USOO894.646OB2

(12) United States Patent (10) Patent No.: US 8,946.460 B2 Petrie et al. (45) Date of Patent: Feb. 3, 2015

(54) PROCESS FOR PRODUCING (52) U.S. Cl. POLYUNSATURATED FATTY ACDS IN AN CPC. CIIB I/00 (2013.01); CIIC3/06 (2013.01); ESTERFED FORM CIIC3/003 (2013.01) USPC ...... 554/124;554/224: 554/170 (71) Applicants: James Robertson Petrie, Goulburn (AU); Surinder Pal Singh, Downer (58) Field of Classification Search (AU); Robert Charles de Feyter, None Monash (AU) See application file for complete search history. (72) Inventors: James Robertson Petrie, Goulburn (56) References Cited (AU); Surinder Pal Singh, Downer U.S. PATENT DOCUMENTS (AU); Robert Charles de Feyter, Monash (AU) 4,399.216 A 8, 1983 Axel et al. 5,004,863. A 4, 1991 Umbeck 5,104,310 A 4, 1992 Saltin (73) Assignees: Commonwealth Scientific and 5,159,135 A 10, 1992 Umbeck et al. Industrial Research Organisation, 5,177,010 A 1/1993 Goldman et al. Campbell (AU); Grains Research and 5,362,865 A 11/1994 Austin Development Corporation, Barton 5,416,011 A 5/1995 Hinchee et al. (AU); Nuseed Pty Ltd, Laverton (AU) 5,451,513 A 9/1995 Maliga et al. (Continued) (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 FOREIGN PATENT DOCUMENTS U.S.C. 154(b) by 0 days. AU 667939 1, 1994 (21) Appl. No.: 13/918,392 AU 776417 9, 2004 (Continued) (22) Filed: Jun. 14, 2013 OTHER PUBLICATIONS Prior Publication Data (65) Gul M.K., et al., Sterols and the phytosterol conent of oil seed rape US 2013/0338387 A1 Dec. 19, 2013 (Brassica napus L.), 2006, Journal of Cell and Molecular Biology, Related U.S. Application Data vol. 5, pp. 71-79.* (Continued) (60) Provisional application No. 61/782,680, filed on Mar. 14, 2013, provisional application No. 61/697,676, filed on Sep. 6, 2012, provisional application No. Primary Examiner – Yate K Cutliff 61/663,344, filed on Jun. 22, 2012, provisional (74) Attorney, Agent, or Firm — John P. White; Gary J. application No. 61/660,392, filed on Jun. 15, 2012. Gershik; Cooper & Dunham LLP (51) Int. C. (57) ABSTRACT C07C 67/00 (2006.01) The present invention relates to a process for producing ethyl A23D 9/00 (2006.01) esters of polyunsaturated fatty acids, comprising transesteri CIIB I/00 (2006.01) fying triacylglycerols in extracted plant lipid. CIIC3/06 (2006.01) CIIC3/00 (2006.01) 43 Claims, 21 Drawing Sheets

aloyl-CoAacetyl-CoA ------> 89 &2 ses. 8:23 2 A.

S:36,9,12 GA S:SYS,2SA.A. '' 6 is as i GY 20:2.y.a. 23A8. , 4 A 8:43,3,2,355A; 26:383,34.7 \ sciss As els / 20:45,8,1,4 ARA 2:48, 4 EA \ 23 s y 20:5A58,3,4,7 EPA 8 Ss: assic 22:..., 0,389 (OA) ------24:5A9, $25,82 scies l is iss 22:6.4.7.0,3,6, 9 A -- 246A9,2,353.i -xcac, US 8,946.460 B2 Page 2

(56) References Cited 7,217,856 B2 5/2007 Weaver et al. 7,220,897 B2 5/2007 Mukerji et al. U.S. PATENT DOCUMENTS 7.241,619 B2 7/2007 Mukerji et al. 7,244,563 B2 7/2007 Cahoon et al. 5,463,174. A 10/1995 Moloney et al. 7,247.461 B2 7/2007 Metz et al. 5,504,200 A 4, 1996 Hall et al. 7,256,033 B2 8, 2007 Damude et al. 5,518,908 A 5, 1996 Corbinet al. 7,262,343 B1 8, 2007 DeBonte et al. 5,545,818 A 8, 1996 McBride et al. 7,271,315 B2 9/2007 Metz et al. 5,569,834. A 10/1996 Hinchee et al. 7,273,746 B2 9/2007 Yadav et al. 5,589.617 A 12/1996 Nehra et al. 7,402,735 B2 7/2008 Browse et al. 560s,152 A 3/1997 Kideal. 7,411,054 B2 8/2008 Meyers et al. 5.614,393 A 3, 1997 Thomas et al. 7,504,259 B2 3/2009 Yadav et al. 5,663,068 A 9/1997 Thomas et al. 7,537.920 B2 5/2009 Renz et al. 5,668,299 A 9/1997 Debonte et al. 7.550,651 B2 6/2009 Damude et al. 5,683,898 A 11/1997 Yazawa et al. 7,589,253 B2 9, 2009 Green et al. 5,689,050 A 11/1997 Thomas et al. 7,615,679 B2 11/2009 Lerchl et al. 5,786.220 A 8, 1998 Thomas et al. 7,619, 105 B2 11/2009 Green et al. 5,798.255. A 8, 1998 Yazawa et al. 7,659,120 B2 2/2010 Yadav et al. 5859347 A 1/1999 Brown et al. 7,709,239 B2 5, 2010 Damude et al. 5,877.402 A 3/1999 Maliga et al. 7.714,185 B2 5/2010 Napier et al. 5,932.479 A 8, 1999 Daniellet al. 7,736,884 B2 6/2010 Gunnarsson et al. 5,952,544 A 9, 1999 Browse et al. 7,777,098 B2 8/2010 Cirpus et al. 5,968.809 A 10/1999 Knutzon et al. 7,807,849 B2 10/2010 Singh et al. 5,972,664 A 10, 1999 Knutzon et al. 7,834,248 B2 11/2010 Green et al. 6,051,754 A 4/2000 Knutzon et al. 7,834,250 B2 11/2010 Singh et al. 6,075,183 A 6/2000 Knutzon et al. 7,838,651 B2 11/2010 Picataggio et al. 6,100.447 A 8, 2000 Wu et al. 7,842,852 B2 11/2010 Cirpus et al. 6,136,574. A 10/2000 Knutzon et al. 7,855,321 B2 12/2010 Renz et al. 6,140,486 A 10/2000 Facciotti et al. 7,871,804 B2 1/2011 Cirpus et al. 6,194,167 B1 2/2001 Browse et al. 7,879,591 B2 2/2011 Damude et al. 6,342,658 B1 1/2002 DeBonte et al. 7,901928 B2 3/2011 Yadav et al. 6,355,861 B1 3/2002 Thomas et al. 7932.438 B2 4/2011 Singh et al. 6,372,965 B1 4/2002 Lightner et al. 8,071,341 B2 12/2011 Singh et al. 6,403,349 B1 6/2002 Mukerji et al. 8,084,074 B2 12/2011 Kinney et al. 6,410,288 B1 6/2002 Knutzon et al. 8, 106,226 B2 1/2012 Singh et al. 6.428,990 B1 8/2002 Mukerji et al. 8,158.392 B1 4/2012 Singh et al. 6.432,684 B1 8/2002 Mukerji et al. 8,288,572 B2 10/2012 Singh et al. 6,459,018 B1 10/2002 Knutzon et al. 8,535.917 B2 9/2013 Singh et al. 6,492,108 B1 12/2002 Hillman et al. 8,575,377 B2 11/2013 Singh et al. 6,541,257 B2 4/2003 Lemaux et al. 8,778,644 B2 7/2014 Singh et al. 6,566,583 B1* 5/2003 Facciotti et al...... 800/281 8,809,559 B2 8/2014 Petrie et al. 6,589,767 B1 7/2003 Knutzon et al. 8,816,106 B2 8/2014 Damcevski et al. 6,620,986 B1 9/2003 McKeon et al. 8,816,111 B2 8/2014 Petrie et al. 6,635,451 B2 10/2003 Mukerji et al. 2001/OO23259 A1 9, 2001 Slabas et al. 6,677,145 B2 1/2004 Mukerji et al. 2002fOOO9779 A1 1/2002 Meyers et al. 6,683.232 B1 1/2004 Thomas et al. 2002fOO42933 A1 4/2002 Browse et al. 6,686,185 B 22004 Logan et al. 2002/0065406 A1 5/2002 Meyers et al. 6.825,017 B1 11/2004 Browse et al. 2002/0076.786 A1 6/2002 Curtis et al. 6.825.335 B1 1/2004 Marinet al. 2002/0104124 A1 8/2002 Green 6,838,594 B1 1/2005 Kinney et al. 2002/0107373 A1 8, 2002 Curtis et al. 6,858.416 B2 2/2005 Mukerji et al. 2002/0108147 A1 8, 2002 Thomas et al. 6,864,077 B1 3/2005 Cahoon et al. 2002/01 11307 A1 8/2002 GluckSmann et al. 6,875,595 B2 4/2005 Kloek et al. 2002fO115178 A1 8/2002 Meyers et al. 6.884.921 B2 4/2005 Browse et al. 2002/0138874 A1 9/2002 Mukerji et al. 6,897.050 B1 5/2005 Napier 2002/0146784 A1 10, 2002 Suzuki et al. 6,913,916 B1 7/2005 Mukerji et al. 2002/0156254 A1 10/2002 Qiu et al. 6.958.229 B2 10, 2005 Suzuki et al. 2002/0170090 A1 11/2002 Browse et al. 6,967.243 B2 1/2005 Debonte et al. 2002/0194641 A1 12/2002 Metz et al. 7001775 B2 2/2006 Roessler et al. 2003, OO33633 A1 2/2003 Lightner et al. 7,045,683 B2 5/2006 Mukerji et al. 2003/OO77747 A1 4/2003 Hillman et al. 7,067.285 B2 6/2006 Mukerji et al. 2003/OO79250 A1 4/2003 Fillatti et al. T.O67.722 B2 6, 2006 Filatti 2003/0082754 A1 5/2003 Mukerji et al. 7,070,970 B2 7/2006 Mukerji et al. 2003, OO84480 A1 5.2003 Filatti et al. T.O81356 B2 7/2006 Putten et al. 2003/0101486 A1 5/2003 Facciotti et al. 7,087432 B2 8/2006 Qinet al. 2003/0104596 A1 6/2003 Mukerji et al. 7,091,005 B2 8, 2006 Petruhkin et al. 2003/O131379 A1 7/2003 DeBonte et al. 7,109,392 B1 9/2006 Broglie et al. 2003/0134400 A1 7/2003 Mukerji et al. 7,135,614 B1 1 1/2006 DeBonte et al. 2003. O152983 A1 8/2003 Napier et al. 7,135,623 B1 1 1/2006 Rusing et al. 2003. O157144 A1 8/2003 Mukerji et al. 7,148,336 B2 12/2006 Fillatti 2003. O159164 A1 8/2003 Kopchicket al. 7,179,620 B2 2/2007 Petrukhin et al. 2003/O159173 A1 8, 2003 Wolter et al. 7,179,647 B2 2/2007 Lerchl et al. 2003/0163844 A1 8/2003 Lightner et al. 7,189,559 B2 3/2007 Damude et al. 2003/0163845 A1 8/2003 Mukerji et al. 7,192,762 B2 3/2007 Macool et al. 2003,0166207 A1 9, 2003 Roessler et al. 7,198.937 B2 4/2007 Xue et al. 2003/0167525 A1 9/2003 Mukerji et al. 7,208,590 B2 4/2007 Mukerji et al. 2003/0172398 A1 9, 2003 Browsse et al. 7,211,418 B2 5/2007 Metz et al. 2003/0172399 A1 9, 2003 Filatti et al. 7.211,656 B2 5/2007 Mukerji et al. 2003/0177508 A1 9/2003 Mukerji et al. 7,214,853 B2 5/2007 Facciotti et al. 2003/0190733 A1 10/2003 Mukerji et al. US 8,946.460 B2 Page 3

(56) References Cited 2008.0160.054 A1 7, 2008 Heinz et al. 2008, 0214667 A1 9, 2008 Das et al. U.S. PATENT DOCUMENTS 2008, 0220 143 A1 9/2008 Kinney et al. 2008, 0220500 A1 9, 2008 Winther et al. 3988: A 1928. Musical 388853. A 858 SMEa 2004.00498.05 A1 3, 2004 E. 2008/0254195 A1 10, 2008 Damude et al. 2004.0053234 A1 3, 2004 Winther et al. 2008/0260929 A1 10, 2008 Ursin et al. 2004.0053379 A1 3, 2004 Lerchl et al. 2008/0268539 A1 10/2008 Singh et al. 2004/0067226 A1 4/2004 Petrukhin et al. 3.s: A. 338 E. et 1 2004f0078845 A1 4/2004 Thomas et al. Irpus et al. 2004/0086899 A1 5, 2004 Winther et al. 2009/0222951 A1 9/2009 Cirpus et al. 2004/0098762 A1 5, 2004 Filatti et al. 2009/0253.188 Al 10/2009 Zhu et al. 2004/0111763 A1 6, 2004 Heinz et al. 2009/0320161 Al 12/2009 McGonigle et al. 2004/O157221 A9 8, 2004 Curtis et al. 2010.0088776 A1 4, 2010 Bauer et al.

E. A. E. E.'utten et al. 38885. A 388 ERita 2004/O195512 A1 10, 2004 Crosetto et al. 2010/0227924 A1 9/2010 Cirpus et al. 2004/0221335 A1 11/2004 Shewmaker et al. 38: F-8. . A. 38: Sigh et Fi 2004/0224413 A1 11/2004 Cahoon et al. a 3. 2004/0235127 A1 11, 2004 Metz et al. 38: 9. 3. A. 5.38: S. i 2005, OOO3442 A1 1/2005 Mukerji et al. Ingn et al. 2005.0005328 A1 1/2005 Mukerji et al. 2011/0059204 A1 3/2011 Jackson et al. 2005/0005329 A1 1/2005 Mukerji et al. 2011/0059496 Al 3, 2011 Zhu et al. 2005.00898652005/0009140 A1 4/20051/2005 NapierMukerji et et al. al. 38: I-886. A. 3. E.ing et al. et al. 2005.0089879 A1 4/2005 Feussner et al. 2011/0269983 Al 11/2011 Kinney et al. 2005.0089981 A1 4/2005 Napier et al. 2012fOO16144 A1 1/2012 Petrie et al. 2005, 0100995 A1 5, 2005 Weaver et al. 2012/0041218 AI 2.2012 Singh et al. 2005, 0112719 A1 5/2005 Roessler et al. 2012/0083615 A1 4/2012 Singh et al. 2005, 0164.192 A1 7/2005 Graham et al. 2012, 0215018 A1 8/2012 Singh et al. 2005, 0166271 A1 7/2005 Feubner et al. 2013, OO60.053 A1 3/2013 Singh et al. 2005/0214761 A1 9, 2005 Lerchl et al. 2014, OO11247 A1 1/2014 Singh at al. 2005/0262.588 A1 11/2005 Dehesh et al. 2005, O262589 A1 11, 2005 Filatti et al. FOREIGN PATENT DOCUMENTS 2005/0262591 A1 11/2005 Debonte et al. 2005/0266440 A1 12/2005 Metz et al. 2005/0273883 A1 12, 2005 Metz et al. A. 2007,273, 2. 2005/0273884 A1 12, 2005 Metz et al. AU 2007 276257 1, 2008 2005/0273885 A1* 12, 2005 Singh et al...... 800/281 CA 209.2588 9, 1994 2006, OO78973 A1 4/2006 Renz et al. EP 275957 T 1988

2006/0094.102 A1 5, 2006 Xue et al. JP 2001,095,588 4/2001 2006, O110806 A1 5, 2006 Damude et al. JP 2001,145.490 5, 2001

2006, O156435 A1 7/2006 Ursin et al. WO WO 84,02913 8, 1984

2006,019 1042 A1 8, 2006 Filatti et al. WO WO91f1398O 9, 1991 2006/0195939 A1 8, 2006 Damude et al. WO WO93,06712 A1 4f1993 2006/0206961 A1 9/2006 Cirpus et al. WO WO95/15389 6, 1995 2006/0206963 A1 9, 2006 Voelker et al. WO WO95/23230 8, 1995 2006, O246556 A1* 11/2006 Napier et al...... 435/128 WO WO 97.06269 2, 1997 2007/0028326 A1 2/2007 Cirpus et al. WO WO 97.21340 6, 1997

2007/01 18929 A1 5, 2007 Damude et al. WO WO 98.01565 A1 1, 1998 2007, 01630O2 A1 7/2007 DeBonte et al. WO WO98, 18952 A1 5, 1998 2007/0220634 A1 9, 2007 Metz et al. WO WO 98.45461 10, 1998 2007/0224661 A1 9/2007 Cirpus et al. WO WO98,46763 A1 10, 1998

2007.0245431 A1 10, 2007 Metz et al. WO WO98,46765 A1 10, 1998

2007/0270494 A1 11, 2007 Metz et al. WO WO99/05265 2, 1999 2007,0294790 A1 12, 2007 Graham et al. WO WO99/14314 3, 1999 2008, OOO5811 A1 1/2008 Metz et al. WO WO99, 16890 4f1999 2008/0022422 A1 1/2008 Weaver et al. WO WO99,33958 A2 7, 1999 2008/0057495 A1 3/2008 Ohyama et al. WO WO99/49050 A2 9, 1999 2008, OO63691 A1 3/2008 Ursin et al. WO WO99,616O2 A1 12/1999 2008/0076166 A1 3/2008 Cirpus et al. WO WO99,64614 A2 12/1999 2008. O155705 A1 6, 2008 Zank et al. WO WO99,646.16 A2 12/1999 US 8,946.460 B2 Page 4

(56) References Cited WO WO 2009/017821 2, 2009 WO WO 2009/129582 10/2009 FOREIGN PATENT DOCUMENTS WO WO 2010/009:500 1, 2010 WO WO 2010/O232O2 3, 2010 WO WOOOf 12720 A3 3, 2000 WO WO 2010/057246 ck 5, 2010 WO WOOO,20602 A2 4/2000 WO WO2O10057246 5/2010 ...... C12N 15/82 WO WOOO,20603 A1 4/2000 WO WO 2011, 146524 11, 2011 WO WOOO/21557 A1 4/2000 WO WO 2013/O16546 1, 2013 WO WOOOf 40705 A2 T 2000 WO WO 2013,153404 10, 2013 WO WOOOf 42.195 A2 T 2000 WO WOOO/O521.83 9, 2000 OTHER PUBLICATIONS WO WOOOf 5377O 9, 2000 WO WOOO,55330 A1 9, 2000 Marekov, I.B., et al., Sterol compositi of rapeseed varieties intro WO WOOOf75341 A1 12/2000 duced in Bulgaria, 2009, Bulgarian Journal of AGricultural Science, WO WOO1/O2591 A1 1, 2001 15 (No. 2), pp. 119-122.* W W 94's A1 38: Aug. 16, 2013 Notice of Allowance, issued in connection with U.S. WO WO 01/14538 A2 3, 2001 Apol.pp No. 13.651,275. WO WOO1?2OOO1 3, 2001 Marangoni and Rousseau (1995) “Engineering triacylglycerols: The WO WOO1,384.84 5, 2001 role of interesterification' Trends in Food Science & Technology 6, WO WOO1/38512 5, 2001 329-335. WO WOO1,385.12 A2 5, 2001 Petrie et al (2010) “Rapid expression of transgenes driven by seed W. W. 8: A1 838: specific constructs in leaf tissue; DHA production' Plant Methods WO WOO1,66758 A2 9, 2001 6:8, pp. 1-6. WO WOO 1/7O777 9, 2001 Petrie et al (2012) “Transgenic production of arachidonic acid in WO WO 2001/70777 9, 2001 oilseeds' Transgenic Res 21:139-147. WO WOO 1/75.069 A1 10, 2001 Ruiz-Lopez (2012) “Enhancing the accumulation of omega-3 long WO WOO1/92489 A2 12/2001 chain polyunsaturated fatty acids in transgenic Arabidopsis thaliana W. Wegg 3.38 t3. via iterative metabolic engineering and genetic crossing Transgenic ReS 21:1233-1243. W W 93.99. A: 3. Sakuradani et al (1999) “A6-Fatty acid desaturase from an WO WO 02/081668 10, 2002 arachidonic acid-producing Mortierella fungus Gene cloning and its WO WO 02/081668 A3 10, 2002 heterologous expression in a fungus, Aspergillus' Gene 238: 445 WO WO O2/O817O2 A1 10, 2002 453. WO WO O2/O83869 A3 10, 2002 Sakuradani et al (2005) "A novel fungal (D3-desaturase with wide WO WO O2/O83870 A2 10, 2002 Substrate specificity from arachidonic acid-producing Mortierella WO WO O2/O90493 A2 11/2002 alpina 1S-4” Appl Microbiol Biotechnol 66: 648-654. WO WO O2/O92540 A1 11, 2002 Speranza and Macedo (2012) 'Lipase-mediated production of spe WO WOO2,92540 A1 11, 2002 cific lipids with improved biological and physicochemical proper WO WOO3,064596 A2 8, 2003 ties” Process Biochemistry 47, 1699-1706. W. W. 8,863 38. Sperling etal (2001) "Functional Identification of a A5-Sphingolipid WO WO 03/0934.82 A2 11/2003 Desaturase from Borago officinalis' Archives of Biochemistry and WO WOO3,O992.16 12/2003 Biophysics vol. 388, No. 2, pp. 293-298. WO WOO3,102138 A2 12/2003 Venegas-Calerón et al (2010) “An alternative to fish oils: Metabolic WO WO 2004/005442 1, 2004 engineering of oil-seed crops to produce omega-3 long chain poly WO WO 2004/057 001 T 2004 unsaturated fatty acids' Progress in Lipid Research 49, 108-119. WO WO 2004/071467 8, 2004 Whitney etal (2003) “Functional characterisation of two cytochrome WO WO 2004/071467 A2 8, 2004 b5-fusion desaturases from Anemone leveillei the unexpected iden WO WO 2004/087.180 A1 10, 2004 tification of a fatty acid A6-desaturase' Planta 217: 983-992. WO WO 2004f101757 11, 2004 Zhou et al (2008) “Isolation and functional characterization of two WO WO 2005/007845 A2 1, 2005 independently-evolved fatty acid A12-desaturase genes from insects' WO WO 2005/O12316 2, 2005 Insect Molecular Biology 17(6), 667-676. WO WO 2005/12316 A2 2, 2005 WO WO 2005,80578 A2 9, 2005 Zhou et al (2007) “Isolation and characterization of genes from the WO WO 2005/083053 9, 2005 marine microalga Pavlova sauna encoding three front-end WO WO 2005,83053 A2 9, 2005 desaturases involved in docosahexaenoic acid biosynthesis' WO WO 2005,83093 A2 9, 2005 Phytochemistry 68,785-796. WO WO 2005,97982 A2 10, 2005 Mar. 12, 2013 Office Action issued in connection with U.S. Appl. No. WO WO 2005,98O33 A1 10, 2005 12/310,645. WO WO 2005,103253 11, 2005 Mar. 22, 2012 Response filed in connection with U.S. Appl. No. WO WO 2005/118814 12/2005 13/044,984. WO WO 2006/008099 1, 2006 May 17, 2012 Office Action issued in connection with U.S. Appl. No. WO WO 2006/019.192 2, 2006 13,044.984. WO WO 2006/064317 6, 2006 WO WO 2006/069936 T 2006 Moses Office Action issued in connection with U.S. Appl. No. W W 392, A2 38 Apr. 15, 2013 Response filed in connection with U.S. Appl. No. WO WO 2007/092460 A2 8, 2007 13/448, 107. WO WO 2007 127381 11, 2007 Dec. 7, 2012 Office Action issued in connection with U.S. Appl. No. WO WO 2007/133425 11, 2007 13/448, 107. WO WO 2007, 137788 12/2007 Jan. 7, 2013 Response filed in connection with U.S. Appl. No. WO WO 2008/009600 A1 1, 2008 13/448, 107. WO WO 2008/022963 2, 2008 Jan. 15, 2013 Office Action issued in connection with U.S. Appl. No. WO WO 2008/O25068 6, 2008 13/448, 107. WO WO 2008.128241 10, 2008 9, 2013 Notice of Allowance issued in connection with U.S. Appl. WO WO 2009/O162O2 2, 2009 No. 13/448,107. US 8,946.460 B2 Page 5

