of the elongation protein complex Magnaporthe grisea. A preferred A12 desaturase is from 15 is required for the elongation of the respective acyl chain. Phytophthora sojae (Ruiz-Lopez et al., 2012). Thus, the introduced elongase is able to Successfully recruit A distinct Subclass of fungal A12-desaturases, and of the reduction and dehydration activities from the transgenic fungal A15-desaturases, are the bifunctional fungal A12/ host to carry out successful acyl elongations. The specificity A 15-desaturases. Genes encoding these have been cloned of the elongation reaction with respect to chain length and from Fusarium monoliforme (Accession No. DQ272516, the degree of desaturation of fatty acid substrates is thought Damude et al., 2006), Acanthamoeba casteilanii (Accession to reside in the condensing component. This component is No. EF017656, Sayanova et al., 2006), Perkinsus marinus also thought to be rate limiting in the elongation reaction. (WO2007042510), Claviceps purpurea (Accession No. As used herein, a “A5-elongase' is at least capable of EF536898, Meesapyodsuk et al., 2007) and Coprinus converting EPA to DPA. Examples of A5-elongases include cinereus (Accession No. AF269266, Zhang et al., 2007). 25 those disclosed in WO2005/103253. In one embodiment, the In another embodiment, the (p3-desaturase has at least A5-elongase has activity on EPA to produce DPA with an Some activity on, preferably greateractivity on, an acyl-CoA efficiency of at least 60%, more preferably at least 65%, Substrate than a corresponding acyl-PC Substrate. As used more preferably at least 70% or most preferably at least 80% herein, a “corresponding acyl-PC substrate” refers to the or 90%. In a further embodiment, the A5-elongase comprises fatty acid esterified at the sn-2 position of phosphatidylcho 30 an amino acid sequence as provided in SEQ ID NO:25, a line (PC) where the fatty acid is the same fatty acid as in the biologically active fragment thereof, or an amino acid acyl-CoA substrate. For example, the acyl-CoA substrate sequence which is at least 47% identical to SEQID NO:25. may be ARA-CoA and the corresponding acyl-PC substrate In a further embodiment, the A6-elongase is from Ostreo is sn-2 ARA-PC. In an embodiment, the activity is at least coccus taurii or Ostreococcus lucimarinus (US2010/ two-fold greater. Preferably, the co3-desaturase has at least 35 088776). Some activity on both an acyl-CoA substrate and its corre As used herein, a “A6-elongase' is at least capable of sponding acyl-PC substrate and has activity on both C18 and converting SDA to ETA. Examples of A6-elongases include C20 substrates. Examples of such (03-desaturases are known those listed in Table 1. In one embodiment, the elongase amongst the cloned fungal desaturases listed above. comprises amino acids having a sequence as provided in In a further embodiment, the (p3-desaturase comprises 40 SEQID NO:16, a biologically active fragment thereof (such amino acids having a sequence as provided in SEQID NO:6. as the fragment provided as SEQ ID NO:17), or an amino a biologically active fragment thereof, or an amino acid acid sequence which is at least 55% identical to one or both sequence which is at least 60% identical to SEQ ID NO:6, of SEQID NO:16 or SEQID NO:17. In an embodiment, the preferably at least 90% or at least 95% identical to SEQ ID A6-elongase is from Physcomitrella patens (Zank et al., NO:6. 45 2002: Accession No. AF428243) or Thalassiosira pseudo In yet a further embodiment, a desaturase for use in the nana (Ruiz-Lopez et al., 2012). present invention has greater activity on an acyl-CoA Sub As used herein, a “A9-elongase' is at least capable of strate than a corresponding acyl-PC substrate. In another converting ALA to ETrA. Examples of A9-elongases include embodiment, a desaturase for use in the present invention those listed in Table 1. In one embodiment, the A9-elongase has greater activity on an acyl-PC Substrate than a corre 50 comprises amino acids having a sequence as provided in sponding acyl-CoA substrate, but has some activity on both SEQID NO:29, a biologically active fragment thereof, or an substrates. As outlined above, a “corresponding acyl-PC amino acid sequence which is at least 80% identical to SEQ substrate” refers to the fatty acid esterified at the sn-2 ID NO:29. In another embodiment, the A9-elongase com position of phosphatidylcholine (PC) where the fatty acid is prises amino acids having a sequence as provided in SEQID the same fatty acid as in the acyl-CoA substrate. In an 55 NO:31, a biologically active fragment thereof, or an amino embodiment, the greater activity is at least two-fold greater. acid sequence which is at least 81% identical to SEQ ID In an embodiment, the desaturase is a A5 or A6-desaturase, NO:31. In another embodiment, the A9-elongase comprises or an (03-desaturase, examples of which are provided, but amino acids having a sequence as provided in SEQ ID not limited to, those listed in Table 2. To test which substrate NO:33, a biologically active fragment thereof, or an amino a desaturase acts on, namely an acyl-CoA or an acyl-PC 60 acid sequence which is at least 50% identical to SEQ ID Substrate, assays can be carried out in yeast cells as NO:33. In another embodiment, the A9-elongase comprises described in Domergue et al. (2003 and 2005). Acyl-CoA amino acids having a sequence as provided in SEQ ID substrate capability for a desaturase can also be inferred NO:35, a biologically active fragment thereof, or an amino when an elongase, when expressed together with the des acid sequence which is at least 50% identical to SEQ ID turase, has an enzymatic conversion efficiency in plant cells 65 NO:35. In a further embodiment, the A9-elongase has of at least about 90% where the elongase catalyses the greater activity on an ()6 Substrate than the corresponding elongation of the product of the desaturase. On this basis, the (O3 substrate, or the converse. US 9,725,399 B2 49 50 As used herein, the term "has greater activity on an ()6 which is capable of using DPA-CoA as a substrate to transfer substrate than the corresponding ()3 substrate” refers to the the DPA to LPA, forming DAG having DPA at the sn-2 relative activity of the enzyme on substrates that differ by the position. action of an ()3 desaturase. Preferably, the Co6 substrate is The transgenes introduced into the recombinant cell, LA and the (O3 substrate is ALA. transgenic plant or part thereof may also encode a DGAT. As An elongase with A6-elongase and A9-elongase activity is used herein, the term “diacylglycerol acyltransferase” (EC at least capable of (i) converting SDA to ETA and (ii) 2.3.1.20; DGAT) refers to a protein which transfers a fatty converting ALA to ETrA and has greater A6-elongase activ acyl group from acyl-CoA to a diacylglycerol Substrate to ity than A9-elongase activity. In one embodiment, the elon produce a triacylglycerol. Thus, the term "diacylglycerol 10 acyltransferase activity” refers to the transfer of acyl-CoA to gase has an efficiency of conversion on SDA to produce ETA diacylglycerol to produce triacylglycerol. There are three which is at least 50%, more preferably at least 60%, and/or known types of DGAT referred to as DGAT1, DGAT2 and an efficiency of conversion on ALA to produce ETrA which DGAT3 respectively. DGAT1 polypeptides typically have is at least 6% or more preferably at least 9%. In another 10 transmembrane domains, DGAT2 typically have 2 trans embodiment, the elongase has at least about 6.5 fold greater 15 membrane domains, whilst DGAT3 is typically soluble. A6-elongase activity than A9-elongase activity. In a further Examples of DGAT1 polypeptides include polypeptides embodiment, the elongase has no detectable A5-elongase encoded by DGAT1 genes from Aspergillus fumigatus (Ac activity. cession No. XP 755172), Arabidopsis thaliana Other Enzymes (CAB44774), Ricinus communis (AAR11479), Vernicia for The transgenes introduced into the recombinant cell Such dii (ABC94472), Vermonia galamensis (ABV21945, as a microbial cell, or transgenic plant or part thereof may ABV21946), Euonymus alatus (AAV31083), Caenorhabdi also encode an LPAAT. As used herein, the term “1-acyl tis elegans (AAF82410), Rattus norvegicus (NP 445889), glycerol-3-phosphate acyltransferase (LPAAT), also Homo sapiens (NP 036211), as well as variants and/or termed lysophosphatidic acid-acyltransferase or acylCoA mutants thereof. Examples of DGAT2 polypeptides include lysophosphatidate-acyltransferase, refers to a protein which 25 polypeptides encoded by DGAT2 genes from Arabidopsis acylates Sn-1-acyl-glycerol-3-phosphate (sn-1 G-3-P) at the thaliana (Accession No. NP 566952), Ricinus communis sn-2 position to form phosphatidic acid (PA). Thus, the term (AAY16324), Vernicia fordii (ABC94474), Mortierella “1-acyl-glycerol-3-phosphate acyltransferase activity” ramanniana (AAK84179), Homo sapiens (Q96PD7, refers to the acylation of (sn-1 G-3-P) at the sn-2 position to Q58HT5), Bos taurus (Q70VD8), Mus musculus 30 (AAK84175), Micromonas CCMP1545, as well as variants produce PA (EC 2.3.1.51). Preferred LPAATs are those that and/or mutants thereof. Examples of DGAT3 polypeptides can use a polyunsaturated C22 acyl-CoA as substrate to include polypeptides encoded by DGAT3 genes from peanut transfer the polyunsaturated C22 acyl group to the Sn-2 (Arachis hypogaea, Saha, et al., 2006), as well as variants position of LPA, forming PA. In an embodiment, the poly and/or mutants thereof. unsaturated C22 acyl-CoA is DHA-CoA and/or DPA-CoA. 35 Polypeptides/Peptides Such LPAATs are exemplified in Example 7 and can be The terms “polypeptide' and “protein’ are generally used tested as described therein. In an embodiment, an LPAAT interchangeably. useful for the invention comprises amino acids having a A polypeptide or class of polypeptides may be defined by sequence as provided in any one of SEQID NOs: 40 to 46, the extent of identity (% identity) of its amino acid sequence a biologically active fragment thereof, or an amino acid 40 to a reference amino acid sequence, or by having a greater sequence which is at least 40% identical to any one or more % identity to one reference amino acid sequence than to of SEQ ID NOs: 40 to 46. In another embodiment, the another. The % identity of a polypeptide to a reference LPAAT does not have amino acids having a sequence as amino acid sequence is typically determined by GAP analy provided in any one of SEQ ID NO: 44. In a preferred sis (Needleman and Wunsch, 1970; GCG program) with embodiment, an LPAAT useful for the invention which can 45 parameters of a gap creation penalty=5, and a gap extension use a C22 polyunsaturated fatty acyl-CoA substrate, prefer penalty 0.3. The query sequence is at least 15 amino acids ably DHA-CoA and/or DPA-CoA, comprises amino acids in length, and the GAP analysis aligns the two sequences having a sequence as provided in any one of SEQ ID NOs: over a region of at least 15 amino acids. More preferably, the 41, 42 and 44, a biologically active fragment thereof, or an query sequence is at least 50 amino acids in length, and the amino acid sequence which is at least 40% identical to any 50 GAP analysis aligns the two sequences over a region of at one or more of SEQ ID NOs: 41, 42 and 44. In a preferred least 50 amino acids. More preferably, the query sequence is embodiment, an LPAAT useful for the invention which can at least 100 amino acids in length and the GAP analysis use a C22 polyunsaturated fatty acyl-CoA substrate, prefer aligns the two sequences over a region of at least 100 amino ably DHA-CoA and/or DPA-CoA, comprises amino acids acids. Even more preferably, the query sequence is at least having a sequence as provided in any one of SEQ ID NOs: 55 250 amino acids in length and the GAP analysis aligns the 41 or 42, a biologically active fragment thereof, or an amino two sequences over a region of at least 250 amino acids. acid sequence which is at least 40% identical to any one or Even more preferably, the GAP analysis aligns two both of SEQID NOs: 41 and 42. In an embodiment in which sequences over their entire length. The polypeptide or class the genetic construct expresses a A4-desaturase in the trans of polypeptides may have the same enzymatic activity as, or genic cell and/or the transgenic cell produces DHA, the 60 a different activity than, or lack the activity of the reference LPAAT is preferably an LPAAT other the Mortierella alpina polypeptide. Preferably, the polypeptide has an enzymatic LPAAT whose amino acid sequence is set forth as SEQ ID activity of at least 10%, at least 50%, at least 75% or at least NO: 44. Alternatively, if the genetic construct does not 90%, of the activity of the reference polypeptide. express a A4-desaturase in the transgenic cell and/or the As used herein a “biologically active' fragment is a transgenic cell produces DPA but not DHA, the LPAAT is 65 portion of a polypeptide defined herein which maintains a preferably the Mortierella alpina LPAAT whose amino acid defined activity of a full-length reference polypeptide, for sequence is set forth as SEQID NO: 44 or another LPAAT example possessing desaturase and/or elongase activity or US 9,725,399 B2 51 52 other enzyme activity. Biologically active fragments as used rally occurring polypeptide. Details of conservative amino herein exclude the full-length polypeptide. Biologically acid changes are provided in Table 3. As the skilled person active fragments can be any size portion as long as they would be aware, such minor changes can reasonably be maintain the defined activity. Preferably, the biologically predicted not to alter the activity of the polypeptide when active fragment maintains at least 10%, at least 50%, at least expressed in a recombinant cell. 75% or at least 90%, of the activity of the full length protein. Polynucleotides With regard to a defined polypeptide or enzyme, it will be The invention also provides for the use of polynucleotides appreciated that % identity figures higher than those pro which may be, for example, a gene, an isolated polynucle vided herein will encompass preferred embodiments. Thus, otide, a chimeric genetic construct Such as a T-DNA mol where applicable, in light of the minimum 9% identity 10 figures, it is preferred that the polypeptide? enzyme com ecule, or a chimeric DNA. It may be DNA or RNA of prises an amino acid sequence which is at least 60%, more genomic or synthetic origin, double-stranded or single preferably at least 65%, more preferably at least 70%, more Stranded, and combined with carbohydrate, lipids, protein or preferably at least 75%, more preferably at least 76%, more other materials to perform a particular activity defined preferably at least 80%, more preferably at least 85%, more 15 herein. The term “polynucleotide' is used interchangeably preferably at least 90%, more preferably at least 91%, more herein with the term “nucleic acid molecule'. preferably at least 92%, more preferably at least 93%, more In an embodiment, the polynucleotide is non-naturally preferably at least 94%, more preferably at least 95%, more occurring. Examples of non-naturally occurring polynucle preferably at least 96%, more preferably at least 97%, more otides include, but are not limited to, those that have been preferably at least 98%, more preferably at least 99%, more mutated (such as by using methods described herein), and preferably at least 99.1%, more preferably at least 99.2%, polynucleotides where an open reading frame encoding a more preferably at least 99.3%, more preferably at least protein is operably linked to a promoter to which it is not 99.4%, more preferably at least 99.5%, more preferably at naturally associated (such as in the constructs described least 99.6%, more preferably at least 99.7%, more preferably herein). at least 99.8%, and even more preferably at least 99.9% 25 identical to the relevant nominated SEQ ID NO. TABLE 3 Amino acid sequence variants/mutants of the polypep tides of the defined herein can be prepared by introducing Exemplary Substitutions. appropriate nucleotide changes into a nucleic acid defined Original Exemplary herein, or by in vitro synthesis of the desired polypeptide. 30 Residue Substitutions Such variants/mutants include, for example, deletions, inser Ala (A) val; leu; ille: gly tions or substitutions of residues within the amino acid Arg (R) lys sequence. A combination of deletion, insertion and Substi ASn (N) gln; his Asp (D) glu tution can be made to arrive at the final construct, provided Cys (C) Se that the final peptide product possesses the desired enzyme 35 Glin (Q) asn; his activity. Glu (E) asp Mutant (altered) peptides can be prepared using any Gly (G) pro, ala technique known in the art. For example, a polynucleotide His (H) aSn; gln Ile (I) leu; val; ala defined herein can be subjected to in vitro mutagenesis or Leu (L) ile; val; met; ala; phe DNA shuffling techniques as broadly described by 40 Lys (K) arg Harayama (1998). Products derived from mutated/altered Met (M) leu; phe DNA can readily be screened using techniques described Phe (F) leu; val; ala Pro (P) gly herein to determine if they possess, for example, desaturase Ser (S) thr or elongase activity. Thr (T) Se In designing amino acid sequence mutants, the location of 45 Trp (W) tyr the mutation site and the nature of the mutation will depend Tyr (Y) trp; phe on characteristic(s) to be modified. The sites for mutation Val (V) ile; leu; met; phe, ala can be modified individually or in series, e.g., by (1) Substituting first with conservative amino acid choices and As used herein, the term “gene' is to be taken in its then with more radical selections depending upon the results 50 broadest context and includes the deoxyribonucleotide achieved, (2) deleting the target residue, or (3) inserting sequences comprising the transcribed region and, if trans other residues adjacent to the located site. lated, the protein coding region, of a structural gene and Amino acid sequence deletions generally range from including sequences located adjacent to the coding region on about 1 to 15 residues, more preferably about 1 to 10 both the 5' and 3' ends for a distance of at least about 2 kb residues and typically about 1 to 5 contiguous residues. 55 on either end and which are involved in expression of the Substitution mutants have at least one amino acid residue gene. In this regard, the gene includes control signals such in the polypeptide molecule removed and a different residue as promoters, enhancers, termination and/or polyadenylation inserted in its place. The sites of greatest interest for sub signals that are naturally associated with a given gene, or stitutional mutagenesis include sites which are not con heterologous control signals in which case the gene is served amongst naturally occurring desaturases or elon 60 referred to as a “chimeric gene'. The sequences which are gases. These sites are preferably substituted in a relatively located 5' of the protein coding region and which are present conservative manner in order to maintain enzyme activity. on the mRNA are referred to as 5' non-translated sequences. Such conservative substitutions are shown in Table 3 under The sequences which are located 3' or downstream of the the heading of “exemplary substitutions”. protein coding region and which are present on the mRNA In a preferred embodiment a mutant/variant polypeptide 65 are referred to as 3' non-translated sequences. The term has only, or not more than, one or two or three or four 'gene' encompasses both cDNA and genomic forms of a conservative amino acid changes when compared to a natu gene. A genomic form or clone of a gene contains the coding US 9,725,399 B2 53 54 region which may be interrupted with non-coding sequences Sources (naturally occurring and/or synthetic) joined to form termed “introns' or “intervening regions' or “intervening a single polynucleotide. Typically such chimeric polynucle sequences.” Introns are segments of a gene which are otides comprise at least an open reading frame encoding a transcribed into nuclear RNA (hnRNA). Introns may contain polypeptide operably linked to a promoter suitable of driv regulatory elements such as enhancers. Introns are removed ing transcription of the open reading frame in a cell of or “spliced out from the nuclear or primary transcript; interest. introns therefore are absent in the messenger RNA (mRNA) With regard to the defined polynucleotides, it will be transcript. The mRNA functions during translation to appreciated that % identity figures higher than those pro specify the sequence or order of amino acids in a nascent vided above will encompass preferred embodiments. Thus, polypeptide. The term “gene' includes a synthetic or fusion 10 where applicable, in light of the minimum '% identity molecule encoding all or part of the proteins described figures, it is preferred that the polynucleotide comprises a herein and a complementary nucleotide sequence to any one polynucleotide sequence which is at least 60%, more pref of the above. erably at least 65%, more preferably at least 70%, more As used herein, a "chimeric DNA or “chimeric genetic preferably at least 75%, more preferably at least 80%, more construct” or similar refers to any DNA molecule that is not 15 preferably at least 85%, more preferably at least 90%, more a native DNA molecule in its native location, also referred preferably at least 91%, more preferably at least 92%, more to herein as a “DNA construct”. Typically, a chimeric DNA preferably at least 93%, more preferably at least 94%, more or chimeric gene comprises regulatory and transcribed or preferably at least 95%, more preferably at least 96%, more protein coding sequences that are not found operably linked preferably at least 97%, more preferably at least 98%, more together in nature i.e. that are heterologous with respect to preferably at least 99%, more preferably at least 99.1%, each other. Accordingly, a chimeric DNA or chimeric gene more preferably at least 99.2%, more preferably at least may comprise regulatory sequences and coding sequences 99.3%, more preferably at least 99.4%, more preferably at that are derived from different sources, or regulatory least 99.5%, more preferably at least 99.6%, more preferably sequences and coding sequences derived from the same at least 99.7%, more preferably at least 99.8%, and even Source, but arranged in a manner different than that found in 25 more preferably at least 99.9% identical to the relevant nature. nominated SEQ ID NO. An "endogenous gene' refers to a native gene in its Polynucleotides may possess, when compared to naturally natural location in the genome of an organism. As used occurring molecules, one or more mutations which are herein, "recombinant nucleic acid molecule”, “recombinant deletions, insertions, or substitutions of nucleotide residues. polynucleotide' or variations thereof refer to a nucleic acid 30 Polynucleotides which have mutations relative to a reference molecule which has been constructed or modified by recom sequence can be either naturally occurring (that is to say, binant DNA technology. The terms “foreign polynucleotide' isolated from a natural source) or synthetic (for example, by or “exogenous polynucleotide' or "heterologous polynucle performing site-directed mutagenesis or DNA shuffling on otide' and the like refer to any nucleic acid which is the nucleic acid as described above). It is thus apparent that introduced into the genome of a cell by experimental 35 polynucleotides can be either from a naturally occurring manipulations. Foreign or exogenous genes may be genes source or recombinant. Preferred polynucleotides are those that are inserted into a non-native organism, native genes which have coding regions that are codon-optimised for introduced into a new location within the native host, or translation in plant cells, as is known in the art. chimeric genes. A “transgene' is a gene that has been Recombinant Vectors introduced into the genome by a transformation procedure. 40 Recombinant expression can be used to produce recom The terms “genetically modified, “transgenic' and varia binant cells, or plants or plant parts of the invention. tions thereof include introducing genes into cells by trans Recombinant vectors contain heterologous polynucleotide formation or transduction, mutating genes in cells and sequences, that is, polynucleotide sequences that are not altering or modulating the regulation of a gene in a cell or naturally found adjacent to polynucleotide molecules organisms to which these acts have been done or their 45 defined herein that preferably are derived from a species progeny. A 'genomic region' as used herein refers to a other than the species from which the polynucleotide mol position within the genome where a transgene, or group of ecule(s) are derived. The vector can be either RNA or DNA transgenes (also referred to herein as a cluster), have been and typically is a plasmid. Plasmid vectors typically include inserted into a cell, or an ancestor thereof. Such regions only additional nucleic acid sequences that provide for easy comprise nucleotides that have been incorporated by the 50 selection, amplification, and transformation of the expres intervention of man such as by methods described herein. sion cassette in prokaryotic cells, e.g. pUC-derived vectors, The term “exogenous” in the context of a polynucleotide pSK-derived vectors, pGEM-derived vectors, pSP-derived refers to the polynucleotide when present in a cell in an vectors, pFBS-derived vectors, or preferably binary vectors altered amount compared to its native state. In one embodi containing one or more T-DNA regions. Additional nucleic ment, the cell is a cell that does not naturally comprise the 55 acid sequences include origins of replication to provide for polynucleotide. However, the cell may be a cell which autonomous replication of the vector, selectable marker comprises a non-endogenous polynucleotide resulting in an genes, preferably encoding antibiotic or herbicide resis altered amount of production of the encoded polypeptide. tance, unique multiple cloning sites providing for multiple An exogenous polynucleotide includes polynucleotides sites to insert nucleic acid sequences or genes encoded in the which have not been separated from other components of the 60 nucleic acid construct, and sequences that enhance transfor transgenic (recombinant) cell, or cell-free expression sys mation of prokaryotic and eukaryotic (especially plant) tem, in which it is present, and polynucleotides produced in cells. The recombinant vector may comprise more than one Such cells or cell-free systems which are Subsequently polynucleotide defined herein, for example three, four, five purified away from at least Some other components. The or six polynucleotides defined herein in combination, pref exogenous polynucleotide (nucleic acid) can be a contiguous 65 erably a chimeric genetic construct described herein, each stretch of nucleotides existing in nature, or comprise two or polynucleotide being operably linked to expression control more contiguous stretches of nucleotides from different sequences that are operable in the cell of interest, Preferably US 9,725,399 B2 55 56 the expression control sequences include, or are all, heter confers a trait that one can identify through observation or ologous promoters i.e. are heterologous with respect to the testing, i.e., by 'screening” (e.g., B-glucuronidase, coding regions they control. More than one polynucleotide luciferase, GFP or other enzyme activity not present in defined herein, for example 3, 4, 5 or 6 polynucleotides, untransformed cells). The marker gene and the nucleotide preferably 7 or 8 polynucleotides each encoding a different sequence of interest do not have to be linked. The actual polypeptide, are preferably covalently joined together in a choice of a marker is not crucial as long as it is functional single recombinant vector, preferably within a single T-DNA (i.e., selective) in combination with the cells of choice such molecule, which may then be introduced as a single mol as a plant cell. ecule into a cell to form a recombinant cell according to the Examples of selectable markers are markers that confer invention, and preferably integrated into the genome of the 10 recombinant cell, for example in a transgenic plant. The antibiotic resistance Such as amplicillin, erythromycin, integration into the genome may be into the nuclear genome chloramphenicol or tetracycline resistance, preferably or into a plastid genome in the transgenic plant. Thereby, the kanamycin resistance. Exemplary selectable markers for polynucleotides which are so joined will be inherited selection of plant transformants include, but are not limited together as a single genetic locus in progeny of the recom 15 to, a hyg gene which encodes hygromycin B resistance; a binant cell or plant. The recombinant vector or plant may neomycin phosphotransferase (nptII) gene conferring resis comprise two or more such recombinant vectors, each tance to kanamycin, paromomycin, G418; a glutathione-S- containing multiple polynucleotides, for example wherein transferase gene from rat liver conferring resistance to each recombinant vector comprises 3, 4, 5 or 6 polynucle glutathione derived herbicides as, for example, described in otides. EP 256223; a glutamine synthetase gene conferring, upon “Operably linked as used herein refers to a functional overexpression, resistance to glutamine synthetase inhibi relationship between two or more nucleic acid (e.g., DNA) tors such as phosphinothricin as, for example, described in segments. Typically, it refers to the functional relationship of WO 87/05327, an acetyltransferase gene from Streptomyces transcriptional regulatory element (promoter) to a tran viridochromogenes conferring resistance to the selective scribed sequence. For example, a promoter is operably 25 agent phosphinothricin as, for example, described in EP linked to a coding sequence, such as a polynucleotide 275957, a gene encoding a 5-enolshikimate-3-phosphate defined herein, if it stimulates or modulates the transcription synthase (EPSPS) conferring tolerance to N-phosphonom of the coding sequence in an appropriate cell. Generally, ethylglycine as, for example, described by Hinchee et al. promoter transcriptional regulatory elements that are oper (1988), or preferably a bar gene conferring resistance against ably linked to a transcribed sequence are physically con 30 bialaphos as, for example, described in WO91/02071. tiguous to the transcribed sequence, i.e., they are cis-acting. Preferably, the nucleic acid construct is stably incorpo However, some transcriptional regulatory elements, such as rated into the genome of the cell, such as the plant cell. enhancers, need not be physically contiguous or located in Accordingly, the nucleic acid may comprise appropriate close proximity to the coding sequences whose transcription elements which allow the molecule to be incorporated into they enhance. 35 the genome, preferably the right and left border sequences of When there are multiple promoters present, each pro a T-DNA molecule, or the construct is placed in an appro moter may independently be the same or different. Prefer priate vector which can be incorporated into a chromosome ably, at least 3 and up to a maximum of 6 different promoter of the cell. sequences are used in the recombinant vector to control Expression expression of the exogenous polynucleotides. 40 As used herein, an expression vector is a DNA vector that Recombinant molecules such as the chimeric DNAS or is capable of transforming a host cell and of effecting genetic constructs may also contain (a) one or more secre expression of one or more specified polynucleotide tory signals which encode signal peptide sequences, to molecule(s). Expression vectors of the present invention can enable an expressed polypeptide defined herein to be direct gene expression in plant cells or in recombinant cells secreted from the cell that produces the polypeptide or 45 such as microbial cells. Expression vectors useful for the which provide for localisation of the expressed polypeptide, invention contain regulatory sequences such as transcription for example for retention of the polypeptide in the endo control sequences, translation control sequences, origins of plasmic reticulum (ER) in the cell or transfer into a plastid, replication, and other regulatory sequences that are compat and/or (b) contain fusion sequences which lead to the ible with the recombinant cell and that control the expres expression of nucleic acid molecules as fusion proteins. 50 sion of polynucleotide molecules of the present invention. In Examples of Suitable signal segments include any signal particular, polynucleotides or vectors useful for the present segment capable of directing the secretion or localisation of invention include transcription control sequences. Tran a polypeptide defined herein. Recombinant molecules may Scription control sequences are sequences which control the also include intervening and/or untranslated sequences Sur initiation, elongation, and termination of transcription. Par rounding and/or within the nucleic acid sequences of nucleic 55 ticularly important transcription control sequences are those acid molecules defined herein. which control transcription initiation, Such as promoter and To facilitate identification of transformants, the nucleic enhancer sequences. Suitable transcription control acid construct desirably comprises a selectable or screenable sequences include any transcription control sequence that marker gene as, or in addition to, the foreign or exogenous can function in at least one of the recombinant cells of the polynucleotide. By “marker gene' is meant a gene that 60 present invention. The choice of the regulatory sequences imparts a distinct phenotype to cells expressing the marker used depends on the target organism Such as a plant and/or gene and thus allows such transformed cells to be distin target organ or tissue of interest. Such regulatory sequences guished from cells that do not have the marker. A selectable may be obtained from any eukaryotic organism such as marker gene confers a trait for which one can “select” based plants or plant viruses, or may be chemically synthesized. A on resistance to a selective agent (e.g., a herbicide, antibi 65 variety of Such transcription control sequences are known to otic, radiation, heat, or other treatment damaging to untrans those skilled in the art. Particularly preferred transcription formed cells). A screenable marker gene (or reporter gene) control sequences are promoters active in directing tran US 9,725,399 B2 57 58 Scription in plants, either constitutively or stage and/or tissue (WO98/45461), the Phaseolus vulgaris phaseolin promoter specific, depending on the use of the plant or parts thereof. (U.S. Pat. No. 5,504,200), the Brassica Bce4 promoter A number of vectors suitable for stable transfection of (WO91/13980) or the legumin LeB4 promoter from Vicia plant cells or for the establishment of transgenic plants have faba (Baumlein et al., 1992), and promoters which lead to been described in, e.g., Pouwels et al., Cloning Vectors: A 5 the seed-specific expression in monocots such as maize, Laboratory Manual, 1985, Supp. 1987; Weissbach and barley, wheat, rye, rice and the like. Notable promoters Weissbach, Methods for Plant Molecular Biology, Academic which are suitable are the barley lpt2 or lpt1 gene promoter Press, 1989; and Gelvin et al., Plant Molecular Biology (WO95/15389 and WO95/23230) or the promoters Manual, Kluwer Academic Publishers, 1990. Typically, described in WO99/16890 (promoters from the barley hor plant expression vectors include, for example, one or more 10 dein gene, the rice glutelin gene, the rice oryzin gene, the cloned plant genes under the transcriptional control of 5' and rice prolamin gene, the wheat gliadin gene, the wheat 3' regulatory sequences and a dominant selectable marker. glutelin gene, the maize Zein gene, the oat glutelin gene, the Such plant expression vectors also can contain a promoter Sorghum kasirin gene, the rye Secalin gene). Other promoters regulatory region (e.g., a regulatory region controlling include those described by Broun et al. (1998), Potenza et al. inducible or constitutive, environmentally- or developmen 15 (2004), US20070192902 and US20030159173. In an tally-regulated, or cell- or tissue-specific expression), a embodiment, the seed specific promoter is preferentially transcription initiation start site, a ribosome binding site, an expressed in defined parts of the seed such as the embryo, RNA processing signal, a transcription termination site, cotyledon(s) or the endosperm. Examples of Such specific and/or a polyadenylation signal. promoters include, but are not limited to, the FP1 promoter A number of constitutive promoters that are active in plant (Ellerstrom et al., 1996), the pea legumin promoter (Peninet cells have been described. Suitable promoters for constitu al., 2000), the bean phytohemagglutnin promoter (Perrin et tive expression in plants include, but are not limited to, the al., 2000), the conlinin 1 and conlinin 2 promoters for the cauliflower mosaic virus (CaMV) 35S promoter, the Figwort genes encoding the flax 2S storage proteins (Cheng et al., mosaic virus (FMV) 35S, and the light-inducible promoter 2010), the promoter of the FAE1 gene from Arabidopsis from the small subunit of the ribulose-1,5-bis-phosphate 25 thaliana, the BnGLP promoter of the globulin-like protein carboxylase. gene of Brassica napus, the LPXR promoter of the perox For the purpose of expression in source tissues of the iredoxin gene from Linum usitatissimum. plant, such as the leaf, seed, root or stem, it is preferred that The 5' non-translated leader sequence can be derived from the promoters utilized in the present invention have rela the promoter selected to express the heterologous gene tively high expression in these specific tissues. Many 30 sequence of the polynucleotide of the present invention, or examples are well known in the art. A variety of plant gene preferably is heterologous with respect to the coding region promoters that are regulated in response to environmental, of the enzyme to be produced, and can be specifically hormonal, chemical, and/or developmental signals, also can modified if desired so as to increase translation of mRNA. be used for expression of genes in plant cells, or it may also For a review of optimizing expression of transgenes, see be advantageous to employ organ-specific promoters. 35 Koziel et al. 1996). The 5' non-translated regions can also be As used herein, the term “seed specific promoter” or obtained from plant viral RNAs (Tobacco mosaic virus, variations thereof refer to a promoter that preferentially, Tobacco etch virus, Maize dwarf mosaic virus, Alfalfa when compared to other plant tissues, directs gene transcrip mosaic virus, among others) from Suitable eukaryotic genes, tion in a developing seed of a plant, preferably a Brassica plant genes (wheat and maize chlorophyll afb binding pro sp., Camelina sativa or G. max’ plant. In an embodiment, the 40 tein gene leader), or from a synthetic gene sequence. The seed specific promoter is expressed at least 5-fold more present invention is not limited to constructs wherein the strongly in the developing seed of the plant relative to the non-translated region is derived from the 5' non-translated leaves and/or stems of the plant, and is preferably expressed sequence that accompanies the promoter sequence. The more strongly in the embryo of the developing seed com leader sequence could also be derived from an unrelated pared to other plant tissues. Preferably, the promoter only 45 promoter or coding sequence. Leader sequences useful in directs expression of a gene of interest in the developing context of the present invention comprise the maize Hsp70 seed, and/or expression of the gene of interest in other parts leader (U.S. Pat. No. 5,362,865 and U.S. Pat. No. 5,859, of the plant such as leaves is not detectable by Northern blot 347), and the TMV omega element. analysis and/or RT-PCR. Typically, the promoter drives The termination of transcription is accomplished by a 3' expression of genes during growth and development of the 50 non-translated DNA sequence operably linked in the chime seed, in particular during the phase of synthesis and accu ric vector to the polynucleotide of interest. The 3' non mulation of storage compounds in the seed. Such promoters translated region of a recombinant DNA molecule contains may drive gene expression in the entire plant storage organ a polyadenylation signal that functions in plants to cause the or only part thereof Such as the Seedcoat, or cotyledon(s), addition of adenylate nucleotides to the 3' end of the RNA. preferably in the embryos, in seeds of dicotyledonous plants 55 The 3' non-translated region can be obtained from various or the endosperm or aleuron layer of a seeds of monocoty genes that are expressed in plant cells. The nopaline Syn ledonous plants. thase 3' untranslated region, the 3' untranslated region from Preferred promoters for seed-specific expression include pea Small Subunit Rubisco gene, the 3' untranslated region i) promoters from genes encoding enzymes involved in fatty from soybean 7S seed storage protein gene or a flax conlinin acid biosynthesis and accumulation in seeds, such as fatty 60 gene are commonly used in this capacity. The 3' transcribed, acid desaturases and elongases, ii) promoters from genes non-translated regions containing the polyadenylate signal encoding seed storage proteins, and iii) promoters from of Agrobacterium tumor-inducing (Ti) plasmid genes are genes encoding enzymes involved in carbohydrate biosyn also suitable. thesis and accumulation in seeds. Seed specific promoters Recombinant DNA technologies can be used to improve which are Suitable are the oilseed rape napin gene promoter 65 expression of a transformed polynucleotide molecule by (U.S. Pat. No. 5,608,152), the Vicia faba USP promoter manipulating, for example, the number of copies of the (Baumlein et al., 1991), the Arabidopsis oleosin promoter polynucleotide molecule within a host cell, the efficiency US 9,725,399 B2 59 60 with which those polynucleotide molecules are transcribed, as a glasshouse or growth chamber, or by purchase or receipt the efficiency with which the resultant transcripts are trans from a Supplier of the plant parts or seed. Standard growth lated, and the efficiency of post-translational modifications. conditions in a glasshouse include 22-24°C. daytime tem Recombinant techniques useful for increasing the expres perature and 16-18°C. night-time temperature, with natural sion of polynucleotide molecules defined herein include, but Sunlight. The seed may be suitable for planting i.e. able to are not limited to, integration of the polynucleotide molecule germinate and produce progeny plants, or alternatively has into one or more host cell chromosomes, addition of stability been processed in Such a way that it is no longer able to sequences to mRNAS, Substitutions or modifications of germinate, e.g. cracked, polished or milled seed which is transcription control signals (e.g., promoters, operators, useful for food or feed applications, or for extraction of lipid enhancers), Substitutions or modifications of translational 10 of the invention. control signals (e.g., ribosome binding sites, Shine-Dalgarno As used herein, the term "plant storage organ” refers to a sequences), modification of polynucleotide molecules to part of a plant specialized to storage energy in the form of correspond to the codon usage of the host cell, and the for example, proteins, carbohydrates, fatty acids and/or oils. deletion of sequences that destabilize transcripts. Examples of plant storage organs are seed, fruit, tuberous Transgenic Plants 15 roots, and tubers. A preferred plant storage organ is seed. The term “plant’ as used herein as a noun refers to whole The plants or plant parts of the invention or used in the plants, but as used as an adjective refers to any Substance invention are preferably phenotypically normal. As used which is present in, obtained from, derived from, or related herein, the term “phenotypically normal” refers to a geneti to a plant. Such as for example, plant organs (e.g. leaves, cally modified plant or plant organ, particularly a storage stems, roots, flowers), single cells (e.g. pollen), seeds, plant organ Such as a seed, tuber or fruit not having a significantly cells and the like. The term “plant part” refers to all plant reduced ability to grow and reproduce when compared to an parts that comprise the plant DNA, including vegetative unmodified plant or plant organ. In an embodiment, the structures Such as, for example, leaves or stems, roots, floral genetically modified plant or plant organ which is pheno organs or structures, pollen, seed, seed parts such as an typically normal has an ability to grow or reproduce which embryo, endosperm, scutellum or seed coat, plant tissue 25 is essentially the same as an isogenic plant or organ not Such as, for example, vascular tissue, cells and progeny of comprising the exogenous polynucleotide(s). Preferably, the the same, as long as the plant part synthesizes lipid accord biomass, growth rate, germination rate, storage organ size, ing to the invention. pollen viability, male and female fertility, seed size and/or A “transgenic plant”, “genetically modified plant’ or the number of viable seeds produced is not less than 90% of variations thereof refers to a plant that contains a gene 30 that of a plant lacking said exogenous polynucleotide when construct (“transgene') not found in a wild-type plant of the grown under identical conditions. Preferably the pollen same species, variety or cultivar. Transgenic plants as viability of the plant of the invention, or plants produced defined in the context of the present invention include plants from seed of the invention, is about 100% relative to the and their progeny which have been genetically modified pollen viability of a corresponding wild-type plant. This using recombinant techniques to cause production of the 35 term does not encompass features of the plant which may be lipid or at least one polypeptide defined herein in the desired different to the wild-type plant but which do not affect the plant or plant organ. Transgenic plant cells and transgenic usefulness of the plant for commercial purposes such as, for plant parts have corresponding meanings. A “transgene’ as example, a ballerina phenotype of seedling leaves. referred to herein has the normal meaning in the art of Plants provided by or contemplated for use in the practice biotechnology and includes a genetic sequence which has 40 of the present invention include both monocotyledons and been produced or altered by recombinant DNA or RNA dicotyledons. In preferred embodiments, the plants of the technology and which has been introduced into a plant cell. present invention are crop plants (for example, cereals and The transgene may include genetic sequences derived from pulses, maize, wheat, potatoes, tapioca, rice, sorghum, mil a plant cell which may be of the same species, variety or let, cassava, barley, or pea), or other legumes. The plants cultivar as the plant cell into which the transgene is intro 45 may be grown for production of edible roots, tubers, leaves, duced or of a different species, variety or cultivar, or from a stems, flowers or fruit. The plants may be vegetables or cell other than a plant cell. Typically, the transgene has been ornamental plants. The plants of, or useful for, the invention introduced into the cell. Such as a plant, by human manipu may be: corn (Zea mays), canola (Brassica napus, Brassica lation Such as, for example, by transformation hut any rapa Ssp.), mustard (Brassica iuncea), flax (Linum usitatis method can be used as one of skill in the art recognizes. 50 Simum), alfalfa (Medicago sativa), rice (Oryza sativa), rye The terms “seed' and “grain” are used interchangeably (Secale cerale), sorghum (Sorghum bicolour, Sorghum vul herein. “Grain” refers to mature grain such as harvested gare), Sunflower (Helianthus annus), wheat (Tritium aesti grain or grain which is still on a plant but ready for vum), soybean (Glycine max), tobacco (Nicotiana tabacum), harvesting, but can also refer to grain after imbibition or potato (Solanum tuberosum), peanuts (Arachis hypogaea), germination, according to the context. Mature grain or seed 55 cotton (Gossypium hirsutum), Sweet potato (Lopmoea bata commonly has a moisture content of less than about 18-20%, tus), cassava (Manihot esculenta), coffee (Cofea spp.), coco preferably less than 10%. Brassica seed such as canola seed nut (Cocos nucifera), pineapple (Anana comosus), citris tree typically has a moisture content of about 4-8% or 6-8% (Citrus spp.), cocoa (Theobroma cacao), tea (Camelia when mature, preferably between about 4% to about 6%. Senensis), banana (Musa spp.), avocado (Persea ameri “Developing seed as used herein refers to a seed prior to 60 cana), fig (Ficus Casica), guava (Psidium guajava), mango maturity, typically found in the reproductive structures of the (Mangifer indica), olive (Olea europaea), papaya (Carica plant after fertilisation or anthesis, but can also refer to such papaya), cashew (Anacardium occidentale), macadamia seeds prior to maturity which are isolated from a plant. (Macadamia intergrifolia), almond (Prunus amygdalus), As used herein, the term “obtaining a plant part” or Sugar beets (Beta vulgaris), oats, or barley. “obtaining a seed’ refers to any means of obtaining a plant 65 In a preferred embodiment, the plant is an angiosperm. part or seed, respectively, including harvesting of the plant In an embodiment, the plant is an oilseed plant, preferably parts or seed from plants in the field or in containment Such an oilseed crop plant. As used herein, an “oilseed plant' is US 9,725,399 B2 61 62 a plant species used for the commercial production of oils 1) an 1-acyl-glycerol-3-phosphate acyltransferase from the seeds of the plant. The oilseed plant may be (LPAAT), a A15-desaturase, a A6-desaturase, a A5-desatu oil-seed rape (such as canola), maize, Sunflower, soybean, rase, a A6-elongase, a A5-elongase and optionally a A4-de Sorghum, flax (linseed) or Sugar beet. Furthermore, the Saturase, oilseed plant may be other Brassicas, cotton, peanut, poppy, m) an 1-acyl-glycerol-3-phosphate acyltransferase mustard, castor bean, Sesame, Sunflower, safflower, Cam (LPAAT), a A12-desaturase, a A6-desaturase, a A5-desatu elina, Crambe or nut producing plants. The plant may rase, a A6-elongase, an A5-elongase and optionally a A4-de produce high levels of oil in its fruit, such as olive, oil palm Saturase, or coconut. Horticultural plants to which the present inven n) an 1-acyl-glycerol-3-phosphate acyltransferase tion may be applied are lettuce, endive, or vegetable bras 10 (LPAAT), a A12-desaturase, a co3-desaturase and/or a A15 sicas including cabbage, broccoli, or cauliflower. The pres desaturase, a A6-desaturase, a A5-desaturase, a A6-elongase ent invention may be applied in tobacco, cucurbits, carrot, and an A5-elongase and optionally a A4-desaturase, Strawberry, tomato, or pepper. o) an 1-acyl-glycerol-3-phosphate acyltransferase In a further preferred embodiment, the non-transgenic (LPAAT), an ()3-desaturase, a A8-desaturase, a A5-desatu plant used to produce a transgenic plant of the invention 15 rase, a A9-elongase, an A5-elongase and optionally a A4-de produces oil, especially in the seed, which has i) less than Saturase, 20%, less than 10% or less than 5% 18:2 fatty acids and/or p) an 1-acyl-glycerol-3-phosphate acyltransferase ii) less than 10% or less than 5% 18:3 fatty acids. (LPAAT), a A15-desaturase, a A8-desaturase, a A5-desatu In a preferred embodiment, the transgenic plant or part rase, a A9-elongase, a A5-elongase and optionally a A4-de thereof is homozygous for each and every gene (exogenous Saturase, polynucleotide) that has been introduced (transgene) so that q) an 1-acyl-glycerol-3-phosphate acyltransferase its progeny do not segregate for the desired phenotype. The (LPAAT), a A12-desaturase, a A8-desaturase, a A5-desatu transgenic plant may also be heterozygous for the introduced rase, a A9-elongase, an A5-elongase and optionally a A4-de transgene(s), preferably uniformly heterozygous for the 25 Saturase, or transgene. Such as for example in F1 progeny which have r) an 1-acyl-glycerol-3-phosphate acyltransferase been grown from hybrid seed. Such plants may provide (LPAAT), a A12-desaturase, a co3-desaturase and/or a A15 advantages such as hybrid vigour, well known in the art, or desaturase, a A8-desaturase, a A5-desaturase, a A9-elongase, may be used in plant breeding or backcrossing. an A5-elongase and optionally a A4-desaturase. Where relevant, the transgenic plant or part thereof may 30 In an embodiment, the exogenous polynucleotides encode also comprise additional transgenes encoding enzymes set of polypeptides which are a Pythium irregulare A6-de involved in the production of LC-PUFAs such as, but not saturase, a Thraustochytrid A5-desaturase or an Emiliana limited to, a A6-desaturase, a A9-elongase, a A8-desaturase, hexleyi A5-desaturase, a Physcomitrella patens A6-elongase, a A6-elongase, a A5-desaturase, an (D3-desaturase, a A4-de a Thraustochytrid A5-elongase or an Ostreocccus taurii saturase, a A5-elongase, diacylglycerol acyltransferase, 35 A5-elongase, a Phytophthora infestans (D3-desaturase or a LPAAT, a A17-desaturase, a A15-desaturase and/or a A12 Pythium irregulare (03-desaturase, and a Thraustochytrid desaturase. Examples of Such enzymes with one of more of A4-desaturase. these activities are known in the art and include those In an embodiment, plants of, or used for, the invention are described herein. In specific examples, the transgenic plant grown in the field, preferably as a population of at least at least comprises a set of exogenous polynucleotides encod 40 1,000, 1,000,000 or 2,000,000 plants that are essentially the 1ng same, or in an area of at least 1 hectare or 2 hectares. a) a A4-desaturase, a A5-desaturase, a A6-desaturase, a Planting densities differ according to the plant species, plant A5-elongase and a A6-elongase, variety, climate, Soil conditions, fertiliser rates and other b) a A4-desaturase, a A5-desaturase, a A8-desaturase, a factors as known in the art. For example, canola is typically A5-elongase and a A9-elongase, 45 grown at a planting density of 1.2-1.5 million plants per c) a A4-desaturase, a A5-desaturase, a A6-desaturase, a hectare. Plants are harvested as is known in the art, which A5-elongase, a A6-elongase, and a A15-desaturase, may comprise Swathing, windrowing and/or reaping of d) a A4-desaturase, a A5-desaturase, a A8-desaturase, a plants, followed by threshing and/or winnowing of the plant A5-elongase, a A9-elongase, and a A15-desaturase, material to separate the seed from the remainder of the plant e) a A4-desaturase, a A5-desaturase, a A6-desaturase, a 50 parts often in the form of chaff. Alternatively, seed may be A5-elongase, a A6-elongase, and a A17-desaturase, harvested from plants in the field in a single process, namely f) a A4-desaturase, a A5-desaturase, a A8-desaturase, a combining. A5-elongase, a A9-elongase, and a A17-desaturase, Transformation of Plants g) an (03-desaturase or a A15-desaturase, a A6-desaturase, Transgenic plants can be produced using techniques a A5-desaturase, a A6-elongase and a A5-elongase, 55 known in the art, Such as those generally described in A. h) an (03-desaturase or a A15-desaturase, a A8-desaturase, Slater et al., Plant Biotechnology—The Genetic Manipula a A5-desaturase, a A9-elongase and a A5-elongase, tion of Plants, Oxford University Press (2003), and P. i) a A12-desaturase, a (03-desaturase or a A15-desaturase, Christou and H. Klee, Handbook of Plant Biotechnology, a A6-desaturase, a A5-desaturase, a A6-elongase and an John Wiley and Sons (2004). A5-elongase, 60 As used herein, the terms “stably transforming”, “stably j) a A12-desaturase, a (03-desaturase or a A15-desaturase, transformed and variations thereof refer to the integration a A8-desaturase, a A5-desaturase, a A9-elongase and an of the exogenous nucleic acid molecules into the genome of A5-elongase, the cell such that they are transferred to progeny cells during k) an 1-acyl-glycerol-3-phosphate acyltransferase cell division without the need for positively selecting for (LPAAT), an ()3-desaturase, a A6-desaturase, a A5-desatu 65 their presence. Stable transformants, or progeny thereof, can rase, a A6-elongase, a A5-elongase and optionally a A4-de be selected by any means known in the art such as Southern Saturase, blots on chromosomal DNA or in situ hybridization of US 9,725,399 B2 63 64 genomic DNA. Preferably, plant transformation is per The development or regeneration of plants containing the formed as described in the Examples herein. foreign, exogenous gene is well known in the art. Preferably, Agrobacterium-mediated transfer is a widely applicable the regenerated plants are self-pollinated to provide system for introducing genes into plant cells because DNA homozygous transgenic plants. Otherwise, pollen obtained can be introduced into cells in whole plant tissues or plant from the regenerated plants is crossed to seed-grown plants organs or explants in tissue culture, for either transient of agronomically important lines. Conversely, pollen from expression or for stable integration of the DNA in the plant plants of these important lines is used to pollinate regener cell genome. The use of Agrobacterium-mediated plant ated plants. A transgenic plant of the present invention integrating vectors to introduce DNA into plant cells is well containing a desired exogenous nucleic acid is cultivated 10 using methods well known to one skilled in the art. known in the art (see, for example, U.S. Pat. No. 5,177,010, To confirm the presence of the transgenes in transgenic U.S. Pat. No. 5,104,310, U.S. Pat. No. 5,004,863 or U.S. Pat. cells and plants, a polymerase chain reaction (PCR) ampli No. 5,159,135) including floral dipping methods using Agro fication or Southern blot analysis can be performed using bacterium or other bacteria that can transfer DNA into plant methods known to those skilled in the art. Expression cells. The region of DNA to be transferred is defined by the 15 products of the transgenes can be detected in any of a variety border sequences, and the intervening DNA (T-DNA) is of ways, depending upon the nature of the product, and usually inserted into the plant genome. Further, the integra include Western blot and enzyme assay. Once transgenic tion of the T-DNA is a relatively precise process resulting in plants have been obtained, they may be grown to produce few rearrangements. In those plant varieties where Agro plant tissues or parts having the desired phenotype. The bacterium-mediated transformation is efficient, it is the plant tissue or plant parts, may be harvested, and/or the seed method of choice because of the facile and defined nature of collected. The seed may serve as a source for growing the gene transfer. Preferred Agrobacterium transformation additional plants with tissues or parts having the desired vectors are capable of replication in E. coli as well as characteristics. Agrobacterium, allowing for convenient manipulations as A transgenic plant formed using Agrobacterium or other described (Klee et al., In: Plant DNA Infectious Agents, 25 transformation methods typically contains a single genetic Hohn and Schell, eds. Springer-Verlag, New York, pp. locus on one chromosome. Such transgenic plants can be 179-203 (1985). referred to as being hemizygous for the added gene(s). More Acceleration methods that may be used include, for preferred is a transgenic plant that is homozygous for the example, microprojectile bombardment and the like. One added gene(s); i.e., a transgenic plant that contains two example of a method for delivering transforming nucleic 30 added genes, one gene at the same locus on each chromo acid molecules to plant cells is microprojectile bombard Some of a chromosome pair. A homozygous transgenic plant ment. This method has been reviewed by Yang et al., Particle can be obtained by self-fertilising a hemizygous transgenic Bombardment Technology for Gene Transfer, Oxford Press, plant, germinating some of the seed produced and analyzing Oxford, England (1994). Non-biological particles (micro the resulting plants for the gene of interest. projectiles) that may be coated with nucleic acids and 35 It is also to be understood that two different transgenic delivered into cells by a propelling force. Exemplary par plants that contain two independently segregating exog ticles include those comprised of tungsten, gold, platinum, enous genes or loci can also be crossed (mated) to produce and the like. A particular advantage of microprojectile offspring that contain both sets of genes or loci. Selfing of bombardment, in addition to it being an effective means of appropriate F1 progeny can produce plants that are homozy reproducibly transforming monocots, is that neither the 40 gous for both exogenous genes or loci. Back-crossing to a isolation of protoplasts, nor the Susceptibility of Agrobac parental plant and out-crossing with a non-transgenic plant terium infection are required. are also contemplated, as is vegetative propagation. Descrip In another alternative embodiment, plastids can be stably tions of other breeding methods that are commonly used for transformed. Methods disclosed for plastid transformation in different traits and crops can be found in Fehr, In: Breeding higher plants include particle gun delivery of DNA contain 45 Methods for Cultivar Development, Wilcox J. ed., American ing a selectable marker and targeting of the DNA to the Society, of Agronomy, Madison Wis. (1987). plastid genome through homologous recombination (U.S. Enhancing Exogenous RNA Levels and Stabilized Expres Pat. No. 5,451,513, U.S. Pat. No. 5,545,818, U.S. Pat. No. sion 5,877,402, U.S. Pat. No. 5,932,479, and WO99/05265), Silencing Suppressors Other methods of cell transformation can also be used and 50 In an embodiment, a plant cell, plant or plant part com include but are not limited to introduction of DNA into prises an exogenous polynucleotide encoding a silencing plants by direct DNA transfer into pollen, by direct injection Suppressor protein. of DNA into reproductive organs of a plant, or by direct Post-transcriptional gene silencing (PTGS) is a nucleotide injection of DNA into the cells of immature embryos fol sequence-specific defense mechanism that can target both lowed by the rehydration of desiccated embryos. 