(56) References Cited Huang et al. (2004) “How Insulin Binds: the B-Chain a-Helix Con tacts the L1 b-Helix of the Insulin Receptor J. Mol. Biol. 341:529 OTHER PUBLICATIONS 55O. Lacroix et al. (2008) "Association of the Agrobacterium T-DNA GenBank accession AAR20444, Periera et al. (2003). protein complex with plant nucleosomes' Proc. Natl. Acad. Sci. GenBank accession AAV67797, Meyer et al. (2004). U.S.A. 105: 15429-15434. GenBank accession AAV67799, Meyer et al. (2004). Lu et al. (1993) “High Efficiency Retroviral Mediated Gene GenBank accession AAV67800, Meyer et al. (2004). Transduction into Single Isolated Immature and 1-Replatable GenBank accession AB094747. Grigoriev et al. (2007). CD34" Hematopoietic Stem/Progenitor Cells from Human Umbili GenBank accession ABP49078, Liat al. (2007). cal Cord Blood” J. Exp. Med. 178:2089-2096. GenBank accession AF390.174, Qi at al. (2001). Matzke et al. (2001) “RNA: Guiding Gene Silencing Science GenBank accession BAD 11952, Oura and Kajiwara (2003). 293:1086-1083. GenBank accession CA158897, Zank at al. (2005). Meng et al. (2008) "Hibiscus chlorotic ringspot virus coat protein GenBank accession XP C01421073 Grigoriev at al. (2007). inhibits trans-acting Small interfering RNA biogenesis in Abdullah et al. (1986) “Efficient Plant Regeneration from Rice Arabidopsis” J. Gen. Viral. 89:2349-2358. Protoplasts Through Somatic Embryogenesis' Biotech. 4:1087-90. Niedzetal (1995) “Green fluorescent protein: an in vivo reporter of Bates at al. (2007) “Incorporation of Newly Synthesized Fatty Acids plant gene expression' Plant Cell Reports. 14:403-406. into Cytosolic Glycerolipids in Pea Leaves Occurs via Acyl Editing” Ohlrogge and Jaworski (1997) “Regulation of Fatty Acid Synthesis” J. Biol. Chem. 282:31206-31216. 48:109-136. Baumberger at al. (2007) “The Polerovirus Silencing Suppressor Po Petrie et al. (2010) “Isolation and Characterisation of a High-Effi Targets Argonaute Proteins for Degradation” Curr, Biol. 17:1609 ciency DeSaturase and Elongases from Microalgae for Transgenic 1614. LC-PUEA Production Mar Biotechnol 12:430-438. Bligh and Dyer (1959) “Orange-red Flesh in Cod and Haddock” Potenza at al. (2004) “Targeting Transgene Expression in Research, Canadian J. Biochem. 37: 911-917. Agricultural, and Environmental Applications: Promoters Used in Brodersen at al. (2008) “Widespread Translational Inhibition by Plant Transformation. In Vitro Cell Dev Biol.-Plant 40:1-22. Plant miRNAS and siRNAs Science 320:1185-1190. Rose at al. (1998) "Consensus-degenerate hybrid oligonucleotide Brosnan at al. (2007) “Nuclear gene silencing directs reception of primers for amplification of distantly related sequences' Nucleic long-distance mRNA silencing in Arabidopsis” Proc. Natl. Acad. Sci Acids Res. 26:1628-1635. U.S.A. 104:14741-14746. Saha et al. (2006) "Cytosolic Triacylglycerol Biosynthetic Pathway Chapman et al. (2004) "Transgenic Cotton Plants with Increased in Oilseeds. Molecular Cloning and Expression of Peanut Cytosolic Seed Oleic Acid Content Gen. Dev. 18:1179-1186. Diacylglycerol Acyltransferase' Plant Physiol. 141: 1533-1543. Cheng et al. (1996) “Production of fertile transgenic peanut (Arachis Sayanova et al. (2007) “Cloning and characterization of unusual fatty hypogaea L.) plants using Agrobacterium tumefaciens” Plant Cell acid desaturases from Anemone leveillei: identification of an acyl Rep. 15:653-657. coenzyme a C20 Delta5-desaturase responsible for the synthesis of Chung et al. (2006) “Effect of 5'UTR introns on gene expression in sciadonic acid” Plant Physiol 144:455-467. Arabidopsis thaliana” BMC Genomics 7:120. Schubert et al. (2004) “Silencing in Arabidopsis T-DNA Clapp (1993) “The 16-Kilodalton N-Terminal Fragment of Human Transformants: The Predominant Role Of A Gene-Specific RNA Prolactin Is a Potent Inhibitor of Angiogenesis' Clin. Perinatol. Sensing Mechanism versus Position Effects' Plant Cell 16:2561 20:155-168. 2572. Curiel at al. (1992) "High-Efficiency Gene Transfer Mediated by Suiyun et al. (2004) “Introgression of salt-tolerance from somatic Adenovirus Coupled to DNA-Polylysine Complexes' Hum. Gen. hybrids between common wheat and Thinapyrum ponticum” Plant Ther. 3:147-154. Science 773-779. Darji et all (1997) “Oral Somatic Transgene Vaccination Using Stalkeretal (1988)“Purification and Properties of a Nitrilase Specific Attenuated S. typhimurium” Cell 91:765-775. for the Herbicide Bromoxynil and Corresponding Nucleotide Denic and Weissman (2007) "A Molecular Caliper Mechanism for Sequence Analysis of the byn Gene” J. Biol. Chem. 263:6310-6314. Determining Very Long-Chain Fatty Acid Length” Cell 130:663 Thillet et el (1988) "Site-directed Mutagenesis of Mouse 677. Dihydrofolate Reductase” J. Biol. Chem 263:12500-12508. Ding and Voinnet (2007) “Antiviral Immunity Directed by Small Toriyama et al. (1986) “Haploid and diploid plant regeneration from RNAS' Cell 130:413-426. protoplasts of anther callus in rice' Theor. Appl. Genet. 205:34. Fennelly et al. (1999) “Mucosal DNAVaccine Immunization Against Tvrdik (2000) “Role of a New Mammalian Gene Family in the Measles with a Highly Attenuated Shigella flexneri Vector” J. Biosynthesis of Very Long Chain Fatty Acids and Sphingolipids' J. Immuhol. 162:1603-1610. Cell Biol. 149:707-718. Fraser et al. (2004) “Expression of the Isochrysis C18-A Polyun Tzfira & Citovsky (2006) "Agrobacterium-mediated genetic trans Saturated Fatty Acid Specific Elongase Component Alters formation of plants: biology and biotechnology” Curt. Opin. Biotech. Arabidopsis Glycerolipid Profiles' Plant Physiol 135:859-866. 17: 147-154. Gleave (1992) “A versatile binary vector system with a T-DNA Voinnet et al., (2003) “An enhanced transient expression system in organisational structure conducive to efficient integration of cloned plants based on Suppression of gene silencing by the p19 protein of DNA into the plant genome” Plant Mol. Biol. 20:1203-1207. tomato bushy stunt virus' Plant J. 33:949-956. Glevin etal (2003)"Agrobacterium-Mediated Plant Transformation: Watts and Browse (1999b) “A Palmitoyl-CoA-Specific A9 Fatty Acid the Biology behind the 'Gene-Jockeying Tool” Microbiol. Mol. Desaturase from Caenorhabditis elegans' Arch. Biochem. Biophys. Biol. Rev. 67:16-37. 362; 175-182. Grantet al. (1995)“Transformation of peas (Pisum sativum L.) using Yang et al. (2003) “Expression and localization of human lysozyme immature cotyledons' Plant Cell Rep. 15:254-258. in the endosperm of transgenic rice' Planta. 216:597-603. Harayama (1998) “Artificial evolution by DNA shuffling Trends Zhang et al. (2006) “Cucumber mosaic virus-encoded 2b suppressor Biotechnol. 16: 76-82. inhibits Arabidopsis Argonautel cleavage activity to counter plant Hense et al. (2001) “Eukaryotic expression plasmid transfer from the defense” Genes & Development 20:3255-3268. intracellular bacterium Listeria monocytogenes to host cells' Cell Zipfel et al. (2006) “Perception of the Bacterial PAMPEF-Tu by the Microbiol. 3:599-609. Receptor EFR Restricts Agrobacterium-Mediated Transformation” Hoffman etal (2007) “A Small Membrane-peripheral Region Close Ce11 125:749-760. to the Active Center Determines Regioselectivity of Membrane Abbadi, A., et al., (2004) “Biosynthesis. Of Very-Long-Chain Poly bound Fatty Acid Desaturases from Aspergillus nidulans' J. Biol. unsaturated Fatty Acids. In Transgenic Oilseeds: Constraints On Their Chem. 282:26.666-26674. Accumulation.” The Plant Cell, 16(10): 2734-3748 al. US 8,946.460 B2 Page 6

(56) References Cited Brown et al. (2002) Limnanthes douglasii lysophosphatidic acid acyltransferases: immunological quantification, acyl selectivity and OTHER PUBLICATIONS functional replacement of the Escherichia coli plsC gene, Biochem J. 364:795-805. Darnude et al. (2006). Identification of bifunctional delta12/omega;3 Cheng et al. (2010) Towards the production of high levels of fatty acid desaturases for improving the ratio of omega} to omega.6 eicosapentaenoic acid in transgenic plants: the effects of different fatty acids in microbes and plants, Proc Natl Acad Sci USA 103: host species, genes and promoters, Transgenic Res 19: 221-229. 9446-9451. Cho, H.P. et al., (1999) “Cloning. Expression, And Nutritional Regu Domergue et al. (2002), Cloning and functional characterization of lation Of The Mammalian A-6 Desaturase.” The Journal Of Biologi Phaeodactylum tricornutum front-end desaturases involved in cal Chemistry, 274(1): 471-477. eicosapentaenoic acid biosynthesis, Eur, J. Biochem. 269:4105 Cho, H.P. et al., (1999) “Cloning. Expression, And Fatty Acid Regu 4113. lation Of The Human A-5 Desaturase.” The Journal Of Biological Domergue et al., (2003), Acyl Carriers Used as Substrates by the Chemistry, 274(52): 37335-37339. Desaturases and Elongases Involved in Very Long-chain Polyunsatu Denic and Weissman (2007) A molecular caliper mechanism for rated Fatty Acids Biosynthesis Reconstituted in Yeast, J. Biol. Chem. determining very long-chain fatty acid length, Cell 130:663-677. 278; 35115-35126. Garcia-Maroto, F., et al., (2002) “Cloning And Molecular Character Domergue et al. In vivo characterization of the first acyl-CoA ization Of The A6-Desaturase From Two Echium Plant Species: A6-desaturase from a member of the plant kingdom, the microalga Production Of GLA By Heterologous Expression In Yeast And Ostreococcus tauri, Biochem J. 2005, 389, 483-490. Tobacco.” Lipids, 37(4):417-426. Meyer, A., et al., (2003) Biosynthesis. Of Docosahexaenoic Acid in Girke, T., et al., (1998) “Identification of A Novel A6-Acyl-Group Euglena gracilis: Biochemical And Molecular Evidence For The Desaturase By Targeted Gene Disruption. In Physcomitrella patens.” Involvement Of A A4-Fatty Acyl Group Desaturase, Biochemistry, The Plant Journal, 15(1): 39-48. 42(32): 9779-9788. Hastings, N., et al., (2001) "A Vertebrate Fatty Acid Desaturase With Meyer, A., et al., (2004) Novel Fatty Acid Elongases And Their Use A5 and A6 Activities.” Proceedings Of The National Academy of For the Reconstitution OfDocosahexaenoic Acid Biosynthesis, Jour Sciences Of The United States Of America, 98(25): 14304-14309. nal of Lipid Research, 45(10): 1899-1909. Hoffman et al., (2008) "Metabolic Engineering of co3-Very Long Pereira et al. (2004b) Identification of two novel microalgal enzymes Chain Polyunsaturated Fatty Acid Production by an Exclusively involved in the conversion of the omegas-fatty acid, Acyl-CoA-dependent Pathway”. The Journal of Biological Chemis eicosapentaenoic acid, into docosahexaenoie acid, Biochem. J. try, 283:22352-22362. 384:357-366. Hong, H., et al., (2002) “Isolation And Characterization Of A A5 FA Petrie et al. (2010a) Metabolic engineering of omega-3 long-chain Desaturase From Pythium irregulare by Heterologous Expression in polyunsaturated fatty acids in plants using an acyl-CoA Delta6 Saccaromyces cerevisiae And Oilseed Crops.” Lipids, 37(9): 863 desaturase with omega3-preference from the marine microalga 868. Micromonas pusilla, Metab. Eng. 12:233240. Huang, Y, et al., (1999) “Cloning of A12-And A6-Desaturases From Qi, B., et al., (2002) “Identification Of A cDNA Encoding A Novel Mortierella alpina and Recombinant Production of Y-Linolenic Acid C18-A9 Polyunsaturated Fatty Acid-Specific Elongating Activity in Saccharomyces cerevisiae.” Lipids, 34(7): 649-659. From The Docosahexaenolc Acid (DHA)-Producing Microalga, Inagaki, K., et al., (2002) “Identification And Expression Of A Rat Isochrysis galbana.” Federation Of European Biochemical Societies Fatty Acid Elongase Involved In The Biosynthesis. Of C18 Fatty Letters, 510(3): 159-165. Acids.” Bioscience, Biotechnology, and Biochemistry, 66(3): 613 Qiu, X., et al., (2001) “Identification Of A A4 Fatty Acid Desaturase 621. From Thraustochytrium sp. Involved In The Biosynthesis Of Kajikawa, M., et al., (2004) “Isolation And Characterization of Docosahexanoic Acid By Heterologous Expression. In Sac A6-Desaturase. An ELO-Like Enzyme and A5-Desaturase From The charomyces cerveisiae and Brassica juncea.” The Journal of Biologi Liverwort Marchantia polymorpha And Production Of Arachidonic cal Chemistry, 276(34): 31561-31566. And Eicosapentaenoic Acids. In The Methylotrophic Yeast Pichia Robert et al., Metabolic engineering of Arabidopsis to produce nutri pastoris.” Plant Molecular Biology, 54:335-352. tionally important DHA in seed oil, Functional Plant Biology, 2005, Kajikawa et al. (2006) Isolation and functional characterization of vol. 32, p. 473–479. fatty acid delta5-elongase gene from the liverwort Marchantia Singh et al. (2005) Metabolic engineering of new fatty acids in polymorpha L., EBBS Lett580:149-154. plants.Curr. Opin. in Plant Biol. 8:197-203. Knutzon, D.S., et al., (1998) “Identification of A5-Desaturase From Tonon, T., et al., (2003) “Identification Of A Very Long Chain Poly Mortierella alpine By Heterologous Expression. In Bakers'Yeast And unsaturated Fatty Acid A4-Desaturase From The Microalga Pavlova Canola.” The Journal OF Biological Chemistry, 278(45): 29360 lutheri” Federation of European biochemical Societies, 553(3): 440 29366. 444. Lassner (1995) Lysophosphatidic acid acyltransferase from Wood (2009) A leaf-based assay using interchangeable design prin meadowfoam mediates insertion of erucic acid at the sn-2 position of ciples to rapidly assemble multistep recombinant pathways, Plant triacylglycerol in transgenic rapeseed oil, Plant Physiol. 109:1389 Biotechnol J. 7:914-24. 94. Wu et al. (2005) Stepwise engineering to produce high yields of very Leonard, A.E., et al., (2000) “cDNA Cloning And Characterization long-chain polyunsaturated fatty acids in plants, Nat. Biotech. Of Human A5-Desaturase Involved In The Biosynthesis of 23: 1013-1017 (Exhibit 16). Arachidonic Acid.” The Biochemical Journal, 347(Pt3): 719-724. Aqaba, M., et al., (2004)"Zebrafish cDNA Encoding Multifunctional Leonard, A.E., et al., (2000) “Cloning Of A Human cDNA Encoding Fatty Acid Elongase Involved In Production Of Eicosapentaenoic A Novel Enzyme Involved In The Elongation Of Long-Chain Poly (20:5n-3) And Docosahexaenoic (22:6n-3) Acids.” Marine unsaturated Fatty Acids.” The Biochemical Journal, 350(Pt3): 765 Biotechnology, 6(3): 251-261. 770. Armbrust et al. (2004) The genome of the diatom Thalassiosira Meesapyodsuk et al. (2007) Primary structure, regioselectivity, and pseudonana: ecology, evolution, and metabolism, Science 306:79 evolution of the membrane-bound fatty acid desaturases of Claviceps 86. purpurea, J Biol Chem 282: 20191-20199. Berberich, T. et al., (1998) “Two Maize Genes Encoding Omega-3 Michaelson, L.V., et al., (1998) “Isolation Of A A5-Fatty Acid Fatty Acid Desaturase And Their Differential Expression To Tem Desaturase Gene From Mortirella alpina.” The Journal Of Biological perature.” Plant Molecular Biology, 36(2): 297-306. Chemistry, 273(30): 19055-19059. Broun, F., at al., (1998) "A Bifunctional oleate 12-Hydroxylase: Michaelson, L.V., et al., (1998)“Functional Identification Of A Fatty Desaturase From Lesguerella fendleri.” The Plant Journal. 13(2): Acid A5 Desaturase Gene From Caenorhabditis elegans.” Federation 201-210. Of European Biochemical Societies Letters, 439(3): 215-218. US 8,946.460 B2 Page 7

(56) References Cited Zank, T.K., et al., (2002) “Cloning and Functional Characterization of an Enzyme Involved in the Elongation of A6-Polyunsaturated OTHER PUBLICATIONS Fatty Acids From The Moss Physcomitrella patens.” The Plant Jour nal, 31(3): 255-268. Napier, J.A., et al., (1998) “Identification Of A Caenorhabditis Zhang, Q., at al., (2004) “Identification And Characterization Of A elegans A6-Fatty-Acid-Desaturase By Heterologous Expression. In Novel A6-Fatty Acid Desaturase Gene Rhizopus arrhizus.” Federa Saccharomyces cerevisiae.” The Biochemical Journal, 330(Pt 2): tion of European Biochemical Societies Letters, 556(1-3): 81-85. 611-614. Zhang et al. (2007a) Identification of a novel bifunctional delta12/ Parker-Barnes, J.M., et al., (2000) “Identification And Characteriza delta15 fatty acid desaturase from a basidiomycete, Coprinus tion Of An Enzyme Involved In The Elongation Of n-6 And n-3 cinereus TD#822-2, FEBS Letters 581: 315-319. Polyunsaturated Fatty Acids.” Proceedings Of The National Acad Zhang et al. (2008) Identification and characterization of a novel emy Of Sciences Of the United States of America, 97(15): 8284 yeast omegas-fatty acid desaturase acting on long-chain n-6 fatty 8289. acid substrates from Pichia pastoris, Yeast 25: 21-27. Pereira, S.L., at al., (2004) “A Novel omega3-Fatty Acid Desaturase Mar. 7, 2012 presentation at the CSIRO Marine and Atmospheric Involved in the Biosynthesis of Eicosapentaenoic Acid.” The Bio Research. Science Forum, Hobart (poster presentation) at Hobart, chemical Journal, 378 (Pt 2): 665-671. Australia, entitled “New Land Plants Containing Long-chain Petrie et al. (2012) Transgenic production of arachidonic acid in Omega-3 Oils' presented by Peter Nichols, first author, Peter oilseeds, Transgenic Res. 21:139-147. Nichols. Qi et al., (2004) “Production of Very Long Chain Polyunsaturated Jun. 8, 2012 presentation at the GOED Exchange at Boston, MA, Omega-3 and Omega-6 Fatty Acids in Plants', Nature Biotechnology entitled "An Update from Australia: A Global Leader in Long-Chain 22:739-745 (published online May 16, 2004). Omega-3” presented by Peter Nichols, first author, Peter Nichols, 34 Reddy, A.S., et al., (1993) “Isolation OfAA6-Desaturase Gene From slides. The Cyanobacterium synechocystis sp. Strain PCC6803 By Gain-Of Jul. 2, 2012 presentation at the Australian Marine Scientists Associa Function Expression in Anabaena sp. Strain PCC7120.” Plant tion, Annual Meeting, 2012 at Hobart, Australia, entitled “New Land Molecular Biology, 27: 293-300. Plants With Long-Chain Omega-3 Oils: A journey from marine gene Robert et al. (2009) Isolation and characterisation of a delta5-fatty discovery to sustainable sources of health-benefitting oils' presented acid elongase from the marine microalga Pavlova salina, Marine by Peter Nichols, first author, Peter Nichols, 21 slides. Biotech 11:410-418. Jul. 13, 2012 presentation at the 20th International conference on Saito, T., et al., (2000) “A Second Functional A5 Fatty Acid plant lipids at Seville, Spain, entitled "Metabolic engineering plant Desaturase InTheCellular Slime Mould Diotyosteliurn discoideum.” seeds with fish oil-like levels of DHA’ presented by James Petrie, European Journal of Biochemistry, 267(6): 1813-1818. first author, James Petrie, 41 slides. Sato et al. (2004) Production of gamma-Linolenic Acid Stearidonic Jul. 16, 2012 presentation at the Australian Institute of Food Science Acid in Seeds of Marker-Free Transgenic Soybean, CropSci. 44: and Technology, Annual Meeting, 2012 at Adelaide, Australia, 646-652. entitled “New Sustainable land plant sources of long-chain omega-3 Sayanova et al. (2006) A bifunctional Delta12.Delta15-desaturase oils' presented by Peter Nichols, first author, Peter Nichols,26 slides. from Acanthamoeba castellanii directs the synthesis of highly Aug. 2, 2012 presentation at the UniGateway, Business breakfast unusual n-I series unsaturated fatty acids, J Biol Chem 281: 36533 series at Melbourne, Australia, entitled “Trends and sustainability of 36541. LC omega-3 oils from wild and farmed fish, and Progress with new Sayanova, O.V., et al., (1997) “Expression Of A Borage Desaturase land plant sources' presented by Peter Nichols, first author, Peter cDNA Containing AnN-Terminal Cytochrome b5Domain Results. In Nichols, 10 slides. The Accumulation Of High Levels of A6-Desaturated Fatty Acids. In Sep. 26, 2012 presentation at the ComBio-Plants and Human Nutri Transgenic Tobacco.” Proceedings Of The National Academy Of tion Symposium, 2012 at Adelaide, Australia, entitled “Creating Sciences Of The United States Of America, 94(8): 4211-4216. Land Plant-Based Sustainable Sources of Essential Long Chain Sayanova, O.V., et al., (2003) “Identification Of Primula Fatty Acid Omega-3 Fatty Acids' presented by Peter Nichols, first author, James A6-Desaturases with n-3 Substrate Preferences.' Federation of Euro Petrie, 24 slides. pean Biochemical Societies, 542: 100-10. Oct. 9, 2012 presentation at the Invited seminar, Department of Plant Sayanova et al. (2006) Identification of Primula "front-end” Science, University of Tasmania at Hobart, Australia, entitled “The desaturases with distinct n-6 or n-3 Substrate preferences, Planta Omega-3 Oils story—Sources of Long-chain Omega-3: A Sustain 224:1269-1277. able Future” presented by Peter Nichols, first author, Peter Nichols, Singhetal. (2005) Metabolic engineering of new fatty acids in plants, 39 slides. Curr. Opin. in Plant Biol. 8: 197-203. Nov. 14, 2012 presentation at the Novel sources of omega-3, Sperling et al. (2001) Functional identification of a delta8 Copenhagen 2012 at Copenhagen, Denmark, entitled "Metabolic sphingolipid desaturase from Borago officinalis, Arch. Biochm. engineering plant seeds with fish oil-like levels of DHA’ presented Biophys. 388:293-8. by James Petrie, first author, James Petrie, 35 slides. Sprecher, H., et al., (1995) “Reevaluation of the Pathways For The Mar. 13, 2013 presentation at the Invited seminar, The Biological Biosynthesis. Of Polyunsaturated Fatty Acids,” Journal of Lipid Club, Hobart at Hobart, Australia, entitled “The Omega-3 Oils Research, 36(12): 2471-2477. story—Sources of Long-chain Omega-3: A Sustainable Future' pre Spychalla, J.P. et al., (1997) “Identification of an animal omega-3 sented by Peter Nichols, first author, Peter Nichols, 39 slides. Fatty Acid Desaturase By Heterologous Expression in Arabidopsis.” Written Opinion of the International Search Authority, issued Apr. 1, Proceedings of the National Academy of Sciences of the United 2010 in connection with PCT International Application Publication States of America, 94(4): 1142-1147. No. PCTAU2009/001488. Trautwein, E.A. (2001) “n-3 Fatty Acids—Physiological And Tech International Search Report, issued Apr. 1, 2010 in connection with nical Aspects For Their Use In Food.” European Journal of Lipid PCT International Application Publication No. PCT/AU2009/ Science and Technology, 103(1): 45-55. OO1488. Wallis, J.G. and Browse, J., (1999) “The A8-Desaturase Of Euglena PCT International Search Report issued Apr. 1, 2010 for WO 2010/ gracilis: An Alternate Pathway For Synthesis. Of 20-Carbon Polyun O57246. saturated Fatty Acids.” Archives of Biochemistry and Biophysics, PCT International Preliminary Report on Patentability issued Oct. 365(2): 307-316. 25, 2006 for WO 2005/103253. Watts, J.L. and Browse, J., (1999) “Isolation And Characterization Of Supplementary European Search Reportissued on Apr. 1, 2008 by the A A5-Fatty Acid Desaturase From Caenorhabditis elegans.” European Patent Office in connection with related International Archives of Biochemistry and Biophysics, 362(1): 175-182. Application No. PCT/AU2005/000571. US 8,946.460 B2 Page 8

(56) References Cited Dec. 5, 2011 Accelerated Examination Support Document, filed in connection with U.S. Appl. No. 13/311,240. OTHER PUBLICATIONS Dec. 5, 2011 Pre-Examination Search Document, filed in connection with U.S. Appl. No. 13/311,240. International Search Report issued Jun. 23, 2005 in connection with Feb. 6, 2012 Communication, filed in connection with U.S. Appl. No. PCT International Application No. PCT/AU05/000571, filed Apr. 22, 13/311,240. 2005. Feb. 17, 2012 Notice of Allowance, issued in connection with U.S. Requirement for Restriction/Election issued Mar. 5, 2007 in connec Appl. No. 13/311,240. tion with U.S. Appl. No. 11/112,882. Feb. 1, 2012 Non-Final Office Action, issued in connection with U.S. Response to Requirement for Restriction/Election filed May 7, 2007 Appl. No. 13/243,747. in connection with U.S. Appl. No. 1 1/112,882. May 1, 2012 Amendment, filed in connection with U.S. Appl. No. Final Office Action issued Oct. 11, 2007 in connection with U.S. 13/243,747. Appl. No. 1 1/112,882. Jul. 6, 2012 Notice of Allowance, issued in connection with U.S. Response to Non Final Office Action filed Oct. 31, 2007 in connec Appl. No. 13/243,747. tion with U.S. Appl. No. 11/112,882. Dec. 7, 2012 Office Action, issued in connection with U.S. Appl. No. Notice of Informal or Non-Responsive Amendment issued Feb. 26, 13/448, 107. 2008 in connection with U.S. Appl. No. 1 1/112,882. May 9, 2013 Notice of Allowance, filed in connection with U.S. Appl. Response to Office Action filed Mar. 11, 2008 in connection with No. 13/448,107. U.S. Appl. No. 1 1/112,882. Mar. 11, 2013 Office Action, issued in connection with U.S. Appl. Non-Final Office Action issued Jun. 17, 2008 in connection with U.S. No. 13/651,275. Appl. No. 1 1/112,882. Certik M. and Shimizu S. Biosynthesis and regulation of microbial Response to Non-Final Office Action filed Oct. 17, 2008 in connec polyunsaturated fatty acid production. J. Biosci Bioeng, 1999; tion with U.S. Appl. No. 11/112,882. 87(1):1-14. Final Office Action issued Apr. 1, 2009 in connection with U.S. Appl. Damude et al., (2007) “Engineering Oilseed Plants for a Sustainable, No. 1 1/112,882. Land-Based Source of Long Chain Polyunsaturated Fatty Acids' Response to Final Office Action filed Jul. 1, 2009 in connection with Lipids, 42:179-185. U.S. Appl. No. 1 1/112,882. Domergue et al., (2003), Acyl Carriers Used as Substrates by the Notice of Allowance issued Aug. 21, 2009 in connection with U.S. Desaturases and Elongases Involved in Very Long-chian Polyunsatu Appl. No. 1 1/112,882. rated Fatty Acids Biosynthesis Reconstituted in Yeast, J. Biol. Chem. Restriction Requirement issued Apr. 30, 2009 in connection with 278; 35115-35126. U.S. Appl. No. 1 1/587,092. Hoffmann at al., (2008) "Metabolic Engineering of co3-Very Long Response to Restriction Requirement filed Jun. 30, 2009 in connec Chain Polyunsaturated Fatty Acid Production by an Exclusively tion with U.S. Appl. No. 1 1/587,092. Acyl-CoA-dependent Pathway” The Journal of Biological Chemis Non-Final Office Action issued Nov. 17, 2009 in connection with try, 283:22352-22362. U.S. Appl. No. 1 1/587,092. Kajikawa M. et al., Isolation and characterization of delta(6)- Examiner Interview Summary Record Feb. 22, 2010 in connection desaturase, an ELO-like enzyme and delta(5)-desaturase from with U.S. Appl. No. 1 1/587,092. liverword Marchantia polymorpha and production of arachidonic Response to Non-Final Office Action, filed Mar. 17, 2010 in connec and eicosapentaenoic acids in the methylotrophic yeast Pichia tion with U.S. Appl. No. 1 1/587,092. pastoris. Plant Mol Biol, 2004; 54(3):335-52. Jul. 2, 2010 Notice of Allowance in connection with U.S. Appl. No. Marquardt et al., (2000) “cDNA cloning, genomic structure, and 1 1/587,092. chromosomal localization of three members of the human fatty acid Office Action issued by the U.S. Patent Office on Dec. 28, 2010 in desaturase family Genomics, 66(2): 175-83. connection with U.S. Appl. No. 12/661,978. Qi et al., (2004) “Production of very long chain polyunsatured Response to Office Action, filed Jan. 25, 2011 in connection with U.S. omega-3 and omega-6 fatty acids in plants' Nature Biotechnology Appl. No. 12/661,978. 22:739-745 (published online May 16, 2004). Final Office Action, issued Apr. 18, 2011 in connection with U.S. Qiu et al. (2001) GenBank Accession No. AF489589, NCBI p. 1. Appl. No. 12/661,978. Qiu, X., et al., (2001) “Identification of a A4 Fatty Acid Desaturase Interview Summary Record, issued May 24, 2011 in connection with from Thraustochytrium sp. Involved in the Biosynthesis of U.S. Appl. No. 12/661,978. Docosahexanoic Acid by Heterologous Expression in Sac Response to Final Office Action, filed Jun. 16, 2011 in connection charomyces cerevisiae and Brassica iuncea.” The Journal of Biologi with U.S. Appl. No. 12/661,978. cal Chemistry, 276(34): 31561-31566. Notice of Allowance, issued Sep. 1, 2011 in connection with U.S. Sayanova O.V. and Napier J.A., Eicosapentaenoic acid: biosynthetic Appl. No. 12/661,978. routes and the potential for synthesis in transgenic plants. Non-Final Office Action issued Jan. 5, 2011 in connection with U.S. Phytochemistry, 2004; 65(2): 147-58. Appl. No. 12/945,708. Truksa et al., (2006) “Metabolic Engineering of Plants to Produce Response to Non-Final Office Action filed Jan. 10, 2011 in connec Very Long-Chain Polyunsaturated Fatty Acids'. Transgenic tion with U.S. Appl. No. 12/945,708. Research, 15:131-137. Notice of Allowance, issued Feb. 11, 2011 in connection with U.S. Notification of European publication number issued Jan. 31, 2007 in Appl. No. 12/945,708. connection with European Patent Application No. 0573.3657.0. Accelerated Examination Support Document, filed Apr. 25, 2011 in Supplementary European Search Report issued Apr. 1, 2008 in con connection with U.S. Appl. No. 13/093,252. nection with European Patent Application No. 05733.657.0. Pre-Examination Search Document, filed Apr. 25, 2011 in connection Communication Pursuant to Article 94(3) EPC issued Feb. 12, 2009 with U.S. Appl. No. 13/093,252. in connection with European Patent Application No. 0573.3657.0. Non-Final Office Action, issued Aug. 30, 2011 in connection with Response to Communication from the Examining Division, filed Oct. U.S. Appl. No. 13/093,252. 22, 2009 in connection with European ApplicationNo. EP05733.657. Examiner Interview Summary, issued Sep. 13, 2011 in connection O. with U.S. Appl. No. 13/093,252. Communication from the Examining Division issued by the Euro Amendment in Response to Office Action and Summary of Examiner pean Patent Office on Aug. 18, 2010 in connection with European Interview, filed Sep. 16, 2011 in connection with U.S. Appl. No. Application No. EP 05733.657.0. 13/093,252. Response to Communication from the Examining Division, filed Feb. Notice of Allowance, issued Oct. 7, 2011 in connection with U.S. 3, 2011 in connection with European Application No. EP 0573.3657. Appl. No. 13/093,252. O. US 8,946.460 B2 Page 9

(56) References Cited Response to Chinese Examination Report filed Sep. 15, 2010 in connection with Chinese Patent Application No. 20058.0020696.3. OTHER PUBLICATIONS Nov.30, 2011 Request for Re-Examination filed in connection with Chinese Patent Application No. 20058.0020696.3, including English Communication from the Examining Division issued by the Euro language translation of Submitted claims. pean Patent Office on Apr. 6, 2011 in connection with European Aug. 18, 2011 Decision of Rejection issued by the Chinese Patent Application No. EP 05733.657.0. Office in connection with Chinese Patent Application No. Examination Report issued Mar. 14, 2012 in connection with corre 20058.0020696.3. sponding European Patent Application No. 05733.657.0. Oct. 17, 2011 Response to Apr. 6, 2011 Communication from the Response to Notification of Re-Examination filed on Oct. 18, 2012 in Examining Division, filed in connection with European Application connection with Chinese Patent Application No. 20058.0020696.3, No EPO573.3657.O. including English language filed claims. Sep. 24, 2012 Response to Mar. 14, 2012 Communication from the Oct. 18, 2012 Request for Reexamination filed in connection with Examining Division, filed in connection with European Application Chinese Patent Application No. 20058.0020696.3. No EPO573.3657.O. Jan. 29, 2013 Office Action issued in connection with Chinese Patent Communication from the Examining Division issued by the Euro Application No. 2012 10006139.8. pean Patent Office on Nov. 9, 2012 in connection with European Brazilian Technical Opinion issued Mar. 1, 2012 in connection with Patent Application No. 05733.657.0. corresponding Brazilian Patent Application No. PI 0510132-8. Apr. 5, 2013 Response filed in connection with European Patent Response filed to Brazilian Technical Opinion filed Mar. 29, 2012 in Application No. 10184533.7. connection with corresponding Brazilian Patent Application No. PI European Search Report, issued by the European Patent Office on Jul. O510132-8. 15, 2011 in connection with European Patent Application No. Nov. 21, 2011 Examination report issued in connection with Cana 111552824. dian Patent Application No. 2,563,875. Extended European Search Report, issued by the European Patent May 22, 2012 Response to Examination Report, filed in connection Office on Oct. 25, 2011 in connection with European Patent Appli with Canadian Patent Application No. 2,563,875. cation No. 111552824. Nov. 23, 2012 Office Action issued in connection with Canadian Sep. 7, 2012 Amendment after receipt of European Search Report, Patent Application No. 2,563,875. filed in connection with European Patent Application No. 11155282. International Search Report issued Nov. 21, 2007 in connection with 4. International Application No. PCT/AU200700 1242, filed Aug. 29. Mar. 11, 2013 Office Action, issued in connection with European 2007 (CSIRO). Patent Application No. 111552824. Written Opinion of the International Searching Authority issued Nov. European Search Report, issued by the European Patent Office on Jul. 21, 2007 in connection with International Application No. PCT/ 15, 2011 in connection with European Patent Application No. A0200700 1242, filed Aug. 29, 2007 (CSIRO). 111553640. Nov. 5, 2013 Office Action, issued in connection with U.S. Appl. No. Extended European Search Report, issued by the European Patent 13/918,399. Office on Oct. 25, 2011 in connection with European Patent Appli Nov. 1, 2013 Office Action, issued in connection with U.S. Appl. No. cation No. 11155364.0. 13/129,940. Sep. 10, 2012 Amendment after receipt of European Search Report, Nov. 21, 2013 Notice of Allowance, issued in connection with U.S. filed in connection with European Patent Application No. 11155364. Appl. No. 14/027,727. O. Nov. 6, 2013 Office Action, issued in connection with U.S. Appl. No, Feb. 13, 2013 Office Action issued in connection with European 13/913,999. Patent Application No. 111553640. Jan. 3, 2013 Response, filed in connection with European Patent European Search Report, issued by the European Patent Office on Application No. 0573.3657.0. Oct. 25, 2011 in connection with European Patent Application No. Dec. 27, 2013 Response, filed in connection with European Patent 11155266.7 Application No. 111552824. Extended European Search Report and Opinion issued Feb. 10, 2012 Dec. 4, 2013 Response, filed in connection with European Patent in connection with corresponding European Divisional Patent Appli Application No. 111553640. cation No. 11155266.7. Jan. 9, 2014 Office Action, issued in connection with Australian Rule 69 EPC Communication issued Mar. 19, 2012 in connection Patent Application No. 2013204296. with European Divisional Patent Application No. 11155266.7. Nov. 21, 2013 Office Action, issued in connection with Chinese Jan. 3, 2013 Response filed in connection with European Patent Patent Application No. 2012 10006139.8. Application No. 11155266.7. Nov. 1, 2013 Office Action, issued in connection with Canadian Examination Report, issued by the Australian Patent Office on Sep. 6. Patent Application No. 2,563,875. 2012 in connection with Australian Patent Application No. Mar. 29, 2012 Extended European Search Report and Search Opinion 2O11232757. issued in connection with European Patent Application No. Australian Examination Report issued Nov. 16, 2009 in connection O9827O358. with Australian Patent Application No. 2005235627. Oct. 29, 2012 Response to European Search Opinion filed in connec Australian Examination Report issued Mar. 14, 2011 in connection tion with European Patent Application No. 09827035.8. with Australian Patent Application No. 2005235627. Jun. 8, 2012 Australian Examination Report issued in connection Response to Australian Examination Report filed Feb. 25, 2011 in with Australian Patent Application No. 2009317860. connection with Australian Patent Application No. 2005235627. Jan. 14, 2013 Chinese First Office Action issued in connection with Response to Australian Examination Report filed Apr. 19, 2011 in Chinese Patent Application No. 200980 154876.9. connection with Australian Patent Application No. 2005235627. Jun. 22, 2011 New Zealand Examination Report issued in connection Australian Examination Report issued May 16, 2011 in connection with New Zealand Patent Application No. 593097. with Australian Patent Application No. 2005235627. Dec. 11, 2012 Response to New Zealand Examination Reportfiled in Response to Australian Examination Report filed Jun. 14, 2011 in connection with New Zealand Patent Application No. 593,097. connection with Australian Patent Application No. 2005235627. Jan. 3, 2013 New Zealand Examination Report issued in connection Chinese Examination Report issued Apr. 10, 2009 in connection with with New Zealand Patent Application No. 593097. Chinese Patent Application No. 20058.0020696.3. Jan. 8, 2013 Response to New Zealand Examination Report filed in Response to Chinese Examination Report filed Jul. 21, 2009 in con connection with New Zealand Patent Application No. 593,097. nection with Chinese Patent Application No. 20058.0020696.3. Supplemental European Search Report and Search Opinion issued Chinese Examination Report issued Apr. 30, 2010 in connection with Jun. 24, 2010 in connection with European Patent Application No. Chinese Patent Application No. 20058.0020696.3. O7784.864.6. US 8,946.460 B2 Page 10

(56) References Cited Cahoonetal. (2001) "Formation of conjugated A8,A10-double bonds by Al2-oleic-acid desaturase-related enzymes' The Journal of Bio OTHER PUBLICATIONS logical Chemistry, 276(4), 2637-2643. Cahoon et al. (2000) “Production of fatty acid components of Response filed to European Search Opinion on Jan. 19, 2011 in meadowfoam oil in somatic soybean embryos' Plant Physiology, connection with European Patent Application No. 07784864.6. 124, 243-251. European Examination Report issued Jul. 18, 2011 in connection Cahoon et al. (1992) “Expression of a coriander desaturase results in with European Patent Application No. 07784864.6. petroselinic acid production in transgenic tobacco” Proc. Natl. Acad. Response filed to European Examination Report on May 15, 2012 in Sci. USA, 89, 11184-11188. connection with European Patent Application No. 07784864.6. Capecchi (1980) “High Efficiency Transformation by Direct Australian Examination Report issued Jul. 25, 2012 in connection Microinjection of DNA into Cultured Mammalian Cells' Cell with Australian Patent Application No. 2007291937. 22:479-488. Zealand Examination Report issued Jul. 29, 2010 in connection with Chapman et al. (2001) "Transgenic Cotton Plants with Increased New Zealand Patent Application No. 575809. Seed Oleic Acid Content” Journal of American Chemists' Chemistry; Response filed to New Zealand Examination Report filed Dec. 23. vol. 78 No. 9,941-947. 2011 in connection with New Zealand Patent Application No. Chen et al. (2004) “Introgression of Salt-Tolerance From Somatic 575809. Hybrids Between common Wheat and Thinopyrum Ponticum” Plant Zealand Examination Reportissued Jan. 24, 2012 in connection with Science 167:773-779. New Zealand Patent Application No. 575809. Cheng et al. (1996) “Production offertile transgenic peanut (Arachis Chinese Office Action issued May 17, 2011 in connection with Chi hypogaea L.) plants using Agrobacterium tumefaciens' Plant Cell nese Patent Application No. 200780040245.5, including English Reports, 15,653-657. Language translation. Chikwambaetal. (2003)“Localization of a bacterial protein in starch , sponse filed to Chinese Office Action on Nov.30, 2011 in connection granules of transgenic maize kernels' Proc. Natl. Acad. Sci. U.S.A. with Chinese Patent Application No. 200780040245.5, including 100:11127-11132. English Language translation of claims. Chung et al. (2006) “Effect of 5'UTR introns on gene expression in Second Chinese Office Action issued Jun. 6, 2012 in connection with Arabidopsis thaliana” BMC Cenomics 7:120. Chinese Patent Application No. 200780040245.5, including English Clapp et al. (1993) “The 16-Kilodalton N-Terminal Fragment of Language translation. Human Prolactin is a Potent Inhibitor of Angiogenesis' Endocrinol Response filed to Second Chinese Office Action on Oct. 22, 2012 in ogy, 133(3): 1292-1299. connection with Chinese Patent Application No. 200780040245.5. Coutu et al. (2007) “pORE: a modular binary vector series suited for Third Chinese Office Action issued Feb. 17, 2013 in connection with both monocot and dicot plant transformation' Transgenic Res. 16: Chinese Patent Application No. 200780040245.5, including English 771-781. Language translation. Cripps (1990) “The A12-desaturase from the house cricket, Acheta Response filed to Chinese Office Action on Jul. 4, 2013 in connection domesticus (orthoptera: gryllidae): characterization and form of the with. Chinese Patent Application No. 200780040245.5. Substrate” Archives of Biochemistry and Biophysics, 278(1), 46-51. Abdullah et al. (1986) “Efficient plant regeneration from rice Dec. 7, 2012 Office Action, issued in connection with U.S. Appl. No. protoplasts through somatic embryogenesis' Biotechnology, 4. 13,498, 107. 1087-1090. Jan. 7, 2013 Response, filed in connection with U.S. Appl. No. Al-Mariri et al. (2002) “Yersinia enterocolitica as a Vehicle for a 13/448, 107. Naked DNA Vaccine Encoding Brucella abortus Bacterioferritin or Jan. 15, 2013 Office Action, issued in connection with U.S. Appl. No. P39 Antigen” Infect. Immun. 70: 1915-1923. 13/448, 107. Altschul et al. (1997) “Gapped BLAST and PSI-BLAST: a new Apr. 15, 2013 Response, filed in connection with U.S. Appl. No. generation of protein database search programs' Nucleic Acids 13/448, 107. Research, 25(17), 3389-3402. 2013 Notice of Allowance, filed in connection with U.S. Appl. No. Alvarez et al. (2000) “Silencing of HMW glutenins in transgenic 13/448, 107. wheat expressing extra HMW subunits' Theor Appl Genet 100:319 Jun. 11, 2013 Response, filed in connection with U.S. Appl. No. 327. 13/651,275. Badamietal. (1980) “Structure and occurrence of unusual fatty acids Aug. 16, 2013 Notice of Allowance, issued U.S. Appl. No. in minor seed oils' Prog. Lipid Res., 19, 119-153. 13/651,275 in connection with Feb. 25, 2014. Bates et al. (2007) “Incorporation of Newly Synthesized Fatty Acids Sep. 6, 2013 Response to Australian Examination report, filed in into Cytosolic Glycerolipids in Pea Leaves Occurs via Acyl Editing” connection with Australian Patent Application No. 2011232757. J. Biol. Chem. 282:31206-31216. Aug. 13, 2013 Response to Chinese Office Action, filed in connection Baumberger et al. (2007) “The Polerovirus Silencing Suppressor PO with Chinese Patent Application No. 2012 100061398. Targets ARGONAUTE Proteins for Degradation” Curr. Biol. Aug. 12, 2013 Response, filed in connection with U.S. Appl. No. 17:1609-1614. 12/310,645. Beclin et al. (2002) “A Branched Pathway for Transgene-Induced Oct. 22, 2013 Office Action, issued in connection with U.S. Appl. No. RNA Silencing in Plants’ Curr. Biol. 12:684-688. 12/310,645. Bligh and Dyer, (1959) “Orange-red Flesh in Cod and Haddock” J. Jul. 17, 2013 Response, filed in connection with U.S. Appl. No. Fish. Res. Bd. Canada, 16(4):449-452. 13/044,984. Bortolamioletal. (2007) “The Polerovirus F Box Protein POTargets Jul. 26, 2013 Advisory Action, issued in connection with U.S. Appl. ARGONAUTE 1 to Suppress RNA Silencing Euro. J. Biochm. No. 13/044.984. 267:85-96. Aug. 7, 2012 Response, filed in connection with U.S. Appl. No. Bouvier (2000) “Identification of neoxanthin synthase as a 13/044,984. carotenoid Eur J. Biochem. 267:6346-6352. Dec. 2, 2013 Office Action, issued in connection with U.S. Appl. No. Brodersen et al. (2008) “Widespread Translational Inhibition by 13/044,984. Plant miRNAS and siRNAs Science 320:1185-1190. International Preliminary Report on Patentability, issued May 24, Brosnan et al. (2007) “Nuclear gene silencing directs reception of 2011 in connection with PCT International Application Publication long-distance mRNA silencing in Arabidopsis” Proc. Natl. Acad. Sci No. PCTAU2009/001488. U.S.A. 104; 14741-14746. Petrie et al. (2013) “Engineered oilseed crops with fish oil DHA Broun et al. (1998) "A bifunctional oleate 12-hydroxylase: levels” Inform, 24(10):648-652. desaturase from Lesquerella fendleri”. Tthe Plant Journal. 13(2), 201 Dec. 6, 2013 International Search Report, issued in connection with 210. PCT International Patent Application No. PCT/AU2013/000639. US 8,946.460 B2 Page 11

(56) References Cited Dobson & Christie (2002) “Mass spectrometry of fatty acid deriva tives' Eur, J. Lipid Sci. Technol. 104, 36-43. OTHER PUBLICATIONS Dunoyer et al. (2004) “Probing the MicroRNA and Small Interfering RNA Pathways with Virus-Encoded Suppressors of RNA Silencing” Dec. 6, 2013 Written Opinion of the International Searching Author The Plant Cell 16:1235-1250. ity, issued in connection with PCT International Patent Application Eglitisetal. (1988) “Retroviral Vectors for Introduction of Genes into No. PCTAU2013,000639. Mammalian Cells' Biotechniques 6:608-614. Chen et al. (2010) “Missa Is a Highly Efficient in Vivo DNA Assem Eigenheer et al (2002) “Isolation and molecular characterization of bly Method for Plant Multiple-Gene Transformation' Plant Physiol Musca domestica delta-9 desaturase sequences' Insect Molecular ogy, vol. 153, pp. 41-51. Biology 1 1(6):533-542. Hu et al. (2008) “Microalgal triacylglycerols as feedstocks for Fay & Richli (1991) “Location of double bonds in polyunsaturated biofuel production: perspectives and advances' The Plant Journal, fatty acids by gas chromatography—mass spectrometry after 4.4- 54, 621-639. dimethyloxazoline derivatization” Journal of Chromatography, 541, Lenihan-Geels et al. (2013) “Alternative Sources of Omega-3 Fats: 89-98. Can We Find a Sustainable Substitute for Fish?' Nutrients, 5, 1301 Fennelly et al. (1999) “Mucosal DNAVaccine Immunization Against 1315. Measles with a Highly Attenuated Shigella flexneri Vector” J. Lin et al. (2003) “Efficient linking and transfer of multiple genes by Immunol. 162:1603-1610. a multigene assembly and transformation vector system” PNAS, Fraser et al. (2004) “Expression of the Isochrysis C18-A9 Polyun 100(10): 5962-5967. Saturated Fatty Acid Specific Elongase Component Alters Petrie et al. (2011) “Expanding the docosahexaenoic acid food web Arabidopsis Glycerolipid Profiles' Plant Physiol. 135:859-866. for Sustainable production: engineering lower plant pathways into Fritsche et al. (1999) “Isolation and characterization of a calendic higher plants' AoB Plants Article plr011 (doi:10.1093/aobpla acid producing (8,11)-linoleoyl desaturase” FEBS Letters, 462,249 plr011). 253. Petrie et al. (2012) "Metabolic Engineering Plant Seeds with Fish Fuji et al. (2007) “Arabidopsis Vacuolar Sorting Mutants (green Oil-Like Levels of DHA’ PLoS One, vol. 7, No. 10, e49165. fluorescent seed) Can Be Identified Efficiently by Secretion of Petrie et al. (2010) “Rapid expression of transgenes driven by seed Vacuole-Targeted Green Fluorescent Protein in Their Seeds' Plant specific constructs in leaf tissue: DHA production' Plant Methods Ce11 19:597-609. 6:8 (pp. 1-6). Fujimura et al. (1985) “Regeneration of Rice Plants from Robert et al. (2009) “Isolation and Characterisation of a A5- fatty Acid Elongase from the Marine Microalga Pavlova sauna” Mar Protoplasts' Plant Tissue Culture Lett. 2:74. Biotechnol, 11:410-418. Cleave (1992) “A versatile binary vector system with a T-DNA Ruiz-Lopez et al. (2012) “Enhancing the accumulation of omega-3 organisational structure conducive to efficient integration of cloned long chain polyunsaturated fatty acids in transgenic Arabidopsis DNA into the plant genome” Plant Mol. Biol. 20:1203-1207. thaliana via iterative metabolic engineering and genetic crossing Glevinet al. (2003)"Agrobacterium-Mediated Plant Transformation: Transgenic Res, 21:1233-1243. the Biology behind the 'Gene-Jockeying Tool” Microbiol. Mol. Ryckebosch et al. (2012) “Microalgae as an alternative source of Biol. Rev. 67:16-37. omega-3 long chain polyunsaturated fatty acids' Lipid Technology, Glicket al. (2008) “Interaction with host SGS3 is required for Sup 24(6): 128-130. pression of RNA silencing by tomato yellow leaf curl virus V2 Untergasser et al. (2012) "One-Step Agrobacterium Mediated Trans protein’ Proc. Natl. Acad. Sci U.S.A. 105:157-161. formation of Eight Genes Essential for Rhizobium Symbiotic Sig Graham et al. (1973) “Transformation of Rat Cells by DNA of naling Using the Novel Binary Vector System pHUGE”. PLoS One, Human Adenovirus 5” Virology 54:536-539. vol. 7, No. 10, e47885. Grant at al. (1995)“Transformation of peas (Pisanisativum L.) using Wu et al. (2005)"Stepwise engineering to produce highyields of very immature cotyledons' Plant Cell Reports, 15, 254-258. long-chain polyunsaturated fatty acids in plants' Nature Biotechnol Grillot-Courvalin (1999) “Bacteria as gene delivery vectors for mam ogy, 23(8): 1013-1017. malian cells' Curr. Opin. Biotech. 10:477-481. Zhou et al. (2007) “Isolation and characterization of genes from the Hamilton and Baulcombe (1999) “A Species of Small Antisense marine microalga Pavlova sauna encoding three front-end RNA in Posttranscriptional Gene Silencing in Plants' Science desaturases involved in docosahexaenoic acid biosynthesis' 286:950-952. Phytochemistry 68,785-796. Hao et al. (2002) "Acyl-CoA Z9- and Z10-desaturase genes from a United Kingdom Application No. GB 1206483.8, filed Apr. 12, 2012 New Zealand leafroller moth species' Planotortrix octo. Insect Bio (Rothamsted Research LTD). chemistry and Molecular Biology, 32,961-966. United Kingdom Application No. GB 12221842, filed Dec. 10, 2012 Harayama, S. (1998). Artificial evolution by DNA shuffling. Trends (Rothamsted Research LTD). in Biotechnology, 16(2), 76-82. Crombie et al. (1984) “Origins of conjugated triene fatty acids. The Hense at al. (2001) “Eukaryotic expression plasmid transfer from the biosynthesis of calendic acid by Calendula oficinalis' J. Chem. Soc., intracellular bacterium Listeria monocytogenes to host cells' Cell Chem. Commun., 15,953-955. Microbiol. 3:599-609. Crombie & Holloway (1985) “The biosynthesis of calendic acid, Hoffman et al. (2007) “A Small Membrane-peripheral Region Close octadeca-(8E, 10E, 12Z)-trienoic acid, by developing marigold seeds: to the Active Center Determines Regioselectivity of Membrane origins of (E.E.Z) and (Z.E.Z) conjugated triene acids in higher bound Fatty Acid Desaturases from Aspergillus nidulans' J. Biol. plants' J. Chem. Soc. Perkin Trans. 1, 2425-2434. Chem. 282:26.666-26674. Cuperus & Derksen (1996) "High value-added applications from Horiguchi et al., (1998) “Developmental Regulation Of Genes For vernolic acid” In J. Janick (Ed.), Progress in new crops(pp. 354-356). Microsome And Plastid Omega-3 Fatty Acid Desaturases. In Wheat Alexandria, VA. ASHS Press. (Triticum aestivum L.). Plant and Cell Physiology, 39(5): 540-544. Curiel et al. (1992) "High-Efficiency Gene Transfer Mediated by Horvath et al. (2000) “The production of recombinant proteins in Adenovirus Coupled to DNA-Polylysine Complexes' Hum. Gen. transgenic barley grains” Proc. Natl. Acad. Sci. U.S.A. 97: 1914 Ther. 3:147-154. 1919. Darji et al. (1997) “Oral Somatic Transgene Vaccination Using Huang et al. (2004) “How Insulin Binds: the B-Chain a-Helix Con Attenuated S. typhimurium” Cell 91:765-775. tacts the Ll b-Helix of the Insulin Receptor” J. Mol. Biol. 341:529 de Renobales et al. (1987) “Biosynthesis of linoleic acid in insects' 55O. Trends in Biochemical Sciences, 12,364-366. Johansen and Carrington (2001) “Silencing on the Spot. Induction Ding & Voinett (2007) “Antiviral Immunity Directed by Small and Suppression of RNA Silencing in the Agrobacterium-Mediated RNAS' Cell 130:413-426. Transient Expression System” Plant Physiol. 126-930-938. US 8,946.460 B2 Page 12