55 cellular and viral mRNAs for degradation PTGS occurs in The regeneration, development, and cultivation of plants plants or fungi stably or transiently transformed with foreign from single plant protoplast transformants or from various (heterologous) or endogenous DNA and results in the transformed explants is well known in the art (Weissbach et reduced accumulation of RNA molecules with sequence al., In: Methods for Plant Molecular Biology, Academic similarity to the introduced nucleic acid. Press, San Diego, Calif., (1988). This regeneration and 60 It has widely been considered that co-expression of a growth process typically includes the steps of selection of silencing Suppressor with a transgene of interest will transformed cells, culturing those individualized cells increase the levels of RNA present in the cell transcribed through the usual stages of embryonic development through from the transgene. Whilst this has proven true for cells in the rooted plantlet stage. Transgenic embryos and seeds are vitro, significant side-effects have been observed in many similarly regenerated. The resulting transgenic rooted shoots 65 whole plant co-expression studies. More specifically, as are thereafter planted in an appropriate plant growth medium described in Mallory et al. (2002), Chapman et al. (2004), Such as soil. Chen et al. (2004), Dunoyer et al. (2004), Zhang et al. US 9,725,399 B2 65 66 (2006), Lewsey et al. (2007) and Meng et al. (2008) plants recombinant cells, for example the percentage of the weight expressing silencing suppressors, generally under constitu of seed that is LC-PUFA. It will be appreciated that the tive promoters, are often phenotypically abnormal to the LC-PUFA that is produced in an oilseed may be consider extent that they are not useful for commercial production. ably higher in terms of LC-PUFA content than in a vegetable Recently, it has been found that RNA molecule levels can or a grain that is not grown for oil production, yet both may be increased, and/or RNA molecule levels stabilized over have similar LC-PUFA compositions, and both may be used numerous generations, by limiting the expression of the as sources of LC-PUFA for human or animal consumption. silencing suppressor to a seed of a plant or part thereof The levels of LC-PUFA may be determined by any of the (WO2010/057246). As used herein, a "silencing suppressor methods known in the art. In a preferred method, total lipid protein' or SSP is any polypeptide that can be expressed in 10 is extracted from the cells, tissues or organisms and the fatty a plant cell that enhances the level of expression product acid converted to methyl esters before analysis by gas from a different transgene in the plant cell, particularly over chromatography (GC). Such techniques are described in repeated generations from the initially transformed plant. In Example 1. The peak position in the chromatogram may be an embodiment, the SSP is a viral silencing suppressor or used to identify each particular fatty acid, and the area under mutant thereof. A large number of viral silencing suppres 15 each peak integrated to determine the amount. As used sors are known in the art and include, but are not limited to herein, unless stated to the contrary, the percentage of P19, V2, P38, Pe-Po and RPV-P0. In an embodiment, the particular fatty acid in a sample is determined as the area viral silencing suppressor comprises amino acids having a under the peak for that fatty acid as a percentage of the total sequence as provided in SEQ ID NO:38, a biologically area for fatty acids in the chromatogram. This corresponds active fragment thereof, or an amino acid sequence which is essentially to a weight percentage (w/w). The identity of at least 50% identical to SEQ ID NO:38 and which has fatty acids may be confirmed by GC-MS. Total lipid may be activity as a silencing suppressor. separated by techniques known in the art to purify fractions As used herein, the terms "stabilising expression”, “stably such as the TAG fraction. For example, thin-layer chroma expressed”, “stabilised expression” and variations thereof tography (TLC) may be performed at an analytical scale to refer to level of the RNA molecule being essentially the 25 separate TAG from other lipid fractions such as DAG, same or higher in progeny plants over repeated generations, acyl-CoAs or phospholipid in order to determine the fatty for example at least three, at least five or at least 10 acid composition specifically of TAG. generations, when compared to isogenic plants lacking the In one embodiment, the sum total of ARA, EPA, DPA and exogenous polynucleotide encoding the silencing suppres DHA in the fatty acids in the extracted lipid is between about sor. However, this term(s) does not exclude the possibility 30 21% and about 40% of the total fatty acids in the cell. In a that over repeated generations there is some loss of levels of further embodiment, the total fatty acid in the cell has less the RNA molecule when compared to a previous generation, than 1% C20:1. In preferred embodiments, the extractable for example not less than a 10% loss per generation. TAG in the cell comprises the fatty acids at the levels The suppressor can be selected from any source e.g. plant, referred to herein. Each possible combination of the features viral, mammal etc. See WO2010/057246 for a list of viruses 35 defining the lipid as described herein is also encompassed. from which the suppressor can be obtained and the protein The level of production of LC-PUFA in the recombinant (eg B2, P14 etc) or coding region designation for the cell, plant or plant part such as seed may also be expressed suppressor from each particular virus. Multiple copies of a as a conversion percentage of a specific substrate fatty acid suppressor may be used. Different suppressors may be used to one or more product fatty acids, which is also referred to together (e.g., in tandem). 40 herein as a “conversion efficiency” or “enzymatic efli RNA Molecules ciency'. This parameter is based on the fatty acid compo Essentially any RNA molecule which is desirable to be sition in the lipid extracted from the cell, plant, plant part or expressed in a plant seed can be co-expressed with the seed, i.e., the amount of the LC-PUFA formed (including silencing suppressor. The encoded polypeptides may be other LC-PUFA derived therefrom) as a percentage of one or involved in metabolism of oil, starch, carbohydrates, nutri 45 more substrate fatty acids (including all other fatty acids ents, etc., or may be responsible for the synthesis of proteins, derived therefrom). The general formula for a conversion peptides, fatty acids, lipids, waxes, oils, starches, sugars, percentage is: 100x(the sum of percentages of the product carbohydrates, flavors, odors, toxins, carotenoids. hor LC-PUFA and all products derived therefrom)/(the sum of mones, polymers, flavonoids, storage proteins, phenolic the percentages of the substrate fatty acid and all products acids, alkaloids, lignins, tannins, celluloses, glycoproteins, 50 derived therefrom). With regard to DHA, for example, this glycolipids, etc., preferably the biosynthesis or assembly of may be expressed as the ratio of the level of DHA (as a TAG. percentage in the total fatty acid content in the lipid) to the In a particular example, the plants produced increased level of a substrate fatty acid (e.g. OA, LA, ALA, SDA, ETA levels of enzymes for oil production in plants such as or EPA) and all products including DHA derived from the Brassicas, for example canola or Sunflower, saflower, flax, 55 substrate. The conversion percentage or efficiency of con cotton, soya bean, Camelina or maize. version can be expressed for a single enzymatic step in a Levels of LC-PUFA Produced pathway, or for part or the whole of a pathway. The levels of the LC-PUFA or combination of LC-PUFAs Specific conversion efficiencies are calculated herein that are produced in the recombinant cell or plant part such according to the formulae: as seed are of importance. The levels may be expressed as 60 a composition (in percent) of the total fatty acid that is a OA to DHA=100x(% DHA)/(sum % for OA.LA, particular LC-PUFA or group of related LC-PUFA, for GLADGLAARA.EDAALA.SDA.ETrA.ETA, example the co3 LC-PUFA or the co6 LC-PUFA, or the EPA.DPA and DHA). 1. VLC-PUFA, or other which may be determined by methods known in the art. The level may also be expressed as a 65 LA to DHA=100x(% DHA)/(sum % for LAGLA, LC-PUFA content, such as for example the percentage of DGLAARA.EDAALASDA.ETrA.ETA.EPA, LC-PUFA in the dry weight of material comprising the DPA and DHA). 2. US 9,725,399 B2 68 ALA to DHA=100x(% DHA) (Sum % for ALAS gram seed. The seed has a moisture content as is standard for DA.ETrAETA.EPA.DPA and DHA). 3. harvested mature seed after drying down (4-15% moisture). The invention also provides a process for obtaining oil, EPA to DHA=100x(% DHA)/(sum 96 for EPA.DPA comprising obtaining the seed and extracting the oil from the and DHA). 4. seed, and uses of the oil and methods of obtaining the seed DPA to DHA(A4-desaturase efficiency)=100x(% comprising harvesting the seeds from the plants according to DHA)/(sum 9% for DPA and DHA). 5. the invention. The amount of DHA and/or DPA produced per hectare can A12-desaturase efficiency=100x(sum % for LAGLA, also be calculated if the seed yield per hectare is known or DGLAARAEDAALASDAETrAETA.EPA, 10 DPA and DHA)/(sum % for OA.L.A.GLA.DG can be estimated. For example, canola in Australia typically LAARAEDAALASDAETrAETAEPADPA yields about 2.5 tonnes seed per hectare, which at 40% oil and DHA). 6. content yields about 1000 kg of oil. At 20.1% DHA and/or DPA in the total oil, this provides about 200 kg of DHA ()3-desaturase efficiency=100x(sum % for ALAS and/or DPA per hectare. If the oil content is reduced by 50%, DA.ETrAETA.EPA.DPA and DHA)/(sum 9% for 15 this still provides about 100 kg DHA and/or DPA/ha. LAGLADGLAARAEDAALASDAETrA, Evidence to date Suggests that some desaturases ETA.EPA.DPA and DHA). 7. expressed heterologously in yeast or plants have relatively OA to ALA=100x(sum % for ALA.SDA.ETrA.ETA, low activity in combination with Some elongases. This may EPA.DPA and DHA)/(sum % for OA.L.A.GLA, be alleviated by providing a desaturase with the capacity of DGLAARAFDAALASDAETrAETA, EPA, to use an acyl-CoA form of the fatty acid as a Substrate in DPA and DHA), 8. LC-PUFA synthesis, and this is thought to be advantageous A6-desaturase efficiency(on (D3 substrate ALA)=100x in recombinant cells particularly in plant cells. A particularly (sum 9% for SDA.ETA.EPA.DPA and DHA)/(% advantageous combination for efficient DHA and/or DPA ALASDA.ETrAETA.EPA.DPA and DHA). 9. synthesis is a fungal (O3-desaturase, for example Such as the 25 Pichia pastoris ()3-desaturase (SEQ ID NO: 6), with a A6-elongase efficiency(on ()3 substrate SDA)=100x A6-desaturase which has a preference for c)3 acyl substrates (sum 9% for ETA, EPA.DPA and DHA)/(sum 9% Such as, for example, the Micromonas pusilla 6-desaturase for SDA.ETA.EPA.DPA and DHA). 10. (SEQID NO:9), or variants thereof which have at least 95% A5-desaturase efficiency(on (D3 substrate ETA)=100x amino acid sequence identity. (sum % for EPA.DPA and DHA)/(sum % for 30 As used herein, the term “essentially free” means that the ETA.EPA.DPA and DHA). 11. composition (for example lipid or oil) comprises little (for example, less than about 0.5%, less than about 0.25%, less A5-elongase efficiency(on ()3 substrate EPA)=100x than about 0.1%, or less than about 0.01%) or none of the (sum % for DPA and DHA)/(sum % for EPA, defined component. In an embodiment, “essentially free” DPA and DHA). 12. 35 means that the component is undetectable using a routine The fatty acid composition of the lipid, preferably seedoil. analytical technique, for example a specific fatty acid (Such of the invention, is also characterised by the ratio of co6 fatty as (D6-docosapentaenoic acid) cannot be detected using gas acids:c)3 fatty acids in the total fatty acid content, for either chromatography as outlined in Example 1. total ()6 fatty acids:total ()3 fatty acids or for new co6 fatty Production of Oils acids:new co3 fatty acids. The terms total (O6 fatty acids, total 40 Techniques that are routinely practiced in the art can be c)3 fatty acids, new (O6 fatty acids and new ()3 fatty acids used to extract, process, and analyze the oils produced by have the meanings as defined herein. The ratios are calcu cells, plants, seeds, etc of the instant invention. Typically, lated from the fatty acid composition in the lipid extracted plant seeds are cooked, pressed, and extracted to produce from the cell, plant, plant part or seed, in the manner as crude oil, which is then degummed, refined, bleached, and exemplified herein. It is desirable to have a greater level of 45 deodorized. Generally, techniques for crushing seed are c)3 than ()6 fatty acids in the lipid, and therefore an ()6:c)3 known in the art. For example, oilseeds can be tempered by ratio of less than 1.0 is preferred. A ratio of 0.0 indicates a spraying them with water to raise the moisture content to, complete absence of the defined ()6 fatty acids; a ratio of e.g., 8.5%, and flaked using a smooth roller with a gap 0.03 was achieved. Such low ratios can beachieved through setting of 0.23 to 0.27 mm. Depending on the type of seed, the combined use of a A6-desaturase which has an (03 50 water may not be added prior to crushing. Application of Substrate preference together with an ()3-desaturase, par heat deactivates enzymes, facilitates further cell rupturing, ticularly a fungal (O3-desaturase Such as the Pichia pastoris coalesces the oil droplets, and agglomerates protein par (O3-desaturase as exemplified herein. ticles, all of which facilitate the extraction process. The yield of LC-PUFA per weight of seed may also be In an embodiment, the majority of the seed oil is released calculated based on the total oil content in the seed and the 55 by passage through a screw press. Cakes expelled from the % DHA and/or DPA in the oil. For example, if the oil content screw press are then solvent extracted, e.g., with hexane, of canola seed is about 40% (w/w) and about 12% of the using a heat traced column. Alternatively, crude oil produced total fatty acid content of the oil is DHA, the DHA content by the pressing operation can be passed through a settling of the seed is about 4.8% or about 48 mg per gram of seed. tank with a slotted wire drainage top to remove the Solids As described in Example 2, the DHA content of Arabidopsis 60 that are expressed with the oil during the pressing operation. seed having about 9% DHA, which has a lower oil content The clarified oil can be passed through a plate and frame than canola, was about 25 mg/g seed. At a DHA content of filter to remove any remaining fine Solid particles. If desired, about 21%, canola seed or Camelina sativa seed has a DHA the oil recovered from the extraction process can be com content of about 84 mg per gram of seed. The present bined with the clarified oil to produce a blended crude oil. invention therefore provides Brassica napus, B. juncea and 65 Once the solvent is stripped from the crude oil, the Camelina sativa plants, and seed obtained therefrom, com pressed and extracted portions are combined and Subjected prising at least about 80 mg or at least about 84 mg DHA per to normal oil processing procedures. As used herein, the US 9,725,399 B2 69 70 term “purified' when used in connection with lipid or oil of Winterisation the invention typically means that that the extracted lipid or Winterization is a process sometimes used in commercial oil has been subjected to one or more processing steps of production of oils for the separation of oils and fats into solid increase the purity of the lipid/oil component. For example, (Stearin) and liquid (olein) fractions by crystallization at a purification step may comprise one or more or all of the 5 Sub-ambient temperatures. It was applied originally to cot group consisting of degumming, deodorising, decolouris tonseed oil to produce a solid-free product. It is typically ing, drying and/or fractionating the extracted oil. However, used to decrease the saturated fatty acid content of oils. as used herein, the term “purified' does not include a Transesterification transesterification process or other process which alters the As used herein. “transesterification” means a process that fatty acid composition of the lipid or oil of the invention so 10 exchanges the fatty acids within and between TAGs or as to increase the DHA content as a percentage of the total transfers the fatty acids to another alcohol to form an ester. fatty acid content. Expressed in other words, the fatty acid This may initially involve releasing fatty acids from the composition of the purified lipid or oil is essentially the same TAGs as free fatty acids or it may directly produce fatty acid as that of the unpurified lipid or oil. esters, preferably fatty acid methyl esters or ethyl esters. In Degumming 15 a transesterification reaction of the TAG with an alcohol Degumming is an early step in the refining of oils and its Such as methanol or ethanol, the alkyl group of the alcohol primary purpose is the removal of most of the phospholipids forms an ester linkage with the acyl groups (including the from the oil, which may be present as approximately 1-2% DHA) of the TAG. When combined with a fractionation of the total extracted lipid. Addition of ~2% of water, process, transesterification can be used to modify the fatty typically containing phosphoric acid, at 70-80° C. to the acid composition of lipids (Marangoni et al., 1995). Trans crude oil results in the separation of most of the phospho esterification can use either chemical (e.g. strong acid or lipids accompanied by trace metals and pigments. The base catalysed) or enzymatic means, the latter using lipases insoluble material that is removed is mainly a mixture of which may be position-specific (sn-1/3 or sn-2 specific) for phospholipids and triacylglycerols and is also known as the fatty acid on the TAG, or having a preference for some lecithin. Degumming can be performed by addition of 25 fatty acids over others (Speranza et al., 2012). The fatty acid concentrated phosphoric acid to the crude seedoil to convert fractionation to increase the concentration of LC-PUFA in non-hydratable phosphatides to a hydratable form, and to an oil can be achieved by any of the methods known in the chelate minor metals that are present. Gum is separated from art, such as, for example, freezing crystallization, complex the seedoil by centrifugation. formation using urea, molecular distillation, Supercritical Alkali Refining 30 fluid extraction, counter current chromatography and silver Alkali refining is one of the refining processes for treating ion complexing. Complex formation with urea is a preferred crude oil, sometimes also referred to as neutralization. It method for its simplicity and efficiency in reducing the level usually follows degumming and precedes bleaching. Fol of Saturated and monounsaturated fatty acids in the oil lowing degumming, the seedoil can treated by the addition (Gamez et al., 2003). Initially, the TAGs of the oil are split of a sufficient amount of an alkali solution to titrate all of the 35 into their constituent fatty acids, often in the form of fatty fatty acids and phosphoric acids, and removing the soaps acid esters, by hydrolysis under either acid or base catalysed thus formed. Suitable alkaline materials include sodium reaction conditions, whereby one mol of TAG is reacted with hydroxide, potassium hydroxide, Sodium carbonate, lithium at least 3 mol of alcohol (e.g. ethanol for ethyl esters or hydroxide, calcium hydroxide, calcium carbonate and methanol for methyl esters) with excess alcohol used to ammonium hydroxide. This process is typically carried out 40 enable separation of the formed alkyl esters and the glycerol at room temperature and removes the free fatty acid fraction. that is also formed, or by lipases. These free fatty acids or Soap is removed by centrifugation or by extraction into a fatty acid esters, which are usually unaltered in fatty acid solvent for the soap, and the neutralised oil is washed with composition by the treatment, may then be mixed with an water. If required, any excess alkali in the oil may be ethanolic solution of urea for complex formation. The satu neutralized with a suitable acid such as hydrochloric acid or 45 rated and monounsaturated fatty acids easily complex with Sulphuric acid. urea and crystallize out on cooling and may subsequently be Bleaching removed by filtration. The non-urea complexed fraction is Bleaching is a refining process in which oils are heated at thereby enriched with LC-PUFA. 90-120° C. for 10-30 minutes in the presence of a bleaching Feedstuffs earth (0.2-2.0%) and in the absence of oxygen by operating 50 The present invention includes compositions which can with nitrogen or steam or in a vacuum. This step in oil be used as feedstuffs. For purposes of the present invention, processing is designed to remove unwanted pigments (caro “feedstuffs’’ include any food or preparation for human or tenoids, chlorophyll, gossypol etc), and the process also animal consumption which when taken into the body (a) removes oxidation products, trace metals, Sulphur com serve to nourish or build up tissues or Supply energy; and/or pounds and traces of soap. 55 (b) maintain, restore or Support adequate nutritional status or Deodorization metabolic function. Feedstuffs of the invention include Deodorization is a treatment of oils and fats at a high nutritional compositions for babies and/or young children temperature (200-260°C.) and low pressure (0.1-1 mm Hg). Such as, for example, infant formula, and seedmeal of the This is typically achieved by introducing steam into the invention. seedoil at a rate of about 0.1 ml/minute? 100 ml of seedoil. 60 Feedstuffs of the invention comprise, for example, a cell After about 30 minutes of sparging, the seedoil is allowed to of the invention, a plant of the invention, the plant part of the cool under vacuum. The seedoil is typically transferred to a invention, the seed of the invention, an extract of the glass container and flushed with argon before being stored invention, the product of the method of the invention, the under refrigeration. This treatment improves the colour of product of the fermentation process of the invention, or a the seedoil and removes a majority of the volatile substances 65 composition along with a suitable carrier(s). The term "car or odorous compounds including any remaining free fatty rier is used in its broadest sense to encompass any com acids, monoacylglycerols and oxidation products. ponent which may or may not have nutritional value. As the US 9,725,399 B2 71 72 skilled addressee will appreciate, the carrier must be suitable or more of the fatty acids and/or resulting oils produced for use (or used in a sufficiently low concentration) in a using the methods of the invention, preferably in the form of feedstuff such that it does not have deleterious effect on an ethyl esters of the fatty acids. organism which consumes the feedstuff. A pharmaceutical composition may comprise one or more The feedstuff of the present invention comprises an oil, of the fatty acids and/or oils, in combination with a standard, fatty acid ester, or fatty acid produced directly or indirectly well-known, non-toxic pharmaceutically-acceptable carrier, by use of the methods, cells or plants disclosed herein. The adjuvant or vehicle Such as phosphate-buffered saline, water, composition may either be in a solid or liquid form. Addi ethanol, polyols, vegetable oils, a wetting agent or an tionally, the composition may include edible macronutrients, emulsion Such as a water/oil emulsion. The composition protein, carbohydrate, Vitamins, and/or minerals in amounts 10 may be in either a liquid or solid form. For example, the desired for a particular use. The amounts of these ingredients composition may be in the form of a tablet, capsule, ingest will vary depending on whether the composition is intended ible liquid or powder, injectable, or topical ointment or for use with normal individuals or for use with individuals cream. Proper fluidity can be maintained, for example, by having specialized needs, such as individuals Suffering from the maintenance of the required particle size in the case of metabolic disorders and the like. 15 dispersions and by the use of Surfactants. It may also be Examples of suitable carriers with nutritional value desirable to include isotonic agents, for example, Sugars, include, but are not limited to, macronutrients such as edible sodium chloride, and the like. Besides such inert diluents, fats, carbohydrates and proteins. Examples of such edible the composition can also include adjuvants, such as wetting fats include, but are not limited to, coconut oil, borage oil, agents, emulsifying and Suspending agents, Sweetening fungal oil, black current oil, soy oil, and mono- and diglyc agents, flavoring agents and perfuming agents. erides. Examples of such carbohydrates include (but are not Suspensions, in addition to the active compounds, may limited to): glucose, edible lactose, and hydrolyzed starch. comprise Suspending agents such as ethoxylated isostearyl Additionally, examples of proteins which may be utilized in alcohols, polyoxyethylene Sorbitol and Sorbitan esters, the nutritional composition of the invention include (but are microcrystalline cellulose, aluminum metahydroxide, ben not limited to) soy proteins, electrodialysed whey, elec 25 tonite, agar-agar, and tragacanth or mixtures of these Sub trodialysed skim milk, milk whey, or the hydrolysates of Stances, these proteins. Solid dosage forms such as tablets and capsules can be With respect to vitamins and minerals, the following may prepared using techniques well known in the art. For be added to the feedstuff compositions of the present inven example, fatty acids produced in accordance with the present tion: calcium, phosphorus, potassium, Sodium, chloride, 30 invention can be tableted with conventional tablet bases magnesium, manganese, iron, copper, Zinc, Selenium, Such as lactose, Sucrose, and cornstarch in combination with iodine, and Vitamins A, E, D, C, and the B complex. Other binders such as acacia, cornstarch or gelatin, disintegrating Such vitamins and minerals may also be added. agents such as potato starch or alginic acid, and a lubricant The components utilized in the feedstuff compositions of Such as Stearic acid or magnesium Stearate. Capsules can be the present invention can be of semi-purified or purified 35 prepared by incorporating these excipients into a gelatin origin. By semi-purified or purified is meant a material capsule along with antioxidants and the relevant fatty which has been prepared by purification of a natural material acid(s). or by de novo synthesis. For intravenous administration, the fatty acids produced A feedstuff composition of the present invention may also in accordance with the present invention or derivatives be added to food even when supplementation of the diet is 40 thereof may be incorporated into commercial formulations. not required. For example, the composition may be added to A typical dosage of a particular fatty acid is from 0.1 mg food of any type, including (but not limited to): margarine, to 20 g, taken from one to five times per day (up to 100 g modified butter, cheeses, milk, yogurt, chocolate, candy, daily) and is preferably in the range of from about 10 mg to Snacks, Salad oils, cooking oils, cooking fats, meats, fish and about 1, 2, 5, or 10 g daily (taken in one or multiple doses). beverages. 45 As known in the art, a minimum of about 300 mg/day of Additionally, fatty acids produced in accordance with the fatty acid, especially LC-PUFA, is desirable. However, it present invention or host cells transformed to contain and will be appreciated that any amount of fatty acid will be express the Subject genes may also be used as animal food beneficial to the subject. Supplements to alter an animal's tissue, egg or milk fatty Possible routes of administration of the pharmaceutical acid composition to one more desirable for human or animal 50 compositions of the present invention include, for example, consumption. Examples of Such animals include sheep, enteral (e.g., oral and rectal) and parenteral. For example, a cattle, horses, poultry Such as chickens and the like. liquid preparation may be administered orally or rectally. Furthermore, feedstuffs of the invention can be used in Additionally, a homogenous mixture can be completely aquaculture to increase the levels of fatty acids in fish or dispersed in water, admixed under sterile conditions with crustaceans Such as, for example, prawns for human or 55 physiologically acceptable diluents, preservatives, buffers or animal consumption. Preferred fish are salmon. propellants to form a spray or inhalant. Preferred feedstuffs of the invention are the plants, seed The dosage of the composition to be administered to the and other plant parts Such as leaves and stems which may be patient may be determined by one of ordinary skill in the art used directly as food or feed for humans or other animals. and depends upon various factors such as weight of the For example, animals may graze directly on Such plants 60 patient, age of the patient, overall health of the patient, past grown in the field or be fed more measured amounts in history of the patient, immune status of the patient, etc. controlled feeding. The invention includes the use of such Additionally, the compositions of the present invention plants and plant parts as feed for increasing the LC-PUFA may be utilized for cosmetic purposes. It may be added to levels in humans and other animals. pre-existing cosmetic compositions such that a mixture is Compositions 65 formed or a fatty acid produced according to the Subject The present invention also encompasses compositions, invention may be used as the sole “active' ingredient in a particularly pharmaceutical compositions, comprising one cosmetic composition. US 9,725,399 B2 73 74 EXAMPLES energy of 60 V. Neutral lipids were targeted on the following major fatty acids: 16:0 (palmitic acid), 18:0 (stearic acid), Example 1 18:1 ().9 (oleic acid, OA). 18:2a)6 (linoleic acid, LA). 18:303 (C.-linolenic acid, ALA), 18:4c)3 (stearidonic acid, SDA), Materials and Methods 20:1, 20:2, 20:3, 20:4c03, 20:5c)3, 22:4p3, 22:5c)3, 22:6003, while phospholipids were scanned containing C, Cs, Co Expression of Genes in Plant Cells in a Transient Expression and C species with double bonds of 0–3, 0-4, 0-5, 4-6 System respectively. Exogenous genetic constructs were expressed in plant Individual MRMTAG was identified based on ammoni cells in a transient expression system essentially as 10 described by Voinnet et al. (2003) and Wood et al. (2009). ated precursor ion and production from neutral loss of 20:1, Gas Chromatography (GC) Analysis of Fatty Acids SDA, EPA and DHA. TAG and DAG were quantified using FAME were analysed by gas chromatography using an the 50 uM tristearin and distearin as external standards. PL Agilent Technologies 7890A GC (Palo Alto, Calif., USA) were quantified with 10 uM of di-18:0-PC, di-17:0-PA, equipped with a 30 m SGE-BPX70 column (70% cyano 15 di-17:0-PE, 17:0-17:1-PG, di-18:1-PI and di-17:0-PS exter propyl polysilphenylene-siloxane, 0.25 mm inner diameter, nal standards (Avanti Polar Lipids, Alabaster, Ala., USA). 0.25 mm film thickness), an FID, a split/splitless injector and Selected TAG, DAG and PL species were further confirmed an Agilent Technologies 7693 Series auto sampler and by Agilent 6520 Q-TOF MS/MS. injector. Helium was used as the carrier gas. Samples were Determination of Seed Fatty Acid Profile and Oil Content injected in split mode (50:1 ratio) at an oven temperature of Where seed oil content was to be determined, seeds were 150° C. After injection, the oven temperature was held at dried in a desiccator for 24 hand approximately 4 mg of seed 150° C. for 1 min then raised to 210°C. at 3° C. min', again was transferred to a 2 ml glass vial containing Teflon-lined raised to 240° C. at 50° C. min' and finally holding for 1.4 screw cap. 0.05 mg triheptadecanoin dissolved in 0.1 ml min at 240° C. Peaks were quantified with Agilent Tech toluene was added to the vial as internal standard. nologies ChemStation software (Rev B.04.03 (16), Palo 25 Seed FAME were prepared by adding 0.7 ml of 1N Alto, Calif., USA) based on the response of the known methanolic HCl (Supelco) to the vial containing seed mate amount of the external standard GLC-411 (Nucheck) and rial, vortexed briefly and incubated at 80° C. for 2 h. After C17:0-ME internal Standard. cooling to room temperature, 0.3 ml of 0.9% NaCl (w/v) and Liquid Chromatography-Mass Spectrometry (LC-MS) 0.1 ml hexane was added to the vial and mixed well for 10 Analysis of Lipids 30 min in Heidolph Vibramax 110. The FAME was collected Total lipids were extracted from freeze-dried developing into 0.3 ml glass insert and analysed by GC with a flame seeds, twelve days after flowering (daf), and mature seeds ionization detector (FID) as mentioned earlier. after adding a known amount of tri-C17:0-TAG as an The peak area of individual FAME were first corrected on internal quantitation standard. The extracted lipids were the basis of the peak area responses of known amount of the dissolved into 1 mL of 10 mMbutylated hydroxytoluene in 35 same FAMEs present in a commercial standard GLC-411 butanol:methanol (1:1 V/v) per 5 mg dry material and (NU-CHEK PREP, INC., USA). GLC-411 contains equal analysed using an Agilent 1200 series LC and 6410b elec amounts of 31 fatty acids (% by wt), ranging from C8:0 to trospray ionisation triple quadrupole LC-MS. Lipids were C22:6. In case of fatty acids, which were not present in the chromatographically separated using an Ascentis Express standard, the inventors took the peak area responses of the RP-Amide column (50 mmx2.1 mm, 2.7 um, Supelco) 40 most similar FAME. For example, peak area response of operating a binary gradient with a flow rate of 0.2 mL/min. FAMEs of 16:1d9 was used for 16:1.d7 and FAME response The mobile phases were: A. 10 mMammonium formate in of C22:6 was used for C22:5. The corrected areas were used HO:methanol: tetrahydrofuran (50:20:30 V/v/v); B. 10 mM to calculate the mass of each FAME in the sample by ammonium formate in H2O:methanol:tetrahydrofuran (5:20: comparison to the internal standard mass. Oil is stored 75, V/v/v). Multiple reaction monitoring (MRM) lists were 45 mainly in the form of TAG and its weight was calculated based on the following major fatty acids: 16:0, 18:0, 18:1, based on FAME weight. Total moles of glycerol was deter 18:2, 18:3, 18:4, 20:1, 20:2, 20:3, 20:4, 20:5, 22:4, 22:5, mined by calculating moles of each FAMES and dividing 22:6 using a collision energy of 30 V and fragmentor of 60 total moles of FAMEs by three. TAG was calculated as the V. Individual MRMTAG was identified based on ammoni Sum of glycerol and fatty acyl moieties using a relation: % ated precursor ion and production from neutral loss of 22:6. 50 oil by weight=100x((41xtotal mol FAME/3)+(total g TAG was quantified using a 10 uM tristearin external FAME-(15xtotal mol FAME)))/g seed, where 41 and 15 are standard. molecular weights of glycerol moiety and methyl group, Lipid Profiling with LC-MS respectively. The extracted total lipids were analysed using an Agilent Analysis of the Sterol Content of Oil Samples 1200 series LC coupled to an Agilent 6410B electrospray 55 Samples of approximately 10 mg of oil together with an ionisation QQQ-MS (Agilent, Palo Alto, Calif., USA). A 5 added aliquot of C24:0 monol as an internal standard were LL injection of each total lipid extract was chromatographi saponified using 4 mL 5% KOH in 80% MeOH and heating cally separated with an Ascentis Express RP-Amide 50 for 2 h at 80° C. in a Teflon-lined screw-capped glass tube. mmx2.1 mm, 2.7 Lum HPLC column (Sigma-Aldrich, Castle After the reaction mixture was cooled, 2 mL of Milli-Q Hill, Australia) using a binary gradient with a flow rate of 0.2 60 water were added and the sterols were extracted into 2 mL mL/min. The mobile phases were: A. 10 mM ammonium of hexane: dichloromethane (4:1 V/v) by shaking and Vor formate in HO:methanol:tetrahydrofuran (50:20:30, V/v/ texing. The mixture was centrifuged and the sterol extract v.); B. 10 mM ammonium formate in HO:methanol:tetra was removed and washed with 2 mL of Milli-Q water. The hydrofuran (5:20:75, V/v/v.). Selected neutral lipids (TAG sterol extract was then removed after shaking and centrifu and DAG) and phospholipids (PL, including PC, PE, PI, PS, 65 gation. The extract was evaporated using a stream of nitro PA, PG) were analysed by multiple reaction monitoring gen gas and the sterols silylated using 200 mL of BSTFA and (MRM) using a collision energy of 30 V and fragmentation heating for 2 h at 80° C. US 9,725,399 B2 75 76 For GC/GC-MS analysis of the sterols, sterol-OTMSi 3000 rpm for 20 min, and 150 uL of each supernatant derivatives were dried under a stream of nitrogen gas on a transferred to 96-well plates for long term storage, heat block at 40° C. and then re-dissolved in chloroform or For efficient and quantitative digital PCR (ddPCR) the hexane immediately prior to GC/GC-MS analysis. The ste DNA was digested with restriction enzymes prior to ampli rol-OTMS derivatives were analysed by gas chromatogra fication reactions, to ensure that multiple copies of the phy (GC) using an Agilent Technologies 6890A GC (Palo transgenes or multiple insertions were physically separated. Alto, Calif., USA) fitted with an Supelco EquityTM-1 fused Aliquots of the DNA preparations were therefore digested silica capillary column (15 mx0.1 mm i.d., 0.1 um film with EcoRI and BamHI, together, in 20 uL volumes using thickness), an FID, a split/splitless injector and an Agilent 10xEcoRI buffer, 5 uL of DNA and about 4 units of each 10 enzyme per sample, incubated overnight at 37° C. Technologies 7683B Series auto sampler and injector. The primers used in these PCR reactions were designed Helium was the carrier gas. Samples were injected in using Primer3 software to confirm that primers for the splitless mode at an oven temperature of 120° C. After reference and target genes were not predicted to interact, or injection, the oven temperature was raised to 270° C. at 10° such interaction would not be a problem under the condi C. min' and finally to 300° C. at 5° C. min'. Peaks were 15 tions used. The reference gene used in the assay was the quantified with Agilent Technologies ChemStation software canola Hmg (high mobility group) gene, present at one gene (Palo Alto, Calif., USA). GC results are subject to an error per canola genome (Weng et al., 2004). Since canola is an of +5% of individual component areas. allotetraploid, it was taken that there were 4 copies of the GC-mass spectrometric (GC-MS) analyses were per Hmg gene, i.e. 2 alleles of each of the two genes, in Brassica formed on a Finnigan Thermoguest GCO GC-MS and a napus. The reference gene reactions used the pair of primers Finnigan Thermo Electron Corporation GC-MS; both sys and a dual-labelled probe, as follows: Sense primer, Can 11 tems were fitted with an on-column injector and Thermo GCGAAGCACATCGAGTCA (SEQ ID NO:50); Antisense quest Xcalibur software (Austin, Tex., USA). Each GC was primer, Can 12 GGTTGAGGTGGTAGCTGAGG (SEQ ID fitted with a capillary column of similar polarity to that NO:51); Probe, Hmg-P3 Hex/TCTCTAC/zen/CCGTCTCA described above. Individual components were identified 25 CATGACGC/3IABkFQ/-3' (SEQ ID NO:52). The amplifi using mass spectral data and by comparing retention time cation product size was 73 bp. data with those obtained for authentic and laboratory stan In one target gene amplification reaction which detected dards. A full procedural blank analysis was performed a region of the PPT selectable marker gene to screen all of concurrent to the sample batch. the transgenic plants, the sense primer was Can17, ATA RT-PCR Conditions 30 CAAGCACGGTGGATGG (SEQ ID NO:53); the antisense Reverse transcription-PCR (RT-PCR) amplification was primer, Can18 TGGTCTAACAGGTCTAGGAGGA (SEQ typically carried out using the Superscript III One-Step ID NO:54); the probe, PPT-P3 5-/FAM/TGGCAAAGA/ RT-PCR system (Invitrogen) in a volume of 25 using 10 Zen/GATTTCGAGCTTCCTGC/3IABkFQ/-3' (SEQ ID pmol of the forward primer and 30 pmol of the reverse NO:55). The size of this target gene amplification product primer, MgSO to a final concentration of 2.5 mM, 400 ng 35 was 82 bp. On some occasions, a second target gene assay of total RNA with buffer and nucleotide components accord was performed in parallel to detect partial insertions of the ing to the manufacturers instructions. Typical temperature T-DNA. This second assay detected a region of the A6-de regimes were: 1 cycle of 45° C. for 30 minutes for the saturase gene using a sense primer, Can23 CAAGCACCG reverse transcription to occur; then 1 cycle of 94° C. for 2 TAGTAAGAGAGCA (SEQ ID NO:56), the antisense minutes followed by 40 cycles of 94° C. for 30 seconds, 52° 40 primer, Can24 CAGACAGCCTGAGGTTAGCA (SEQ ID C. for 30 seconds, 70° C. for 1 minute; then 1 cycle of 72° NO:57); the probe, D6des-P3 5'-/FAM/TCCCCACTT/zen/ C. for 2 minutes before cooling the reaction mixtures to 5° CTTAGCGAAAGGAACGA/3IABkFQ/-3' (SEQ ED C. NO:58). The size of this target gene amplification product Determination of Copy-Number of Transgenes by Digital was 89 bp. Reactions routinely used 2 LL of the digested PCR 45 DNA preparations. Reaction composition per sample: ref To determine the copy-number of transgenes in a trans erence sense primer (10 pM), 1 Jul; reference antisense genic plant, a digital PCR method was used as follows. This primer (10 pM), 1 u : reference gene probe (10 pM), 0.5uL.; method could also be used to determine whether a plant was target gene sense primer (10 pM). 1 LL; target gene antisense transgenic for the genetic constructs described herein. About primer (10 pM), 1 uL; target gene probe (10 pM), 0.5 LL; a centimeter square of leaf tissue was harvested from each 50 ddPCR reagent mix, 12.5 LL; water 5.5 uL in a total volume individual plant and placed in a collection microtube (Qia of 25 uL. gen). The samples were then freeze dried for 24 to 48 hr. For The mixtures were then placed into a QX100 droplet breaking up the samples for DNA extraction, stainless steel generator, which partitioned each sample into 20000 nano ball bearings were added to each dried sample and the tubes liter-sized droplets. This was done in 8-well cartridges until shaken on a Qiagen Tissue lyser. 375 uL of extraction buffer 55 all of the samples were processed and transferred to a (0.1M Tris-HC1 pH8, 0.05M EDTA pH8 and 1.25% SDS) 96-well PCR plate. This plate was then heat sealed with a was added to each tube, the mixtures incubated at 65° C. for pierceable foil using a plate sealer machine. The samples 1 hr., and then cooled before 1874 of 6 Mammonium acetate were then treated under the following reaction conditions: (4°C.) was added to each tube with thorough mixing. The 95° C., 10 min, ramping at 2.5° C./s; then 39 cycles of 94° samples were then centrifuged for 30 min at 3000 rpm. The 60 C., 30s ramping at 2.5°C./s; 61° C., 1 min, ramping at 2.5° Supernatant from each tube was removed into new micro C/s: 98°C., 10 min, followed by cooling to 12° C. Follow tubes each containing 220 uL of isopropanol for precipita ing the amplification reactions of the DNA in the droplets, tion of the DNA at room temperature for 5 min. DNA was the plate was placed in a QX100 droplet reader which collected by centrifuging the tubes at 3000 rpm for 30 min, analysed each droplet individually using a two-color detec the DNA pellets washed with 320 uL of 70% ethanol and 65 tion system (set to detect FAM or Hex). The droplet digital dried before resuspension of the DNA in 225 uL of water. PCR data were viewed as either a 1-D plot with each droplet Non-dissolved material was pelleted by centrifugation at from a sample plotted on the graph of fluorescence intensity, US 9,725,399 B2 77 78 or a 2-D plot in which fluorescence (FAM) was plotted promoter (pAtFAE 1) and the Linum usitatissimum conlinin against fluorescence (Hex) for each droplet. The software 1 promoter (pLuCn11). The seven fatty acid biosynthesis measured the number of positive and negatives droplets for genes together coded for an entire DHA synthesis pathway each fluorophore (FAM or Hex) in each sample. The soft that was designed to convert 18:1° (oleic acid) through to ware then fitted the fraction of positive droplets to a Poisson 22:6-7'''''' (DHA). Both binary vectors contained a algorithm to determine the concentration of the target DNA BAR plant selectable marker coding region operably linked molecule in units of copies/ul input. The copy number to a Cauliflower Mosaic Virus (CaMV) 35S promoter with variation was calculated using the formula: CNV-(A/B) duplicated enhancer region and A. tumefaciens nos3' poly *Nb, where A concentration of target gene, adenylation region-transcription terminator. The plant B-concentration of reference gene, and Nb=4, the number 10 selectable marker was situated adjacent to the left border of of copies of the reference gene in the genome. the 1-DNA region, therefore distally located on the 1-DNA Assessment of Pollen Viability with respect to the orientation of 1-DNA transfer into the Fluorescein diacetate (FDA) was dissolved in acetone at plant cells. This increased the likelihood that partial transfer 2 mg/ml to provide a stock solution. FDA dilutions were of the T-DNA, which would be likely to not include the prepared just before use by adding drops of the FDA stock 15 selectable marker gene, would not be selected. p.JP3416 solution to 2 ml of a sucrose solution (0.5 M) until saturation GA7 and pP3404 each contained an RiA4 origin of repli was reached as indicated by the appearance of persistent cation from Agrobacterium rhizogenes (Hamilton, 1997). cloudiness. The GA7 construct also included two Nicotiana tabacum Propidium iodide (P1) was dissolved in sterile distilled Rb7 matrix attachment region (MAR) sequences, as water at 1 mg/ml to provide a stock Solution. Just before use, described by Hall et al. (1991). MAR sequences, sometimes 100 ul of the stock solution was added to 10 ml of sterile termed nuclear attachment regions, are known to bind spe distilled water to make a working solution. To check the cifically to the nuclear matrix in vitro and may mediate ratio of viable and non-viable pollen, PI and FDA stock binding of chromatin to the nuclear matrix in vivo. MARs solutions were mixed in 2:3 ratio. are thought to function to reduce transgene silencing. In Transgenic and wild-type canola and mustard plants were 25 plP3416-GA7 the MARs were also inserted and positioned grown understandard conditions in a glasshouse at 22t2°C. within the T-DNA region in order to act as DNA spacers to with a 16 hr photoperiod per day. Mature flower buds which insulate transgenic expression cassettes. The pP3416 vector were ready to open in the next day were labelled and prior to insertion of the GA7 region contained only the plant collected on the following morning at 9-10 am. Pollen from selectable marker cassette between the borders. opened flowers were stained with the FDA/PI mixture and 30 A. thaliana Transformation and Analysis of Fatty Acid visualized using a Leica MZFLIII fluorescence microscope. Composition GFP-2, a 510 nm long pass emission filter (transmitting red The chimeric vectors were introduced into A. tumefaciens and green light) with a 480/40 nm excitation filter was used strain AGL1 and cells from cultures of the transformed to detect viable and non-viable pollen. Non-viable pollen Agrobacterium used to treat A. thaliana (ecotypes Columbia which took up the PI stain appeared red under the fluores 35 and a fad2 mutant) plants using the floral dip method for cence microscope whereas viable pollen appeared bright transformation (Clough and Bent, 1998). After maturation, green when stained with PI and FDA. the T seeds from the treated plants were harvested and plated onto MS plates containing PPT for selection of plants Example 2 containing the BAR selectable marker gene. Surviving, 40 healthy T. seedlings were transferred to soil. After growth of Stable Expression of Transgenic DHA Pathways in the plants to maturity and allowing for self-fertilisation, T. Arabidopsis thaliana Seeds seeds from these plants were harvested and the fatty acid composition of their seed lipid analysed by GC analysis as Binary Vector Construction described in Example 1. The binary vectors plP3416-GA7 (also referred to herein 45 The plP3416-GA7 construct resulted in the production of as “GA7” described in WO 2013/185184) and pP3404 each slightly higher levels of DHA, as a percentage of total fatty contained seven heterologous fatty acid biosynthesis genes, acid content, on average than the pP3404 construct. The encoding 5 desaturases and 2 elongases, and a plant select conversion efficiencies for each enzymatic step in the pro able marker between the left and right border repeats of the duction of DHA from oleic acid were calculated as (% T-DNA present in each vector (FIGS. 2 and 3). SEQ ID 50 products x100)/(% remaining substrate+% products), NO:1 provides the nucleotide sequence of the T-DNA region thereby expressed as a percentage. of pP3416-GA7 from the right to left border sequences. The highest observed level of DHA produced in the Both genetic constructs contained plant codon-optimised plP3416-GA7 T transformed lines was 6.2%, additionally genes encoding a Lachancea kluyveri A12-desaturase (com with 0.5% EPA and 0.2% DPA (line #14). These T, seeds prising nucleotides 14143-16648 of SEQID NO:1), a Pichia 55 were still segregating for the transgene i.e. were not yet pastoris (D3-desaturase (comprising nucleotides 7654-10156 uniformly homozygous. The level of co3 fatty acids pro of SEQ ID NO:1), a Micromonas pusilla A6-desaturase duced as a result of the transgenes in these seeds (total new (comprising nucleotides 226-2309 of SEQ ID NO:1), Pay c)3 fatty acids, excluding the level of ALA which was lova sauna A5- and A4-desaturases (comprising nucleotides produced endogenously in the Columbia background) was 4524-6485 and 10157-14142 of SEQID NO:1, respectively) 60 10.7% while the level of co6 fatty acids (total new ()6 fatty and Pyramimonas cordata A6- and A5-elongases (compris acids but excluding 18:2^''') was 1.5%. This represents an ing nucleotides 23104523 and 17825-19967 of SEQ ID extremely favourable ration of new co3 fatty acids: new (06 NO:1, respectively). fatty acids, namely 7.3:1. The seven coding regions in the constructs were each T. seeds of selected lines transformed with pP3416 under the control of a seed specific promoter-three different 65 GA7, namely for lines designated 7, 10, 14, 22 and 34 in the promoters were used, namely the truncated Brassica napus Columbia background and for lines designated 18, 21 and 25 napin promoter (pEnEP1), the Arabidopsis thaliana FAE1 in the fad2 mutant background, were plated onto MS media US 9,725,399 B2 79 80 containing PPT for selection of transgenic seedlings in vitro. fatty acids, including 11.5% DHA, as a percentage of the Twenty PPT-resistant seedlings for each line were trans total fatty acids in the seed lipid content. ferred to soil and grown to maturity after self-fertilisation. Enzymatic conversion efficiencies for each enzyme step These plants were highly likely to be homozygous for the in the pathway for production of DHA from oleic acid are shown in Table 4 for the T seeds with the higher DHA selectable marker gene, and therefore for at least one T-DNA levels. The A12-desaturase conversion efficiency in seeds of insertion in the genome of the plants. T. Seed from these line 22.2 was 81.6% and the co3-desaturase efficiency was plants were harvested and analysed for fatty acid composi 89.1%, both of them remarkably high and indicating that tion in their seeded by GC. This analysis revealed that the these fungal (yeast) enzymes were able to function well in plP3416-GA7 construct generated higher levels of the co3 developing seeds. The activities of the other exogenous LC-PUFADHA in T. seeds of the homozygous plants than 10 enzymes in the DHA pathway were similarly high for co3 in the segregating 12 seed. Up to about 13.9% DHA was substrates with the A6-desaturase acting at 42.2% efficiency, observed in the T p)P3416-GA7 transformed line desig A6-elongase at 76.8%, A5-desaturase at 95.0%, A5-elongase nated 22.2 in the Columbia background, increased from at 88.7% and A4-desaturase at 93.3% efficiency. The A6-de about 5.5% in the hemizygous T, seed, with a sum level of 15 saturase activity on the ()6 Substrate LA was much lower, about 24.3% of new co3 fatty acids as a percentage of the with the A6-desaturase acting at only 0.7% conversion total fatty acids in the seed lipid content. New Co6 fatty acids efficiency on LA. GLA was present at a level of only 0.4% were at a level of 1.1% of total fatty acids, representing a and was the only new co6 product aside from 20:2006 very favourable ratio of new co3 fatty acids:new ()6 fatty detected in the T seeds with the highest DHA content. acids, namely about 22:1. Similarly, transformants in the Compiled data from the total seed lipid profiles from inde fad2 mutant background yielded 20.6% as a sum of new co3 pendent transgenic seed are shown in Table 5. TABLE 4 Conversion efficiencies of the individual enzymatic steps for the production of DHA from oleic acid, observed in total seed lipid from transgenic T. Arabidopsis seeds. GA7. Col. 7.2 GA7 Col. 34.2 GA7. Col. 10.13 GA7. Col. 22.2 GA7 Col. 14.19

d12-des 75.4% 73.1% 75.70% 81.6% 73.4% d15-des 85.3% 84.4% 86.2% 89.1% 70.2% Omega-6 d6-des O.3% O.3% O.3% O.7% O.3% (d.9-elo) 1.7% 1.7% 1.2% 1.2% 2.6% d6-elo d5-des d5-elo d4-des Omega-3 d6-des 30.7% 29.3% 28.2% 42.2% 30.2% (d.9-elo) 2.7% 2.7% 2.3% 2.4% 3.0% d6-elo 79.0% 81.1% 79.0% 76.8% 70.9% d5-des 94.0% 94.6% 94.5% 95.0% 97.9% d5-elo 91.9% 91.7% 93.6% 88.7% 89.5% d4-des 93.2% 93.7% 94.4% 93.3% 93.7% GA7 FAD2- GA7 FAD2- GA7 FAD2- T. Col. 22.2 T. Col 22.2 25.10 21.2 18.14 (mean) best line

d12-des 66.6% 78.59% 63.1% 67.6% 82.7% d15-des 87.5% 82.2% 87.6% 81.0% 90.9% Omega-6 dé-des O.6% 1.0% O.2% 1.3% O.7% (d9-elo) 1.1% 2.0% 1.3% 1.6% 1.5% d6-elo d5-des d5-elo d4-des Omega-3 d6-des 38.5% 40.0% 29.2% 41.0% 45.7% (d9-elo) 2.3% 2.7% 2.9% 2.8% 3.1% d6-elo 79.2% 73.2% 79.1% 77.59% 77.70% d5-des 87.8% 93.3% 91.1% 95.0% 95.8% d5-elo 89.9% 92.2% 91.6% 90.8% 90.2% d4-des 92.5% 95.0% 93.9% 92.2% 90.9%