(56) References Cited Ow et al. (1986) “Transient and Stable Expression of the Firefly Luciferase Gene in Plant Cells and Transgenic Plants' Science OTHER PUBLICATIONS 234:856-859. Park and Jeong (2005) “Cloning and Functional Expression of cDNA Kang et al. (2008) "Coexpression of Elo-like Enzyme and Encoding Pheromone A9 Acyl-CoA Desaturase of the Tobacco Cut A4-Desaturases Derived from Thraustochytrium aureum ATCC worm, Spodoptera litura (Lepidoptera: Noctuidae).” Entomological 34304 and the Production of DHA and DPA in Pichia pastoris” Research, 35(4):253-263. 13:483-490. Passornet al (1999) “Heterologous Expression of Mucor rouxii A12 Kasschau et al. (2003) “P1/HC-Pro, a Viral Suppressor of RNA Desaturase Gene in Saccharomyces cerevisiae' Biochemical and Silencing, Interferes with Arabidopsis Development and miRNA Biophysical Research Communications 263, 47-51. Function Devel. Cell 4:205-217. Pereira et al. (2004) “Identification of two novel microalgal enzymes Khozin et al. (1997) “Elucidation of the Biosynthesis of involved in the conversion of the Co3-fatty acid, eloosapentaenoic Eicosapentaenoic Acid in the Microalga Porphyridium cruentum” acid, into docosahexaenoic acid Biochem. J. Plant Physiol. 114:223-230. Potenza et al. (2004) “Targeting Transgene Expression in Research, Agricultural, and Environmental Applications: Promoters Used in Kleiman, R., & Spencer, G. F. (Jan. 1982). Search for new industrial Plant Transformation. In Vitro Cell Dev Biol-Plant 40:1-22. oils: XVI. umbelliflorae- seed oils rich in petroselinic acid. Journal of Qiu et al. (2001) “Identification and analysis of a gene from the American Oil Chemists' Society. 59(1), 29-38. Calendula officinalis encoding a fatty acid conjugase' Plant Physi Knipple etal. (2002) “Evolution of the integral membrane desaturase ology, 125, 847-855. gene family in moths and flies' Genetics, 162, 1737-1752. Riddervoldetal. (2002)“Biochemical and molecular characterization Koziel et al. (1996) "Optimizing expression of transgenes with an of house cricket (Acheta domesticus, Orthoptera: Gryllidee) A9 emphasis on post-transcriptional events' Plant Mol. Biol. 32:393 desaturase' Insect Biochemistry and Molecular Biology 32, 1731 405. 1740. Kunik et al. (2001) “Genetic transformation of HeLa cells by Rodriguez et al. (2004) “Expression and evolution of A9 and A11 Agrobacterium” Proc. Natl. Acad. Sci. U.S.A. 98:1871-1876. desaturase genes in the moth Spodoptera littoralis' Insect Biochem Lacroix et al. (2008) "Association of the Agrobacterium T-DNA istry and Molecular Biology, 34, 1315-1328. protein complex with plant nucleosomes' Proc. Natl. Acad. Sci. Rose et al. (1998) "Consensus-degenerate hybrid oligonucleotide U.S.A. 105: 15429-15434. primers for amplification of distantly related sequences' Nucleic Lechtenberg et al. (2003) “Neither inverted repeat T-DNA configu Acids Res. 26:1628-1635. rations nor arrangements of tandemly repeated transgenes are suffi Saha et al. (2006) "Cytosolic Triacylglycerol Biosynthetic Pathway cient to trigger transgene silencing” Plant J. 507-517. in Oilseeds. Molecular Cloning and Expression of Peanut Cytosolic Lewis et al. (2000) “Evaluation of extraction methods for recovery of Diacylglycerol Acyltransferase' Plant Physiol. 141: 1533-1543. Sayanova et al., (2012) “The role of delta (6)-desaturase acyl-carrier fatty acids from lipid-producing microheterotrophs” Journal of specificity in the efficient synthesis of long-chain polyunsaturated Microbiological Methods, 43, 107-116. fatty acids in transgenic plants' Plant Biotechnology Journal, Lewsey et al. (2007) “Selective targeting of miRNA-regulated plant 10:195-206. development by a viral counter-silencing protein' Plant J. 50:240 Serra et al. (2006) “All desaturases of Trichoplusia ni and Spodoptera 252. littoralis exhibit dual catalytic behavior” Insect Biochemistry and Lindbo et al. (1993) “Induction of a Highly Specific Antiviral State in Molecular Biology, 36, 822-825. Transgenic Plants: Implications for Regulation of Gene Expression Shanklin & Cahoon (1998) “Desaturation and related modifications and Virus Resistance Plant Cell 5:1749-1759. of fatty acids' Annu. Rev. Plant Physiol. Plant Mol. Biol. 49, 611 Lu et al. (1993) “High Efficiency Retroviral Mediated Gene 641. Transduction into Single Isolated Immature and Replatable CD343+ Smith (1971) “Occurrence of unusual fatty acids in plants' Progress Hematopoietic Stem/Progenitor Cells from Human Umbilical Cord in the Chemistry of Fats and Other Lipids, 11, 137, 139-177. Blood” J. Exp. Med. 178:2089-2096. Smith et al. (2003) “Heterologous expression of a fatty acid Mallory et al (2002) “The amplicon-plus system for high-level hydroxylase gene in developing seeds of Arabidopsis thaliana' expression of transgenes in plants' Nat. Biotech. 20:622-625. Planta, 217,507-516. Matzke et al. (2001) “RNA: Guiding Gene Silencing Science Stalker et al. (1988) “Purification and Properties of a Nitrilase Spe 293:1080-1083. cific for the Herbicide Bromoxynil and Corresponding Nucleotide Meng et al. (2008) "Hibiscus chlorotic ringspot virus coat protein Sequence Analysis of the bXn Gene” J. Biol. Chem. 263:6310-6314. inhibits trans-acting Small interfering RNA biogenesis in Stanley-Samuelson et al. (1998) “Fatty Acids in Insects: Composi Arabidopsis” J. Gen. Virol. 89:2349-2358. tion, Metabolism, and Biological Significance' Archives of Insect Moreau et al. (1998) “Lipid Trafficking in Plant Cells' Progress Lip. Biochemistry and Physiology 9:1-33. ReS. 37:371-391 Stukey et al. (1990) “The OLE1 gene of Saccharomyces cerevisiae Mortimer et al. (1986) “Genealogy of principal strains of the yeast encodes the A9 fatty acid desaturase and can be functionally replaced genetic stock center' Genetics, 113, 35-43. by the rat Stearoyl-CoA desaturase gene”. The Journal of Biological Moto et al. (2004) “Involvement of a bifunctional fatty-acyl Chemistry, 265(33), 20144-20149. desaturase in the biosynthesis of the silkmoth, Bombyx mori, sex Stymne & Appelgvist (1978) “The biosynthesis of linoleate from pheromone” PNAS, 101(23), 8631-8636. oleoyl-CoA via oleoyl-phosphatidylcholine in microsomes of devel Murata & Wade (1995) "Acyl-lipid desaturases and their importance oping safflower seeds' Eur, J. Biochem, 90, 223-229. in the tolerance and acclimatization to cold of cyanobacteria' Suiyun of al. (2004) “Introgression of salt-tolerance from somatic Biochem. J., 308, 1-8. hybrids between common wheat and Thinopyrum ponticum” Plant Napier (2007) “The Production of Unusual Fatty Acids in Transgenic Science 773-779. Plants' Ann. Rev. Plant. Biol. 58:295-319. Thompson et al. (1997) “The CLUSTAL X windows interface: Niedz et al (1995) “Green fluorescent protein: an in vivo reporter of flexible strategies for multiple sequence alignment aided by quality plant gene expression' Plant Cell Reports 14:403-406. analysis tools' Nucleic Acids Research, 25(24), 4876-4882. Nishizawa et al. (2003) “A C-terminal sequence of soybean Thillet et al (1988) "Site-directed Mutagenesis of Mouse b-conglycinina'subunit acts as a vacuolar sorting determinant in seed Dihydrofolate Reductase” J. Biol. Chem 263:12500-12508. cells’ Plant J. 34:647-659. Torlyama et al. (1986) “Haploid and diploid plant regeneration from Ohlrogge and Browse (1995) “Lipid Biosynthesis” Plant Cell 7:957 protoplasts of anther callus in rice' Theor App? Genet, 73:16-19. 97O. Tzfira & Citovsky (2006) "Agrobacterium-mediated genetic trans Ohlrogge and Jaworski (1997) Regulation of Fatty Acid Synthesis. formation of plants: biology and biotechnology” Curr. Opin. Biotech. Annu Rev Plant Physiol Plant Mol Biol. 48:109-136. 17: 147-154. US 8,946.460 B2 Page 13

(56) References Cited Apr. 15, 2014 Demand for International Preliminary Examination, including substitute claim pp. 164-186, filed in connection with PCT OTHER PUBLICATIONS International Patent Application No. PCT/AU2013/000639. Response to Office Action, filed Mar. 22, 2012 in connection with Voinnet et al. (2003) “An enhanced transient expression system in U.S. Appl. No. 13/044,984. plants based on Suppression of gene silencing by the p19 protein of Final Office Action, issued May 17, 2012 in connection with U.S. tomato bushy stunt virus' Plant J. 33:949-956. Appl. No. 13/044.984. Wada et al (1993) “The desA Gene of the Cyanobacterium Mar. 12, 2013 Office Action, issued in connection with U.S. Appl. synechocystis sp. Strain PCC6803 Is the Structural Gene for A12 Desaturase” Journal of Bacteriology 175(18):6056-6058. No. 12/310,645. Wagner et al. (1992) "Coupling of adenovirus to transferrin Abbadi, A., et al., (2001) "Transgenic Oilseeds. As Sustainable polylysine/DNA complexes greatly enhances receptor-mediated Source Of Nutritionally Relevant C20 And C22 Polyunsaturated gene delivery and expression of transfected genes' Proc. Natl. Acad. Fatty Acids?” European Journal Of Lipid Science And Technology, Sci. USA 89:6099-6103. 103(2): 106-113. Wang and Hildebrand (1988) “Biosynthesis and Regulation of The C. Elegans Sequencing Consortium, (1998) "Genome Sequence Linolenic Acid in Higher Plants' Plant Physiol. Biochem. 26(6), Of The Nematode C. elegans: A Platform For Investigating Biology.” 777-792 Science, 282(5396): 2012-2018. Watts and Browse (1999) “A Palmitoyl-CoA-Specific A9 Fatty Acid Akiyama, H., et al., (1998) “A Novel Plasmid RecombinationMecha Desaturase from Caenorhabditis elegans' Arch. Biochem. Biophys. nism Of The Marine Cyanobacterium synechococcus sp. PCC7002.” 362; 175-182. DNA Research, 5(6): 327-334. Whittle et al. (2005) “A multifunctional acyl-acyl carrier protein Akiyama, H., et al., (1998)“Nucleotide Sequence Of Plasmid pAQ1 desaturase from Hedera helix L. (English ivy) can synthesize 16- and Of Marine Cyanobacterium synechococcus sp. PCC7002.” DNA 18-carbon monoene and diene products' The Journal of Biological Research, 5(2): 127-129. Chemistry, 280(31), 28.169-28176. Bäumlein, H., et al., (1992) “Cis-Analysis. Of A Seed Protein Gene Yang at al. (2003) “Expression and localization cifhuman lysozyme Promoter: The Conservative RY Repeat CATGCATC Within The in the endosperm of transgenic rice' Planta 216:597-603. Legumin Box Is Essential For Tissue-Specific Expression Of A Zhang at al. (2006) "cucumber mosaic virus-encoded 2b Suppressor Legumin Gene.” The Plant Journal. 2(2): 233-239. inhibits Arabidopsis Argonautel cleavage activity to counter plant Bäumlein, H., et al., (1991) “A Novel Seed Protein Gene From Viola defense” Genes & Development 20:3255-3268. faba Is Developmentally Regulated In Transgenic Arabidopsis Zhou at al. (2005) “Heterologous production of GLA and SDA by Plants.” Molecular And General Genetics, 225(3): 459-467. expression of an Echium plantagineum A6-desaturase gene' Plant Beaudoin, F., et al., (2000) “Heterologous Reconstitution InYeast Of Science, 170, 665-673. The Polyunsaturated Fatty Acid Biosynthetic Pathway.” Proceedings Zipfel at al. (2006) “Perception of the Bacterial PAMPEF-Tu by the Of The National Academy Of Sciences Of The United States Of Receptor EFR Restricts Agrobacterium-Mediated Transformation” America,97(12): 6421-6426. Ce11 125:749-760. Bolch, C.J.S., et al., (1999) “Genetic, Morphological, And Toxico Genbank accession AAF19262, Benveniste (1998). logical Variation Among Globally Distributed Strains of Nodularia Genbank accession AAL37626, Qi et al. (2001). (Cyanobacteria).” Journal of Phycology, 35(2): 339-355. GenBank accession AAM09687, Qiu at al. (2001). Bolch, C.J.S., et al., (1999) “Genetic Variation Among Strains Of The GenBank accession AAR20444, Periera at al. (2003). Toxic Dinoflagellate Gymnodinium catenatum (Dinophyceae).” GenBank accession AAT85661, Kajikawa et al. (2004). Journal of Phycology, 35: 356-367. GenBank accession AAV67797, Meyer at al. (2004). Brown, M.R., et al., (1997) “Nutritional Properties Of Microalgae GenBank accession AAV67799, Meyer at al. (2004). For Mariculture.” Aquaculture, 151(1): 315-331. GenBank accession AAV67800, Meyer at al. (2004). Browse, J.A. and Slack, C.R., (1981) “Catalase Stimulates Linoleate GenBank accession AAW70 157, Domergue and Heinz (2004). Desaturase Activity In Microsomes From Developing Linseed Coty GenBank accession AAW70 159, Domergue and Heinz (2004). ledons.” Federation Of European Biochemical Societies Letters, GenBank accession AAX 14505, Tonon et al. (2004). 131(1): 111-114. GenBank accession AAY15135, Zhou et al. (2005). Chinain, M., et al., “Intraspecific Variation. In The Dinoflagellate GenBank accession AAY15136, Zhou et al. (2005). Gambierdiscus toxicus (Dinophyceae). I. Isozyme Analysis.” Journal GenBank accession ABC18313, Huang and Jiang (2005). of Phycology, 33: 36-43, (1997). GenBank accession ABC18314, Huang and Jiang (2005). Clough, S.J. and Bent, A.F., (1998)“Floral Dip: A Simplified Method GenBank accession ABL63813, Zhang et al. (2006). for Agrobacterium-Mediated Transformation of Arabidopsis GenBank accession ABL96295, Zhou et al. (2006). thaliana,” 16(6); 735-743. Genbank accession ABL96296, Zhou et al. (2006). Coleman, A.W. (1977) “Sexual And Genetic Isolation. In The Cos GenBank accession ABO94747, Grigoriev et al. (2007). mopolitan Algal Species Pandorina Morum.” American Journal of GenBank accession ABP49078, Liet al. (2007). Botany, 64(3): 361-368. GenBank accession ABR67690, Niu et al. (2007). Dafny-Yelin et al., Delivery of Multiple Transgenes to Plant Cells, GenBank accession AY746357, Domergue and Heinz (2004). Plant Physiology, Dec. 2007, vol. 145, pp. 1118-11128. GenBank accession BAD 11952, Lura and Kajiwara (2003). Domergue, F., et al., (2003) “New Insight Into Phaeodactylum Genbank accession BAD91495, Sakuradani et al. (2004). tricornutum Fatty Acid Metabolism. Cloning And Functional Char GenBank accession CAD58540, Napier et al. (2002). acterization Of Plastidial and Microsomal A12-Fatty Acid GenBank accession CAI58897, Zank et al. (2005). Desaturases.” Plant Physiology, 131(4): 1648-1660. GenBank accession CAJ30869, Cirpus et al. (2005). Drexler, H., et al., (2003)"Metabolic Engineering Of Fatty Acids For GenBank accession CAL23339, Cirpus et al. (2006). Breeding Of New Oilseed Crops: Strategies, Problems And First GenBank accession CAL55414. (2012). Results.” Journal Of Plant Physiology, 160(7): 779-802. GenBank accession CAM55882, Cirpus (2006). Dunstan, G.A., et al., (1994) “Essential Polyunsaturated Fatty Acids GenBank accession EDQ92231, Kuo et al. (2007). From 14 Species Of Diatom (Bacillariophyceae).” Phytochemistry, GenBank accession XP 001416454. Grigoriev et al. (2007). 35(1): 155-161. GenBank accession XP 001421073 Grigoriev et al. (2007). Gallagher, J.C., (1980) “Population Genetics Of Skeletonema Apr. 22, 2014 Notice of Allowance, issued in connection with U.S. costatum (Bacillariophyceae) In Narragansett Bay. Journal of Appl. No. 13/918,399. Phycology, (16)3: 464–474. May 13, 2014 International Preliminary Report on Patentability, Guil-Guerrero, J.L., et al., (2000) "Occurrence And Characterization issued in connection with PCT International Patent Application No. Of Oils Rich In Y-Linolenic Acid Part I: Echium Seeds From PCT/AU2013,000639. Macaronesia.” Phytochemistry, 53(4): 451-456. US 8,946.460 B2 Page 14

(56) References Cited Slater et al., Metabolic engineering of Arabidopsis and Brassica for poly(3-hydroxybutyrate-co-3-hydroxyvalerate) copolymer produc OTHER PUBLICATIONS tion, Nature Biotechnology, Oct. 1999, vol. 12, 1011-1016. Smith, N.A., et al., (2000) "Total Silencing By Intron-Spliced Hair Halpin, Gene stacking in transgenic plants—the challenge for 21st pin RNAs.” Nature, 407(6802): 319-320. century plant biotechnology, Plant Biotechnology Journal (2005, 3. Sperling, P. et al., (2000) "A Bifunctional AA-Fatty Acyl pp. 141-155). Acetylenase/Desaturase From The Moss Ceratodon purpureus.” Haseloff, J. and Gerlach, W.L., (1988) “Simple RNA Enzymes With European Journal of Biochemistry, 267(12): 3801-3811. New And Highly Specific Endoribonuclease Activities.” Nature, 334: Sperling, P. and Heinz, E. (2001) "Desaturases Fused To Their 585-591. Electron Donor.” European Journal Of Lipid Science And Technol Horiguchi, G., et al., (1998) “Developmental Regulation Of Genes ogy, 103(3): 158-180. For Microsome And Plastid Omega-3 Fatty Acid Desaturases. In Stålberg, K., et al., (1993) "Deletion Analysis. Of A 2S Seed Storage Wheat (Triticum aestivum L.). Plant and Cell Physiology, 39(5): Protein Promoter Of Brassica napus. In Transgenic Tobacco.” Plant 540-544. Molecular Biology, 23(4): 671-683. Ikeda, K., et al., (2002) “Transformation Of The Fresh Water Takeyama, H., et al., (1997) “Expression Of The Eicosapentaenoic Cyanobacterium synechococcus PCC7942 With The Shuttle-Vector Acid Synthesis Gene Cluster From Shewanella sp. In A Transgenic pAQ-EX1 Developed For The Marine Cyanobacterium synechococ Marine Cyanobacterium, Synechococcus sp.” Microbiology, 143(Pt 8): 2725-2731. cus PCC7002.” World Journal of Microbiology & Biotechnology, Tanaka, M., et al., (1999) “Isolation Of Clustered Genes That Are 18(1): 55-56. Notably Homologous To The Eicosapentaenoic Acid Biosynthesis Jones, A.V.M. and Harwood, J.L. (1980) “Desaturation of Linoleic Gene Cluster From The Docosaehexaenoic Acid-Producing Bacte Acid From Exogenous Lipids by Isolated Chloroplasts.” The Bio rium Vibrio marinus Strain MP-1.” Biotechnology Letters, 21 (11): chemical Journal, 190(3): 851-854. 939-945. Lee, M., et al., (1998) “Identification Of Non-theme Diiron Proteins TsevegSuren et al., (2003) “Isomers of hexadecenoic and That Catalyze Triple Bond And Epoxy Group Formation.” Science, hexadecadienoic acids in Androspace Septentrionalis (Primulaceae) 280(5365): 915-918. seed oil” Lipids 38(11): 1173-1178. Leonard, A.E., et al., (2002) “Identification and Expression of Mam Tvrdik, P. et al., (2000) “Role of a New Mammalian Gene Family. In malian Long-Chain PUPA Elongation Enzymes.” Lipids, 37(8): 733 The Biosynthesis. Of Very Long Chain Fatty Acids And T40. Sphingolipids.” The Journal of Cell Biology, 149(3): 707-717. Lo, J., et al., (2003) “15,000 Unique Zebrafish EST Clusters and Valvekens, D., et al., (1988) "Agrobacterium tumefaciens Medi Their Future Use In Microarray For Profiling Expression Patterns ated Transformation Of Arabidopsis thaliana Root Explants By During Embryogenesis.” Genome Research Letter, 13(3): 455-466. Using Kanamycin Selection.” Proceedings Of the National Academy Mansour, M.P. et al., (1999) “The Fatty Acid And Sterol Composi of Sciences of the United States of America, 85(15) 5536-5540. van de Loo, F. J., Broun, P., Turner, S., & Somerville, C. (Jul 1995). tion Of Five Marine Dinoflagellates,” Journal of Phycology, 35(4): An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl T10-720. desaturase homolog. Proc. Natl. Acad. Sci. USA. 92, 6743-6747. Medlin, L.K., et al., (1996) “Genetic Characterization of Emiliania Volkman, J.K., et al., (1989) “Fatty Acid and Lipid Composition Of huxleyi (Haptophyta).” Journal of Marine Systems, 9: 13-31. 10 Species Of Microalgae Used In Mariculture.” Journal of Experi Metz, J.G., et al., (2001) “Production of Polyunsaturated Fatty Acids mental Marine Biology and Ecology, 128(3): 219-240. by Polyketide Synthases in Both Prokaryotes and Eukaryotes.” Sci Wang, M.B., et al., (1997) “Intron-Mediated Improvement Of A ence, 293(5528): 290-293. Selectable Marker Gene For Plant Transformation Using Mitchell, A.G. and Martin, C., (1995) “A Novel Cytochrome b5-Like Agrobacterium tumefaciens,” Journal of Genetics & Breeding, 51: Domain Is Linked To The Carboxyl Terminus Of The Saccharomyces 325-334. cerevisiae A-9 Fatty Acid Desaturase.” The Journal Of Biological Waterbury, J.B. and Willey, J.M., (1988) “Isolation and Growth of Chemistry, 270(50): 29766-29772. Marine Planktonic Cyanobacteria.” Methods of Enzymology, 167: Morita, N., et al., (2000) “Biosynthesis. Of Fatty Acids. In The 100-105. Docosahexaenoic Acid-Producing Bacterium Moritella marina Waterhouse, P.M., et al., (1998) “Virus Resistance And Gene Silenc Strain MP-1.” Biochemical Society Transactions, 28(6): 943-945. ing In Plants Can Be Induced By Simultaneous Expression Of Sense Napier, J.A., et al., (1999) “A Growing Family Of Cytochrome And Antisense RNA.” Proceedings of the National Academy of Sci b5-Domain Fusion Proteins.” Trends. In Plant Science, 4(1): 2-4. ences of the United States of America. 95(23): 13959-13964. Napier, J.A., et al., (1999) “Plant Desaturases: Harvesting The Fat Of Williams, J.G.K. and Szalay, A.A. (1983) "Stable Integration of The Land.” Current Opinion. In Plant Biology, 2(2): 123-127. Foreign DNA Into The Chromosome Of The Cyanobacterium Needleman, S. B., & Wunsch, C. D. (1970). A general method appli synechococcus R2.” Gene, 24(1): 37-51. cable to the search for similarities in the amino acid sequence of two Whitney, H., et al., (2003) “Functional Characterization of Two proteins. J. Mol. Biol. 48, 443-453. Cytochrome b5-Fusion Desaturases From Anemone leveillei: The Perriman, R., et al., (1992) “Extended Target-Site Specificity for a Unexpected Identification Of A Fatty Acid A6-Desaturase.” Planta, Hammerhead Ribozyme.” Gene, 113(2): 157-163. 217(6): 983-992. Sakuradani, F., et al., (1999) “A6-Fatty Acid Desaturase From An Wolff, R. L., et al., (1999) “Arachidonic Eicosapentaenoic, and Arachidonic Acid-Producing Mortierella Fungus. Gene Cloning And Biosynthetically Related Fatty Acids in the Seed Lipids from a Primi Its Heterologous Expression. In A Fungus, Aspergillus. Gene, tive Gymnosperm. Agathis Robusta' Lipids, 34(10): 1083-1097. 238(2): 445-453. Yazawa, K., (1996) “Production Of Eicosapentaenoic Acid From Sayanova, O.V., et al., (1999) “Histidine-41 Of The Cytochrome b5 Marine Bacteria.” Lipids, 31: S297-300. Domain Of The Borage A6 Fatty Acid Desaturase Is Essential For R., et al., (2000) “Production of Eicosapentaenoic Acid By A Recom Enzyme Activity.” Plant Physiology, 121(2): 641-646. binant Marine Cyanobacterium, Synechococcus sp.” Lipids, 35(10): Shippy, R., et al., (1999) “The Hairpin Ribozyme Discovery, 1061-1064. Mechanism, And Development For Gene Therapy.” Molecular Zhou, X. and Christie, P.J., (1997) “Suppression Of Mutant Pheno Biotechnology, 12(1): 117-129. types Of The Agrobacterium tumefaciens VirB11 ATPase Overpro Simopoulos, A.P. (2000)"Symposium: Role Of Poultry Products. In duction Of VirB Proteins,” Journal of Bacteriology, 179(18): 5835 Enriching The Human Diet With N-3 PUFA.” Poultry Science, 79: 5842. 961-970. Meyer et al. (2003) GenBank Accession No. AY278558, NCBI, pp. Singh, S., et al., (2001) "Transgenic Expression Of A A 12 1-2. Epoxygenase Gene in Arabidopsis Seeds Inhibits Accumulation Of Tonon et al. (2003) GenBank Accession No. AY332747, NCBI, pp. Linoleic Acid. Planta, 212: 872-879. 1-2. US 8,946.460 B2 Page 15