TABLE 5 Compiled data from the total seed lipid profiles from independent transgenic seed. Parameter GA7-Col. 7.2 GA7-Col. 34.2 GA7-Col 10.13 GA7-Col 22.2 GA7-Col. 14.19 total wis (% of total FA) SO.O 48.9 S1.6 55.8 38.6 total w8 (% of total FA) 8.7 9.1 8.3 6.7 16.3 w3/w 6 ratio 5.75 5.37 6.22 8.33 2.37 w6.w3 ratio O.17 O.19 O16 O.12 O42 total novel wis (% of total FA) 16.3 15.2 15.5 24.3 12.5 total novel w8 (% of total FA) 1.2 1.2 O.9 1.1 1.5 novel wifw8 ratio 13.58 12.67 17.22 22.09 8.33 US 9,725,399 B2 81 82 TABLE 5-continued Compiled data from the total seed lipid profiles from independent transgenic seed. novel wéfw3 ratio O.O7 O.08 O.O6 O.OS O.12 OA to EPA efficiency 14.1% 13.3% 13.4% 21.8% 10.2% OA to DHA efficiency 12.0% 1.4% 11.8% 18.0% 8.6% LA to EPA efficiency 18.9% 8.4% 17.9% 26.9% 14.2% LA to DHA efficiency 16.2% 5.9% 15.7% 22.2% 12.0% ALA to EPA efficiency 22.2% 21.9% 20.7% 30.1% 20.2% ALA to DHA efficiency 19.0% 8.8% 18.2% 24.9% 17.1% total Saturates 16.0 4.7 15.4 16.0 16.2 total monounsaturates 23.7 25.8 23.4 19.2 26.5 total polyunsaturates 58.7 58.0 59.9 62.5 S4.9 total C20 19 9.8 16.8 15.9 19.1 total C22 11.4 1 10.8 15.5 8.6 C20C22 ratio 1.67 18O 1.56 1.03 2.22 GA7-FAD2- GA7-FAD2- GA7-FAD2- T. Col 22.2 T. Col 22.2 Parameter 25.10 21.2 1814 (mean it SD) best line total wis (% of total FA) 47.1 49.4 44.8 S4.O 55.9 total w8 (% of total FA) 6.7 10.7 6.3 6.7 5.7 w3/w6 ratio 7.03 4.62 7.11 8.06 9.81 w6.w3 ratio O.14 O.22 O.14 O.12 O.10 total novel wis (% of total FA) 18.8 2O.S 14.0 23.0 26.4 total novel w8 (% of total FA) O.9 1.8 0.7 1.4 1.4 novel wifw8 ratio 20.89 11.39 2O.OO 16.43 1886 novel wéfw3 ratio O.OS O.09 O.OS O.O6 O.OS OA to EPA efficiency 15.0% 16.8% 11.2% 20.4% 24.5% OA to DHA efficiency 12.6% 14.8% 9.6% 17.1% 20.1% LA to EPA efficiency 22.9% 21.8% 18.0% 26.2% 29.9% LA to DHA efficiency 19.1% 19.1% 15.5% 21.9% 24.5% ALA to EPA efficiency 26.1% 26.5% 20.5% 29.4% 32.9% ALA to DHA efficiency 21.9% 23.3% 17.6% 24.6% 27.0% total Saturates 13.4 16.5 12.9 16.0 17.8 total monounsaturates 30.9 21.3 34.3 21.1 18.1 total polyunsaturates 53.8 60.1 S1.1 60.7 61.6 total C20 21.5 18.2 23.3 18 16.6 total C22 12.1 13.2 9.9 15.4 17.5 C20C22 ratio 1.78 1.38 2.35 1.17 O.95

35 T. seeds from the pP3416-GA7 line 22.2 in the Columbia DHA level of about 9% relative to the seeds with about 14% background, which were progeny from T line 22, were DHA, Subsequent data from species other than Arabidopsis Sown directly to Soil and the fatty acid composition of has shown that this negative correlation is more pronounced mature seed from the resultant T. plants analysed by G.C. in Arabidopsis than in C. sativa or Brassica species (Ex The average DHA level of these seeds was 133%+1.6 (n=10) 40 ample 8 below). as a percentage of total fatty acids in the seed lipid. The line with the highest level of DHA contained 15.1% DHA in the TABLE 6 total fatty acids of the seed lipid. The enzymatic conversion Proportion and amount of DHA in GA7-transformed efficiencies are shown in Table 4 for each step in the 45 Arabidopsis seeds. production of DHA from oleic acid. Southern blot hybridisation analysis was performed. The DHA content DHA content Oil content per weight results showed that the high-accumulating DHA lines were (% of TFA) (% oil per g seeds) (mg/g seed) either single- or double-copy for the T-DNA from the plP3416-GA7 construct with the exception of transgenic 50 A. iii. it. 3. line Columbia#22, which had three T-DNA insertions in the GA7/col 22.3.3 14.0 1592 212 genome of the Arabidopsis plant. The T5 generation seed GA7 col 10.15-1 8.7 30.23 25.06 was also analysed and found to have up to 13.6% DHA in GA7 col 10.15-2 8.6 31.25 25.77 the total seed lipids. The GA7 construct was found to be GA7 col 10.15-3 8.8 31.70 26.49 stable across multiple generations in terms of DHA produc- 55 tion capability. Determination of Oil Content in Transgenic A. thaliana Example 3 DHA Lines The oil content of transgenic A. thaliana seeds with Stable Expression of a Transgenic DHA Pathway in various levels of DHA was determined by GC as described 60 Camelina sativa Seeds in Example 1. The data are shown in FIG. 4, graphing the oil content (% oil by weight of seed) against the DHA content The binary vector pP3416-GA7 as described above was (as a percentage of total fatty acids). Up to 26.5 mg of DHA introduced into A. tumefaciens strain AGL1 and cells from per gram of seed was observed (Table 6). The oil content of a culture of the transformed Agrobacterium used to treat C. the transgenic Arabidopsis seeds was found to be negatively 65 sativa flowering plants using a floral dip method for trans correlated with DHA content. The amount of DHA per formation (Lu and Kang, 2008). After growth and matura weight of seed was greater in the transformed seeds with a tion of the plants, the T seeds from the treated plants were US 9,725,399 B2 83 84 harvested, Sown onto Soil and the resultant plants treated by individual T seeds from this plant and the fatty acid spraying with the herbicide BASTA to select for plants composition analysed by GC. The fatty acid composition which were transgenic for, and expressing, the bar selectable data of the individual seeds for this transformed line is also marker gene present on the T-DNA of plP3416-GA7. Sur shown in Table 7. Compiled data from the total seed lipid viving T plants which were tolerant to the herbicide were 5 grown to maturity after allowing them to self-fertilise, and profiles (Table 7) are shown in Table 8. the resultant T. Seed harvested. Five transgenic plants were DHA was present in six of the 10 individual seeds. The obtained, only three of which contained the entire T-DNA. four other seeds did not have DHA and were presumed to be Lipid was extracted from a pool of approximately twenty null segregants which did not have the T-DNA, based on seeds from each of the three plants that contained the entire 10 hemizygosity of the 1-DNA insertion in the parental plant. 1-DNA. Two of the pooled samples contained very low, Extracted lipid from the single seed with the highest level of barely detectable levels of DHA, but the third pool contained DHA had 9.0% DHA while the sum of the percentages for about 4.7% DHA. Therefore, lipid was extracted from 10 EPA, DPA and DHA was 11.4%. TABLE 7 Fatty acid composition of total seed lipids from transgenic T. Camelina sativa seeds transformed with the T-DNA from pP3416-GA7. The fatty acid composition is shown for a pooled seed batch FD5.46) and for 10 single seeds ranked (left to right) from highest to lowest DHA. FDS.46 Fatty acid pooled # 2 #4 # 8 # 7 # 9 # 1 # 3 # 5 # 6 # 10 14:O O O2 O2 O.1 O2 O2 O2 O2 O.1 O2 (0.2 16:O 11.6 12.1 12.3 121 13.2 12.3 128 11.9 11.4 11.5 11.7 16:1 O2 O.O. O.1 O.1 O.O. O.2 O.O O2 O2 O2 O2 16:3 O.3 O O.O O.O. O.O. O.O. O.O. O.O. O.O. O.O. O.O 18:0 3.7 33 3.2 3.2 3.0 3.1 3.2 3.3 3.1 3.2 3.2 18:1 10.8 8.0 8.O 8.6 8.5 9.4 11.0 102 8.3 94 8.6 18:1d 11 1.7 13 1.4 14 1.7 14 15 1.3 1.3 13 1.3 18:2 24.7 18.2 19.S. 19.2 18.5 20.1 23.8 32.2 30.3 29.8 31.6 18:303 27.4 26.7 26.6 27.3 28.9 28.2 27.4 28.3 29.2 29.S. 28.2 18:36 O.2 14 O.3 O3 O.4 O2 (0.5 O.O. O.S 04 0.6 20:O 1.6 1.4 1.3 1.4 1.2 1.4 1.4 1.8 2.1 1.9 2.0 18:403 2.2 6.8 6.4 5.7 7.2 5.7 4.1 O.O. O.O. O.O. O.O 20:1d 11 5.3 44 4.6 4.8 33 41 3.5 4.4 6.1 5.8 5.5 20:1 iso O.4 O.3 0.3 0.3 0.3 0.3 O.O. O.S. O.6 OS. O.S 20:26 O.8 O.8 O.9 O.8 O.6 0.8 O.7 13 1.5 14 14 20:303 O.6 0.8 O.8 O.8 O.7 O.8 O.7 O.6 0.7 O.7 O.6 22:O O.4 O.S. O.S. O.S. O.4 O.5 OS 06 0.6 06 0.6 20:403 O2 O.3 O.3 O3 O.4 O.4 OS O.O. O.O. O.O. O.O 22:1 1.1 1.1 12 11 O.S. O.9 O.8 1.6 2.2 19 2.0 20:53 0.7 13 1.6 15 1.6 11 17 O.O. O.O. O.O. O.1 22:2006 O.1 O.O O.O. O.O. O.O. O.O. O.O O2 O.3 O2 (0.2 22:4006 + 22:303 O3 O2 (0.3 O3 O.O. O.3 O.O. O.4 O.6 OS O.S 24:O O3 O.3 O.3 O3 O.O. O.3 O.O. O.4 O.4 O.4 O.4 24:1 O3 O.4 O.4 O3 O.O. O.3 O.O. O.S. O.6 OS O.S 22:53 O.3 1.1 12 11 11 O.9 O.8 O.O. O.O. O.O. O.O 22:63 4.7 9.0 8.5 8.3 8.3 7.1 4.9 O.O. O.O. O.O. O.O

TABLE 8 Compiled data from the total seed lipid profiles from transgenic seed as shown in Table 7. Calculations do not include the minor fatty acids in Table 7. FDS.46 Parameter pooled # 2 ii. 4 # 8 # 7 # 9 # 1 # 3 # 5 # 6 # 10 total wis (% of total FA) 36.1 46 45.4 45 48.2 44.2 40.1 28.9 29.9 30.2 28.9 total w8 (% of total FA) 25.8 20.4 20.7 20.3 19.5 21.1 25 33.7 32.6 31.8 33.8 w3/wó ratio 140 2.25 2.19 2.22 2.47 2.09 1.60 O.86 O.92 O.95 O.86 w6fw3 ratio O.71 0.44 O46 O.45 O4O O.48 O.62 1.17 1.09 1.OS 1.17 total novel wis (% of total FA) 8.1 18.5 18 16.9 18.6 15.2 12 O O O O.1 total novel w8 (% of total FA) 1.1 2.2 1.2 1.1 1 1 1.2 1.5 2.3 2 2.2 novel wifw8 ratio 7.36 841 1S.OO 15.36 18.60 15.20 1O.OO O.OS novel wéfw3 ratio O.14 O.12 O.O7 O.O7 O.OS O.O7 O.10 22.00 OA to EPA efficiency 8.2%. 15.6%. 15.5% 15.1% 15.1%. 12.8%. 10.5% O.0% O.0% O.0% O.1% OA to DHA efficiency 6.7%. 12.3%. 11.6% 11.5%. 11.4%. 10.0% 7.0% O.0% O.0% O.0% O.0% LA to EPA efficiency 9.2%. 17.2%. 17.1% 16.7%. 16.2%. 13.9%. 11.4% O.0% O.0% O.0% O.2% LA to DHA efficiency 7.6%. 13.6%. 12.9% 12.7%. 12.3%. 10.9% 7.5% O.0% O.0% O.0% O.0% ALA to EPA efficiency 15.8% 24.8% 24.9% 24.2%. 22.8%. 20.6%. 18.5% O.0% O.0% O.0% O.3% ALA to DHA efficiency 13.0%. 19.6%. 18.7% 18.4%. 17.2%. 16.1% 12.2% O.0% O.0% O.0% O.0% total Saturates 17.6 17.8 17.8 17.6 18 17.8 18.1 18.2 17.7 17.8 18.1 total monounsaturates 19.8 15.5 16 16.6 14.3 16.6 16.8 18.7 19.3 19.6 18.6 total polyunsaturates 62.5 66.6 66.4 65.6 67.7 65.6 65.1 63 63.1 62.5 63.2 US 9,725,399 B2 85 86 TABLE 8-continued Compiled data from the total seed lipid profiles from transgenic seed as shown in Table 7. Calculations do not include the minor fatty acids in Table 7. FDS.46 Parameter pooled # 2 ii. 4 # 8 # 7 # 9 # 1 # 3 # 5 # 6 # 10 total C20 9.6 9.3 9.8 9.9 8.1 8.9 8.5 8.6 11 10.3 10.1 total C22 5.4 10.3 10 9.7 9.4 8.3 5.7 O6 O.9 0.7 0.7 C20C22 ratio 1.78 O.90 O.98 1.02 O.86 1.07 1.49 14.33 12.22 14.71 14.43

Homozygous seed from this line was obtained in the T4 found on Sn-1.3 was similar to results previously reported in generation. Up to 10.3% DHA was produced in event A. thaliana seed (Petrie et al., 2012). FD5-46-18-110 with an average of 7.3% DHA observed 15 Since only a small number of independent transgenic lines across the entire T4 generation. A Subsequent generation were obtained in the transformation experiment described (T5) was established to further test the stability of PUFA above, further C. saliva transformations were performed production over multiple generations, particularly the DHA. using the GA7-modB construct (Example 4). More trans The maximum DHA levels observed was found to be stable formants were obtained and homozygous lines producing in in the fifth generation, even though the pooled seed DHA excess of 20.1% DHA are identified. content had not stabilised until the T generation due to the presence of multiple transgenic loci. Ts seed batches were Example 4 also germinated on MS media in vitro alongside parental C. saliva seed with no obvious difference in germination effi Modifications to T-DNAS Encoding DHA Pathways ciency or speed observed. Further generations of the trans 25 in Plant Seeds genic line (T6. T7 generations etc) did not show any reduction in the seed DHA level. The transgenic plants were In order to improve the DHA production level in B. napus fully male and female fertile, and the pollen showed about beyond the levels described in WO2013/185184, the binary 100% viability as for the wild-type plants. Analysis of the oil Vectors p.JP3416-GA7-modA, p.JP3416-GA7-modB, content of the seeds having different levels of DHA did not 30 plP3416-GA7-modC, p.JP3416-GA7-modD, plP3416 identify a correlation between DHA level and oil content, GA7-modE and pP3416-GA7-modF were constructed as contrary to the correlation seen in Arabidopsis thaliana. described in WO2013/185184 and tested in transgenic In several further transgenic lines, the DHA content of plants. These binary vectors were variants of the pP3416 single seeds from independent events exceeded 12%. The GA7 construct described in Example 2 and were designed to transgenic: null ratio of these lines was found to be between 35 further increase the synthesis of DHA in plant seeds, par approximately 3:1 and 15:1. Analysis of representative fatty ticularly by improving A6-desaturase and A6-elongase func acid profiles from the top DHA samples from each construct tions. SDA had been observed to accumulate in some seed found only 1.2-1.4% GLA with no other new co6 PUFA transformed with the GA7 construct due to a relatively low detected. In contrast, new co3 PUFA (SDA) co3 LC-PUFA A6 elongation efficiency compared to the A5-elongase, so (ETA, EPA, DPA, DHA) were found to accumulate to 18.5% 40 amongst other modifications, the two elongase gene posi with a DHA level of 9.6% of the total fatty acid content. tions were switched in the T-DNA. A6-desaturation was 32% and EPA was 0.8% of the total The two elongase coding sequences in plP3416-GA7 fatty acid content. The A5-elongation efficiency was 93% were switched in their positions on the T-DNA to yield and A6-elongation efficiency was 60%. DHA was detected in plP3416-GA7-modA by first cloning a new P. cordata the polar seed lipid fraction of GA7 lines. 45 A6-elongase cassette between the SbfI sites of pP3416 It was noted that the segregation ratios observed (-3:1 to GA7 to replace the P. cordata A5-elongase cassette. This ~15:1) indicated that one or, at most, two transgenic loci construct was further modified by exchanging the FP1 were required to produce fish oil-like levels of DHA in C. promoter driving the M. pusilla A6-desaturase with a con saliva. This had important implications for the ease with linin Cnl2 promoter (pLuCnl2) to yield pP3416-GA7 which the transgenic trait can be bred as well as for 50 modB. This modification was made in an attempt to increase transgene Stability. the A6-desaturase expression and thereby enzyme efficiency. Homozygous seed was planted out across several glass It was thought that the Cnl2 promoter might yield higher houses to generate a total of over 600 individual plants. Oil expression of the transgene in B. napus than the truncated was extracted from the seed using a variety of methods napin promoter. including SOXhlet, acetone and hexane extractions. 55 Eight transgenic plP3416-GA7-modBA. thaliana events 'C NMR regiospecificity analysis was performed on the and 15 transgenic pP3416-GA7-modG A. thaliana events transgenic C. Saliva seed oil to determine the positional were generated. Between 3.4% and 7.2% DHA in pooled distribution of the (03 LC-PUFA on TAG. An event with plP3416-GA7-modB seed was observed and between 0.6 approximately equal EPA and DHA was selected to maxi and 4.1% DHA in pooled T2 p.JP3416-GA7-modG seed was mise response for these fatty acids and the ratio of sn-1.3 to 60 observed. Several of the highest plP3416-GA7-modB Sn-2 was found to be 0.75:0.25 for EPA and 0.86:0.14 for events were sown out on selectable media and Surviving DHA where an unbiased distribution would be 0.66:0.33. seedlings taken to the next generation. Seed is being ana That is, 75% of the EPA and 86% of the DHA were located lysed for DHA content. Since the pooled T1 seeds repre at the sn-1.3 position of TAG. This indicated that both fatty sented populations that were segregating for the transgenes acids were preferentially located on the Sn-1.3 positions in 65 and included any null segregants, it is expected that the C. sativa TAG although the preference for EPA was weaker homozygous seeds from progeny plants would have than for DHA. The finding that DHA was predominantly increased levels of DHA, up to 30% of the total fatty acid US 9,725,399 B2 87 88 content in the seed oil. The other modified constructs were comprising up to 34.3% DHA were identified, for example used to transform A. thaliana. Although only a small number in seed CT136-27-47-25 (Table 12). The fatty acid compo of transformed lines were obtained, none yielded higher sition for seedoil obtained from CT 136-27-47-25 is shown levels of DHA than the modB construct. in Table 12. The fatty acid composition included 34.3% The pP3416-GA7-modB construct was also used to DHA together with about 1.5% DPA, 0.6% EPA and 0.5% generate transformed B. napus plants of cultivar Oscar and ETA. The SDA level was about 7.5%, ALA about 21.9% and of a series of breeding lines designated NX002, NX003, LA about 6.9%. The new (06 PUFA exhibited 1.1% GLA but NX005, NX050, NXO52 and NXO54. A total of 1558 trans no detectable (06-C20 or -C22 LC-PUFA. Total Saturated formed plants were obtained including 77 independent trans fatty acids: 9.6%; monounsaturated fatty acids, 12.5%; total formed plants (TO) for the Oscar transformation, and 1480 10 PUFA, 75.2%; total (O6-PUFA (including LA), 7.2%; total independent plants for the breeding lines including 189 for (03-PUFA, 66.9%; the ratio of total (06:03 fatty acids, 9.3:1; NX005 which is a line having a high oleic acid content in its new ()6:new co3 fatty acids, 37:1. The efficiencies of each of seedoil by virtue of mutations in FAD2 genes. The other the enzymatic steps from oleic acid to DHA were as follows: breeding lines had higher levels of LA and ALA. Transgenic A12-desaturase, 90%; A15/o3-desaturase, 89%; A6-desatu plants which exhibited more than 4 copies of the T-DNA as 15 rase, 67%; A6-elongase, 83%; A5-desaturase, 99%; A5-elon determined by a digital PCR method (Example 1) were gase, 98%; M-desaturase, 96%. The overall efficiency of discarded; about 25% of the TO plants were discarded by this conversion of oleic acid to DHA was about 50%. It was criterion. About 53% of the TO transgenic plants had 1 or 2 therefore clear that seeds producing DHA in the range of copies of the T-DNA as determined by the digital PCR 20.1-35% of the total fatty acid content of the seedoil could method, 12% had about 3 copies and 24% 4 or more copies. be identified and selected, including seeds having between Seed (T1 seed) was harvested from about 450 of the trans 20.1% and 30% DHA or between 30% and 35% DHA in the genic lines after self-fertilisation, achieved by bagging the total fatty acid content. plants during flowering to avoid out-crossing. T1 seed are The oil content in some seeds was decreased from about harvested from the remainder of the transgenic plants when 44% in wild-type seeds to about 31-39% in some of the mature. About 1-2% of the plant lines were either male or 25 DHA producing seeds, but was was similar to wild-type femalesterile and produced no viable seeds, these TO plants levels in other DHA producing seeds. were discarded. Various transformed plant lines which were producing Pools of seed (20 T1 seeds in each pool) were tested for DHA at levels of at least 10% in T2 seed are crossed and the levels of DHA in the pooled seed oil, and lines which F1 progeny selfed in order to produce F2 progeny which are showed the highest levels were selected. In particular, lines 30 homozygous for multiple T-DNA insertions. Seedoil from having a DHA content of at least 2% of the total fatty content homozygous seed is analysed and up to 30% or 35% of the in the pooled T1 seeds were selected, About 15% of the total fatty acid content in the seed oil is DHA. transgenic lines were selected in this way; the other 85% The TAG in the oil obtained from CT136-27-18-2 and were discarded. Some of these were designated lines CT136-27-18-19 was analysed by CNMR regiospecificity CT132-5 (in cultivar Oscar), CT133-15,-24, -63, -77, -103, 35 assay for positional distribution of the DHA on the glycerol -129 and -130 (in NX005). Selected lines in NX050 included backbone of the TAG molecules. The DHA was preferen CT136-4, -8, -12, -17, -19, -25, -27, -49 and -51. Twenty tially linked at the sn-1.3 position. More than 70%, indeed seeds from selected lines including CT132.5 and 11 seeds more than 90% of the DHA was in the sn-1.3 position. from CT 133.15 were imbibed and, after two days, oil was In several further transgenic lines, the DHA content of extracted from a half cotyledon from each of the individual 40 single seeds from independent events exceeded 12%. The seeds. The other half cotyledons with embryonic axes were transgenic: null ratio of these lines was found to be approxi kept and cultured on media to maintain the specific progeny mately 3:1, corresponding to a single transgenic locus, or lines. The fatty acid composition in the oil was determined: 15:1, corresponding to two transgenic loci. Analysis of the data is shown in Table 9 for CT132.5. The DHA level in representative fatty acid profiles from the samples from each ten of the 20 seeds analysed was in the range of 7-20% of 45 construct with the highest levels of DHA found only 1.2- the total fatty acid content as determined by the GC analysis. 1.4% GLA with no other new (06 PUFA detected. In con Other seeds had less than 7% DHA and may have contained trast, new co3 PUFA (SDA) and co3 LC-PUFA (ETA, EPA, a partial (incomplete) copy of the T-DNA from plP3416 DPA, DHA) accumulated to a sum of 25.8% for the modF GA7-modB. The transgenic line appeared to contain mul construct and 21.9% for the modG construct compared to tiple transgene insertions that were genetically unlinked. 50 18.5% for the GA7-transformed seed. The DHA levels in the The seeds of transgenic line CT133.15 exhibited DHA levels oil from these seeds were 9.6%, 12.4% and 11.5%, respec in the range Seeds with no DHA were likely to be null tively. A6-desaturation was found to be lower in the GA7 segregants. These data confirmed that the modB construct transformed seeds than the modF- and modG-transformed performed well for DHA production in canola seed. seeds (32% vs. 47% and 43%) and this resulted in a reduction Twenty or 40 individual seeds (T2 seeds) obtained from 55 of ALA in the modF and modG seeds relative to GA7. each of multiple T1 plants, after self-fertilisation, from the Another noteworthy difference was the accumulation of selected transformed lines were tested individually for fatty EPA in the modF seed (3.3% vs 0.8% in the other two acid composition. Seeds comprising DHA at levels greater transgenic seeds) and this was reflected in the reduced than 20% were identified (Table 10), Two representative A5-elongation observed in modF (80%) seed relative to GA7 samples, CT136-27-18-2 and CT136-27-18-19 had 21.2% 60 and modG seeds (93% and 94%). There was a slight increase and 22.7% DHA, respectively. The total ()3 fatty acid in A6-elongation in these seeds (66% vs 60% and 61%) content in these seeds was about 60% as a percentage of the although the amount of SDA actually increased due to the total fatty acid content, and the (D6 content was less than slightly more active A6-desaturation. DHA was detected in 10%. Further sets of 20 or 40 T2 seeds from each of the T1 the polar seed lipid fraction of GA7 lines. plants were tested for fatty acid composition. Representative 65 The fatty acid composition was analysed of the lipid in the data for DHA levels in the total fatty acid content of seedoil T1 seed of 70 independent transgenic plants of the B. napus from individual T2 seeds is shown in FIG. 10. Seeds breeding line NX54 transformed with the T-DNA of the US 9,725,399 B2 89 90 modB construct. It was observed that one of these transgenic rase and A5-elongase coding regions resulted in greater plants produced seed having DPA but no DHA in the seedoil. A6-desaturation. A5-elongase activity was not reduced in The T1 seed of this line (CT-137-2) produced about 4% DPA this instance due to the replacement of the FP1 promoter without any detectable DHA in the T1 pooled seed. The with the Cnl2 promoter. These data confirmed that the modB, modF and modG inventors concluded that this was caused by inactivation of 5 constructs performed well for DHA production in Camelina the A4-desaturase gene in that particular inserted T-DNA, seed, as for Arabidopsis and canola. perhaps through a spontaneous mutation. Around 50 T1 The inventors considered that, in general, the efficiency of seeds from this transgenic line were germinated and one rate-limiting enzyme activities in the DHA pathway can be emerged cotyledon from each analysed for fatty acid com 10 greater in multicopy T-DNA transformants compared to position in the remaining oil. Selected seedlings exhibiting single-copy T-DNA transformants, or can be increased by more than 5% DPA were then grown to maturity and T2 seed inserting into the T-DNA multiple genes encoding the harvested. Pooled seed fatty acid compositions are shown in enzyme which might be limiting in the pathway. Evidence Table 11, more than 7% DPA was observed in these lines. for the possible importance of multi-copy transformants was Whilst the focus of this experiment was the demonstration 15 seen in the Arabidopsis seeds transformed with the GA7 of DHA production in an oilseed crop species, the differ construct (Example 2), where the highest yielding DHA ences noted above were also interesting from a construct event had three T-DNAs inserted into the host genome. The design perspective. First, Switching the A6- and A5-elongase multiple genes can be identical, or preferably are different coding region locations in the modF construct resulted in the variants that encode the same polypeptide, or are under the intended profile change with more EPA accumulated due to control of different promoters which have overlapping lower A5-elongation. A concomitant increase in A6-elonga expression patterns. For example, increased expression tion was observed but this did not result in lower SDA levels. could be achieved by expression of multiple A6-desaturase This was due to an increase in A6-desaturation in the modF coding regions, even where the same protein is produced. In transformed seed, caused by adding an extra M. pusilla plP3416-GA7-modF and plP3416-GA7-modC, for A6-desaturase expression cassette as well as by replacing the 25 instance, two versions of the M. pusilla A6-desaturase were truncated napin promoter (FP1) with a more highly active present and expressed by different promoters. The coding flax conlinin2 promoter. The somewhat lower increase in sequences had different codon usage and therefore different A6-desaturation observed with the modG construct was nucleotide sequences, to reduce potential silencing or co caused by capitalising on the highly expressed A5-elongase Suppression effects but resulting in the production of the cassette in GA7. Switching the positions of the A6-desatu same protein. TABLE 9 Fatty acid profiles of half cotyledons of germinating T1 transgenic B. naptis seeds containing the modB construct. Up to 18.1% DHA was observed with numerous samples containing greater than 10% DHA. Seed 14:0 16:0 16:1d32 16:1 16:3 18:0 18:1 18:1d 11 18:2 18:3n6 18:3m3 20:0 18:4n3 C20:1d 11