(56) References Cited Zank et al. (2002) GenBank Accession No. AF428243, NCBI, pp. 1-2. OTHER PUBLICATIONS Kajikawa et al. (2004) GenBank Accession No. AY583464, NCBI. pp. 1-2. Qiu et al. (2001) GenBank Accession No. AF489589, NCBI, pp. 1-2. Chaung et al. (1999) GenBank Accession No. AF20666.2, NCBI, pp. Thurmond et al. (2001) GenBank Accession No. AF3.91543, NCBI, 1-2. pp. 1-2. Cho et al. (1999) GenBankAccession No. AF199596, NCBI, pp. 1-2. Cirpues et al. (2003) GenBank Accession No. AX951565, NCBI, pp. Sanger Institute. (2003) GenBank Accession No. NM 069350, 1. NCBI, pp. 1-4. Heinzetal. (2001) GenBankAccession No. AX214454, NCBI, pp. 1. Knutzonetal. (1998) GenBank Accession No. AF067654, NCBI, pp. Leonard etal. (2000) GenBank Accession No. AF231981, NCBI, pp. 1-2. 1-2. Hong et al. (2001) GenBank Accession No. AF419297, NCBI, pp. Akietal. (2001) GenBankAccession No. AB071985, NCBI, pp. 1-2. 1-2. Akietal. (2001) GenBankAccession No. AB071986, NCBI, pp. 1-2. Saito et al. (1999) GenBank Accession No. AB022097, NCBI, pp. Tvrdik et al. (1999) GenBank Accession No. AF 170907, NCBI, pp. 1-2. 1-2. Domergue et al. (2002) GenBank Accession No. AY082392, NCBI. Tvrdik et al. (1999) GenBank Accession No. AF 170908, NCBI, pp. pp. 1-2. 1-2. Qiu et al. (2003) GenBank Accession No. AF489588, NCBI, pp. 1-2. Agaba et al. (2004) GenBank Accession No. AF532782, NCBI, pp. Kajikawa et al. (2004) GenBank Accession No. AY583465, NCBI. 1-2. pp. 1-2. Lo et al. (2003) GenBank Accession No. NM 199532, NCBI, pp. GenBank Accession No. NM 013402, NCBI, pp. 1-6, (2008). 1-2. GenBank Accession No. NM 019699, NCBI, pp. 1-3, (1999). Wilkinson et al. (1996) GenBank Accession No. 268749, NCBI, pp. Swinburne et al. (1998) GenBank Accession No. 270271, NCBI, pp. 1-8. 1-11. Mukerjietal. (2002) GenBank Accession No. AX464802, NCBI, pp. Sayanova et al. (1996) GenBank Accession No. U79010, NCBI, pp. 1. 1-2. Qi et al. (2001) GenBank Accession No. AF390.174, NCBI, pp. 1-2. Maroto et al. (2001) GenBank Accession No. AY055117. NCBI, pp. File History of U.S. Patent No. 7,807,849. Singh et al., issued Oct. 5, 1-2. 2010 (U.S. Appl. No. 1 1/112,882, filed Apr. 22, 2005). Maroto et al. (2001) GenBank Accession No. AY055118, NCBI, pp. File History of U.S. Patent Application Publication No. 2011/ 1-2. 0015415. Singh, et al., published Jan. 20, 2011 (U.S. Appl. No. Sayanova et al. (2003) GenBank Accession No. AY234127, NCBI. 12/661,978, filed Mar. 26, 2010). pp. 1-2. File History of U.S. Patent Application Publication No. 2012 Sayanova et al. (2003) GenBank Accession No. AF536525, NCBI, 0041218, Singh et al., published Feb. 16, 2012, (U.S. Appl. No. 13/243,747, filed Sep. 23, 2011). Sis et al. (1999) GenBank Accession No. AJ250735, NCBI, pp. File History of U.S. Patent No. 7,834,250, Singh et al., issued Nov. 16, 2010 (U.S. Appl. No. 1 1/587,092, filed Oct. 20, 2006). kiva et al. (2004) GenBank Accession No. AY583463, NCBI, File History of U.S. Patent No. 7,932,438, Singh et al., issued (U.S. Appl. No. 12/945,708, filed Nov. 12, 2010). R et al. (1998) GenBank Accession No. AF110510, NCBI, pp. File History of U.S. Patent Application Publication No. 2011/ 0201065. Singh et al., published Aug. 18, 2011 (U.S. Appl. No. kiyah et al. (1998) GenBank Accession No. AB020032, NCBI, 13/093,252, filed Apr. 25, 2011). FileHistory of U.S. Patent No. 8,158,392. Singhet al., issued Apr. 17. 3. i. (2001) GenBank Accession No. AF419296, NCBI, pp. 1-2. 2012 (U.S. Appl. No. 13/311,240, filed Sep. 23, 2011). Akietal. (2000) GenBankAccession No. AB052086, NCBI, pp. 1-2. File History of U.S. Patent Application Publication No. 2011/ Zhang et al. (2003) GenBank Accession No. AY320288, NCBI, pp. 0 190521. Damcevski et al., published Aug. 4, 2011 (U.S. Appl. No. 12/310,645, filed Feb. 16, 2011). Snegie et al. (2002) GenBank Accession No. AY082393, NCBI, File History of U.S. Appl. No. 12/989,405, Zhou et al., filed May 16, 2011. Rail al. (1993) GenBank Accession No. L11421, NCBI, pp. 1-2. File History of U.S. Patent No. 7,589.253, Green et al., issued Sep. Hastings etal. (2000) GenBank Accession No. AF309556, NCBI, pp. 15, 2009 (U.S. Appl. No. 09/981,124, filed Oct. 17, 2011). File History of U.S. Patent No. 7,834.248, Green et al., issued Nov. Wis et al. (1991) GenBank Accession No. AF139720, NCBI, pp. 16, 2010 (U.S. Appl. No. 1 1/699,817, filed Jan. 30, 2007). File History of U.S. Patent Application No. 2012-0016144. Singh et fish et al. (1999) GenBank Accession No. AF13372B, NCBI, pp. al., Jan. 19, 2012 (U.S. Appl. No. 13/129,940, filed Sep. 30, 2011). ins) GenBank Accession No. NM 069288, NCBI, pp. 1-3. * cited by examiner

U.S. Patent Feb. 3, 2015 Sheet 2 of 21 US 8,946.460 B2

U.S. Patent Feb. 3, 2015 Sheet 3 of 21 US 8,946.460 B2 ||

€9.InáH

U.S. Patent Feb. 3, 2015 Sheet 4 of 21 US 8,946.460 B2

##då!ago-odoladz?vºpponºº U.S. Patent Feb. 3, 2015 Sheet 5 of 21 US 8,946.460 B2

14 poor i2 or & is s 10 r - * & a & & s 8 : ...... M M M M M e & S. 8813. 5 6 i...... i.883.------4------". & is 88 s {d & x^ & 82 8. 43 4. 8 to - #25 & 3:807 & 2 mm a a a8.------8 8

e

o ------3. Cottambia fads Countaia 33 iad2s and T3 Arabidopsis generations

Figure 5 U.S. Patent Feb. 3, 2015 Sheet 6 of 21 US 8,946.460 B2

{i} catsrit wiwiys. DHA intent in traitsgeric Arabidopsis isaiara sseds

33 3-8-8-8-8-8-8------i s: ; : :

: 8. & OHA's of tatai fatty axiids:

Figure 6 U.S. Patent Feb. 3, 2015 Sheet 7 of 21 US 8,946.460 B2

Figure 7 U.S. Patent Feb. 3, 2015 Sheet 8 of 21 US 8,946.460 B2

& 3: if & C

3. ~irear CiS;33&rea

&

8 S. : 8 28 3. & 8:3d9 oleic acidia totis fatty acids

Figure 8 U.S. Patent Feb. 3, 2015 Sheet 9 of 21 US 8,946.460 B2

8 - 'a- \--Marw wwyww.------wryM8 N. fw

~~~.--~~~~~~~~~~~~~ 3.3 s 3. ;3 2: 3. &

Figure 9 U.S. Patent Feb. 3, 2015 Sheet 10 of 21 US 8,946.460 B2

80k r. 6Ok 40k imm. 20k or or or

O ...: ::::::: ...ca.co.ca.g. c...S.'sN - : * S 3- 3 - 3 is 3 as 3 a. o. op 3 oš -š -8 -S

Figure 10 U.S. Patent Feb. 3, 2015 Sheet 11 of 21 US 8,946.460 B2

II9.InáH

U.S. Patent Feb. 3, 2015 Sheet 12 of 21 US 8,946.460 B2

GFP-C terminai 4G cat atron GFPN terminal secretion signal catalase-1 intron, Besna-FP pro \\ NOS terminator y * neorycin phosphotransferase E \ fir2 promoter w

NOS terminator s JP3364 Piep?-w3. 34833; s iot Site: Weate '^

a hosterminator Faef . \ TMVeader rviv leader \ \, \ \ Fpt promoter Gossypium hirsistan sad 3' UTR, inverted spacer ining Micco Pisas-d60 opt}

Figure 12 U.S. Patent Feb. 3, 2015 Sheet 13 of 21 US 8,946.460 B2

% of 20:4 in T2 Seeds

st

8 15 - r; 98 percertie d S s 10 - assessents

a. 88: 2l 5 3S383: s d ~- CN S. 0 - X 8 ... to: scentie

------PO p38 p19 35S:W2 FP1V2 No WSP

Figure 13 U.S. Patent Feb. 3, 2015 Sheet 14 of 21 US 8,946.460 B2

Average of 20:4 in T2 seeds

1 4.

2 - {}

S. O - K) {) N {) - 9 8 - {0 {) s C cN s 6 Mer C is 4 - c s 2 -

O T t f PO p38 p19 35S:V2 FP1V2 No VSP

Figure 14 U.S. Patent Feb. 3, 2015 Sheet 15 of 21 US 8,946.460 B2

% of 20:2 in T2 seeds

1 4.

1 2

1 O

8

6

PO p38 p19 35S:V2 FP1:V2 NOVSP

Figure 15 U.S. Patent Feb. 3, 2015 Sheet 16 of 21 US 8,946.460 B2

% of 20.4 in T4 Seeds

50

4. O

3 O

2 O

1 O

PO p38 p19 35S:V2 FP1:V2 NO VSP

Figure 16 U.S. Patent Feb. 3, 2015 Sheet 17 of 21 US 8,946.460 B2

Average of 20:4 in T4 seeds

18

16 - K) ()

4 -

2 -

10 - ()

PO p38 p19 35S:V2 FP1V2 No VSP

Figure 17 U.S. Patent Feb. 3, 2015 Sheet 18 of 21 US 8,946.460 B2

% of 20:2 in T4 Seeds

30

2 5

2O

1 5

10 -

PO p38 p19 35SV2 FP1 V2 No WSP

Figure 18 U.S. Patent Feb. 3, 2015 Sheet 19 of 21 US 8,946.460 B2

B) ------r

3:::::Stef: H:

? - ^s.- r -&- r -- -

83&Silaste: stigastafe: 3:8:38te?

Figure 19 U.S. Patent Feb. 3, 2015 Sheet 20 of 21 US 8,946.460 B2

--- : 3. : K.

A. s , & & & & . s & 3. 8

8 sc o scs

$: S. &S s S; s N S. 3. y a. S s : i E.-> g sys s: wa Figure 20 U.S. Patent Feb. 3, 2015 Sheet 21 of 21 US 8,946.460 B2

Kennedy : Pathway :

Erzyres

Figure 21 US 8,946,460 B2 1. 2 PROCESS FOR PRODUCING produce substantial quantities of LC-PUFA, thus providing POLYUNSATURATED FATTY ACDS IN AN an alternative source of these compounds. ESTERFED FORM LC-PUFA Biosynthesis Pathways Biosynthesis of LC-PUFAs in organisms such as microal CROSS-REFERENCE TO RELATED gae, mosses and fungi usually occurs as a series of oxygen APPLICATIONS dependent desaturation and elongation reactions (FIG. 1). The most common pathway that produces EPA in these This application claims benefit of U.S. Provisional Patent organisms includes a A6-desaturation, A6-elongation and Application No. 61/782,680, filed Mar. 14, 2013, U.S. Pro A5-desaturation (termed the A6-desaturation pathway) whilst 10 a less common pathway uses a A9-elongation, A8-desatura visional Patent Application No. 61/697,676, filed Sep. 6, tion and A5-desaturation (termed the A9-desaturation path 2012, U.S. Provisional Patent Application No. 61/663,344, way). These consecutive desaturation and elongation reac filed Jun. 22, 2012, and U.S. Provisional Patent Application tions can begin with either the Co6 fatty acid substrate LA, No. 61/660,392, filed Jun. 15, 2012, the entire contents of shown schematically as the upper left part of FIG. 1 (c)6) or each of which are hereby incorporated by reference into the 15 the co3 substrate ALA through to EPA, shown as the lower Subject application. right part of FIG. 1 (c)3). If the initial A6-desaturation is performed on the ()6 substrate LA, the LC-PUFA product of REFERENCE TO SEQUENCE LISTING the series of three enzymes will be the (D6 fatty acid ARA. LC-PUFA synthesising organisms may convert ()6 fatty acids This application incorporates-by-reference nucleotide to co3 fatty acids using an (03-desaturase, shown as the A17 and/or amino acid sequences which are present in the file desaturase step in FIG. 1 for conversion of arachidonic acid named “130614 2251 84.199 B Sequence Listin (ARA, 20:4(O6) to EPA. Some members of the co3-desaturase g REB.txt,” which is 369 kilobytes in size, and which was family can act on a variety of Substrates ranging from LA to created Jun. 14, 2013 in the IBM-PC machine format, having ARA. Plant (03-desaturases often specifically catalyse the an operating system compatibility with MS-Windows, which 25 A 15-desaturation of LA to ALA, while fungal and yeast is contained in the text file filed Jun. 14, 2013 as part of this (03-desaturases may be specific for the A17-desaturation of application. ARA to EPA (Pereira et al., 2004a: Zanket al., 2005). Some reports suggest that non-specific (D3-desaturases may exist FIELD OF THE INVENTION which can convert a wide variety of co6 substrates to their 30 corresponding ()3 products (Zhang et al., 2008). The present invention relates to a process for producing The conversion of EPA to DHA in these organisms occurs ethyl esters of polyunsaturated fatty acids, comprising trans by a A5-elongation of EPA to produce DPA, followed by a esterifying triacylglycerols in extracted plant lipid. A4-desaturation to produce DHA (FIG. 1). In contrast, mam mals use the so-called “Sprecher pathway which converts BACKGROUND OF THE INVENTION 35 DPA to DHA by three separate reactions that are independent ofa A4-desaturase (Sprecher et al., 1995). Omega-3 long-chain polyunsaturated fatty acids (LC The front-end desaturases generally found in plants, PUFA) are now widely recognized as important compounds mosses, microalgae, and lower animals such as Caenorhab for human and animal health. These fatty acids may be ditis elegans predominantly accept fatty acid Substrates obtained from dietary sources or by conversion of linoleic 40 esterified to the sn-2 position of a phosphatidylcholine (PC) (LA, 18:2a)6) or O-linolenic (ALA, 18:303) fatty acids, both substrate. These desaturases are therefore known as acyl-PC, of which are regarded as essential fatty acids in the human lipid-linked, front-end desaturases (Domergue et al., 2003). diet. While humans and many other vertebrate animals are In contrast, higher animal front-end desaturases generally able to convert LA or ALA, obtained from plant sources to accept acyl-CoA substrates where the fatty acid substrate is C22 they carry out this conversion at a very low rate. More 45 linked to CoA rather than PC (Domergue et al., 2005). Some over, most modern Societies have imbalanced diets in which microalgal desaturases and one plant desaturase are known to at least 90% of polyunsaturated fatty acids (PUFA) are of the use fatty acid substrates esterified to CoA (Table 2). ()6 fatty acids, instead of the 4:1 ratio or less for ()6:c03 fatty Each PUFA elongation reaction consists of four steps acids that is regarded as ideal (Trautwein, 2001). The imme catalysed by a multi-component protein complex: first, a con diate dietary source of LC-PUFAs such as eicosapentaenoic 50 densation reaction results in the addition of a 2C unit from acid (EPA, 20:5c)3) and docosahexaenoic acid (DHA, malonyl-CoA to the fatty acid, resulting in the formation of a 22:603) for humans is mostly from fish or fish oil. Health B-ketoacyl intermediate. This is then reduced by NADPH, professionals have therefore recommended the regular inclu followed by a dehydration to yield an enoyl intermediate. sion of fish containing significant levels of LC-PUFA into the This intermediate is finally reduced a second time to produce human diet. Increasingly, fish-derived LC-PUFA oils are 55 the elongated fatty acid. It is generally thought that the con being incorporated into food products and in infant formula, densation step of these four reactions is Substrate specific for example. However, due to a decline in global and national whilst the other steps are not. In practice, this means that fisheries, alternative sources of these beneficial health-en native plant elongation machinery is capable of elongating hancing oils are needed. PUFA providing that the condensation enzyme (typically Flowering plants, in contrast to animals, lack the capacity 60 called an elongase) specific to the PUFA is introduced, to synthesise polyunsaturated fatty acids with chain lengths although the efficiency of the native plant elongation machin longer than 18 carbons. In particular, crop and horticultural ery in elongating the non-native PUFA substrates may below. plants along with otherangiosperms do not have the enzymes In 2007 the identification and characterisation of the yeast needed to synthesize the longer chain (p3 fatty acids such as elongation cycle dehydratase was published (Denic and EPA, docosapentaenoic acid (DPA, 22:5c)3) and DHA that 65 Weissman, 2007). are derived from ALA. An important goal in plant biotech PUFA desaturation in plants, mosses and microalgae natu nology is therefore the engineering of crop plants which rally occurs to fatty acid substrates predominantly in the US 8,946,460 B2 3 4 acyl-PC pool whilst elongation occurs to substrates in the which comprise linoleic acid (LA), (03 fatty acids which acyl-CoA pool. Transfer of fatty acids from acyl-PC mol comprise O-linolenic acid (ALA), and docosahexaenoic acid ecules to a CoA carrier is performed by phospholipases (DHA), and optionally one or more of stearidonic acid (PLAs) whilst the transfer of acyl-CoA fatty acids to a PC (SDA), eicosapentaenoic acid (EPA), docosapentaenoic acid carrier is performed by lysophosphatidyl-choline acyltrans (DPA) and eicosatetraenoic acid (ETA), wherein the level of ferases (LPCATs) (FIG. 21) (Singh et al., 2005). DHA in the total fatty acid content of the extracted lipid is Engineered Production of LC-PUFA about 7% to 20%. Most LC-PUFA metabolic engineering has been per In an embodiment, the extracted lipid has one or more or all formed using the aerobic A6-desaturation/elongation path of the following features way. The biosynthesis of Y-linolenic acid (GLA, 18:3()6) in 10 i) the level of palmitic acid in the total fatty acid content of tobacco was first reported in 1996 using a A6-desaturase from the cyanobacterium Synechocystis (Reddy and Thomas, the extracted lipid is between about 2% and 18%, 1996). More recently, GLA has been produced in crop plants between about 2% and 16%, or between about 2% and such as safflower (73% GLA in seedoil; Knaufet al., 2006) 15%, and soybean (28% GLA; Sato et al., 2004). The production of 15 ii) the level of myristic acid (C14:0) in the total fatty acid LC-PUFA such as EPA and DHA involves more complicated content of the extracted lipid is less than about 6%, less engineering due to the increased number of desaturation and than about 3%, less than about 2%, or less than about elongation steps involved. EPA production in a land plant was 1%, first reported by Qi et al. (2004) who introduced genes encod iii) the level of oleic acid in the total fatty acid content of the ing a A9-elongase from Isochrysis galbana, a A8-desaturase extracted lipid is between about 1% and about 30%, from Euglena gracilis and a A5-desaturase from Mortierella between about 3% and about 30%, between about 6% alpina into Arabidopsis yielding up to 3% EPA. This work and about 30%, between 1% and about 20%, between was followed by Abbadi et al. (2004) who reported the pro about 30% and about 60%, between about 45% to about duction of up to 0.8% EPA in flaxseed using genes encoding 60%, or is about 30%, a A6-desaturase and A6-elongase from Physcomitrella patens 25 iv) the level of linoleic acid (LA) in the total fatty acid and a A5-desaturase from Phaeodactylum tricornutum. content of the extracted lipid is between about 4% and The first report of DHA production, and to date the highest about 35%, between about 4% and about 20%, or levels of VLC-PUFA production reported, was in WO between about 4% and 17%, 04/017467 where the production of 3% DHA in soybean v) the level of C-linolenic acid (ALA) in the total fatty acid embryos is described, but not seed, by introducing genes 30 content of the extracted lipid is between about 4% and encoding the Saprolegnia diclina A6-desaturase, Mortierella about 40%, between about 7% and about 40%, between alpina A6-desaturase, Mortierella alpina A5-desaturase, about 10% and about 35%, between about 20% and Saprolegnia diclina A4-desaturase, Saprolegnia diclina A17 about 35%, between about 4% and about 16%, or desaturase, Mortierella alpina A6-elongase and Pavlova luth between about 2% and about 16%, eri A5-elongase. The maximal EPA level in embryos also 35 vi) the level of Y-linolenic acid (GLA) in the total fatty acid producing DHA was 19.6%, indicating that the efficiency of content of the extracted lipid is less than about 4%, less conversion of EPA to DHA was poor (WO 2004/071467). than about 3%, less than about 2%, less than about 1%, This finding was similar to that published by Robert et al. less than about 0.5%, between 0.05% and about 7%, (2005), where the flux from EPA to DHA was low, with the between 0.05% and about 4%, between 0.05% and about production of 3% EPA and 0.5% DHA in Arabidopsis using 40 3%, or between 0.05% and about 2%, the Danio rerio A5/6-desaturase, the Caenorhabditis elegans vii) the level of stearidonic acid (SDA) in the total fatty acid A6-elongase, and the Pavlova Salina A5-elongase and A4-de content of the extracted lipid is less than about 7%, less saturase. Also in 2005, Wu et al. published the production of than about 6%, less than about 4%, less than about 3%, 25% ARA, 15% EPA, and 1.5% DHA in Brassica iuncea between about 0.05% and about 7%, between about using the Pythium irregulare A6-desaturase, a Thraus 45 0.05% and about 6%, between about 0.05% and about tochytrid A5-desaturase, the Physcomitrella patens A6-elon 4%, between about 0.05% and about 3%, or between gase, the Calendula officianalis A12-desaturase, a Thraus 0.05% and about 2%, tochytrid A5-elongase, the Phytophthora infestans A17 viii) the level of eicosatetraenoic acid (ETA) in the total desaturase, the Oncorhyncus mykiss LC-PUFA elongase, a fatty acid content of the extracted lipid is less than about Thraustochytrid A4-desaturase and a Thraustochytrid 50 6%, less than about 5%, less than about 4%, less than LPCAT (Wu et al., 2005). Summaries of efforts to produce about 1%, less than about 0.5%, between about 0.05% oil-seed crops which synthesize ()3 LC-PUFAs is provided in and about 6%, between about 0.05% and about 5%, Venegas-Caleron et al. (2010) and Ruiz-Lopez et al. (2012). between about 0.05% and about 4%, between about As indicated by Ruiz-Lopez et al. (2012), results obtained to 0.05% and about 3%, or between about 0.05% and about date for the production of DHA in transgenic plants has been 55 2%, no where near the levels seen in fish oils. ix) the level of eicosatrienoic acid (ETrA) in the total fatty There therefore remains a need for more efficient produc acid content of the extracted lipid is less than about 4%, tion of LC-PUFA in recombinant cells, in particular of DHA less than about 2%, less than about 1%, between about in seeds of oilseed plants. 0.05% and about 4%, between about 0.05% and about 60 3%, between about 0.05% and about 2%, or between SUMMARY OF THE INVENTION about 0.05% and about 1%, x) the level of eicosapentaenoic acid (EPA) in the total fatty The present inventors have identified methods and plants acid content of the extracted lipid is less than about 4%, for producing lipid with high levels of DHA. less than about 3%, less than about 2%, between about In a first aspect, the present invention provides extracted 65 0.05% and about 10%, between about 0.05% and about plant lipid, comprising fatty acids in an esterified form, the 5%, between about 0.05% and about 3%, or between fatty acids comprising oleic acid, palmitic acid, ()6 fatty acids about 0.05% and about 2%. US 8,946,460 B2 5 6 xi) the level of docosapentaenoic acid (DPA) in the total between about 0.1 and about 0.5, less than about 0.50, fatty acid content of the extracted lipid is less than about less than about 0.40, less than about 0.30, less than about 4%, less than about 3%, less than about 2%, between 0.20, less than about 0.15, about 0.1, about 0.2 or about about 0.05% and about 8%, between about 0.05% and 1.0, about 5%, between about 0.05% and about 3%, or XXV) the fatty acid composition of the lipid is based on an between about 0.05% and about 2%, efficiency of conversion of oleic acid to LA by A12 xii) the level of DHA in the total fatty acid content of the desaturase of at least about 60%, at least about 70%, at extracted lipid is about 8%, about 9%, about 10%, about least about 80%, between about 60% and about 98%, 11%, about 12%, about 13%, about 14%, about 15%, between about 70% and about 95%, or between about about 16%, about 17%, about 18%, between about 8% 10 and 20%, between about 10% and 20%, between about 75% and about 90%, 11% and 20%, between about 10% and about 16%, or xxvi) the fatty acid composition of the lipid is based on an between about 14% and 20%, efficiency of conversion of ALA to SDA by A6-desatu xiii) the lipid comprises ()6-docosapentaenoic acid (22: rase of at least about 30%, at least about 40%, at least 5^*''''') in its fatty acid content, 15 about 50%, at least about 60%, at least about 70%, xiv) the lipid is essentially free of ()6-docosapentaenoic between about 30% and about 70%, between about 35% acid (22:5^'''''') in its fatty acid content, and about 60%, or between about 50% and about 70%, XV) the lipid is essentially free of SDA, EPA and ETA in its xxvii) the fatty acid composition of the lipid is based on an fatty acid content, efficiency of conversion of SDA to ETA acid by A6-elon xvi) the level of total saturated fatty acids in the total fatty gase of at least about 60%, at least about 70%, at least acid content of the extracted lipid is between about 4% about 75%, between about 60% and about 95%, between and about 25%, between about 4% and about 20%, about 70% and about 88%, or between about 75% and between about 6% and about 20%, between about 4% about 85%, and about 60%, between about 30% and about 60%, or xxviii) the fatty acid composition of the lipid is based on an between about 45% and about 60%, 25 efficiency of conversion of ETA to EPA by A5-desatu xvii) the level of total monounsaturated fatty acids in the rase of at least about 60%, at least about 70%, at least total fatty acid content of the extracted lipid is between about 75%, between about 60% and about 99%, between about 4% and about 35%, between about 8% and about about 70% and about 99%, or between about 75% and 25%, or between 8% and about 22%, about 98%, xviii) the level of total polyunsaturated fatty acids in the 30 XXix) the fatty acid composition of the lipid is based on an total fatty acid content of the extracted lipid is between efficiency of conversion of EPA to DPA by A5-elongase about 20% and about 75%, between about 50% and of at least about 80%, at least about 85%, at least about about 75%, or between about 60% and about 75%, 90%, between about 50% and about 95%, or between xix) the level of total (O6 fatty acids in the total fatty acid about 85% and about 95%, content of the extracted lipid is between about 35% and 35 XXX) the fatty acid composition of the lipid is based on an about 50%, between about 20% and about 35%, between efficiency of conversion of DPA to DHA by A4-desatu about 6% and 20%, less than about 20%, less than about rase of at least about 80%, at least about 90%, at least 16%, less than about 10%, between about 1% and about about 93%, between about 50% and about 95%, between 16%, between about 2% and about 10%, or between about 80% and about 95%, or between about 85% and about 4% and about 10%, 40 about 95%, XX) the level of new co6 fatty acids in the total fatty acid XXXi) the fatty acid composition of the lipid is based on an content of the extracted lipid is less than about 10%, less efficiency of conversion of oleic acid to DHA of at least than about 8%, less than about 6%, less than 4%, about 10%, at least about 15%, at least about 20%, between about 1% and about 20%, between about 1% between about 10% and about 50%, between about 10% and about 10%, between about 0.5% and about 8%, or 45 and about 30%, or between about 10% and about 25%, between about 0.5% and 4%, XXXii) the fatty acid composition of the lipid is based on an xxi) the level of total ()3 fatty acids in the total fatty acid efficiency of conversion of LA to DHA of at least about content of the extracted lipid is between 36% and about 15%, at least about 20%, at least about 22%, at least 65%, between about 40% and about 60%, between about about 25%, between about 15% and about 50%, between 20% and about 35%, between about 10% and about 50 about 20% and about 40%, or between about 20% and 20%, about 25%, about 30%, about 35% or about 40%, about 30%, xxii) the level of new co3 fatty acids in the total fatty acid XXXiii) the fatty acid composition of the lipid is based on an content of the extracted lipid is between about 9% and efficiency of conversion of ALA to DHA of at least about about 33%, between about 10% and about 20%, between 17%, at least about 22%, at least about 24%, between about 20% and about 30%, between about 12% and 55 about 17% and about 55%, between about 22% and about 25%, about 13%, about 15%, about 17% or about about 35%, or between about 24% and about 35%, 20%, XXXiv) the total fatty acid in the extracted lipid has less than xxiii) the ratio of total ()6 fatty acids:total ()3 fatty acids in 1% C20:1, the fatty acid content of the extracted lipid is between XXXV) the triacylglycerol (TAG) content of the lipid is at about 1.0 and about 3.0, between about 0.1 and about 1, 60 least about 70%, at least about 80%, at least about 90%, between about 0.1 and about 0.5, less than about 0.50, at least 95%, between about 70% and about 99%, or less than about 0.40, less than about 0.30, less than about between about 90% and about 99%, 0.20, less than about 0.15, about 1.0, about 0.1 or about XXXvi) the lipid comprises diacylglycerol (DAG), 0.2, XXXvii) the lipid comprises less than about 10%, less than xxiv) the ratio of new co6 fatty acids:new co3 fatty acids in 65 about 5%, less than about 1%, or between about 0.001% the fatty acid content of the extracted lipid is between and about 5%, free (non-esterified) fatty acids and/or about 1.0 and about 3.0, between about 0.1 and about 1, phospholipid, or is essentially free thereof, US 8,946,460 B2 7 8 XXXviii) at least 70%, or at least 80%, of the DHAesterified the level of new co3 fatty acids in the total fatty acid content of in the form of TAG is in the sn-1 or sn-3 position of the the extracted lipid is between about 9% and about 33%, the TAG, ratio oftotal ()6 fatty acids:total ()3 fatty acids in the fatty acid XXXix) the most abundant DHA-containing TAG species in content of the extracted lipid is between about 0.05 and about the lipid is DHA/18:3/18:3 (TAG 58:12), and 5 3.0, the ratio of new (06 fatty acids: new co3 fatty acids in the xl) the lipid comprises tri-DHATAG (TAG 66:18). fatty acid content of the extracted lipid is between about 0.03 In another embodiment, the extracted lipid is in the form of and about 3.0, the fatty acid composition of the lipid is based an oil, wherein at least about 90%, or least about 95%, at least on: an efficiency of conversion of oleic acid to LA by A12 about 98%, or between about 95% and about 98%, by weight desaturase of at least about 60%, an efficiency of conversion of the oil is the lipid. 10 of SDA to ETA acid by A6-elongase of at least about 60%, an In a preferred embodiment, the lipid or oil, preferably a efficiency of conversion of ETA to EPA by A5-desaturase of seedoil, has the following features: in the total fatty acid at least about 60%, an efficiency of conversion of EPA to DPA content of the lipid or oil, the level of DHA is between about by A5-elongase of between about 50% and about 95%, an 7% and 20%, the level of palmitic acid is between about 2% efficiency of conversion of DPA to DHA by A4-desaturase of and about 16%, the level of myristic acid is less than about 15 between about 50% and about 95%, an efficiency of conver 6%, the level of oleic acid is between about 1% and about sion of oleic acid to DHA of at least about 10%, an efficiency 30%, the level of LA is between about 4% and about 35%, of conversion of LA to DHA of at least about 15%, an effi ALA is present, GLA is present, the level of SDA is between ciency of conversion of ALA to DHA of at least about 17%, about 0.05% and about 7%, the level of ETA is less than about and the total fatty acid content in the extracted lipid has less 4%, the level of EPA is between about 0.05% and about 10%, than 1% C20:1, the triacylglycerol (TAG) content of the lipid the level of DPA is between about 0.05% and about 8%, the is at least about 70%, the lipid is essentially free of choles level of total saturated fatty acids in the total fatty acid content terol, and the lipid comprises tri-DHA TAG (TAG 66:18). of the extracted lipid is between about 4% and about 25%, the Preferably, the lipid or oil is canola oil and/or has not been level of total monounsaturated fatty acids in the total fatty treated with a transesterification process after it was extracted acid content of the extracted lipid is between about 4% and 25 from the plant or plant part. In a particular embodiment, the about 35%, the level of total polyunsaturated fatty acids in the lipid or canola oil may subsequently be treated to convert the total fatty acid content of the extracted lipid is between about fatty acids in the oil to alkyl esters such as methyl or ethyl 20% and about 75%, the ratio of total (O6 fatty acids:total ()3 esters. Further treatment may be applied to enrich the lipid or fatty acids in the fatty acid content of the extracted lipid is oil for the DHA. between about 0.05 and about 3.0, the ratio of new co6 fatty 30 In an embodiment, the lipid or oil, preferably a seedoil, has acids:new co3 fatty acids in the fatty acid content of the the following features: in the total fatty acid content of the extracted lipid is between about 0.03 and about 3.0, prefer lipid, the level of DHA is between about 7% and 20%, the ably less than about 0.50, the fatty acid composition of the level of palmitic acid is between about 2% and about 16%, the lipid is based on: an efficiency of conversion of oleic acid to level of myristic acid is less than about 2%, the level of oleic LA by A12-desaturase of at least about 60%, an efficiency of 35 acid is between about 30% and about 60%, preferably conversion of SDA to ETA acid by A6-elongase of at least between about 45% and about 60%, the level of LA is about 60%, an efficiency of conversion of EPA to DPA by between about 4% and about 20%, the level of ALA is A5-elongase of between about 50% and about 95%, an effi between about 2% and about 16%, the level of GLA is less ciency of conversion of DPA to DHA by A4-desaturase of than about 3%, the level of SDA is less than about 3%, the between about 50% and about 95%, an efficiency of conver 40 level of ETA is less than about 4%, the level of ETrAless than sion of oleic acid to DHA of at least about 10%, and the about 2%, the level of EPA is less than about 4%, the level of triacylglycerol (TAG) content of the lipid is at least about DPA is less than about 4%, the level of total saturated fatty 70%, and optionally the lipid is essentially free of cholesterol acids in the total fatty acid content of the extracted lipid is and/or the lipid comprises tri-DHATAG (TAG 66:18). between about 4% and about 25%, the level of total monoun In a more preferred embodiment, the lipid or oil, preferably 45 saturated fatty acids in the total fatty acid content of the a seedoil, has the following features: in the total fatty acid extracted lipid is between about 30% and about 60%, or content of the lipid, the level of DHA is between about 7% and between about 40% and about 60%, the level of total polyun 20%, the level of palmitic acid is between about 2% and about saturated fatty acids in the total fatty acid content of the 16%, the level of myristic acid is less than about 2%, the level extracted lipid is between about 20% and about 75%, the level of oleic acid is between about 1% and about 30%, the level of 50 of new ()6 fatty acids in the total fatty acid content of the LA is between about 4% and about 35%, the level of ALA is extracted lipid is between about 0.5% and about 10%, the between about 7% and about 40%, the level of GLA is less level of total co3 fatty acids in the total fatty acid content of the than about 4%, the level of SDA is between about 0.05% and extracted lipid is between about 10% and about 20%, the level about 7%, the level of ETA is less than about 4%, the level of of new co3 fatty acids in the total fatty acid content of the ETrA is between about 0.05% and about 4%, the level of EPA 55 extracted lipid is between about 9% and about 20%, the ratio is between about 0.05% and about 10%, the level of DPA is of total (O6 fatty acids:total co3 fatty acids in the fatty acid between about 0.05% and about 8%, the level of total satu content of the extracted lipid is between about 0.05 and about rated fatty acids in the total fatty acid content of the extracted 3.0, preferably less than about 0.50, the ratio of new co6 fatty lipid is between about 4% and about 25%, the level of total acids:new co3 fatty acids in the fatty acid content of the monounsaturated fatty acids in the total fatty acid content of 60 extracted lipid is between about 0.03 and about 3.0, the tria the extracted lipid is between about 4% and about 35%, the cylglycerol (TAG) content of the lipid is at least about 70%, level of total polyunsaturated fatty acids in the total fatty acid the lipid is essentially free of cholesterol, and the lipid com content of the extracted lipid is between about 20% and about prises tri-DHATAG (TAG 66:18). Preferably, the lipid or oil 75%, the level of new (O6 fatty acids in the total fatty acid is essentially free of SDA, EPA and ETA and/or is canola oil content of the extracted lipid is between about 0.5% and about 65 and/or has not been treated with a transesterification process 10%, the level of total co3 fatty acids in the total fatty acid after it was extracted from the plant or plant part. In a par content of the extracted lipid is between 36% and about 75%, ticular embodiment, the lipid or canola oil may Subsequently US 8,946,460 B2 10 be treated to convert the fatty acids in the oil to alkyl esters viii) the level of SDA is less than about 6%, or less than such as methyl or ethyl esters. Further treatment may be about 4%, applied to enrich the lipid or oil for the DHA. ix) the level of ETA is less than about 6%, or less than about In a further preferred embodiment, the lipid or oil, prefer 4%, ably a seedoil, has the following features: in the total fatty x) the level of ETrA less than about 1%, acid content of the lipid or oil, the level of DHA is between xi) the level of EPA is less than about 10% and/or the level about 7% and 20%, the level of palmitic acid is between about of EPA is 0.5-2.0 fold the level of DHA, 2% and about 16%, the level of myristic acid is less than about xii) the level of DPA is less than about 4%, 6%, the level of oleic acid is between about 1% and about xiii) the level of total saturated fatty acids in the total fatty 30%, the level of LA is between about 4% and about 35%, 10 acid content of the extracted lipid is between about 4% and ALA is present, GLA is present, the level of SDA is between about 25%, about 0.05% and about 7%, the level of ETA is less than about xiv) the level of total monounsaturated fatty acids in the 6%, the level of EPA is between about 0.05% and about 10%, total fatty acid content of the extracted lipid is between about the level of DPA is between about 0.05% and about 8%. 