1 O. 4.2 O. O. O.2 1.8 29.9 2.5 9.9 O.1 38.4 O.S O.8 O 2 O. 4.7 O. O. O.2 4.O 23.0 2.3 7.4 O.3 29.3 1.O 4.3 .1 3 O. 3.7 O.2 O. O.2 18 SS.1 9 4.7 O.2 15.2 O.8 1.8 .4 4 O. 4.6 O.2 O.2 O.2 29 22.1 8 6.6 0.4 26.5 1.O 7.2 O 5 O. 4.0 O. O. O.2 17 27.4 2.1 8.1 O.3 26.4 O6 2.8 O 6 O. 3.5 O. O. O.2 16 S9.8 2.0 4.3 O.1 18.5 O6 O.S 3 7 O. 6.O O.3 O.3 O.3 17, 16.6 2.6 23.9 1.O 23.2 O6 5.4 O.8 8 O. 4.9 O. O. O.2 2.7 12.9 .4 11.7 O.3 34.3 O.9 S.O O.9 9 O. 3.9 O. O. O.1 2.4 41.6 7 21.5 O.O 23.4 0.7 O.O .2 10 O. 3.7 O.2 O. O.1 2.1 30.9 7 19.2 0.4 23.6 0.7 2.1 .1 11 O. 5.7 0.4 O.3 O.2 38 41.2 2.4 26.7 2.1 7.2 1.3 O.3 .2 12 O. 4.6 O.O O. O.2 24 25.5 7 16.1 O.3 28.9 O.8 3.9 .1 13 O. 4.3 O. O. O.1 4.2 19.4 .6 9.2 O.1 45.5 1.O O.2 .1 14 O. 6.3 O.2 O.2 O.2 40 10.5 2.3 8.4 O.3 31.1 1.3 3.9 O.8 15 O. S.1 O. O.2 O.2 33 16.8 2.4 11.2 O.3 28.8 1.O 4.5 O.9 16 O. 4.4 O. O. O.2 40 16.2 .5 11.6 O.2 33.5 O.9 2.8 .1 17 O.2 7.2 O.2 O.2 O.2 4.9 15.O 2.1 8.9 O.3 25.9 1.4 S.1 O.9 18 O. 4.0 O. O. O.2 23 64.8 .2 7.2 O.1 12.5 1.O 3.5 .5 19 O. 3.9 O. O. O.2 4.6 36.9 7 7.1 O.2 28.6 1.2 1.8 .2 2O O. 4.8 O. O. O.2 6.0 18.5 .2 12.8 O.2 34.8 1.4 2.4 .1

Seed 20:1d 13 C20:2n6 C20:3m3 C22:O 20:4n3 20:53 22:33 C24:O C24:1 22:53 C22:63

1 O.O O.1 2.1 O.3 2.8 O.3 O.1 O.2 O.2 O.S 3.9 2 O.O O.1 1.9 0.4 6.9 1.O O.O O.3 O.1 1.7 9.5 3 O.O O.1 O.3 O.S 11.3 O.O O.O O.3 O.2 O.O O.O 4 O.O O.1 O.8 O.S 11.2 1.9 O.O O.2 O.2 1.7 8.7 5 O.O O.1 1.5 O.3 7.6 1.5 O.O O.1 O.1 1.8 12.2 6 O.O O.O 0.7 O.3 6.O O.O O.O O.2 O.1 O.O O.O 0.4 2.6 1.1 O.O O.3 O.3 1.7 9.9 8 O.O O.2 2.4 O.S 4.1 1.3 O.O O.2 O.2 1.8 13.8 9 O.O O.1 2.2 0.4 O.O O.O O.1 O.3 O.2 O.O O.O 10 O.O O.1 1.5 0.4 3.6 O6 O.O O.2 O.1 0.7 6.9 11 O.O O.2 O.3 0.8 4.8 O.O O.O O6 O.3 O.O O.O 12 O.O O.1 1.9 0.4 3.9 O6 O.O O.2 O.O 1.1 6.2 13 O.O O.1 5.2 0.4 2.6 O.3 O.2 O.2 O.1 0.4 3.4 14 O.O O.1 2.3 0.6 4.6 1.8 O.1 O.3 O.2 2.5 18.1

US 9,725,399 B2

TABLE 11-continued Fatty acid composition of the lipid in T2 transgenic B. napus seeds transformed with the T-DNA of the modB construct, with a presumed mutation in the A4-desaturase gene. The lipids also contained about 0.1% 14:0, 0.2% 16:3, 0.2-0.4% GLA, 0.1% 20:1A13, 0.3-0.4% 22:0, and 16:2 and 22:1 were not detected. 20:36 20:4né 20:3m3 20:4n3 20:53 22:26 22:33 24:O 24:1 22:53 22:63

CT137-2-34 O.O O.O 1.1 1.7 O.8 O.O O.1 O.1 O.1 1O.O O.O CT137-2-38 O.O O.O 1.3 2.2 O.9 O.O O.1 O2 O1 10.8 O.O CT137-2-48 O.O O.O 1.5 2.0 1.O O.O O.1 O.1 O.1 1O.S O.O CT137-2-51 O.O O.O 1.9 1.2 O.S O.O O.1 O2 O2 7.9 O.O CT137-2-59 O.O O.O 1.O 1.9 O.9 O.O O.1 O2 O1 11.O O.O

TABLE 12 Fatty acid composition of seedoil from T2 seed of B. napus transformed with the T-DNA from GA7-modB. C16:O C18:O C18:19 C18:17 C18:26 C18:36 C18:33 C2O:O C18:4m3 C2O:19C

6.3 2.4 8.4 3.1 6.9 1.1 21.9 0.7 7.5 0.7

C2O:2n6 - C21:O C2O:3m3 C20:4n3 C2O:Sm3 C22:56 C22:53 C22:63

O.1 O.S O.S O6 O.2 1.5 34.3

The seedoil samples also contained 0.1% C14:0; 0.2% C16:1; 0.1% C20:306; no C22:1 and C22:2006; 0.1% C24:0 and 0.2% C24:1, 2.6% other fatty acids. Example 5 Example 6

Analysis of TAG from Transgenic A. thaliana Assaying Sterol Content and Composition in Oils Seeds Producing DHA 30 The positional distribution of DHA on the TAG from the The phytosterols from 12 vegetable oil samples purchased transformed A. thaliana seed was determined by NMR. Total from commercial Sources in Australia were characterised by lipid was extracted from approximately 200 mg of seed by GC and GC-MS analysis as O-trimethylsilyl ether (OTMSi first crushing them under hexane before transferring the 35 crushed seed to a glass tube containing 10 mL hexane. The ether) derivatives as described in Example 1. Sterols were tube was warmed at approximately 55° C. in a water bath identified by retention data, interpretation of mass spectra and then Vortexed and centrifuged. The hexane solution was and comparison with literature and laboratory standard mass removed and the procedure repeated with a further 4x10 mL. spectral data. The sterols were quantified by use of a The extracts were combined, concentrated by rotary evapo 40 Cholan-24-ol internal standard. The basic phytosterol struc ration and the TAG in the extracted lipid purified away from polar lipids by passage through a short silica column using ture and the chemical structures of some of the identified 20 mL of 7% diethyl ether in hexane. Acyl group positional sterols are shown in FIG. 7 and Table 13. distributions on the purified TAG were determined quanti The vegetable oils analysed were from: Sesame (Sesamum tatively as previously described (Petrie et al., 2010a and b). 45 The analysis showed that the majority of the DHA in the indicum), olive (Olea europaea), Sunflower (Helianthus total seed oil was located at the sn-1/3 positions of TAG with annus), castor (Ricinus communis), canola (Brassica napus), little found at the sn-2 position (FIG. 5). This was in contrast safflower (Carthamus tinctorius), peanut (Arachis hypo to TAG from ARA producing seeds which demonstrated that 50 gaea), flax (Linum usitatissimum) and soybean (Glycine 50% of the ARA (20:4:'''') was located at the sn-2 max). In decreasing relative abundance, across all of the oil position of transgenic canola oil whereas only 33% would be samples, the major phytosterols were: B-sitosterol (range expected in a random distribution (Petrie et al., 2012). The total lipid from transgenic A. thaliana seeds was also 28-55% of total sterol content), A5-avenasterol (isoflucos analysed by triple quadrupole LC-MS to determine the 55 terol) (3-24%), campesterol (2-33%), A5-stigmasterol (0.7- major DHA-containing triacylglycerol (TAG) species (FIG. 18%), A7-stigmasterol (1-18%) and A7-avenasterol (0.1- 6). The most abundant DHA-containing TAG species was 5%). Several other minor sterols were identified, these were: found to be DHA-18:3-18:3 (TAG 58:12: nomenclature not cholesterol, brassicasterol, chalinasterol, campestanol and descriptive of positional distribution) with the second-most eburicol. Four C29:2 and two C30:2 sterols were also abundant being DHA-18:3-18:2 (TAG 58:11). Tri-DHA 60 TAG (TAG 66:18) was observed in total seed oil, albeit at detected, but further research is required to complete low but detectable levels. Other major DHA-containing identification of these minor components. In addition, sev TAG species included DHA-34:3 (TAG 56:9), DHA-36:3 eral other unidentified sterols were present in some of the (TAG 58:9), DHA-36:4 (TAG 58:10), DHA-36:7 (TAG 58:13) and DHA-38:4 (TAG 60:10). The identities of the 65 oils but due to their very low abundance, the mass spectra two major DHA-containing TAG were further confirmed by were not intense enough to enable identification of their Q-TOF MS/MS, Structures. US 9,725,399 B2 95 96 TABLE 13 IUPAC SYStematic names of identified sterols. Sterol No. Common name(s) IUPAC/Systematic name 1 cholesterol cholest-5-en-3?-ol 2 brassicasterol 24-methylcholesta-5,22E-dien-3?-ol 3 chalinasterol. 24-methylene 24-methylcholesta-5,24(28)E-dien-3?-ol cholesterol 4 campesterol. 24-methylcholesterol 24-methylcholest-5-en-3?-ol 5 campestanol/24-methylcholestanol 24-methylcholestan-3?-ol 7 A5-stigmasterol 24-ethylcholesta-5,22E-dien-3?-ol 9 ergost-7-en-3?-ol 24-methylcholest-7-en-3?-ol 11 eburicol 44,14-trimthylergosta-8.24(28)-dien 3?-ol 12 B-sitosterol/24-ethylcholesterol 24-ethylcholest-5-en-3?-ol 13 D5-avenasterol isoflucosterol 24-ethylcholesta-5,24(28)Z-dien-3? ol 19 D7-stigmasterol stigmast-7-en-3b-ol 24-ethylcholest-7-en-3?-ol 20 D7-avenasterol 24-ethylcholesta 7.24(28)-dien-3?-ol

The sterol contents expressed as mg/g of oil in decreasing sterol contents, suggesting that processing and refining had amount were: canola oil (6.8 mg/g), Sesame oil (5.8 mg/g), little effect on these two parameters. The sterol content flax oil (4.8–5.2 mg/g), Sunflower oil (3.7-4.1 mg/g), peanut among the samples varied three-fold and ranged from 1.9 oil (3.2 mg/g), safflower oil (3.0 mg/g), soybean oil (3.0 mg/g to 6.8 mg/g. Canola oil had the highest and castor oil mg/g), olive oil (2.4 mg/g), castor oil (1.9 mg/g). The % 25 the lowest sterol content. sterol compositions and total sterol content are presented in Table 14. Example 7 Among all the seed oil samples, the major phytosterol was generally B-sitosterol (range 30-57% of total sterol content). Increasing Accumulation of DHA at the sn-2 TAG There was a wide range amongst the oils in the proportions so Position of the other major sterols: campesterol (2-17%), A5-stig masterol (0.7-18%), A5-avenasterol A7-stigmasterol The present inventors considered that DHA and/or DPA (1-18%). Oils from different species had a different sterol accumulation at the Sn-2 position in TAG could be increased profile with some having quite distinctive profiles. In the by co-expressing an 1-acyl-glycerol-3-phosphate acyltrans case of canola oil, it had the highest proportion of campes: ferase (LPAAT) together with the DHA or DPA biosynthesis terol (33.6%), while the other species samples generally had pathway such as conferred by the GA7 construct or its lower levels, e.g. up to 17% in peanut oil. Safflower oil had variants. Preferred LPAATs are those which can act on a relatively high proportion of A7-stigmasterol (18%), while polyunsaturated C22 fatty acyl-CoA as substrate, preferably this sterol was usually low in the other species oils, up to 9% DHA-CoA and/or DPA-CoA, resulting in increased inser in sunflower oil. Because they were distinctive for each tion of the polyunsaturated C22 chain at the sn-2 position of species, sterol profiles can therefore be used to help in the 40 LPA to form PA, relative to the endogenous LPAAT. Cyto identification of specific vegetable or plant oils and to check plasmic LPAAT enzymes often display varied substrate their genuineness or adulteration with other oils. preferences, particularly where the species synthesises and Two samples each of sunflower and safflower were com- accumulates unusual fatty acids in TAG. A LPAAT2 from pared, in each case one was produced by cold pressing of Limnanthes douglasii was shown to use erucoyl-CoA (C22: seeds and unrefined, while the other was not cold-pressed 45 1-CoA) as a substrate for PA synthesis, in contrast to an and refined. Although some differences were observed, the LPAAT 1 from the same species that could not utilise the C22 two sources of oils had similar sterol compositions and total substrate (Brown et al., 2002). TABLE 1.4 Sterol content and composition of assayed plant oils.

Sun- Saf flower flower Sterol Sterol common Sun- cold- Saf- cold- Flax Flax Soy number name Sesame Olive flower pressed Castor Canola flower pressed Peanut (linseed) (linseed) bean 1 cholesterol O.2 O.8 O.2 O.O O.1 O.3 O.2 O.1 O.2 0.4 0.4 O.2 2 brassicasterol O.1 O.O O.O O.O O.3 O.1 O.O O.O O.O O.2 O.2 O.O 3 chalinasterol. 24- 1.5 O.1 O.3 O.1 1.1 2.4 O.2 O.1 O.9 1.5 1.4 O.8 methylene cholesterol 4 campesterol. 24- 16.2 2.4 7.4 7.9 8.4 33.6 12.1 8.5 17.4 15.7 14.4 16.9 methylcholesterol 5 campestanol 24- 0.7 O.3 O.3 O.1 O.9 O.2 O.8 O.8 O.3 O.2 O.2 0.7 methylcholestanol 6 C29:2: O.O O.O O.1 O.2 O.O O.1 O.S O.S O.O 1.2 1.3 O.1 7 A5-stigmasterol 6.4 1.2 7.4 7.2 18.6 0.7 7.0 4.6 6.9 S.1 5.8 17.6 8 unknown O.S 1.3 0.7 O6 O.8 0.7 0.7 1.3 0.4 0.7 O6 1.3 9 ergost-7-en-3?-ol O.1 O.1 1.9 1.8 O.2 0.4 2.7 4.0 1.4 1.4 1.4 1.O 10 unknown O.O 1.3 O.9 O.8 1.2 O.9 1.8 0.7 1.2 0.7 O.S 0.7 US 9,725,399 B2 97 98 TABLE 14-continued Sterol content and composition of assayed plant oils.

Sun Saf flower flower Sterol Sterol common Sun- cold Saf- cold- Flax Flax Soy number name Sesame Olive flower pressed Castor Canola flower pressed Peanut (linseed) (linseed) bean 11 eburicol 1.6 1.8 4.1 4.4 1.S 1.O 1.9 2.9 1.2 3.5 3.3 O.9 12 B-sitosterol/24- 55.3 45.6 43.9 43.6 37.7 SO.8 40.2 35.1 57.2 29.9 28.4 40.2 ethylcholesterol 13 A5-avenasterol 8.6 16.9 7.2 4.1 19.3 4.4 7.3 6.3 5.3 23.0 24.2 3.3 isoflucosterol 14 triterpenoid O.O 2.4 O.9 1.1 O.O O.O 1.6 1.9 O.O O.O O.O O.9 alcohol 15 triterpenoid O.O O.O 0.7 O6 O.O O.O 2.8 1.8 O.O O.O O.3 O.O alcohol 16 C29:2: O.O O.S 0.7 0.7 1.S 1.2 2.8 1.9 2.0 1.O 0.7 O.S 17 C29:2: 1.O O.9 2.3 2.4 O.6 0.4 1.3 1.9 O.9 1.O 1.O 1.O 18 C30:28 O.O O.O O.O O.O 1.9 O.O O.O O.O O.O O.O O.O O.O 19 A7-stigmasterol 2.2 7.1 9.3 10.9 2.3 O.9 1O.S 18.3 1.1 7.9 8.7 S.6 Stigmast-7-en-33 ol 2O A7-avenasterol 1.3 O.1 4.0 3.6 O.6 O.2 2.O 4.7 0.7 0.4 0.4 O6 21 unknown 0.7 7.1 O.9 O.8 O.O 0.4 O.3 0.4 O.O 3.0 3.6 O.O 22 unknown O.3 O.O O.3 O.9 O.O O.O 1.2 1.3 O.2 O.1 O.O O.3 23 unknown O.2 O.2 O.3 O.3 O.2 O.1 O.3 O.2 O.2 O.1 O.2 O.S 24 unknown O.O 3.1 O.9 1.3 O.6 0.4 O.2 0.4 0.7 1.7 1.9 O.8 25 unknown O.9 0.4 O.3 O.S O.3 O.1 O.S 0.7 O.3 O.1 O.1 O6 26 C30:2 2.2 6.O 4.6 5.7 1.4 O6 1.O 1.2 1.2 1.2 1.1 5.2 27 unknown O.O 0.4 0.4 O.3 O.3 O.2 O.1 O.2 O.3 O.1 O.O O.3

Sum 1OO.O 1OOO 100.O 1OOO 1OO.O 1OOO 1OO.O 1OOO 1OOO 1OOO 1OO.O 1OOO Total sterol (mg/g 5.8 2.4 4.1 3.7 1.9 6.8 3.2 3.0 3.2 4.8 5.2 3.0 oil) C29:2* and and C30:2* denotes a C29 sterol with two double bonds and a C30 sterol with two double bonds, respectively

Known LPAATs were considered and a number were sis LPAAT2 as a BLAST query sequence. Several candidate selected for testing, including some which were not sequences emerged and the sequence XP 002501997 was expected to increase DHA incorporation at the Sn-2 position, 35 synthesised for testing on C22 LC-PUFA. The Ricinus as controls. The known LPAATs included: Arabidopsis communis LPAAT was annotated as a putative LPAAT in the thaliana LPAAT2: (SEQ ID NO: 40, Accession No. castor genome sequence (Chan et al., 2010). Four candidate ABG48392, Kim et al., 2005), Limnanthes alba LPAAT LPAATs from the castor genome were synthesised and tested (SEQ ID NO: 41, Accession No. AAC49185, Lassner et al., in crude leaf lysates of infiltrated N. benthamiana leaf tissue. 1995), Saccharomyces cerevisiae Skip (SEQ ID NO: 42, 40 The candidate sequence described here showed LPAAT Accession No. NP 010231, Zou et al., 1997), Mortierella activity. alpina LPAAT1 (SEQ ID NO: 44, Accession No. A number of candidate LPAATs were aligned with known AED33305; U.S. Pat. No. 7,879,591) and Brassica napus LPAATs on a phylogenetic tree (FIG. 8). It was noted that LPAATs (SEQ ID NO: 45 and SEQ ID NO:46, Accession the putative Micromonas LPAAT did not cluster with the Nos ADC97479 and ADC97478 respectively). 45 putative C22 LPAATs but was a divergent sequence. The Arabidopsis LPAAT2 (also designated LPAT2) is an As an initial test of various LPAATs for their ability to use endoplasmic reticulum-localised enzyme shown to have DHA-CoA as Substrate, chimeric genetic constructs were activity on C16 and C18 substrates, however activity on C20 made for constitutive expression of exogenous LPAATs in or C22 substrates was not tested (Kim et al., 2005). Lim N. benthamiana leaves, each under the control of the 35S nanthes alba LPAAT2 was demonstrated to insert a C22:1 50 promoter, as follows: 35S: Arath-LPAAT2 (Arabidopsis ER acyl chain into the sn-2 position of PA, although the ability LPAAT): 35S:Limal-LPAAT (Limnanthes alba LPAAT): to use DHA or DPA as a substrate was not tested (Lassner 35S:Sacce-Slclp (S. cerevisiae LPAAT): 35S:Micpu et al., 1995). The selected S. cerevisiae LPAAT Slclp was LPAAT (Micromonas pusilla LPAAT): 35S:Moral-LPAAT1 shown to have activity using 22:1-CoA in addition to (Mortierella alpina LPAAT): 35S:Brana-LPAAT1.13 (Bras 18:1-CoA as Substrates, indicating a broad Substrate speci sica napus LPAAT1.13): 35S:Brana-LPAAT1.5 (Brassica ficity with respect to chain Length (Zou et al., 1997). Again, 55 napus LPAAT1.5). A 35S:p 19 construct lacking an exog DHA-CoA, DPA-CoA and other LC-PUFAs were not tested enous LPAAT was used as a control in the experiment. Each as substrates. The Mortierella LPAAT had previously been of these constructs was introduced via Agrobacterium into shown to have activity on EPA and DHA fatty acid sub N. benthamiana leaves as described in Example 1, and 5 strates in transgenic Yarrowia lipolytica (U.S. Pat. No. days after infiltration, the treated leaf Zones were excised 7,879,591) but its activity in plant cells was unknown. 60 and ground to make leaf lysates. Each lysate included the Additional LPAATs were identified by the inventors. exogenous LPAAT as well as the endogenous enzymes for Micromonas pusilla is a microalga that produces and accu synthesizing LPA. In vitro reactions were set up by sepa mulates DHA in its oil, although the positional distribution rately adding "C-labelled-OA and -DHA to the lysates. of the DHA on TAG in this species has not been confirmed. Reactions were incubated at 25° C. and the level of incor The Micromonas pusilla LPAAT (SEQ ID NO: 43, Acces 65 poration of the ''C labelled fatty acids into PA determined sion No. XP 002501997) was identified by searching the by TLC. The ability of each LPAAT to use DHA relative to Micromonas pusilla genomic sequence using the Arabidop ARA and the C18 fatty acids were assessed. The meadow US 9,725,399 B2 99 100 foam (Limnanthes alba), Mortierella and Saccharomyces formed with the Cnl1::Moral-LPAAT vector were harvested LPAATs were found to have activity on DHA substrate, with and oil extracted from the seed. The TAG fraction was then radiolabelled PA appearing for these but not the other isolated from the extracted oil by TLC methods and recov ered from the TLC plate. These TAG samples and samples LPAATs. All LPAATs were confirmed active by the oleic of the seedoil prior to the fractionation were analysed by acid control feed. digestion with Rhizopus lipase to determine the positional To test LPAAT activity in seeds, several of the protein distribution of the DHA. The lipase is specific for acyl coding sequences or LPAATs were inserted into a binary groups esterified at the sn-1 or sn-3 position of TAG. This vector under the control of a conlinin (pLuCnll) promoter. was performed by emulsifying each lipid sample in 5% gum The resultant genetic constructs containing the chimeric arabic using an ultrasonicator, adding the Rhizopus lipase genes, Cnl1:Arath-LPAAT (negative control), Cnl1:Limal solution in 0.1M Tris-HCl pH 7.7 containing 5 mM CaCl2 LPAAT, Cnl:Sacce-Slclp, and Cnl1:Moral-LPAAT, respec and incubating the mixtures at 30° C. with continuous tively, are then used to transform A. thaliana plants produc shaking. Each reaction was stopped by adding chloroform: ing DHA in their seed to generate stable transformants methanol (2/1, v/v) and one volume of 0.1M KCl to each expressing the LPAATs and the transgenic DHA pathway in mixture. The lipid was extracted into the chloroform fraction a seed-specific manner to test whether there would be an 15 and the relative amounts determined of the sn-2 MAG, increased incorporation of DHA at the sn-2 position of TAG. sn-1/3 FFA, DAG and TAG components of the resulting The constructs are also used to transform B. napus and C. lipid by separation on 2.3% boric acid impregnated TLC saliva plants that already contain the GA7 construct and using hexane/diethylether/acetic acid (50/50/1, V/v). Lipid variants thereof (Examples 2 to 4) to generate progeny bands were visualized by spraying 0.01% primuline in carrying both the parental and LPAAT genetic constructs. acetone/water (80/20, v/v) onto the TLC plate and visuali Increased incorporation of DHA at the sn-2 position of TAG sation under UV light. Individual lipid bands were identified is tested relative to the incorporation in plants lacking the on the basis of lipid standard spots, resolved on the same LPAAT encoding transgenes. Oil content is also improved in TLC plate. TLC lipid bands were collected into glass vials the seeds, particularly for seeds producing higher levels of and their fatty acid methyl esters were prepared using 1N DHA, counteracting the trend seen in Arabidopsis seed as methanolic-HCl (Supelco) and incubating at 80° C. for 2 h. described in Example 2. 25 Fatty acid composition of individual lipids were analysed by The 35S:Moral-LPAAT1 construct was used to transform G.C. an already transgenic Arabidopsis thaliana line which was This assay demonstrated that the DHA in the parental homozygous for the T-DNA from the GA7 construct and seeds transformed with the GA7 (lines 22-2-1-1 and 22-2- whose seed contained approximately 15% DHA in seed 38-7) was preferentially esterified at the sn-1 or sn-3 posi lipids (Petrie et al., 2012). For this, use was made of the 30 tion of the TAG. In contrast, the DHA in the NY11 and kanamycin selectable marker gene in the 35S:Moral NY 15 seed transformed with both the GA7 constructs and LPAAT1 construct which was different to the bar selectable the transgene encoding LPAAT was enriched at the Sn-2 marker gene already present in the transgenic line. Trans position, with 35% of the DHA in one of the lines and 48% genic seedlings were selected which were resistant to of the DHA in the other line being esterified at the sn-2 kanamycin and grown to maturity in a glasshouse. T2 seeds position of TAG i.e. after lipase digestion the DHA was were harvested and the fatty acid composition of their total 35 present as sn-2-MAG (Table 16). Analogous results are seed lipids analysed by GC (Table 15). Three phenotypes obtained for B. napus and B. juncea seeds transformed with were observed amongst the 33 independently transformed both the T-DNA from the GA7-modB construct and the lines. In a first group (6/33 lines), DPA increased signifi LPAAT-encoding gene and producing DHA. cantly to a level substantially greater than the level of DHA. In order to determine whether the Mortierella LPAAT or up to about 10.6% of total seed Lipids. This came at the 40 another LPAAT had preference for either DPA-CoA or expense of DHA which was strongly decreased in this group DHA-CoA, in vitro reactions are set up by separately adding of lines. In two of the lines in this first group, the sum of "C-labelled-DPA-CoA or -DHA-CoA to lysates of N. ben DPA+DHA was reduced, but not in the other 4 lines. In a thamiana leaves transiently expressing the candidate second group (5/33), the levels of DPA and DHA were about LPAAT under control of a constitutive promoter as described equal, with the sum of DPA+DHA about the same as for the 45 above. Reactions are incubated at 25° C. and the level of parental seed. In the third group, the levels of DPA and DHA incorporation of the ''C labelled fatty acids into PA deter were similar to those in the parental seeds. One possible mined by TLC analysis of the lipids. The ability of each explanation for the increased level of DPA in the first and LPAAT to use DHA-CoA relative to DPA-CoA is assessed. second groups is that the LPAAT out-competes the A4-de Genes encoding LPAATs which are confirmed to have good saturase for DPA-CoA substrate and preferentially incorpo 50 DHA incorporating LPAAT activity are used to produced rates the DPA into PA and thence into TAG, relative to the transformed DHA-producing canola plants and seed. A4-desaturation. A second possible explanation is that the Genes encoding LPAATs which have strong activity using A4-desaturation is partially inhibited. DPA-CoA are used to transform DPA-producing plants and Seed from the Arabidopsis plants transformed with the seed, to increase the amount of DPA esterified at the sn-2 T-DNA of the GA7 construct which had been further trans position of TAG. TABLE 1.5 Fatty acid composition (% of total fatty acids) of transgenic A. thaliana seeds transformed with an LPAAT1 construct as well as the GA7 construct for DHA production. C16:0 C18:0 C18:1 C18:1d 11 C18:2 C18:3n6 C18:3m3 C20:0 18:4n3 C20:1d 11 20:1d 13

NY-1 9.3 3.2 9.1 6.8 9.4 0.5 23.8 1.6 4.1 7.9 5.1 NY-2 10.7 3.3 6.5 4.4 7.6 0.3 28.1 1.9 4.3 8.5 3.7 NY-3 9.3 2.8 6.3 3.4 10.3 O.2 32.8 2.2 2.7 6.2 3.6 NY-4 11.4 3.5 4.5 3.1 7.0 O.3 32.5 2.1 4.7 5.5 2.3 NY.5 14.6 4.5 7.0 7.7 6.7 O.3 20.7 2.2 5.7 5.4 4.8 NY.6 7.8 2.7 12.5 2.2 18.0 0.1 24.9 1.8 0.7 15.5 3.1

US 9,725,399 B2 103 104 TABLE 16-continued Presence of DHA at the Sn-2 position of TAG in the lipid fromtransgenic A. thaliana seeds transformed with Cnl1:Moral-LPAAT vector as well as the T-DNA of the GA7 construct, relative to the presence of DHA in TAG. The TAG and Sn-2 MAG fatty acid compositions also contained 0-0.4% each of 14:0, 16:1 wil3t, 16:2, 16:3, 22:0, and 24:0. 22-2-38-7 1O.O O.2 3.7 6.O 2.7 6.4 0.4 33.8 1.6 3.7 11.3 1.8 O.8 oil 2-MAG O.S O.1 O.3 9.7 2.4 11.1 O.6 60.0 O.1 3.6 O.3 O.1 O.1 Transformation additionally with gene encoding Mortierella alpina LPAAT

NY11- 11.O O.2 3.4 6.O 2.8 9.2 O.3 34.8 1.6 3.6 6.3 1.8 1.O TAG 2-MAG 0.7 O.1 O.2 6.7 1.1 11.8 O.3 49.8 O.2 3.7 O.S 1.5 O.3 NY-1S-oil 11.O O.O 3.3 4.6 2.8 6.9 O.3 33.6 2.0 S.1 5.5 2.1 O.9 2-MAG O.8 O.1 O.3 6.4 1.3 11.4 O.3 SO.2 O.2 4.9 0.4 1.4 O.2 Sample C20:3nó C20:4nó C20:3n3 20:4n3 C22:1 20:5n3 C22:4nó 22:5né 22:4n3 22:5n3 C22:6n3

22-2-1-1 O.1 O.1 1.3 1.O O6 2.1 O.O 0.7 10.1 TAG 2-MAG O.O O.O O.3 O.2 O.O 3.8 O.O 2.3 9.1 DHA at Sn-2 = 30% 22-2-38-7 1.3 O.9 O6 1.2 O.1 0.7 11.6 oil 2-MAG O.O O.O 0.4 O.2 O.O 2.1 O.1 1.3 6.7 DHA at Sn-2 = 1.9% Transformation additionally with gene encoding Mortierella alpina LPAAT

NY11- O.O O.O 1.8 0.7 O6 O.9 O.O O.1 O.6 12.2 TAG 2-MAG O.O O.O 1.6 O6 O.1 O.8 O.1 O.2 1.6 17.8 DHA at Sn-2 = 4.8% NY-1S-oil O.O O.O 1.9 0.7 O6 O.9 O.1 0.4 O.9 14.9 2-MAG O.O O.O 1.5 O6 O.1 O.9 O.O O.O O.2 1.6 16.7 DHA at Sn-2 = 37%

Example 8 tion. The meal was then removed by filtration and the combined extracts rotary evaporated. The pooled CM total Further Analysis of Transgenic Camelina sativa 35 crude lipid extracts were then dissolved using a one-phase Seeds methanol-chloroform-water mix (2:1:0.8 V/v/v). The phases were separated by the addition of chloroform-water (final Total Lipid Content solvent ratio, 1:1:0.9 V/v/v methanol-chloroform-water). C. sativa seed which was homozygous for the T-DNA The purified lipid in each extract was partitioned in the lower from the GA7 construct and containing DHA in its total fatty 40 chloroform phase, concentrated using rotary evaporation acid content was analysed for its total lipid content and and constituted the polar lipid-rich CM extracts. The lipid composition as follows. Two consecutive solvent extraction content in each of these extracts was determined gravimetri steps were performed on the seeds, firstly using hexane and cally. secondly using chloroform/methanol. No antioxidants were For fatty acid compositional analysis, aliquots of the added during the extractions or analysis. The Soxhlet extrac 45 hexane and CM extracts were trans-methylated according to tion method which is commonly used to extract seed lipids the method of Christie et al. (1982) to produce fatty acid by prolonged heating and refluxing of the lipid/solvent methyl esters (FAME) using methanol-chloroform-conc, mixture was not used here because of the potential for hydrochloric acid (3 mL, 10:1:1, 80° C., 2 h). FAME were degradation or oxidation of the co3 PUFA such as DHA. extracted into hexane-chloroform (4:1, 3x1.8 mL). Samples Hexane was used as the solvent in the first extraction since 50 of the remaining seed meal (1-2 g) after the hexane and CM it is the industry standard for oilseeds. Also, it preferentially extractions were also trans-methylated to measure any extracts TAG-containing oil due to its solvating properties residual lipid as FAME by gravimetry. The total lipid content and its relatively poor Solubilization of polar lipids, particu of the seeds was calculated by adding the lipid contents of larly at room temperature. Transformed and control Cam the hexane and CM extracts and the FAME content of the elina seeds (130 g and 30 g, respectively) were wetted with 55 transmethylated meal after solvent extraction. hexane and crushed using an electric agate mortar and pestle The transgenic seeds contained slightly less total lipid at (Retsch Muhle, Germany). The mixtures were transferred to 36.2% of seed weight compared to the wild-type Camelina separatory funnels and extracted four times using a total of saliva seeds at 40.9% of seed weight. For seeds including 800 mL hexane, including an overnight static extraction for oilseeds, the total lipid was determined as the sum of solvent the third extraction. For each extraction, extracts were 60 extractable lipid obtained by consecutive extractions with filtered to remove fines through a GFC glass fiber filter under hexane, then chloroform-methanol, plus the residual lipid vacuum, and then rotary evaporated at 40°C. under vacuum. released by transmethylation of the extracted meal after the The extracts were pooled and constituted the TAG-rich solvent extractions, as exemplified herein. This total lipid hexane extracts. consisted mainly of fatty acid containing lipids such as Following extraction with hexane, the remaining seed 65 triacylglycerols and polar lipids and Small amounts of non meals were further extracted using chloroform-methanol fatty acid lipids e.g. phytosterols and fatty alcohols which (CM, 1:1 V/v) using the procedure as for the hexane extrac may be present in the free unesterified form or esterified with US 9,725,399 B2 105 106 fatty acids. In addition, any sterol esters or wax esters and the TAG fraction. This was because more than 90% of the hydrocarbons such as carotenoids, for example B-carotene, total lipids present in the seed occurred in the form of TAG. were also included in the solvent extractable lipid if present. The fatty acid composition of the different lipid classes in These were included in the overall gravimetric determina the hexane and CM extracts was determined by gas chro tion and were indicated in the TLC-FID analysis (Table 17). matography (GC) and GC-MS analysis using an Agilent Of the total lipid, 31%-38% of lipid per seed weight was Technologies 6890AGC instrument (Palo Alto, Calif., USA) extracted by hexane for the transgenic and control seeds, fitted with a Supelco Equity TM-1 fused silica capillary col respectively, which accounted for 86% and 92% of the total umn (15 mx0.1 mm i.d., 0.1 um film thickness, Bellefont, lipid in the seeds. The CM extraction recovered a further Pa., USA), an FID, a split/splitless injector and an Agilent 4.8% and 2.4% (of seed weight) mostly polar lipid-rich 10 Technologies 7683B Series auto sampler and injector. extract from the transgenic and control seeds, respectively. Helium was the carrier gas. Samples were injected in The residual lipid released by transmethylation of the split-less mode at an oven temperature of 120° C. After remaining solvent extracted oilseed meal was 0.3% and injection, the oven temperature was raised to 270° C. at 10° 0.4% of seed weight, respectively. That is, the first and C. min' and finally to 300° C. at 5° C. min'. Eluted second solvent extractions together extracted 99% of the 15 compounds were quantified with Agilent Technologies total lipid content of the seeds (i.e. of the 36.2% or 40.9% ChemStation software (Palo Alto, Calif., USA). GC results of the seed weight, which was mostly fatty acid containing were subject to an error of not more than +5% of individual lipid Such as triglycerides and polar lipids consisting of component areas. glyco- and phospholipids (see next section Lipid class analysis)). TABLE 17 Lipid Class Analysis Lipid class composition (% of total lipid obtained for each Lipid classes in the hexane and CM extracts were ana extraction step) of hexane and CM extracts from transgenic lyzed by thin-layer chromatography with flame-ionization and control Cameina sativa seeds. SE, WE and HC were detection (TLC-FID; Iatroscan Mark V. Iatron Laboratories, not separated from each other. Tokyo, Japan) using hexane? diethyl ether/glacial acetic acid 25 (70:10:0.1, V/v/v) as the developing solvent system in com Transgenic Control bination with Chromarod S-III silica on quartz rods. Suitable seeds seeds calibration curves were prepared using representative stan Lipid class Hexane CM Hexane CM dards obtained from Nu-Chek Prep, Inc. (Elysian, Minn., SEWEHC: 1.O 1.4 1.O 1.4 30 USA). Data were processed using SIC-480II software (SISC TAG 95.6 44.2 96.O 13.1 Version: 7.0-E). Phospholipid species were separated by FFA O.9 1.3 O.8 1.4 applying the purified phospholipid fraction obtained from UN: 3 O.9 1.1 O.8 1.2 silica column chromatography and developing the rods in ST O.S 0.7 0.4 0.4 MAG 0.7 1.1 O.8 6.2 chloroform/methanol/glacial acetic acid/water (85:17:5:2. PL O.3 S.O.3 O.3 76.3 V/v/v) prior to FID detection. 35 To separate TAG, glycolipid and phospholipid fractions Total 1OOO 1OOO 1OO.O 1OO.O from the CM extracts, silica gel 60 (100-200 mesh) (0.3-1 g) Abbreviations: in a short glass column or Pasteur pipette plugged with glass sterol esters (SE), wool was used to purify 10 mg of the purified CM lipid wax esters (WE). extract. The residual TAG fraction in the CM extract was 40 hydrocarbons (HC), triacylglycerols (TAG), eluted using 20 mL of 10% diethyl ether in hexane, the free fatty acids (FFA), glycolipids eluted with 20 mL of acetone and the phospho unknown (UN), lipids eluted in two steps, first 10 mL of methanol then 10 sterols (ST), mL of methanol-chloroform-water (5:3:2). This second elu monoacylglycerols (MAG), tion increased the recovery of phospholipids. The yield of 45 polar lipids (PL) consisting of glycolipids and phospholipids; *SE, WE and HC co-elute with this system; each fraction was determined gravimetrically and the purity **May contain fatty alcohols and diacylglycerols (DAG). checked by TLC-FID. All extracts and fractions were stored in dichloromethane at -20°C. until further analysis by GC GC-mass spectrometric (GC-MS) analyses were per and GC-MS. formed on a Finnigan Trace ultra Quadrupole GC-MS The TAG-rich hexane extracts from each of the transgenic 50 (model: ThermoQuest Trace DSQ, Thermo Electron Corpo and control seeds contained about 96%. TAG. The CM ration). Data were processed with ThermoQuest Xcalibur extracts contained residual TAG amounting to 44% and 13% software (Austin, Tex., USA). The GC was fitted with an by weight of the CM extracts, respectively, for the transgenic on-column injector and a capillary HP-5 Ultra Agilient J & and wild-type seeds. In contrast to the hexane extracts, the W column (50 mx0.32 mm i.d., 0.17 um film thickness, CM extracts were rich in polar lipids, namely phospholipids 55 Agilent Technologies, Santa Clara, Calif., USA) of similar and glycolipids, amounting to 50% and 76% by weight of polarity to that described above. Individual components the CM extracts, respectively, for the transgenic and control were identified using mass spectral data and by comparing seeds (Table 17). The main phospholipid was phosphatidyl retention time data with those obtained for authentic and choline (PC) and accounted for 70%-79% of the total laboratory standards. A full procedural blank analysis was phospholipids followed by phosphatidyl ethanolamine (PE, 60 performed concurrent to the sample batch. 7%-13%) with relatively low levels of phosphatidic acid The data for the fatty acid composition in the different (PA, 2%-5%) and phosphatidyl serine (PS, <2%). lipid classes in the extracts are shown in Table 18. In the Fatty Acid Composition DHA-producing Camelina seed, the DHA was distributed in Generally for seeds producing DHA and/or DPA, the the major lipid fractions (TAG, phospholipids and glycolip inventors observed that the fatty acid composition of the 65 ids) at a proportion ranging between 1.6% and 6.8% with an total lipids in the seeds as determined by direct transmeth inverse relationship between the proportions of DHA and ylation of all of the lipid in the seed was similar to that of ALA. The TAG-rich hexane extract from the transgenic seed US 9,725,399 B2 107 108 contained 6.8% DHA and 41% ALA (Table 18). The polar (BSTFA, Sigma-Aldrich) by heating for 2 h at 80° C. in a lipid-rich CM extract contained 4.2% DHA and 50% ALA sealed GC vial. By this method, free hydroxyl groups were i.e. relatively less DHA and more ALA. Residual TAG from converted to their trimethylsilyl ethers. The sterol- and the polar lipid-rich CM extract contained 6% DHA and 40% alcohol-OTMSi derivatives were dried under a stream of ALA, The glycolipid fraction isolated from the CM extract 5 nitrogen gas on a heating block (40°C.) and re-dissolved in contained 3% DHA and 39% ALA and the phospholipid dichloromethane (DCM) immediately prior to GC/GC-MS fraction contained the lowest level of DHA (1.6%) and the analysis as described above. TABLE 1.8 Fatty acid composition (% of total fatty acids) of lipid extracts and fractions of transgenic and control C. Saiva seeds. Transgenic seeds Control seeds

Hexane CM Meal Hexane CM Meal

Fatty acid TAG Total TAG GL PL Residue TAG Total TAG GL PL Residue 16:17 O.1 O.2 0.1 O2 O1 O.2 O.1 O.2 0.2 — O.3 16:O 6.2 12.8 6.8. 21.3 194 10.4 6.7 12.8 7.8. 29.6 13.7 10.3 18:403 3.7 3.3 3.4 2.1 2.9 3.6 18:26 7.1 3.9 8.8 7.2 3.7 8.8 22.2 28.4 29.4 20.8. 29.3 27.9 18:303 41.9 S.O.3 39.9 38.6 54.1 38.9 32.O 20.6 19.7 13.0 12.3 2O.O 18:19 11.1 4.7 9.6 7.2 2.8 8.1 14.0 25.4 13.3 14.7 35.7 14.3 18:17 1.4 2.3 2.1 3.7 3.4 2.8 1.O 1.5 2.2 4.O 2.8 2.2 18:0 3.2 4.0 3.0 4.5 5.7 3.1 3.0 2.7 2.9 5.7 3.6 2.7 20:53 0.4 O.2 0.3 — O.3 20:40)3 0.4 0.4 0.4 — O.2 O.3 20:26 0.7 0.7 0.8 O6 O.4 0.7 1.8 O.8 2.1 1.2 — 1.8 20:303 O.8 1.2 O.9 O.6 1.3 O.S O.9 0.3 — 0.4 20:109.11 11.6 6.1 10.9 S.1 1.3 8.4 12.5 3.O 111 4.2 1.7 9.4 20:17 O6 O.8 14 O. 6 O2 1.1 O6 O6 2.O 1.3 — 1.8 20:0 1.3 O.8 14 O.6 0.1 1.4 1.5 0.7 2.O 1.4 — 1.8 22:63 6.8 4.2 6.1 3.0 1.6 5.4 22:53 O.3 1.1 0.4 0.6 1.4 O.3 22:109 1.3 1.O 1.8 O6 O1 1.5 2.7 0.7 3.6 0.9 — 2.9 22:0 O.3 O.2 O.3 O6 O1 0.7 O.3 O.2 0.7 0.8 — O.8 24:109 O.3 0.4 0.4 0.6 0.3 O6 O.3 O6 0.7 O.9 .5 1.O 24:O O.1 0.4 O.2 O.9 O.4 1.1 O.1 O4 O.S 1.4 0.4 1.3 others * 0.4 1.O 1.O 14 O.S 1.8 O.3 1.1 O.9 O.1 1.1

Total 100 100 1OO 100 100 100 100 1OO 100 100 100 100 Abbreviations: triacylglycerols (TAG), glycolipids (GL), phospholipids (PL); Total; polar lipid-rich extract containing GL and PL from CM extraction; TAG, GL and PL were separated by silica column chromatography of the CM extracts; * Sum of minor fatty acids 40 highest levels of ALA (54%). The transgenic Camelina seed The major sterols in both the transgenic and control seeds contained higher levels of ALA and lower levels of LA were 24-ethylcholesterol (sitosterol, 43%-54% of the total (linoleic acid, 18:2c)6) compared with the control seeds in sterols), 24-methylcholesterol (campesterol, 20%-26%) the major lipid classes (TAG, glycolipids and phospholip 45 with lower levels of cholesterol (5%-8%), brassicasterol ids). The proportions of ALA and LA were: ALA 39%-54% (2%-7%), isoflucosterol (A5-avenasterol, 4%–6%), stigmas and LA 4%–9% for transgenic seeds and ALA 12%-32% and terol (0.5%-3%), cholest-7-en-3 B-ol, (0.2%-0.5%), LA 20%-29% for control seeds. The relative level of erucic 24-methylcholestanol (campestanol, 0.4%-1%) and 24-de acid (22:1 (09) was lower in all fractions in the transgenic hydrocholesterol (0.5%-2%) (Table 19). These nine sterols seeds than in the control seeds, for example, in the hexane 50 accounted for 86%-95% of the total sterols, with the remain extracts 1.3% versus 2.7% (Table 18). ing components being sterols only partially identified for the Sterol Composition in the Seeds numbers of carbons and double bonds. The overall sterol To determine the sterol content and composition in the profiles were similar between the transgenic and control extracted lipids, Samples of approximately 10 mg total lipid seeds for both the hexane and CM extracts. from the TAG-rich hexane extract and the polar lipid-rich 55 Fatty Alcohol Analysis CM extract were saponified using 4 mL 5% KOH in 80% Fatty alcohols in the extracts were derivatised and ana MeOH and heated for 2 h at 80° C. in a Teflon-lined lysed as for the sterols. A series of fatty alcohols from screw-capped glass test tube. After the reaction mixtures C-C, with accompanying iso-branched fatty alcohols, were cooled, 2 mL of Milli-Q water was added and the were identified in both the hexane and CM extracts. Similar sterols and alcohols were extracted three times into 2 mL of 60 profiles were observed for the transgenic and control seeds, hexane:dichloromethane (4:1. V/v) by shaking and Vortex with some variation in the proportions of individual com ing. The mixtures were centrifuged and each extract in the ponents observed. Phytol, derived from chlorophyll, was the organic phase was washed with 2 mL of Milli-Q water by major aliphatic alcohol and accounted for 47% and 37% of shaking and centrifugation. After taking off the top sterol the total fatty alcohols in the hexane fractions in the trans containing organic layer, the solvent was evaporated using a 65 genic and control seeds, respectively. The odd-chain alco stream of nitrogen gas and the sterols and alcohols silylated hols were present at higher levels in the CM extract (37%– using 200 uL of Bis(trimethylsilyl)-trifluoroacetamide 38% of the total fatty alcohol content) than in the hexane US 9,725,399 B2 109 110 extract (16%-23%). Iso-17:0 (16%-38%) predominated over Example 9 17:0 (0.3%-5.7%). Another odd-chain alcohol present was 19:0 (4.5%-6.5%). Other alcohols detected included iso-16: Production of LC-PUFA in Brassica juncea Seeds 0, 16:0, iso-18:0, 18:1, 18:0, with minor levels of iso-20:0, 20:1, 20:0, iso-22:0, 22:1 and 22:0 also present. 5 Transgenic Brassica iuncea plants were produced using Discussion the GA7-modB construct (Example 4) for the production of The results indicated that crushing using a motorized DHA, as follows. B. juncea seeds of a long-daylength mortar and pestle with multiple extractions with hexane at sensitive variety were sterilized using chlorine gas as room temperature was effective in recovering most of the described by Kereszt et al. (2007). Sterilized seeds were 10 germinated on "/2 strength MS media (Murashige and Skoog. TAG-containing oil from the transgenic seeds. In addition to 1962) solidified with 0.8% agar, adjusted to pH 5.8 and the oil from the transgenic seeds containing moderate levels grown at 24°C. under fluorescent lighting (50 uE/ms) with of DHA, the transgenic seeds also had markedly higher a 16/8 hour (light/dark) photoperiod for 6-7 days. Cotyle levels of ALA in the major lipid classes (triacylglycerols, donary petioles with 2-4 mm stalk were isolated aseptically glycolipids and phospholipids) compared with the control 15 from these seedlings and used as explants. Agrobacterium seeds. This showed that the A15-desaturase activity was tumefaciens strain AGL1 was transformed with the binary considerably enhanced in the transgenic seeds during seed construct GA7. Agrobacterium culture was initiated and development. Interestingly, there were some slight differ processed for infection as described by Betide et al. (2013). ences in the fatty acid composition and proportion of DHA For all transformations, about 50 freshly-isolated cotyledon in the various extracts and fractions with the DHA levels ary petioles were infected with 10 ml of A. tumefaciens being higher in the TAG-rich hexane extract and TAG from culture for 6 minutes. The infected petioles were blotted on CM extraction (6%-6.8%) and lower in the polar lipid sterile filter paper to remove excess A. tumefaciens and fractions (3% in glycolipids and 1.6% in phospholipids). transferred to co-cultivation media (MS containing 1.5 mg/L The level of 16:0 was higher in the polar lipid fractions of BA, 0.01 mg/L NAA and 100 uM acetosyringone, also glycolipids and phospholipids in the CM extracts (19%- 25 supplemented with L-cysteine (50 mg/L), ascorbic acid (15 21%) compared with the TAG-rich hexane extract and TAG mg/L) and MES (250 mg/L). All plates were sealed with from CM extraction (6%-7%). micropore tape and incubated in the dark at 24°C. for 48 hours of co-cultivation. The explants were then transferred TABLE 19 to pre-selection medium (MS-agar containing 1.5 mg/L BA, 30 0.01 mg/L NAA, 3 mg/L AgNO, 250 mg/L cefotaxime and Sterol composition (% of total sterols) of transgenic and 50 mg/L timentin) and cultured for 4-5 days at 24°C. with control Camelina seeds. a 16/8 hour photoperiod before the explants were transferred Transgenic Control to selection medium (MS-agar containing 1.5 mg/L. BA, Seeds Seeds 0.01 mg/L NAA, 3 mg/L. AgNO, 250 mg/L cefotaxime, 50 35 mg/L timentin and 5 mg/L PPT) and cultured for 4 weeks at Hexane CM Hexane CM 24° C. with 16/8 hour photoperiod. Explants with green Sterols callus were transferred to shoot regeneration medium (MS agar containing 2.0 mg/L BA, 3 mg/L. AgNO, 250 mg/L 24-dehydrocholesterol O.8 1.8 O.S 1.4 cholesterol 5.7 7.6 4.7 7.2 cefotaxime, 50 mg/L timentin and 5 mg/L PPT) and cultured 40 brassicasterol 4.4 6.5 1.9 4.2 for another 2 weeks. Small regenerating shoot buds were cholest-7-en-3?-ol O.2 O.S O.3 0.4 transferred to hormone free MS medium (MS-agar contain campesterol 24.5 20.8 25.7 21.7 ing 3 mg/L. AgNO, 250 mg/L cefotaxime, 50 mg/L timentin campestanol 0.4 1.1 0.4 O.9 Stigmasterol 1.O 2.6 O.S 1.6 and 5 mg/L PPT) and cultured for another 2-3 weeks. sitosterol S4.3 43.7 53.8 42.9 Potential transgenic shoots of at least 1.5 cm in size were A5-avenasterol(isofucosterol) 4.2 5.2 4.7 5.5 45 isolated and transferred to root induction medium (MS-agar containing 0.5 mg/L NAA, 3 mg/L. AgNO, 250 mg/L Sum 95.5 89.6 92.6 85.9 Others cefotaxime and 50 mg/L timentin) and cultured for 2-3 UN1 C28 1b. O.6 1.2 0.7 1.2 weeks. Transgenic shoots confirmed by PCR and having UN2 C29 1b. 1.2 2.O 1.2 2.4 prolific roots were transferred to soil in a greenhouse and UN3 C29 2db O.9 1.8 1.3 2.4 50 grown under a photoperiod of 16/8 h (light/dark) at 22°C. UN4 C28 1b. O.3 O.9 O6 1.1 Three confirmed transgenic plants were obtained. The trans UNS C30 2db 1.2 1.8 1.4 1.8 formed plants were grown in the greenhouse, allowed to UN6 C29 1b - C30 2db O.3 2.7 2.2 5.2 self-fertilise, and T1 seed harvested. The fatty acid compo Sum of others 4.5 10.4 7.4 14.1 sition was analysed of the lipid from pools of T1 seeds from 55 each T0 transformed plants, which showed the presence of Total 100 100 100 100 2.8% DPA and 7.2% DHA in one line designated JT1-4, Abbreviations: whereas another line designated JT1-6 exhibited 2.6% DPA. UN denotes unknown sterol, the number after Cindicates the number of carbon atoms and Seedoil from individual T1 seeds was analysed for fatty db denotes number of double bonds acid composition; some of the data is shown in Table 20. The sterol composition of the transgenic seeds and control 60 Several T1 seeds produced DHA at a level of 10% to about seeds were similar to that found in refined Camelina oil 21% of the total fatty acid content, including JT1-4-A-13, (Shukla et al., 2002) with the same major sterols present, JT1-4-A-5, and JT1-4-13-13. Surprisingly and unexpect indicating that the added genes did not affect Sterol synthesis edly, some of the T1 seeds contained DPA at levels of 10% in the seeds. The level of cholesterol in Camelina oil was to about 18% of the total fatty acid content and no detectable higher than occurred in most vegetable oils. Brassicasterol 65 DHA (<0.1%). One possible explanation for these seeds is was present, which is a characteristic sterol found in the that the A4-desaturase gene in the T-DNA inserted in these Brassicaceae family which includes Camelina saliva. plants was inactivated, perhaps through a spontaneous muta US 9,725,399 B2 111 112 tion. T1 seeds were germinated and one emerged cotyledon seed DPA content of 18% and the single seed from this from each analysed for fatty acid composition in the remain particular segregant had a DPA content of about 26%, each ing oil. The remainder of each seedling was maintained and as a percentage of the total fatty acid content. grown to maturity to provide T2 seed. The following parameters were calculated for oil from a Transgenic plants which were homozygous for single seed having 17.9% DPA: total saturated fatty acids, 6.8%; 1-DNA insertions were identified and selected. Plants of one total monounsaturated fatty acids, 36.7%; total polyunsatu selected line designated JT1-4-17 had a single T-DNA rated fatty acids, 56.6%, total ()6 fatty acids, 7.1%; new ()6 insertion and produced DHA with only low levels of DPA, fatty acids, 0.4% of which all was GLA; total ()3 fatty acids, whereas those of a second selected line designated JT1-4-34 46.5%: new co3 fatty acids, 24.0%; ratio of total ()6:total ()3 also had a single 1-DNA insertion but produced DPA 10 fatty acids, 6.5; ratio of new co6:new co3 fatty acids, 60; the without producing DHA. The inventors concluded that the efficiency of conversion of oleic acid to LA by A12-desatu original transformant contained two separate T-DNAS, one rase, 61%; the efficiency of conversion of ALA to SDA by which conferred production of DHA and the other which A6-desaturase, 51%; the efficiency of conversion of SDA to conferred production of DPA without DHA. The B. juncea ETA acid by A6-elongase, 90%; the efficiency of conversion plants producing DHA in their seeds were crossed with the 15 of ETA to EPA by A5-desaturase, 87%; the efficiency of plants producing DPA in their seeds. The F1 progeny conversion of EPA to DPA by A5-elongase, 98%. included plants which were heterozygous for both of the In order to produce more transgenic plants in B. iuncea T-DNA insertions. Seed from these progeny plants were with the modB construct, the transformation was repeated observed to produce about 20% DHA and about 6% DPA, five times and 35 presumed transgenic shoots/seedlings were for a total DHA+DPA content of 26%. The F1 plants are regenerated. T1 seed analysis is carried out to determine self-fertilised and progeny which are homozygous for both DPA and DHA content. of the 1-DNA insertions are expected to produce up to 35% In order to produce further seed containing DPA and no DHA and DPA. DHA, the A4-desaturase gene was deleted from the modB About 18% DPA was observed in the lipid of pooled seed construct and the resultant construct used to transform B. of the T3 progeny designated JT1-4-34-11. Similarly about 25 juncea and B. napus. Progeny seed with up to 35% DPA in 17.5% DHA was observed in the lipid from pooled seed in the total fatty acid content of the seed lipid are produced. the progeny of 13 al-4-1.7-20. Fatty acid compositions of When the oil extracted from the seeds of a plant producing JT1-4T1 pooled seed, T1 single seed, 12 pooled seed, T2 DHA was examined by NMR, at least 95% of the DHA was single seed, and T3 pooled seed, T3 single seed are in Tables observed to be present at the sn-1.3 position of the TAG 21 to 24. JT1-4T3 segregant JT-1-4-34-11, had a pooled T3 molecules. TABLE 2.0 Fatty acid composition of seedoil from T1 seeds of B. iuncea transformed with the T-DNA from GA7. T1 Seed No. C16:0 16:1d9 C18:O C18:1 C18:111 C18:2 C18:36 C18:33 C2O:O