30% and about 70%, 15 XV) the level of total polyunsaturated fatty acids in the total In a further embodiment, the extracted lipid further com fatty acid content of the extracted lipid is between about 15% prises one or more sterols, preferably plant sterols. and about 75%, preferably between about 15% and about In another embodiment, the extracted lipid is in the form of 30%, an oil, and comprises less than about 10 mg of sterols/g of oil, xvi) the level of new co6 fatty acids in the total fatty acid less than about 7 mg of sterols/g of oil, between about 1.5 mg content of the extracted lipid is between about 0.5% and about and about 10 mg of sterols/g of oil, or between about 1.5 mg 10%, and about 7 mg of sterols/g of oil. xvii) the level of total co3 fatty acids in the total fatty acid Examples of sterols which can be in the extracted lipid content of the extracted lipid is between about 10% and about include, but are not necessarily limited to, one or more or all 20%, of campesterol/24-methylcholesterol. A5-Stigmasterol, ebu 25 xviii) the level of new co3 fatty acids in the total fatty acid ricol, B-sitosterol/24-ethylcholesterol, A5-avenasterol/isoflu content of the extracted lipid is between about 3% and about costerol, A7-Stigmasterol/stigmast-7-en-3.3-ol, and A7-ave 20%, nasterol. xix) the ratio of total (O6 fatty acids:total ()3 fatty acids in In an embodiment, the plant species is one listed in Table the fatty acid content of the extracted lipid is between about 26, Such as canola, and the level of sterols are about the same 30 0.05 and about 3.0, preferably less than about 0.50, as that listed in Table 26 for that particular plant species. XX) the ratio of new ()6 fatty acids: new co3 fatty acids in the In an embodiment, the extracted lipid comprises less than fatty acid content of the extracted lipid is between about 0.03 about 0.5 mg of cholesterol/g of oil, less than about 0.25 mg and about 3.0, of cholesterol/g of oil, between about 0 mg and about 0.5 mg xxi) the triacylglycerol (TAG) content of the lipid is at least of cholesterol/g of oil, or between about 0 mg and about 0.25 35 about 70%, and mg of cholesterol/g of oil, or which is essentially free of xxii) the lipid is essentially free of cholesterol. In an cholesterol. embodiment, the lipid comprises tri-DHATAG (TAG 66:18). In a further embodiment, the lipid is an oil, preferably oil More preferably, the lipid is essentially free of SDA and ETA, from an oilseed. Examples of such oils include, but are not and/or has not been treated with a transesterification process limited to, Brassica sp. oil such as canola oil, Gossypium 40 after it was extracted from the plant or plant part. hirsutlum oil, Linum usitatissimum oil, Helianthus sp. oil, In another aspect, provided is extracted plant lipid, com Carthamus tinctorius oil, Glycine max oil, Zea mays oil, prising fatty acids in an esterified form, the fatty acids com Arabidopsis thaliana oil, Sorghum bicolor oil, Sorghum vul prising oleic acid, palmitic acid, (D6 fatty acids which com gare oil, Avena sativa oil, Trifolium sp. oil, Elaesisguineenis prise linoleic acid (LA), (03 fatty acids which comprise oil, Nicotiana benthamiana oil, Hordeum vulgare oil, Lupi 45 O-linolenic acid (ALA) and docosahexaenoic acid (DHA), nus angustifolius oil, Oryza sativa oil, Oryza glaberrima oil, and one or more of Stearidonic acid (SDA), eicosapentaenoic Camelina sativa oil, Crambe abyssinica oil, MiscanthusX acid (EPA), docosapentaenoic acid (DPA) and eicosatet giganteus oil, or Miscanthus sinensis oil. raenoic acid (ETA), wherein (i) the level of DHA in the total Also provided is extracted plant lipid, preferably extracted fatty acid content of the extracted lipid is between 7% and canola seedoil, comprising fatty acids in an esterified form, 50 20%, (ii) the level of palmitic acid in the total fatty acid the fatty acids comprising oleic acid, palmitic acid, ()6 fatty content of the extracted lipid is between 2% and 16%, (iii) the acids which comprise linoleic acid (LA), ()3 fatty acids which level of myristic acid (C14:0) in the total fatty acid content of comprise O-linolenic acid (ALA), and docosahexaenoic acid the extracted lipid is less than 6%, (iv) the level of oleic acid (DHA), and optionally one or more of stearidonic acid in the total fatty acid content of the extracted lipid is between (SDA), eicosapentaenoic acid (EPA), docosapentaenoic acid 55 1% and 30% or between 30% and 60%, (v) the level of (DPA) and eicosatetraenoic acid (ETA), wherein lipid has the linoleic acid (LA) in the total fatty acid content of the following features in the total fatty acid content of the lipid: extracted lipid is between 4% and 35%, (vi) the level of i) the level of DHA is about 3%, about 4%, about 5%, about O-linolenic acid (ALA) in the total fatty acid content of the 6% or about 7%, extracted lipid is between 4% and 40%, (vii) the level of ii) the level of palmitic acid is between about 2% and about 60 eicosatrienoic acid (ETrA) in the total fatty acid content of the 16%, extracted lipid is less than 4%. (viii) the level of total saturated iii) the level of myristic acid is less than about 2%, fatty acids in the total fatty acid content of the extracted lipid iv) the level of oleic acid is between about 30% and about is between 4% and 25%, (ix) the ratio of total ()6 fatty acids: 60%, preferably between about 45% and about 60%, total ()3 fatty acids in the fatty acid content of the extracted v) the level of LA is between about 4% and about 20%, 65 lipid is between 1.0 and 3.0 or between 0.1 and 1, (x) the vi) the level of ALA is between about 2% and about 16%, triacylglycerol (TAG) content of the lipid is at least 70%, and vii) the level of GLA is less than about 4%, (xi) at least 70% of the DHA esterified in the form of TAG is US 8,946,460 B2 11 12 in the sn-1 or sn-3 position of the TAG. In an embodiment, one xvii) the level of total monounsaturated fatty acids in the or more or all of the following features total fatty acid content of the extracted lipid is between i) the level of palmitic acid in the total fatty acid content of about 4% and about 35%, between about 8% and about the extracted lipid is between 2% and 15%, 25%, or between 8% and about 22%, ii) the level of myristic acid (C14:0) in the total fatty acid 5 xviii) the level of total polyunsaturated fatty acids in the content of the extracted lipid is less than 1%. total fatty acid content of the extracted lipid is between iii) the level of oleic acid in the total fatty acid content of the about 20% and about 75%, between about 50% and extracted lipid is between about 3% and about 30%, about 75%, or between about 60% and about 75%, between about 6% and about 30%, between 1% and xix) the level of total (O6 fatty acids in the total fatty acid about 20%, between about 45% and about 60%, or is 10 about 30%, content of the extracted lipid is between about 35% and iv) the level of linoleic acid (LA) in the total fatty acid about 50%, between about 20% and about 35%, between content of the extracted lipid is between about 4% and about 6% and 20%, less than 20%, less than about 16%, about 20%, or between about 4% and 17%, less than about 10%, between about 1% and about 16%, v) the level of C-linolenic acid (ALA) in the total fatty acid 15 between about 2% and about 10%, or between about 4% content of the extracted lipid is between about 7% and and about 10%, about 40%, between about 10% and about 35%, between XX) the level of new co6 fatty acids in the total fatty acid about 20% and about 35%, or between about 4% and content of the extracted lipid is less than about 10%, less 16%, than about 8%, less than about 6%, less than 4%, vi) the level of Y-linolenic acid (GLA) in the total fatty acid between about 1% and about 20%, between about 1% content of the extracted lipid is less than 4%, less than and about 10%, between about 0.5% and about 8%, or about 3%, less than about 2%, less than about 1%, less between about 0.5% and 4%, than about 0.5%, between 0.05% and 7%, between xxi) the level of total ()3 fatty acids in the total fatty acid 0.05% and 4%, or between 0.05% and about 3%, or content of the extracted lipid is between 36% and about between 0.05% and about 2%, 25 65%, between 40% and about 60%, between about 20% vii) the level of stearidonic acid (SDA) in the total fatty acid and about 35%, between about 10% and about 20%, content of the extracted lipid is less than about 4%, less about 25%, about 30%, about 35% or about 40%, than about 3%, between about 0.05% and about 7%, xxii) the level of new co3 fatty acids in the total fatty acid between about 0.05% and about 4%, between about content of the extracted lipid is between 9% and about 0.05% and about 3%, or between 0.05% and about 2%, 30 33%, between about 10% and about 20%, between about viii) the level of eicosatetraenoic acid (ETA) in the total 20% and about 30%, between about 12% and about fatty acid content of the extracted lipid is less than about 25%, about 13%, about 15%, about 17% or about 20%, 4%, less than about 1%, less than about 0.5%, between xxiii) the ratio of total ()6 fatty acids:total ()3 fatty acids in about 0.05% and about 5%, between about 0.05% and the fatty acid content of the extracted lipid is between about 4%, between about 0.05% and about 3%, or 35 about 0.1 and about 0.5, less than about 0.50, less than between about 0.05% and about 2%, about 0.40, less than about 0.30, less than about 0.20, ix) the level of eicosatrienoic acid (ETrA) in the total fatty less than about 0.15, about 1.0, about 0.1 or about 0.2, acid content of the extracted lipid is less than about 2%, xxiv) the ratio of new co6 fatty acids:new ()3 fatty acids in less than about 1%, between 0.05% and 4%, between the fatty acid content of the extracted lipid is between 0.05% and 3%, or between 0.05% and about 2%, or 40 about 1.0 and about 3.0, between about 0.1 and about 1, between 0.05% and about 1%, between about 0.1 and about 0.5, less than about 0.50, x) the level of eicosapentaenoic acid (EPA) in the total fatty less than about 0.40, less than about 0.30, less than about acid content of the extracted lipid is less than 4%, less 0.20, less than about 0.15, about 0.1, about 0.2 or about than about 3%, less than about 2%, between 0.05% and 1.0, 10%, between 0.05% and 5%, or between 0.05% and 45 XXV) the fatty acid composition of the lipid is based on an about 3%, or between 0.05% and about 2%, efficiency of conversion of oleic acid to DHA of at least xi) the level of docosapentaenoic acid (DPA) in the total about 10%, at least about 15%, at least about 20%, fatty acid content of the extracted lipid is less than 4%. between about 10% and about 50%, between about 10% less than about 3%, less than about 2%, between 0.05% and about 30%, or between about 10% and about 25%, and 8%, between 0.05% and 5%, or between 0.05% and 50 xxvi) the fatty acid composition of the lipid is based on an about 3%, or between 0.05% and about 2%, efficiency of conversion of LA to DHA of at least about xii) the level of DHA in the total fatty acid content of the 15%, at least about 20%, at least about 22%, at least extracted lipid is about 8%, about 9%, about 10%, about about 25%, between about 15% and about 50%, between 11%, about 12%, about 13%, about 14%, about 15%, about 20% and about 40%, or between about 20% and about 16%, about 17%, about 18%, between about 8% 55 about 30%, and 20%, between about 10% and 20%, between about xxvii) the fatty acid composition of the lipid is based on an 11% and 20%, between about 10% and about 16%, or efficiency of conversion of ALA to DHA of at least about between about 14% and 20%, 17%, at least about 22%, at least about 24%, between xiii) the lipid comprises ()6-docosapentaenoic acid (22: about 17% and about 55%, between about 22% and 5^*''''') in its fatty acid content, 60 about 35%, or between about 24% and about 35%, xiv) the lipid is essentially free of ()6-docosapentaenoic xxviii) the total fatty acid in the extracted lipid has less than acid (22:5^'''''') in its fatty acid content, 1% C20:1, XV) the lipid is essentially free of SDA, EPA and ETA in its xxix) the triacylglycerol (TAG) content of the lipid is at fatty acid content, least about 80%, at least about 90%, at least 95%, xvi) the level of total saturated fatty acids in the total fatty 65 between about 70% and about 99%, or between about acid content of the extracted lipid is between about 4% 90% and about 99%, and about 20%, or between about 6% and about 20%, XXX) the lipid comprises diacylglycerol (DAG), US 8,946,460 B2 13 14 XXXi) the lipid comprises less than about 10%, less than vii) a A12-desaturase, a A8-desaturase, a A5-desaturase, a about 5%, less than about 1%, or between about 0.001% A4-desaturase, a A9-elongase and an A5-elongase, or and about 5%, free (non-esterified) fatty acids and/or viii) a A12-desaturase, a co3-desaturase or a A15-desatu phospholipid, or is essentially free thereof, rase, a A8-desaturase, a A5-desaturase, a A4-desaturase, a XXXii) at least 80%, of the DHA esterified in the form of 5 A9-elongase and an A5-elongase, TAG is in the sn-1 or sn-3 position of the TAG, and wherein each polynucleotide is operably linked to one or XXXiii) the most abundant DHA-containing TAG species in more promoters that are capable of directing expression of the lipid is DHA/18:3/18:3 (TAG 58:12), and said polynucleotides in a cell of the plant part. XXXiv) the lipid comprises tri-DHATAG (TAG 66:18). In yet a further embodiment, the plant part has one or more With specific regard to the above aspect, in an embodiment 10 or all of the following features i) the lipid is in the form of an oil, wherein the oil comprises i) the A12-desaturase converts oleic acid to linoleic acid in one or more sterols such as one or more or all of campesterol, one or more cells of the plant with an efficiency of at least A5-stigmasterol, eburicol, B-sitosterol, A5-avenasterol, about 60%, at least about 70%, at least about 80%, between A7-stigmasterol and A7-avenasterol, and optionally the oil 15 about 60% and about 98%, between about 70% and about comprises less than 10 mg of sterols/g of oil and/or the oil is 95%, or between about 75% and about 90%, essentially free of cholesterol, and/or ii) the co3-desaturase converts ()6 fatty acids to co3 fatty ii) the lipid is in the form of an oil from an oilseed such as acids in one or more cells of the plant with an efficiency of at oilseed is a Brassica spoilseed or canola seed. least about 65%, at least about 75%, at least about 85%, In another aspect, the present invention provides a process between about 65% and about 95%, between about 75% and for producing extracted plant lipid, comprising the steps of about 95%, or between about 80% and about 95%, i) obtaining a plant part comprising lipid, the lipid com iii) the A6-desaturase converts ALA to SDA in one or more prising fatty acids in an esterified form, the fatty acids com cells of the plant with an efficiency of at least about 30%, at prising oleic acid, palmitic acid, (D6 fatty acids which com least about 40%, at least about 50%, at least about 60%, at prise linoleic acid (LA), (03 fatty acids which comprise 25 least about 70%, between about 30% and about 70%, between O-linolenic acid (ALA), and docosahexaenoic acid (DHA), about 35% and about 60%, or between about 50% and about and optionally one or more of eicosapentaenoic acid (EPA), 70%, stearidonic acid (SDA), docosapentaenoic acid (DPA) and iv) the A6-desaturase converts linoleic acid to Y-linolenic eicosatetraenoic acid (ETA), wherein the level of DHA in the acid in one or more cells of the plant with an efficiency of less total fatty acid content of extractable lipid in the plant part is 30 than about 5%, less than about 2.5%, less than about 1%, about 7% to 20%, and between about 0.1% and about 5%, between about 0.5% and ii) extracting lipid from the plant part, about 2.5%, or between about 0.5% and about 1%, wherein the level of DHA in the total fatty acid content of the v) the A6-elongase converts SDA to ETA in one or more extracted lipid is about 7% to 20%. cells of the plant with an efficiency of at least about 60%, at In a preferred embodiment, the extracted lipid has one or 35 least about 70%, at least about 75%, between about 60% and more of the features defined above. about 95%, between about 70% and about 88%, or between In an embodiment, wherein the plant part is a seed, prefer about 75% and about 85%, ably an oilseed. Examples of Such seeds include, but are not vi) the A5-desaturase converts ETA to EPA in one or more limited to, Brassica sp., Gossypium hirsutum, Linum usitatis cells of the plant with an efficiency of at least about 60%, at Simum, Helianthus sp., Carthamus tinctorius, Glycine max, 40 least about 70%, at least about 75%, at least about 80%, at Zea mays, Arabidopsis thaliana, Sorghum bicolor, Sorghum least about 90%, between about 60% and about 99%, between vulgare, Avena sativa, Trifblium sp., Elaesis guineenis, Nic about 70% and about 99%, or between about 75% and about Otiana benthamiana, Hordeum vulgare, Lupinus angustifo 98%, lius, Oryza sativa, Oryza glaberrima, Camelina sativa, or vii) the A5-elongase converts EPA to DPA in one or more Crambe abyssinica, preferably a Brassica napus, B. juncea or 45 cells of the plant with an efficiency of at least about 80%, at C. sativa seed. least about 85%, at least about 90%, between about 50% and In another embodiment, the seed comprises at least about about 95%, or between about 85% and about 95%, 18 mg, at least about 22 mg, at least about 26 mg, between viii) the A4-desaturase converts DPA to DHA in one or about 18 mg and about 100 mg, between about 22 mg and more cells of the plant with an efficiency of at least about about 70 mg. or between about 24 mg and about 50 mg. of 50 80%, at least about 90%, at least about 93%, between about DHA per gram of seed. 50% and about 95%, between about 80% and about 95%, or In a further embodiment, the plant part comprises exog between about 85% and about 95%, enous polynucleotides encoding one of the following sets of ix) the efficiency of conversion of oleic acid to DHA in one enzymes; or more cells of the plant part is at least about 10%, at least i) an (03-desaturase, a A6-desaturase, a A5-desaturase, a 55 about 15%, at least about 20%, between about 10% and about A4-desaturase, a A6-elongase and a A5-elongase, 50%, between about 10% and about 30%, or between about ii) a A15-desaturase, a A6-desaturase, a A5-desaturase, a 10% and about 25%, A4-desaturase, a A6-elongase and a A5-elongase, x) the efficiency of conversion of LA to DHA in one or iii) a A12-desaturase, a A6-desaturase, a A5-desaturase, a more cells of the plant part is at least about 15%, at least about A4-desaturase, a A6-elongase and an A5-elongase, 60 20%, at least about 22%, at least about 25%, between about iv) a A12-desaturase, a (03-desaturase or a A15-desaturase, 15% and about 50%, between about 20% and about 40%, or a A6-desaturase, a A5-desaturase, a A4-desaturase, a A6-elon between about 20% and about 30%, gase and an A5-elongase, xi) the efficiency of conversion of ALA to DHA in one or V) an (D3-desaturase, a A8-desaturase, a A5-desaturase, a more cells of the plant part is at least about 17%, at least about A4-desaturase, a A9-elongase and an A5-elongase, 65 22%, at least about 24%, between about 17% and about 55%, vi) a A15-desaturase, a A8-desaturase, a A5-desaturase, a between about 22% and about 35%, or between about 24% A4-desaturase, a A9-elongase and a A5-elongase, and about 35%, US 8,946,460 B2 15 16 xii) one or more cells of the plant part comprise at least iii) the A6-desaturase comprises amino acids having a about 15%, at least about 20%, between about 15% and about sequence as provided in SEQID NO:16, a biologically active 30%, or between about 22.5% and about 27.5%, more (03 fragment thereof, or an amino acid sequence which is at least fatty acids than corresponding cells lacking the exogenous 50% identical to SEQID NO:16, polynucleotides, iv) the A6-elongase comprises amino acids having a xiii) the A6-desaturase preferentially desaturates C-lino sequence as provided in SEQID NO:25, a biologically active lenic acid (ALA) relative to linoleic acid (LA), fragment thereof such as SEQID NO:26, or an amino acid Xiv) the A6-elongase also has A9-elongase activity, sequence which is at least 50% identical to SEQID NO:25 XV) the A12-desaturase also has A15-desaturase activity, and/or SEQID NO:26, 10 V) the A5-desaturase comprises amino acids having a Xvi) the A6-desaturase also has A8-desaturase activity, sequence as provided in SEQID NO:30, a biologically active Xvii) the A8-desaturase also has A6-desaturase activity or fragment thereof, or an amino acid sequence which is at least does not have A6-desaturase activity, 50% identical to SEQID NO:30, xviii) the A15-desaturase also has co3-desaturase activity vi) the A5-elongase comprises amino acids having a on GLA, 15 sequence as provided in SEQID NO:37, a biologically active xix) the (O3-desaturase also has A15-desaturase activity on fragment thereof, or an amino acid sequence which is at least LA, 50% identical to SEQID NO:37, XX) the co3-desaturase desaturates both LA and/or GLA, vii) the A4-desaturase comprises amino acids having a xxi) the co3-desaturase preferentially desaturates GLA sequence as provided in SEQID NO:41, a biologically active relative to LA, fragment thereof, or an amino acid sequence which is at least xxii) the level of DHA in the plant part is based on an 50% identical to SEQID NO:41. efficiency of conversion of oleic acid to DHA in the plant part In an embodiment, the plant part further comprises an of at least about 10%, at least about 15%, at least about 20%, exogenous polynucleotide encoding a diacylglycerol acyl between about 10% and about 50%, between about 15% and transferase (DGAT), monoacylglycerol acyltransferase about 30%, or between about 20% and about 25%, 25 (MGAT), glycerol-3-phosphate acyltransferase (GPAT), xxiii) the level of DHA in the plant part is based on an 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) pref efficiency of conversion of LA to DHA in the plant part of at erably an LPAAT which can use a C22 polyunsaturated fatty least about 15%, at least about 20%, at least about 22%, acyl-CoA Substrate, acyl-CoA:lysophosphatidylcholine between about 15% and about 60%, between about 20% and acyltransferase (LPCAT), phospholipase A(PLA), phos about 40%, or between about 22% and about 30%, 30 pholipase C(PLC), phospholipase D (PLD), CDP-choline xxiv) the level of DHA in the plant part is based on an diacylglycerol choline phosphotransferase (CPT), phoshati efficiency of conversion of ALA to DHA in the plant part of at dylcholine diacylglycerol acyltransferase (PDAT), phos least about 17%, at least about 22%, at least about 24%, phatidylcholine:diacylglycerol choline phosphotransferase between about 17% and about 65%, between about 22% and (PDCT), acyl-CoA synthase (ACS), or a combination of two about 35%, or between about 24% and about 35% 35 or more thereof. XXX) one or more or all of the desaturases have greater In another embodiment, the plant part further comprises an activity on an acyl-CoA substrate than a corresponding acyl introduced mutation or an exogenous polynucleotide which PC substrate, down regulates the production and/or activity of an endog XXXi) the A6-desaturase has greater A6-desaturase activity enous enzyme in a cell of the plant part selected from FAE1. on ALA than LA as fatty acid Substrate, 40 DGAT, MGAT, GPAT, LPAAT, LPCAT, PLA, PLC, PLD, XXXii) the A6-desaturase has greater A6-desaturase activity CPT, PDAT, a thioesterase such as FATB, or a A12-desatu on ALA-CoA as fatty acid substrate than on ALA joined to the rase, or a combination of two or more thereof. sn-2 position of PC as fatty acid substrate, In a further embodiment, at least one, or all, of the promot XXXiii) the A6-desaturase has at least about a 2-fold greater ers are seed specific promoters. In an embodiment, at least A6-desaturase activity, at least 3-fold greateractivity, at least 45 one, or all, of the promoters have been obtained from oil 4-fold greater activity, or at least 5-fold greater activity, on biosynthesis or accumulation genes such as oleosin, or from ALA as a Substrate compared to LA, seed storage protein genes such as conlinin. XXXiv) the A6-desaturase has greateractivity on ALA-CoA In another embodiment, the promoter(s) directing expres as fatty acid Substrate than on ALA joined to the Sn-2 position sion of the exogenous polynucleotides encoding the A4-de of PC as fatty acid substrate, 50 saturase and the A5-elongase initiate expression of the poly XXXV) the A6-desaturase has at least about a 5-fold greater nucleotides in developing seed of the plant part before, or A6-desaturase activity or at least 10-fold greater activity, on reach peak expression before, the promoter(s) directing ALA-CoA as fatty acid substrate than on ALA joined to the expression of the exogenous polynucleotides encoding the sn-2 position of PC as fatty acid substrate, A 12-desaturase and the (p3-desaturase. XXXVi) the desaturase is a front-end desaturase, 55 In a further embodiment, the exogenous polynucleotides XXXvii) the A6-desaturase has no detectable A5-desaturase are covalently linked in a DNA molecule, preferably a T-DNA activity on ETA. molecule, integrated into the genome of cells of the plant part In yet a further embodiment, the plant part has one or more and preferably where the number of such DNA molecules or all of the following features integrated into the genome of the cells of the plant part is not i) the A12-desaturase comprises amino acids having a 60 more than one, two or three, or is two or three. sequence as provided in SEQID NO:10, a biologically active In yet another embodiment, the plant comprises at least two fragment thereof, or an amino acid sequence which is at least different, exogenous polynucleotides each encoding a A6-de 50% identical to SEQID NO:10, saturase which have the same or different amino acid ii) the (O3-desaturase comprises amino acids having a Sequences. sequence as provided in SEQID NO:12, a biologically active 65 In a further embodiment, the total oil content of the plant fragment thereof, or an amino acid sequence which is at least part comprising the exogenous polynucleotides is at least 50% identical to SEQID NO:12, about 40%, or at least about 50%, or at least about 60%, or at US 8,946,460 B2 17 18 least about 70%, or between about 50% and about 80% of the xviii) the level of new co3 fatty acids in the total fatty acid total oil content of a corresponding plant part lacking the content of the extracted lipid is between about 3% and about exogenous polynucleotides. In these embodiments, the maxi 20%, mum oil content may be about 100% of the oil content of a xix) the ratio of total (6 fatty acids: total ()3 fatty acids in the corresponding wild-type plant part. fatty acid content of the extracted lipid is between about 0.05 In another embodiment, the lipid is in the form of an oil, and about 3.0, preferably less than about 0.50, preferably a seedoil from an oilseed, and wherein at least XX) the ratio of new co6 fatty acids:new (c)3 fatty acids in about 90%, or about least 95%, at least about 98%, or between the fatty acid content of the extracted lipid is between about about 95% and about 98%, by weight of the lipid is triacylg 0.03 and about 3.0, lycerols. 10 xxi) the triacylglycerol (TAG) content of the lipid is at least about 70%, and In a further embodiment, the process further comprises xxii) the lipid is essentially free of cholesterol. In an treating the lipid to increase the level of DHA as a percentage embodiment, the lipid comprises tri-DHATAG (TAG 66:18). of the total fatty acid content. For example, the treatment is More preferably, the lipid is essentially free of SDA and ETA, transesterification. For example, the lipid such as canola oil 15 and/or has not been treated with a transesterification process may be treated to convert the fatty acids in the oil to alkyl after it was extracted from the plant or plant part. esters such as methyl or ethyl esters, which may then be Also provided is a process for producing extracted plant fractionated to enrich the lipid or oil for the DHA. lipid, comprising the steps of Further, provided is a process for producing extracted plant i) obtaining a plant part comprising lipid, the lipid com lipid, comprising the steps of prising fatty acids in an esterified form, the fatty acids com i) obtaining a plant part, preferably canola seed, compris prising oleic acid, palmitic acid, (D6 fatty acids which com ing lipid, the lipid comprising fatty acids in an esterified form, prise linoleic acid (LA), (03 fatty acids which comprise the fatty acids comprising oleic acid, palmitic acid, ()6 fatty O-linolenic acid (ALA) and docosahexaenoic acid (DHA), acids which comprise linoleic acid (LA), ()3 fatty acids which and one or more of Stearidonic acid (SDA), eicosapentaenoic comprise O-linolenic acid (ALA), and docosahexaenoic acid 25 acid (EPA), docosapentaenoic acid (DPA) and eicosatet (DHA), and optionally one or more of eicosapentaenoic acid raenoic acid (ETA), wherein (i) the level of DHA in the total (EPA), stearidonic acid (SDA), docosapentaenoic acid (DPA) fatty acid content of the extracted lipid is between 7% and and eicosatetraenoic acid (ETA), wherein the level of DHA in 20%, (ii) the level of palmitic acid in the total fatty acid the total fatty acid content of extractable lipid in the plant part content of the extracted lipid is between 2% and 16%, (iii) the is about 3%, about 4%, about 5%, about 6% or about 7%, and 30 level of myristic acid (C14:0) in the total fatty acid content of ii) extracting lipid from the plant part, the extracted lipid is less than 6%, (iv) the level of oleic acid wherein the extracted lipid has the following features in the in the total fatty acid content of the extracted lipid is between total fatty acid content of the lipid: 1% and 30% or between 30% and 60%, (v) the level of i) the level of DHA is about 3%, about 4%, about 5%, about linoleic acid (LA) in the total fatty acid content of the 6% or about 7%, 35 extracted lipid is between 4% and 35%, (vi) the level of ii) the level of palmitic acid is between about 2% and about O-linolenic acid (ALA) in the total fatty acid content of the 16%, extracted lipid is between 4% and 40%, (vii) the level of iii) the level of myristic acid is less than about 2%, eicosatrienoic acid (ETrA) in the total fatty acid content of the iv) the level of oleic acid is between about 30% and about extracted lipid is less than 4%. (viii) the level of total saturated 60%, preferably between about 45% and about 60%, 40 fatty acids in the total fatty acid content of the extracted lipid v) the level of LA is between about 4% and about 20%, is between 4% and 25%, (ix) the ratio of total ()6 fatty acids: vi) the level of ALA is between about 2% and about 16%, total ()3 fatty acids in the fatty acid content of the extracted vii) the level of GLA is less than about 4%, lipid is between 1.0 and 3.0 or between 0.1 and 1, (x) the viii) the level of SDA is less than about 6%, or less than triacylglycerol (TAG) content of the lipid is at least 70%, and about 4%, 45 (xi) at least 70% of the DHA esterified in the form of TAG is ix) the level of ETA is less than about 6%, or less than about in the sn-1 or sn-3 position of the TAG. 4%, %, and x) the level of ETrA less than about 1%, ii) extracting lipid from the plant part, wherein the level of xi) the level of EPA is less than about 10% and/or the level DHA in the total fatty acid content of the extracted lipid is of EPA is 0.5-2.0 fold the level of DHA, 50 about 7% to 20%. xii) the level of DPA is less than about 4%, Also provided is lipid, or oil comprising the lipid, produced xiii) the level of total saturated fatty acids in the total fatty using a process of the invention. acid content of the extracted lipid is between about 4% and In another aspect, the present invention provides a process about 25%, for producing ethyl esters of polyunsaturated fatty acids, the xiv) the level of total monounsaturated fatty acids in the 55 process comprising transesterifying triacylglycerols in total fatty acid content of the extracted lipid is between about extracted plant lipid, wherein the extracted plant lipid com 30% and about 70%, prises fatty acids esterified in the form, the fatty acids com XV) the level of total polyunsaturated fatty acids in the total prising oleic acid, palmitic acid, (D6 fatty acids which com fatty acid content of the extracted lipid is between about 15% prise linoleic acid (LA), (03 fatty acids which comprise and about 75%, preferably between about 15% and about 60 O-linolenic acid (ALA), and docosahexaenoic acid (DHA), 30%, and optionally one or more of Stearidonic acid (SDA), eicosa xvi) the level of new (6 fatty acids in the total fatty acid pentaenoic acid (EPA), docosapentaenoic acid (DPA) and content of the extracted lipid is between about 0.5% and about eicosatetraenoic acid (ETA), wherein the level of DHA in the 10%, total fatty acid content of the extracted lipid is about 7% to xvii) the level of total ()3 fatty acids in the total fatty acid 65 20%, thereby producing the ethyl esters. content of the extracted lipid is between about 10% and about In a preferred embodiment, the extracted lipid has one or 20%, more of the features defined above. US 8,946,460 B2 19 20 In another aspect, the present invention provides a process 4%, between about 0.05% and about 3%, or between for producing ethyl esters of polyunsaturated fatty acids, the about 0.05% and about 2%, process comprising transesterifying triacylglycerols in xli) the level of eicosatrienoic acid (ETrA) in the total fatty extracted plant lipid, wherein the extracted plant lipid com acid content of the extracted lipid is less than about 2%, prises fatty acids esterified in the form of the triacylglycerols, less than about 1%, between 0.05% and 4%, between the fatty acids comprising oleic acid, palmitic acid, ()6 fatty 0.05% and 3%, or between 0.05% and about 2%, or acids which comprise linoleic acid (LA), ()3 fatty acids which between 0.05% and about 1%, comprise O-linolenic acid (ALA) and docosahexaenoic acid xlii) the level of eicosapentaenoic acid (EPA) in the total (DHA), and one or more of stearidonic acid (SDA), eicosap fatty acid content of the extracted lipid is less than 4%. 