T1-4-A-1 S.O O.2 2.7 23.5 3.4 7.0 0.7 24.8 0.7 T1-4-A-2 4.3 O.3 2.6 37.2 3.2 1.O O.3 22.1 0.7 T1-4-A-3 S.6 O.3 2.7 20.8 3.7 6.O O6 24.4 0.7 T1-4-A-4 4.6 0.4 2.8 36.2 3.4 O6 O.3 24.5 O.8 T1-4-A-5 S.O O.2 3.2 20.3 3.6 3.7 0.7 25.9 0.7 T1-4-A-6 4.8 0.4 3.4 37.9 3.7 7.4 0.4 19.9 O.9 T1-4-A-7 S.6 O.3 3.0 26.2 4.0 8.9 O.3 26.6 O.6 T1-4-A-8 4.8 0.4 2.9 40.3 3.4 7.8 O.3 22.2 O.8 T1-4-A-9 7.1 O.3 3.6 17.7 4.3 7.9 0.7 23.1 1.O T1-4-A-10 S.1 O.2 4.2 22.3 3.4 9.5 0.7 21.7 O.8 T1-4-A-11 S.O O.S 2.8 37.6 4.0 7.1 0.4 19.2 0.7 T1-4-A-12 5.2 O.3 3.0 28.2 4.0 9.2 O.3 27.4 O.6 T1-4-A-13 5.4 O.2 3.0 16.7 4.1 9.9 O6 29.9 0.7 T1-4-A-14 S.1 0.4 3.1 3O.O 4.0 1.5 O.3 27.7 0.7 T1-4-A-15 S.1 0.4 2.5 34.2 3.6 6.9 O6 20.4 0.7 T1-4-B-1 5.5 O.2 2.7 18.9 4.0 7.6 O.8 24.1 O.8 T1-4-B-2 5.5 O.2 2.7 2O2 4.0 4.3 O.S 25.5 0.7 T1-4-B-3 5.3 O.3 3.6 34.1 3.5 3S.O O6 9.3 O.8 T1-4-B-4 5.3 O.3 3.1 25.2 3.6 7.0 0.7 24.1 0.7 T1-4-B-5 5.5 O.S 2.2 30.1 4.6 O.2 O.S 21.7 O.6 T1-4-B-6 S.6 O.3 2.5 19.5 3.8 5.2 O.S 27.7 O.6 T1-4-B-7 5.9 O.S 2.0 29.9 4.0 1.2 O.3 26.2 O.6 T1-4-B-8 6.2 O.S 1.9 33.1 4.0 3O.O O.S 12.7 O.6 T1-4-B-9 4.9 O.2 3.4 24.6 3.0 8.5 O.3 26.2 O.8 T1-4-B-10 5.2 O.3 2.7 19.0 4.0 2.0 O6 3O.S 0.7 T1-4-B-11 4.8 O.2 3.0 23.7 3.1 8.1 O6 23.5 0.7 T1-4-B-12 S.O O.2 2.6 19.6 3.4 2.5 O6 26.9 O.8 T1-4-B-13 S.6 O.3 2.8 20.9 3.9 1.9 0.4 27.0 0.7 T1-4-B-14 S.1 O.3 3.1 25.5 3.3 6.7 0.7 23.9 O.8 T1-4-B-15 S.6 O.3 2.7 19.5 4.1 4.0 O.8 24.6 0.7

T1 Seed No. 18:4m3 C20:1 d11 C20:2n6 C20:3n3 20:4n3 20:5n3 22:5n3 C22:6n3

JT1-4-A-1 2.0 1.1 O.2 O.8 4.0 O.6 2.4 9.9 JT1-4-A-2 O.9 1.3 O.2 1.4 3.2 O.3 9.4 O.O JT1-4-A-3 2.0 O.9 O.2 1.1 4.5 0.7 3.1 11.4 JT1-4-A-4 9.9 1.7 O.2 O.3 O.S O.O 2.5 O.O

US 9,725,399 B2 121 122 Example 10 The Selected seed lots also included B0050-27 derived lines which had shown T2 seed DHA levels in excess of 20%, and Further Analysis of Transformed Plants and Field a T2 plant T-DNA copy number of 1 or 2. Seeds sown in the Trials field germinated and plantlets emerged at the same rate as the wild-type seeds. Plants grown from most, but not all, of Southern blot hybridisation analysis was carried out on the Sown seed lots were phenotypically normal, for example selected T2 B. napus plants transformed with the T-DNA had morphology, growth rate, plant height, male and female from the GA7-modB construct. DNA extracted from fertility, pollen viability (100%), seed set, silique size and samples of plant tissue were digested with several restriction morphology that was essentially the same as the wild-type enzymes for the Southern blot hybridisation analysis. A 10 control plants grown under the same conditions. Seed yield radioactive probe corresponding to part of the T-DNA was per plant was similar to that of wild-type controls grown hybridised to the blots, which were washed under stringent under the same conditions. Other seed samples were sown in conditions, and the blots exposed to film to detect hybridis larger areas to bulk-up the selected transgenic lines. The ing bands. Some of the samples exhibited single hybridising total DHA content in harvested seeds was at least 30 mg/g bands for each of the restriction digests, corresponding to 15 seed. single T-DNA insertions in the plants, while others showed It will be appreciated by persons skilled in the art that two bands and others again showed multiple T-DNA bands, numerous variations and/or modifications may be made to corresponding to 4 to 6 insertions. The number of hybridis the invention as shown in the specific embodiments without ing bands observed by Southern Blot analysis correlated departing from the spirit or scope of the invention as broadly well with the T-DNA copy number in the transgenic plants described. The present embodiments are, therefore, to be as determined by the digital PCR method, up to a copy considered in all respects as illustrative and not restrictive. number of about 3 or 4. At higher copy numbers than about The present application claims priority from AU 5, the digital PCR method was less reliable. 2013905033 filed 18 Dec. 2013, and AU 2014902471 filed Some of the selected lines were used as pollen donors in 27 Jun. 2014, the entire contents of both of which are crosses with a series of about 30 different B. napus varieties 25 incorporated herein by reference. All publications discussed of different genetic backgrounds. Further back-crosses are and/or referenced herein are incorporated herein in their carried out to demonstrate whether the multiple 1-DNA entirety. insertions are genetic linked or not, and allowing segrega Any discussion of documents, acts, materials, devices, tion of genetically-unlinked transgenic loci. Thereby, lines articles or the like which has been included in the present containing single transgenic loci are selected. 30 specification is solely for the purpose of providing a context Single-primer PCR reactions are carried out on the trans for the present invention. It is not to be taken as an admission genic lines, using primers adjacent to the left- and right that any or all of these matters form part of the prior art base borders of the 1-DNA, and any lines that show the presence or were common general knowledge in the field relevant to of inverted repeats of the T-DNAs are discarded. the present invention as it existed before the priority date of Several of the transgenic lines showed delayed flowering, 35 each claim of this application. while others had reduced seed-set and therefore reduced seed yield per plant after growth in the glasshouse, consis REFERENCES tent with a reduced male or female fertility. Flower mor phology was examined in these plants and it was observed Abbadi et al. (2004) Plant Cell 16:2734-2748. that in Some cases, dehiscence and release of pollen from the 40 Abbott et al. (1998) Science 282:2012-2018. anthers was delayed so that styles had elongated before Agaba et al. (2004) Marine Biotechnol. (NY) 6:251-261. dehiscence occurred, thereby distancing the anthers from the Alvarez et al. (2000) Theor Appl Genet 100:319-327. stigmas. Full fertility could be restored by artificial pollina Armbrust et al. (2000) Science 306:79-86. tion. Furthermore, pollen viability at dehiscence was deter Baumlein et al. (1991) Md. Gen. Genet. 225:459-467. mined by staining with the vital stains FDA and PI (Example 45 Baumlein et al. (1992) Plant J. 2:233-239. 1) and was shown to be reduced in some of the lines, Beaudoin et al. (2000) Proc. Natl. Acad. Sci. U.S.A. whereas in most of the transgenic lines, pollen viability was 97:6421-6426. about 100% as in the wild-type controls. As a further test for Belide et al. (2013) Plant Cell Tiss Organ Cult. 113:543-553. a possible cause of the reduced seed yield in some plants, the Berberich. et al. (1998) Plant Mol. Biol. 36:297-306. fatty acid content and composition of flower buds including 50 Broun et al. (1998) Plant J. 13:201-210. the anthers and Stigmas/styles of Some 13 and 14 plants was Brown et al. (2002) Biochem J. 364:795-805. tested. No DHA was detected in the extracted lipids, indi Chan et al. (2006) Nature Biotechnology 28:951-956. cating that the genes in the genetic construct were not Chapman et al. (2004) Gen. Dev. 18:1179-1186. expressed in the flower buds during plant development, and Chen et al. (2004) The Plant Cell 16:1302-1313. ruling this out as a cause of the reduced seed yield. 55 Cheng et al. (1996) Plant Cell Rep. 15:653-657. The oil content was measured by NMR and the DHA level Cheng et al. (2010) Transgenic Res 19: 221-229. in the total fatty acid content was determined for 12 seeds. Cho et al. (1999a) J. Biol. Chem. 274:471-477. Trangenic lines having less than 6% DHA were discarded. Cho et al. (1999b) J. Biol. Chem. 274:37335-37339. 1-DNA copy number in leaf samples from plants of the T1, Christie (1982) J. Lipid Res. 23:1072-1075. T2 and T3 generations were determined by the digital PCR 60 Clough and Bent (1998) Plant J. 16:735-43. method (Example 1). Damude et al. (2006). Proc Natl Acad Sci USA 103: 9446 Selected T3 and T4 seed lots were sown in the field at two 9451. sites in Victoria, Australia, each in 10 m rows at a sowing Denic and Weissman (2007) Cell 130:663-677. density of about 10 seeds/m. The selected seed lots included Domergue et al. (2002) Eur. J. Biochem. 269:4105-4113. a B003-5-14 derived line which showed pooled seed DHA 65 Domergue et al. (2003) J. Biol. Chem. 278: 35115-35126. levels of about 8-11% and individual T2 Seed DHA levels of Domergue et al. (2005) Biochem. J. I 389: 483-490. up to about 19%, with a TO plant T-DNA copy number of 3. Dunoyer et al. (2004) The Plant Cell 16:1235-1250.

US 9,725,399 B2 127 128 - Continued tgtaaatgta ttatatgta atgtgtataa aacgtag tac ttaaatgact aggagtggitt 246 O

Cttgaga.ccg atgagagatg ggagcagaac taaagatgat gaCataatta agaacga att 252O tgaaaggctic ttaggitttga atcct attcg agaatgttitt ttcaaagat agtggcgatt 2580 ttgaac caaa gaaaacattt aaaaaatcag tat coggitta cott catgca aatagaaagt 264 O ggtc.taggat citgattgtaa ttittagacitt aaagagt ct c ttaagattica atcctggctg 27 OO tgtacaaaac tacaaataat at attittaga citatttggcc ttalactaaac titccact cat 276 O tatt tact gaggittagagaa tag acttgcg aataaacaca titc.ccgagaa atact catga 282O tcc cataatt agt cagaggg tatgccaatc agatctaaga acacacatt c cct caaattit 288O taatgcacat gtaatcatag tittagcacaa ttcaaaaata atgtag tatt aaagacagaa 294 O atttgtagac tttitttittgg cqttaaaaga agactaagtt tatacgtaca ttittattitta 3 OOO agtggaaaac cqaaattitt c catcgaaata tatgaattta gtatatatat ttctgcaatg 3 O 6 O tact attittg c tattittggc aactitt cagt gigact actac titt attacaa totgitatgga 312 O tgcatgagtt tdagtataca catgtctaaa tdcatgctitt gtaaaacgta acggaccaca 318O aaagaggat.c catacaaata catct catag citt cotc cat tattitt.ccga cacaaacaga 324 O gcattt taca acaattacca acaacaacaa acaacaaaca acattacaat tacatttaca 33 OO attaccatac catggaattic goccagoc to ttgttgctat ggctcaagag caatacgctg 3360 citat cqatgc tigttgttgct c ct gctat ct tctctgctac tdattictatic ggatggggac 342O ttaa.gc.ctat citcttctgct actaaggact tcc ct cittgt tdagt ct cot acacct citca 3480 t cctitt ctitt gcttgcttac titcgctat cq ttggatctgg act cqtttac agaaaggttt 354 O t ccctagaac cqtgaaggga caagatcc at tcc titttgaa gogotcittat g c ttgct caca 36OO acgtgttcct tat cqgact t t ct citttaca tdtgcct caa gcttgttgtac gaggcttacg 366 O ttaacaagta Ctctttctgg ggaaacgctt acaac cctgc ticaaactgag atggctaagg 372 O ttatctggat cittctacgtg agcaagat ct acgagttcat ggataccttic at catgcticc 378 O t caagggaaa tottaaccag gttagct tcc titcacgttta ccatcacgga tictat citctg 384 O gaatctggtg gatgattact tacgctgctic Ctggtggtga tigctt acttic tictgctgctic 3900 ttaact cittg ggttcacgtg td tatgtaca cct actattt tatggct gcc gtgct tccta 396 O aggacgagaa alactalagaga aagtacct ct ggtggggaag atacct tact caaatgcaga 4 O2O tgttccagtt citt catgaac Cttct coagg ctgtttacct tct ct actic t t catcto citt 4 O8O accctaagtt tat cqcticag ctic ct cqtgg tdtacatggit tactic ttctic atgcttitt.cg 414 O gaaact tcta ctacatgaag caccacgcta gcaagtgatg aggcgc.gc.cg ggcc.gcc.gc.c 42OO atgtgacaga t caaggaag aaagtgtaat aagacgactic ticact acticg atcgctagtg 426 O attgtcattgttatatataa taatgttatc titt cacaact tat cqtaatg catgtgaaac 432O tata acacat taatcc tact tdt catatga taacact citc cc catttaaa act cittgtca 438 O atttaaagat ataagattct ttaaatgatt aaaaaaaata tattataaat t caat cactic 4 44 O c tactaataa attattaatt attatttatt gattaaaaaa at acttatac taatttagt c 4500 tgaatagaat aattagattic tagt ct catc cccttittaaa cca acttagt aaacgtttitt 456 O ttttittaatt titatgaagtt aagtttittac Cttgtttitta aaaagaatcg tt cataagat 462O gccatgccag aac attagct acacgttaca catagcatgc agcc.gcggag aattgtttitt 468O citt.cgc.cact tdt cactic cc ttcaaacacic taagagctitc tict ct cacag cacacacata 474. O

US 9,725,399 B2 139 140 - Continued gaaag.cacat gct cqtgtgg gttctatotic gattaaaaat cocaattata tittggtctaa 668O tittagtttgg tattgagtaa aacaaatt cq aaccaaacca aaatataaat atatagttitt 674 O tatatatatg cctttalagac tttittataga attitt ctitta aaaaatat ct agaaatattt 68OO gccact ctitc tdgcatgitaa tattt cqtta aatatgaagit gct coattitt tattaactitt 6860 aaataattgg ttgtacgatc actitt cittat caagtgttac taaaatgcgt caatctottt 692 O gttct tcc at att catatgt caaaatctat caaaattictt atatat ctitt titcgaatttg 698 O aagtgaaatt togataattit aaaattaaat agaac at atc attatttagg tat catattg 704 O atttittatac ttaattacta aatttggitta actittgaaag togtacat caa cqaaaaatta 71OO gtcaaacgac taaaataaat aaatat catg tdttattaag aaaattct c c tataagaata 716 O ttittaataga t catatgttt gtaaaaaaaa ttaatttitta ctaacacata tatt tactta 722 O tcaaaaattit gacaaagtaa gattaaaata atatt catct aacaaaaaaa aaaccagaaa 7280 atgctgaaaa cccggcaaaa ccgaaccalat coaaaccoat at agttggitt tdgtttgatt 734 O ttgatataaa ccgaac caac toggtc.catt tdcaccc cta at cataatag ctittaatatt 74 OO t caagatatt attaagttaa cqttgttcaat atcctggaaa ttittgcaaaa tdaat caagc 746 O ctatatggct gtaatatgaa tittaaaag.ca gct cqatgtg gtggtaatat gtaatttact 752O tgattictaaa aaaatat coc aag tattaat aatttctgct aggaagaagg ttagctacga 758 O tttacagcaa agccagaata caaagaacca taaagtgatt gaagctic gala atatacgaag 764 O gaacaaat at ttittaaaaaa atacgcaatg acttggalaca aaagaaagtg atatatttitt 77OO tgttcttaaa caa.gcatc.cc citctaaagaa tdgcagttitt cctittgcatg taact attat 776 O. gctic cct tcc ttacaaaaat tittggactac tattgggaac ttcttctgaa aatagt cct g 782O Caggct agta gattggttgg ttggtttcca ttaccagaa ggctt accct attagttgaa 788 O agttgaaact ttgttc ccta ct caattic ct agttgttgtaa atgitatgtat atgtaatgtg 794 O tataaaacgt agtact taaa tact aggag titt Cttga gaccgatgag agatgggagc 8 OOO agaactaaag atgatgacat aattaagaac gaatttgaaa gogotcittagg tttgaatcct 806 O attcqagaat gttitttgtca aagatagtgg cattttgaa ccaaagaaaa catttaaaaa 812 O atcagtat co ggittacgttc atgcaaatagaaagtggtct aggatctgat td taattitta 818O gacittaaaga gtct cittaag attcaatcct ggctgttgtac aaaactacaa ataatatatt 824 O ttagactatt toggcct taac taaact tcca ct cattattt act gaggitta gagaatagac 83OO ttgcgaataa acacatt.ccc gagaaatact catgatcc.ca taattagt ca gaggg tatgc 8360 caat cagatc taagaacaca cattcc.ctica aattittaatg cacatgtaat catagitt tag 842O caca attcaa aaataatgta gtattaaaga cagaaatttg tag acttittt tttggcgitta 848 O aaagaagact aagtttatac gtacatttta ttittaagtgg aaaac cqaaa ttitt.ccatcg 854 O aaatatatga atttagtata tatatttctg caatgtacta ttittgctatt ttggcaactt 86OO t cagtggact act actitt at tacaatgtgt atggatgcat gagtttgagt atacacatgt 866 O ctaaatgcat gctttgtaaa acgtaacgga ccacaaaaga gcatc catac aaata catct 872O catagott co to cattattt toccacacaa acagagcatt ttacaacaat taccaacaac 878 O. aacaaacaac aaacaa.catt acaattacat ttacaattac catac catgg cct citat cqc 884. O tatic cctdct gct cittgctg gaact cittgg atacgttacc tacaatgtgg cta accctga 89 OO tatic ccagct tctgagaaag titcctgctta citt catgcag gttgagtact ggggacctac 896 O

US 9,725,399 B2 147 148 - Continued acccttgtcc gtatgcttga ggg tacccta gtagattggit tttggttt C catgtacca 432O gaaggcttac cct attagtt gaaagttgaa actttgttcc ctact caatt cct agttgttg 438 O taaatgitatg tatatgtaat gtgtataaaa cqtag tactt aaatgactag gag tdgttct 4 44 O tgaga.ccgat gagagatggg agcagaacta aagatgatga cataattaag alacga atttg 4500 aaaggct citt aggtttgaat colt attcdag aatgttitttgtcaaagatag toggcgattitt 456 O gaac caaaga aaa catttaa aaaat cagta t coggittacg tt catgcaaa tagaaagtgg 462O tctaggat.ct gattgtaatt ttagacittaa agagt ct citt aagattcaat cotggctgtg 468O tacaaaacta caaataatat attittagact atttggcctt aactaaact t c cact catta 474. O tttact gagg ttagagaata gacttgcgaa taalacacatt ccc.gagaaat act catgat c 48OO c cataattag to agagggta togccaatcag atctaagaac acacatt coc toaaattitta 486 O atgcacatgt aat catagitt tag cacaatt caaaaataat gtag tattaa agacagaaat 492 O ttgtag actt ttttittggcg ttaaaagaag actaagttta tacgtacatt ttattittaag 498O tggaaaac cq aaattitt.cca totgaaatata tdaatttagt atatatattt ctogcaatgta 5040 ctattittgct attittggcaa ctitt cagtgg act act actt tattacaatg td tatggatg 51OO catgagtttg agtatacaca tdtctaaatg catgctttgt aaaacgtaac gigaccacaaa 516 O agaggat.cca tacaaataca tot catagct tcc to catta ttitt.ccgaca caaacagagc 522 O attitta Caac aattacCaac aacaacaaac aacaaacaac attacaatta catttacaat 528 O taccatacca tdgcct citat cqctatocct gctgctic titg citggaactict toggatacgitt 534 O acct acaatig toggcta acco tdatat coca gcttctgaga aagttcc togc titact tcatg 54 OO caggttgagt actggggacc tact atcgga act attggat acctic ct citt catct acttic 546 O ggaaag.cgta t catgcagaa Cagat ct cala CCttt cqgac toaagaacgc tatgct cott 552O tacaacttct accagacctt Cttcaa.ca.gc tactgcatct accttitt cqt tacttct cat 558 O agggct Cagg gaCttalaggt ttggggaaac atc cctgata tactgctala Ctcttgggga 564 O atct ct cagg ttatctggct t cact acaac aacaagtacg ttgagcttct coacaccitt c st OO tt catggtga tigaggaagaa gttcgaccag ctittctitt.cc titcacat ct a ccaccacact 576. O cittct catct ggit catggitt cqttgttatgaagcttgagc ctdttggaga ttgct acttic 582O ggat cittctg tta acaccitt cqtgcacgtg at catgtact ct tactacgg acttgctgct 588 O cittggagitta actgtttctg gaagaagtac at cacccaga t coagatgct t cagttctgt 594 O atctgtgctt ct cact citat ctacaccgct tacgttcaga at accqctitt ctogct tcct 6 OOO tacctt caac totgggittat gigtgaacatgttcgttct ct tcgc.caact t c taccgtaag 6 O6 O aggtacaagt cta agggtgc taagaagcag tata aggcg cqcggcgc.gc C9ggcc.gc.cg 612 O c catgtgaca gatcgaagga agaaagtgta atalagacgac tot cact act catcgctag 618O tgattgtcat tdttatatat aataatgtta t ctitt cacaa cittatcgitaa togcatgtgaa 624 O actata acac attaatcc ta cittgt catat gataa cactic ticciccattta aaact cittgt 63 OO caatttaaag atataagatt ctittaaatga ttaaaaaaaa tat attataa attcaat cac 636 O t cct actaat aaattattaa ttatt attta ttgattaaaa aaatactitat actaatttag 642O tctgaataga ataattagat t c tagt ct catcc ccttitta aacca actta gtaaacgttt 648 O tttitttittaa titt tatgaag ttaagtttitt accttgttitt taaaaagaat cqtt cataag 654 O atgc catgcc agaac attag ctacacgtta Cacat agcat gcagcc.gcgg agaattgttt 66OO