10 less than about 3%, less than about 2%, between 0.05% entaenoic acid (EPA), docosapentaenoic acid (DPA) and and 10%, between 0.05% and 5%, or between 0.05% eicosatetraenoic acid (ETA), wherein (i) the level of DHA in and about 3%, or between 0.05% and about 2%, the total fatty acid content of the extracted lipid is about 3%, xliii) the level of docosapentaenoic acid (DPA) in the total about 4%, about 5%, about 6% or between 7% and 20%, (ii) fatty acid content of the extracted lipid is less than 4%. the level of palmitic acid in the total fatty acid content of the less than about 3%, less than about 2%, between 0.05% extracted lipid is between 2% and 16%, (iii) the level of and 8%, between 0.05% and 5%, or between 0.05% and myristic acid (C14:0) in the total fatty acid content of the about 3%, or between 0.05% and about 2%, extracted lipid is less than 6%, (iv) the level of oleic acid in the xliv) the level of DHA in the total fatty acid content of the total fatty acid content of the extracted lipid is between 1% extracted lipid is about 8%, about 9%, about 10%, about and 30% or between 30% and 60%, (v) the level of linoleic 11%, about 12%, about 13%, about 14%, about 15%, acid (LA) in the total fatty acid content of the extracted lipid about 16%, about 17%, about 18%, between about 8% is between 4% and 35%, (vi) the level of C-linolenic acid and 20%, between about 10% and 20%, between about (ALA) in the total fatty acid content of the extracted lipid is 11% and 20%, between about 10% and about 16%, or between 4% and 40%, (vii) the level of eicosatrienoic acid between about 14% and 20%, (ETrA) in the total fatty acid content of the extracted lipid is 25 Xlv) the lipid comprises ()6-docosapentaenoic acid (22: less than 4%, (viii) the level of total saturated fatty acids in the 5^*-7''') in its fatty acid content, total fatty acid content of the extracted lipid is between 4% xlvi) the lipid is essentially free of ()6-docosapentaenoic and 25%, (ix) the ratio of total (O6 fatty acids:total to 3 fatty acid (22:5^*-7''') in its fatty acid content, acids in the fatty acid content of the extracted lipid is between xlvii) the lipid is essentially free of SDA, EPA and ETA in 1.0 and 3.0 or between 0.1 and 1, (x) the triacylglycerol (TAG) 30 its fatty acid content, content of the lipid is at least 70%, and (xi) at least 70% of the xlviii) the level of total saturated fatty acids in the total fatty DHA esterified in the form of TAG is in the sn-1 or sn-3 acid content of the extracted lipid is between about 4% position of the TAG, thereby producing the ethyl esters. In an and about 20%, or between about 6% and about 20%, embodiment, the extracted plant lipid has one or more or all of xlix) the level of total monounsaturated fatty acids in the the following features 35 total fatty acid content of the extracted lipid is between i) the level of palmitic acid in the total fatty acid content of about 4% and about 35%, between about 8% and about the extracted lipid is between 2% and 15%, 25%, or between 8% and about 22%, ii) the level of myristic acid (C14:0) in the total fatty acid 1) the level of total polyunsaturated fatty acids in the total content of the extracted lipid is less than 1%. fatty acid content XXXV) the level of oleic acid in the total fatty acid content of 40 of the extracted lipid is between about 20% and about 75%, the extracted lipid is between about 3% and about 30%, between about 50% and about 75%, or between about 60% between about 6% and about 30%, between 1% and and about 75%, about 20%, between about 45% and about 60%, or is li) the level of total (O6 fatty acids in the total fatty acid about 30%, content of the extracted lipid is between about 35% and XXXvi) the level of linoleic acid (LA) in the total fatty acid 45 about 50%, between about 20% and about 35%, between content of the extracted lipid is between about 4% and about 6% and 20%, less than 20%, less than about 16%, about 20%, or between about 4% and 17%, less than about 10%, between about 1% and about 16%, XXXvii) the level of C-linolenic acid (ALA) in the total fatty between about 2% and about 10%, or between about 4% acid content of the extracted lipid is between about 7% and about 10%, and about 40%, between about 10% and about 35%, 50 lii) the level of new co6 fatty acids in the total fatty acid between about 20% and about 35%, or between about content of the extracted lipid is less than about 10%, less 4% and 16%, than about 8%, less than about 6%, less than 4%, XXXviii) the level of Y-linolenic acid (GLA) in the total fatty between about 1% and about 20%, between about 1% acid content of the extracted lipid is less than 4%, less and about 10%, between about 0.5% and about 8%, or than about 3%, less than about 2%, less than about 1%, 55 between about 0.5% and 4%, less than about 0.5%, between 0.05% and 7%, between liii) the level of total ()3 fatty acids in the total fatty acid 0.05% and 4%, or between 0.05% and about 3%, or content of the extracted lipid is between 36% and about between 0.05% and about 2%, 65%, between 40% and about 60%, between about 20% XXXix) the level of stearidonic acid (SDA) in the total fatty and about 35%, between about 10% and about 20%, acid content of the extracted lipid is less than about 4%, 60 about 25%, about 30%, about 35% or about 40%, less than about 3%, between about 0.05% and about 7%, liv) the level of new co3 fatty acids in the total fatty acid between about 0.05% and about 4%, between about content of the extracted lipid is between 9% and about 0.05% and about 3%, or between 0.05% and about 2%, 33%, between about 10% and about 20%, between about xl) the level of eicosatetraenoic acid (ETA) in the total fatty 20% and about 30%, between about 12% and about acid content of the extracted lipid is less than about 4%, 65 25%, about 13%, about 15%, about 17% or about 20%, less than about 1%, less than about 0.5%, between about lv) the ratio of total (O6 fatty acids:total ()3 fatty acids in the 0.05% and about 5%, between about 0.05% and about fatty acid content of the extracted lipid is between about US 8,946,460 B2 21 22 0.1 and about 0.5, less than about 0.50, less than about wherein each promoter is independently identical or different 0.40, less than about 0.30, less than about 0.20, less than to the other promoters such that the DNA molecule comprises about 0.15, about 1.0, about 0.1 or about 0.2, three, four, five or six different promoters, lvi) the ratio of new ()6 fatty acids: new co3 fatty acids in the wherein one or more or all of the promoters are heterologous fatty acid content of the extracted lipid is between about with respect to the coding region to which it is operably 1.0 and about 3.0, between about 0.1 and about 1, linked, between about 0.1 and about 0.5, less than about 0.50, wherein the direction of transcription of the first gene is away less than about 0.40, less than about 0.30, less than about from the third gene and opposite to the direction of transcrip 0.20, less than about 0.15, about 0.1, about 0.2 or about tion of the third gene, 1.0, 10 wherein the direction of transcription of the fourth gene is lvii) the fatty acid composition of the lipid is based on an away from the sixth gene and opposite to the direction of efficiency of conversion of oleic acid to DHA of at least transcription of the sixth gene, about 10%, at least about 15%, at least about 20%, wherein the direction of transcription of the second gene is the between about 10% and about 50%, between about 10% same as for the first gene or the third gene, and about 30%, or between about 10% and about 25%, 15 wherein the direction of transcription of the fifth gene is the lviii) the fatty acid composition of the lipid is based on an same as for the fourth gene or the sixth gene, efficiency of conversion of LA to DHA of at least about wherein the transcription terminator and/or polyadenylation 15%, at least about 20%, at least about 22%, at least region of the second gene is spaced apart from the promoter of about 25%, between about 15% and about 50%, between the first or third genes, whichever is closer, by a first spacer about 20% and about 40%, or between about 20% and region of between about 0.2 and about 3.0 kilobases, about 30%, wherein the first gene cluster is spaced apart from the second lix) the fatty acid composition of the lipid is based on an gene cluster by a second spacer region of between about 1.0 efficiency of conversion of ALA to DHA of at least about and about 10.0 kilobases, and 17%, at least about 22%, at least about 24%, between wherein the transcription terminator and/or polyadenylation about 17% and about 55%, between about 22% and 25 region of the fifth gene is spaced apart from the promoter of about 35%, or between about 24% and about 35%, the fourth or sixth genes, whichever is closer, by a third spacer lx) the total fatty acid in the extracted lipid has less than 1% region of between about 0.2 and about 3.0 kilobases. C20:1, In an embodiment, the DNA molecule comprises a seventh lxi) the triacylglycerol (TAG) content of the lipid is at least gene which is spaced apart from the first gene cluster or the about 80%, at least about 90%, at least 95%, between 30 second gene cluster, whichever is closer, by a spacer region of about 70% and about 99%, or between about 90% and between about 1.0 and about 10.0 kilobases. about 99%, In another embodiment, the DNA molecule comprises two lxii) the lipid comprises diacylglycerol (DAG), or more different transcription terminator and/or polyadeny lxiii) the lipid comprises less than about 10%, less than lation regions. about 5%, less than about 1%, or between about 0.001% 35 In yet a further embodiment, at least one of the spacer and about 5%, free (non-esterified) fatty acids and/or regions comprises a matrix attachment region (MAR). phospholipid, or is essentially free thereof, In a further embodiment, the DNA molecule comprises lxiv) at least 80%, of the DHA esterified in the form of TAG right and left border regions flanking the genes and is a is in the sn-1 or sn-3 position of the TAG, T-DNA molecule. lxv) the most abundant DHA-containing TAG species in 40 In another embodiment, the genetic construct is in an Agro the lipid is DHA/18:3/18:3 (TAG 58:12), and bacterium cell or is integrated into the genome of a plant cell. lxvi) the lipid comprises tri-DHATAG (TAG 66:18). In a preferred embodiment, at least one of the genes With specific regard to the above aspect, in an embodiment encodes a fatty acid desaturase or a fatty acid elongase. one or more or all of the following apply In another embodiment, the genetic construct comprises i) the lipid is in the form of an oil, wherein the oil comprises 45 genes encoding a set of enzymes as defined herein, and/or one or more sterols such as one or more or all of campesterol, wherein one or more of the genes encode an enzyme as A5-stigmasterol, eburicol, B-sitosterol, A5-avenasterol, defined herein. A7-stigmasterol and A7-avenasterol, and optionally the oil In a further aspect, the present invention provides an iso comprises less than 10 mg of sterols/g of oil and/or the oil is lated and/or exogenous polynucleotide comprising: essentially free of cholesterol, 50 i) a sequence of nucleotides selected from any one of SEQ ii) the lipid is in the form of an oil from an oilseed such as ID NOs: 1 to 9, 11, 14, 18, 22, 23, 28, 34,35, 39 or 45, and/or oilseed is a Brassica spoilseed or canola seed, ii) a sequence of nucleotides which are at least 95% iden iii) the level of DHA in the total fatty acid content of the tical or 99% identical to one or more of the sequences set forth extracted plant lipid is about 3%, about 4%, about 5%, about in SEQID NOs: 1 to 9, 11, 14, 18, 22, 23, 28, 34,35, 39 or 45. 6%, or is between 7% and 20%. 55 In a particularly preferred embodiment, the isolated and/or In a further aspect, the present invention provides a chi exogenous polynucleotide comprises: meric genetic construct comprising in order a first gene, a i) a sequence of nucleotides of SEQID NO: 2, and/or second gene, a third gene, a fourth gene, a fifth gene and a ii) a sequence of nucleotides which are at least 95% iden sixth gene which are all covalently linked on a single DNA tical or 99% identical to the sequence set forth in SEQID NO: molecule, 60 2. wherein the first, second and third genes are joined togetheras In another aspect, the present invention provides a vector or a first gene cluster and the fourth, fifth and sixth genes are genetic construct comprising the polynucleotide of the inven joined together as a second gene cluster, tion and/or the genetic construct of the invention. wherein each gene comprises a promoter, a coding region and In an embodiment, the sequence of nucleotides selected a transcription terminator and/or polyadenylation region Such 65 from any one of SEQID NOs: 11, 14, 18, 22, 23, 28, 34,35, that each promoteris operably linked to the coding region and 39 or 45, or the sequence of nucleotides which is at least 95% transcription terminator and/or polyadenylation region, identical or 99% identical to one or more of the sequences set US 8,946,460 B2 23 24 forth in SEQID NOs: 11, 14, 18, 22, 23, 28, 34,35, 39 or 45, ii) a A12-desaturase, a fungal oc)3-desaturase and/or fun is operably linked to a promoter. gal A15-desaturase, a A8-desaturase, a A5-desaturase, a In a further aspect, the present invention provides a host A4-desaturase, a A9-elongase and an A5-elongase, cell comprising exogenous polynucleotides encoding one of wherein each polynucleotide is operably linked to one or the following sets of enzymes; 5 more seed-specific promoters that are capable of directing i) an (03-desaturase, a A6-desaturase, a A5-desaturase, a expression of said polynucleotides in developing seed of the A4-desaturase, a A6-elongase and a A5-elongase, plant, wherein the fatty acids comprise oleic acid, palmitic ii) a A15-desaturase, a A6-desaturase, a A5-desaturase, a acid, (D6 fatty acids which comprise linoleic acid (LA) and A4-desaturase, a A6-elongase and a A5-elongase, Y-linolenic acid (GLA), ()3 fatty acids which comprise C-li iii) a A12-desaturase, a A6-desaturase, a A5-desaturase, a 10 A4-desaturase, a A6-elongase and an A5-elongase, nolenic acid (ALA), Stearidonic acid (SDA), docosapen iv) a A12-desaturase, a (03-desaturase or a A15-desaturase, taenoic acid (DPA) and docosahexaenoic acid (DHA), and a A6-desaturase, a A5-desaturase, a A4-desaturase, a A6-elon optionally eicosapentaenoic acid (EPA) and/or eicosatet gase and an A5-elongase, raenoic acid (ETA), and wherein the level of DHA in the total V) an (D3-desaturase, a A8-desaturase, a A5-desaturase, a 15 fatty acid content of the lipid is about 7% to 20%. A4-desaturase, a A9-elongase and an A5-elongase, Examples of oilseed plants include, but are not limited to, vi) a A15-desaturase, a A8-desaturase, a A5-desaturase, a Brassica sp., Gossypium hirsutum, Linum usitatissimum, A4-desaturase, a A9-elongase and a A5-elongase, Helianthus sp., Carthamus tinctorius, Glycine max, Zea vii) a A12-desaturase, a A8-desaturase, a A5-desaturase, a mays, Arabidopsis thaliana, Sorghum bicolor, Sorghum vul A4-desaturase, a A9-elongase and an A5-elongase, or gare, Avena sativa, Trifolium sp., Elaesis guineenis, Nicoti viii) a A12-desaturase, a co3-desaturase or a A15-desatu ana benthamiana, Hordeum vulgare, Lupinus angustifolius, rase, a A8-desaturase, a A5-desaturase, a A4-desaturase, a Oryza sativa, Oryza glaberrima, Camelina sativa, or Crambe A9-elongase and an A5-elongase, abyssinica. In an embodiment, the oilseed plant is a canola, and wherein each polynucleotide is operably linked to one or Glycine max, Camelina sativa or Arabidopsis thaliana plant. more promoters that are capable of directing expression of 25 In an alternate embodiment, the oilseed plant is other than A. said polynucleotides in the cell. thaliana. In an embodiment, the cell comprises lipid as defined In an embodiment, one or more of the desaturases is above, or wherein one or more or all of the desaturases or capable of using an acyl-CoA substrate. In a preferred elongases have one or more of the features as defined above. embodiment, one or more of the A6-desaturase, A5-desatu In another aspect, the present invention provides a host cell 30 rase, A4-desaturase and A8-desaturase, if present, is capable comprising of using an acyl-CoA substrate, preferably each of the i) i) a first exogenous polynucleotide encoding a A12-desatu A6-desaturase, A5-desaturase and A4-desaturase orii) A5-de rase which comprises amino acids having a sequence as pro saturase, A4-desaturase and A8-desaturase is capable of using vided in SEQ ID NO:10, a biologically active fragment an acyl-CoA substrate. In an embodiment, a A12-desaturase thereof, or an amino acid sequence which is at least 50% 35 and/or an (03-desaturase is capable of using an acyl-CoA identical to SEQID NO:10, and substrate. The acyl-CoA substrate is preferably an ALA ii) a second exogenous polynucleotide encoding a (03-de CoA, ETA-CoA, DPA-CoA, ETrA-CoA, LA-CoA, GLA saturase which comprises amino acids having a sequence as CoA, or ARA-CoA. provided in SEQ ID NO:12, a biologically active fragment In an embodiment, mature, harvested seed of the plant has thereof, or an amino acid sequence which is at least 50% 40 a DHA content of at least about 28 mg per gram seed, pref identical to SEQID NO:12, erably at least about 32 mg per gram seed, at least about 36 mg wherein each polynucleotide is operably linked to one or per gram seed, at least about 40 mg per gram seed, more more promoters that are capable of directing expression of preferably at least about 44 mg per gram seed or at least about said polynucleotides in the cell. 48 mg per gram seed. The maximum DHA content may be In a further aspect, the present invention provides a host 45 about 80 to about 100 mg per gram seed, or about 80 mg or cell comprising one or more of the polynucleotide of the about 100 mg per gram seed. invention, the genetic construct of the invention, or the vector In a further aspect, the present invention provides a Bras or genetic construct of the invention. sica napus, B. juncea or Camelina sativa plant which is In an embodiment, the cell is in a plant, in a plant part capable of producing seed comprising DHA, wherein mature, and/or is a mature plant seed cell. 50 harvested seed of the plant has a DHA content of at least about In an embodiment, the plant or plant seed is an oilseed plant 28 mg per gram seed, preferably at least about 32 mg per gram or an oilseed, respectively. seed, at least about 36 mg per gram seed, at least about 40 mg Also provided is a transgenic non-human organism com per gram seed, more preferably at least about 44 mg per gram prising a cell of the invention. Preferably, the transgenic non seed or at least about 48 mg per gram seed. The maximum human organism is a transgenic plant, preferably an oilseed 55 DHA content may be about 80 to about 100 mg per gram seed, plant or Arabidopsis thaliana. In an embodiment, the plant is or about 80 mg or about 100 mg per gram seed. a Brassica plant, preferably B. napus or B. iuncea, or a plant In another aspect, the present invention provides plant cell other than Arabidopsis thaliana. of a plant of the invention comprising the exogenous poly In another aspect, the present invention provides an oilseed nucleotides. plant comprising 60 Also provided is a plant part, preferably a seed, which has a) lipid in its seed, the lipid comprising fatty acids in an one or more of the following features esterified form, and i) is from a plant of the invention, b) exogenous polynucleotides encoding one of the follow ii) comprises lipid as defined herein, ing sets of enzymes; iii) can be used in a process of the invention, i) a A12-desaturase, a fungal ()3-desaturase and/or fungal 65 iv) comprises a genetic construct of the invention, or A 15-desaturase, a A6-desaturase, a A5-desaturase, a V) comprises a set of exogenous polynucleotides as defined A4-desaturase, a A6-elongase and an A5-elongase, or herein. US 8,946,460 B2 25 26 In yet another aspect, the present invention provides In another aspect, the present invention provides a method mature, harvested Brassica napus, B. juncea or Camelina of producing one or more fatty acid desaturases and/or fatty sativa seed comprising DHA and a moisture content of acid elongases, or one or more fatty acid desaturases and one between about 4% and about 15% by weight, wherein the or more fatty acid elongases, the method comprising express DHA content of the seed at least about 28 mg per gram seed, ing in a cell or cell free expression system the gene construct preferably at least about 32 mg per gram seed, at least about of the invention, the isolated and/or exogenous polynucle 36 mg per gram seed, at least about 40 mg per gram seed, otide of the invention, the vector or genetic construct of the more preferably at least about 44 mg per gram seed or at least invention, one or more of the combinations of exogenous about 48 mg per gram seed. The maximum DHA content may polynucleotides defined herein, preferably in a developing be about 80 to about 100 mg per gram seed, or about 80 mg or 10 oilseed in an oilseed plant in the field. about 100 mg per gram seed. In a further aspect, the present invention provides lipid, or In an embodiment, the cell of the invention, the transgenic oil, produced by, or obtained from, using the process of the organism of the invention, the oilseed plant of the invention, invention, the cell of the invention, the transgenic organism of the Brassica napus, B. juncea or Camelina sativa plant of the the invention, the oilseed plant of the invention, the Brassica invention, the plant part of the invention, or the seed of the 15 napus, B. iuncea or Camelina sativa plant of the invention, invention, which can be used to produce extracted lipid com the plant part of the invention, the seed of the invention, or the prising one or more or all of the features defined herein. plant, plant cell, plant part or seed of the invention. In yet a further aspect, the present invention provides a In an embodiment, the lipid or oil is obtained by extraction method of producing a cell of the invention, the method ofoil from an oilseed. Examples of oil from oilseeds include, comprising but are not limited to, canola oil (Brassica napus, Brassica a) introducing into the cell, preferably a cell which is not rapa Ssp.), mustard oil (Brassica juncea), other Brassica oil, capable of synthesising a LC-PUFA, the gene construct of the Sunflower oil (Helianthus annus), linseed oil (Linum usitatis invention, the isolated and/or exogenous polynucleotide of Simum), soybean oil (Glycine max), Safflower oil (Carthamus the invention, the vector or genetic construct of the invention, tinctorius), corn oil (Zea mays), tobacco oil (Nicotiana one or more of the combinations of exogenous polynucle 25 tabacum), peanut oil (Arachis hypogaea), palm oil, cotton otides defined herein, seed oil (Gossypium hirsutum), coconut oil (Cocos nucifera), b) optionally, expressing the genes or polynucleotide(s) in avocado oil (Persea americana), olive oil (Olea europaea), the cell; cashew oil (Anacardium Occidentale), macadamia oil (Mac c) optionally, analysing the fatty acid composition of the adamia intergrifolia), almond oil (Prunus amygdalus) or cell, and 30 Arabidopsis seed oil (Arabidopsis thaliana). d) optionally, selecting a cell which express the genes or In a further aspect, the present invention provides fatty acid polynucleotide(s). produced by, or obtained from, using the process of the inven In an embodiment, the lipid in the cell has one or more of tion, the cell of the invention, the transgenic organism of the the features defined herein. invention, the oilseed plant of the invention, the Brassica In another embodiment, the gene construct, the isolated 35 napus, B. iuncea or Camelina sativa plant of the invention, and/or exogenous polynucleotide, the vector, the genetic con the plant part of the invention, the seed of the invention, or the struct or combinations of exogenous polynucleotides, plant, plant cell, plant part or seed of the invention. Preferably become stably integrated into the genome of the cell. the fatty acid is DHA. The fatty acid may be in a mixture of In a further embodiment, the cell is a plant cell, and the fatty acids having a fatty acid composition as described method further comprises the step of regenerating a trans 40 herein. In an embodiment, the fatty acid is non-esterified. formed plant from the cell of step a). Also provided is seedmeal obtained from seed of the inven In another embodiment, the genes and/or exogenous poly tion. Preferred seedmeal includes, but not necessarily limited nucleotide(s) are expressed transiently in the cell. to, Brassica napus, B. juncea, Camelina sativa or Glyvcine Also provided is a cell produced using a method of the max Seedmeal. In an embodiment, the seedmeal comprises an invention. 45 exogenous polynucleotide(s) and/or genentic constructs as In another aspect, the present invention provides a method defined herein. of producing seed, the method comprising, In another aspect, the present invention provides a compo a) growing a plant of the invention, or a plant which pro sition comprising one or more of a lipid or oil of the invention, duces a part as defined herein, preferably in a field as part of the fatty acid of the invention, the genetic construct of the a population of at least 1000 such plants or in an area of at 50 invention, the isolated and/or exogenous polynucleotide of least 1 hectare planted at a standard planting density, the invention, the vector or genetic construct of the invention, b) harvesting seed from the plant or plants, and the cell according of the invention, the transgenic organism of c) optionally, extracting lipid from the seed, preferably to the invention, the oilseed plant of the invention, the Brassica produce oil with a total DHA yield of at least 60 kg DHA/ napus, B. iuncea or Camelina sativa plant of the invention, hectare. 55 the plant part of the invention, the seed of the invention, the In an embodiment, the plant, plant cell, plant part or seed of plant, plant cell, plant part or seed of the invention, or the the invention has one or more of the following features seedmeal of the invention. In embodiments, the composition i) the oil is as defined herein, comprises a carrier Suitable for pharmaceutical, food or agri ii) the plant part or seed is capable of being used in a cultural use, a seed treatment compound, a fertiliser, another process of the invention, 60 food or feed ingredient, or added protein or vitamins. iii) the exogenous polynucleotides are comprised in a Also provided is feedstuffs, cosmetics or chemicals com genetic construct of the invention, prising one or more of the lipid or oil of the invention, the fatty iv) the exogenous polynucleotides comprise an exogenous acid of the invention, the genetic construct of the invention, polynucleotide of the invention, the isolated and/or exogenous polynucleotide of the inven v) the plant cell is a cell of the invention, and 65 tion, the vector or genetic construct of the invention, the cell vi) the seed was produced according to the method of the according of the invention, the transgenic organism of the invention. invention, the oilseed plant of the invention, the Brassica US 8,946,460 B2 27 28 napus, B. iuncea or Camelina sativa plant of the invention, or oil for the DHA. In a preferred embodiment, the medica the plant part of the invention, the seed of the invention, the ment comprises ethyl esters of DHA. In an even more pre plant, plant cell, plant part or seed of the invention, the seed ferred embodiment, the level of ethyl esters of DHA in the meal of the invention, or the composition of the invention. medicament is between 30% and 50%. The medicament may In another aspect, the present invention provides a method further comprise ethyl esters of EPA, such as between 30% of producing a feedstuff, the method comprising mixing one and 50% of the total fatty acid content in the medicament. or more of the lipid or oil of the invention, the fatty acid of the Such medicaments are suitable for administration to human invention, the genetic construct of the invention, the isolated or animal Subjects for treatment of medical conditions as and/or exogenous polynucleotide of the invention, the vector described herein. or genetic construct of the invention, the cell according of the 10 In another aspect, the present invention provides a method invention, the transgenic organism of the invention, the oil of trading seed, comprising obtaining seed of the invention, seed plant of the invention, the Brassica napus, B. juncea or and trading the obtained seed for pecuniary gain. Camelina sativa plant of the invention, the plant part of the In an embodiment, obtaining the seed comprises cultivat invention, the seed of the invention, the plant, plant cell, plant ing plants of the invention and/or harvesting the seed from the part or seed of the invention, the seedmeal of the invention, or 15 plants. the composition of the invention, with at least one other food In another embodiment, obtaining the seed further com ingredient. prises placing the seed in a container and/or storing the seed. In another aspect, the present invention provides a method In a further embodiment, obtaining the seed further com of treating or preventing a condition which would benefit prises transporting the seed to a different location. from a PUFA, the method comprising administering to a In yet another embodiment, the method further comprises subject one or more of the lipid or oil of the invention, the fatty transporting the seed to a different location after the seed is acid of the invention, the genetic construct of the invention, traded. the isolated and/or exogenous polynucleotide of the inven In a further embodiment, the trading is conducted using tion, the vector or genetic construct of the invention, the cell electronic means Such as a computer. according of the invention, the transgenic organism of the 25 In yet a further aspect, the present invention provides a invention, the oilseed plant of the invention, the Brassica process of producing bins of seed comprising: napus, B. iuncea or Camelina sativa plant of the invention, a) Swathing, windrowing and/or or reaping above-ground the plant part of the invention, the seed of the invention, the parts of plants comprising seed of the invention, plant, plant cell, plant part or seed of the invention, the seed b) threshing and/or winnowing the parts of the plants to meal of the invention, the composition of the invention, or the 30 separate the seed from the remainder of the plant parts, and feedstuff of the invention. c) sifting and/or sorting the seed separated in step b), and Examples of conditions which would benefit from a PUFA loading the sifted and/or sorted seed into bins, thereby pro include, but are not limited to, cardiac arrhythmias, angio ducing bins of seed. plasty, inflammation, asthma, psoriasis, osteoporosis, kidney In an embodiment, where relevant, the lipid or oil, prefer stones, AIDS, multiple sclerosis, rheumatoid arthritis, 35 ably seedoil, of, or useful for, the invention has fatty levels Crohn's disease, Schizophrenia, cancer, foetal alcohol Syn about those provided in a Table in the Examples section, such drome, attention deficient hyperactivity disorder, cystic fibro as seed 14 of Table 16. sis, phenylketonuria, unipolar depression, aggressive hostil Any embodiment herein shall be taken to apply mutatis ity, adrenoleukodystophy, coronary heart disease, mutandis to any other embodiment unless specifically stated hypertension, diabetes, obesity, Alzheimer's disease, chronic 40 otherwise. obstructive pulmonary disease, ulcerative colitis, restenosis The present invention is not to be limited in scope by the after angioplasty, eczema, high blood pressure, platelet specific embodiments described herein, which are intended aggregation, gastrointestinal bleeding, endometriosis, pre for the purpose of exemplification only. Functionally-equiva menstrual syndrome, myalgic encephalomyelitis, chronic lent products, compositions and methods are clearly within fatigue after viral infections or an ocular disease. 45 the scope of the invention, as described herein. Also provided is the use of one or more of the lipid or oil of Throughout this specification, unless specifically stated the invention, the fatty acid of the invention, the genetic otherwise or the context requires otherwise, reference to a construct of the invention, the isolated and/or exogenous single step, composition of matter, group of steps or group of polynucleotide of the invention, the vector or genetic con compositions of matter shall be taken to encompass one and struct of the invention, the cell according of the invention, the 50 a plurality (i.e. one or more) of those steps, compositions of transgenic organism of the invention, the oilseed plant of the matter, groups of steps or group of compositions of matter. invention, the Brassica napus, B. iuncea or Camelina sativa The invention is hereinafter described by way of the fol plant of the invention, the plant part of the invention, the seed lowing non-limiting Examples and with reference to the of the invention, the plant, plant cell, plant part or seed of the accompanying figures. invention, the seedmeal of the invention, the composition of 55 the invention, or the feedstuff of the invention for the manu BRIEF DESCRIPTION OF THE facture of a medicament for treating or preventing a condition ACCOMPANYING DRAWINGS which would benefit from a PUFA. The production of the medicament may comprise mixing the oil of the invention FIG.1. Aerobic DHA biosynthesis pathways. with a pharmaceutically acceptable carrier, for treatment of a 60 FIG.2. Map of the T-DNA insertion region between the left condition as described herein. The method may comprise and right borders of pP3416-GA7. RB denotes right border; firstly purifying the oil and/or transesterification, and/or frac LB, left border; TER, transcription terminator/polyadenyla tionation of the oil to increase the level of DHA. In a particular tion region; PRO, promoter, Coding regions are indicated embodiment, the method comprises treating the lipid or oil above the arrows, promoters and terminators below the such as canola oil to convert the fatty acids in the oil to alkyl 65 arrows. Micpu-A6D, Micromonas pusilla A6-desaturase; esters such as methyl or ethyl esters. Further treatment such as Pyrco-A6E, Pyramimonas cordata A6-elongase; Pavsa-A5D, fractionation or distillation may be applied to enrich the lipid Pavlova salina A5-desaturase: Picpa-co3D, Pichia pastoris US 8,946,460 B2 29 30 (O3-desaturase; Pavsa-A4D. P. salina A4-desaturase; Lackl FIG. 15. BoxPlot showing the percentage of fatty acid A12D. Lachancea kluyveri A12-desaturase: Pyrco-A5E, 20:2006 (EDA) in seed lipid of Arabidopsis T2 seed popula Pyramimonas cordata A5-elongase. NOS denotes the Agro tions transformed with pFN045-pFN050. The BoxPlot rep bacterium tumefaciens nopaline synthase transcription termi resents values as described in FIG. 13. nator/polyadenylation region; FP1, Brassica napus truncated 5 FIG. 16. BoxPlot showing the percentage of ARA in seed napin promoter; FAE1, Arabidopsis thaliana FAE1 pro lipid of Arabidopsis T4 seed populations transformed with moter, Lectin, Glycine max lectin transcription terminator/ pFN045-pFNO50. The BoxPlot represents values as polyadenylation region; Cnl1 and Cnl2 denotes the Linum described in FIG. 13. usitatissimum conlinin1 or conlinin2 promoter or terminator. FIG. 17. Average level of ARA as a percentage of the total MAR denotes the Rb7 matrix attachment region from Nicoti- 10 ana tabacum. fatty acid content in seed lipid of Arabidopsis T4 seed popu FIG.3. Map of the T-DNA insertion region between the left lations transformed with pFN045-pFN050. and right borders of pP3404. Labels are as in FIG. 2. FIG. 18. BoxPlot showing the percentage of EDA in seed FIG. 4. Map of the insertion region between the left and lipid of Arabidopsis T4 seed populations transformed with right borders of plP3367. Labels are as in FIG. 2. 15 pFN045-pFNO50. The BoxPlot represents values as FIG. 5. DHA levels as a percentage of total fatty acids in described in FIG. 13. seed lipid from multiple independent transgenic Arabidopsis FIG. 19. (A) Basic phytosterol structure with ring and side thaliana seeds in both the T and T. generations. The brack chain numbering. (B) Chemical structures of some of the eted T. events were taken to T. Events from both the Colum phytosterols. bia and fad2 mutant A. thaliana backgrounds are shown. 2O FIG. 20. Phylogenetic tree of known LPAATs. FIG. 6. Oil content (w/w) vs. DHA content, as a percentage FIG. 21. The various acyl exchange enzymes which trans of total fatty acid content of lipid from transgenic Arabidopsis fer fatty acids between PC, CoA pools, and TAG pools. thaliana seeds. Adapted from Singh et al. (2005). FIG. 7. Representative RT-PCR gel showing the low expression of the A6-desaturase gene relative to the other 25 KEY TO THE SEQUENCE LISTING transgenes in the T-DNA of B. napus embryos transformed using pP3416-GA7. Lanes from the left show RT-PCR prod SEQ ID NO:1-p)P3416-GA7 nucleotide sequence. ucts: 1, DNA size markers; lane 2, A12 desaturase; lane 3, SEQID NO:2 pGA7-mod B nucleotide sequence. (O3-desaturase; lane 4. A6-desaturase (low expression); lane SEQID NO:3 pGA7-mod C nucleotide sequence. 5, A6-elongase; lane 6, A5-desaturase; lane 7, A5-elongase; 30 SEQID NO:4 pGA7-mod D nucleotide sequence. lane 8, A4-desaturase. SEQID NO:5 pGA7-mod E nucleotide sequence. FIG. 8. Percentage of ALA plotted against percentage of SEQID NO:6 pGA7-mod F nucleotide sequence. oleic acid, each as a percentage of total fatty acids in lipid SEQID NO:7 pGA7-mod G nucleotide sequence. obtained from transgenic 35S:LEC2 Brassica napus somatic SEQ ID NO:8 pORE04+11ABGBEC Cowpea EPA in embryos. 35 sert nucleotide sequence. FIG. 9. Positional distribution analysis by NMR on A) SEQ ID NO:9—Codon-optimized open reading frame for Tuna oil and, B) transgenic DHA Arabidopsis seed oil. The expression of Lachancea kluyveri A12 desaturase in plants. peaks labelled DHA-alpha represent the amount of DHA SEQID NO:10—Lachancea kluyveri A12-desaturase. present at the sn-1 and sn-3 positions of TAG (with no posi SEQ ID NO:11—Codon-optimized open reading frame for tional preference this would equal 66% of total DHA) whilst 40 expression of Pichia pastoris (D3 desaturase in plants. the peaks labelled DHA-beta represent the amount of DHA SEQID NO:12—Pichia pastoris (O3 desaturase. present at the sn-2 position of TAG (with no preference this SEQID NO: 13 Open reading frame encoding Micromonas would equal 33% of DHA). pusilla A6-desaturase. FIG. 10. LC-MS analysis of major DHA-containing tria SEQID NO: 14 Codon-optimized open reading frame for cylglycerol species in transgenic A. thaliana developing 45 expression of Micromonas pusilla A6-desaturase in plants (grey) and mature (black) seeds. The number following the (version 1). DHA denotes the total number of carbon atoms and total SEQ ID NO:15 Codon-optimized open reading frame for number of double bonds in the other two fatty acids. There expression of Micromonas pusilla A6-desaturase in plants fore DHA/34:1 can also be designated TAG 56:7, etc. (version 2). FIG. 11. Map of the T-DNA insertion region between the 50 SEQID NO: 16—Micromonas pusilla A6-desaturase. left and right borders of pCRE04+11ABGBEC Cowpea E SEQ ID NO:17 Open reading frame encoding Ostreococ PA insert. Labels areas in FIG. 2; SSU, Arabidopsis thaliana cus lucimarinus A6-desaturase. rubisco Small subunit promoter. SEQID NO: 18 Codon-optimized open reading frame for FIG. 12. Map of the binary vector plP3364 showing the expression of Ostreococcus lucimarinus A6-desaturase in Not restriction site into which the candidate A12-desaturases 55 plants. were cloned. SEQID NO: 19—Ostreococcus lucimarinus A6-desaturase. FIG. 13. BoxPlot generated using SigmaPlot showing the SEQID NO:20 Ostreococcus tauri A6-desaturase. percentage of fatty acid 20:4()6 (ARA) in seed lipid of Ara SEQID NO:21—Open reading frame encoding Pyramino bidopsis T2 seed populations transformed with pFNO45 nas Cordata A6-elongase. pFNO50. The boundary of each box closest to zero indicates 60 SEQ ID NO:22 Codon-optimized open reading frame for the 25th percentile, a line within each box marks the median, expression of Pyramimonas cordata A6-elongase in plants and the boundary of each box farthest from Zero indicates the (truncated at 3' end and encoding functional elongase) 75th percentile. Error bars shown above and below each box (version 1). indicate the 90th and 10th percentiles. SEQ ID NO:23 Codon-optimized open reading frame for FIG. 14. Average level of ARA as a percentage of the total 65 expression of Pyramimonas cordata A6-elongase in plants fatty acid content in seed lipid of Arabidopsis T2 seed trans (truncated at 3' end and encoding functional elongase) formed with pFNO45-pFN050. (version 2). US 8,946,460 B2 31 32 SEQ ID NO:24 Codon-optimized open reading frame for SEQ ID NO:60 Open reading frame encoding P38 viral expression of Pyramimonas cordata A6-elongase in plants Suppressor. (truncated at 3' end and encoding functional elongase) SEQID NO:61—Open reading frame encoding Pe-P0 viral (version 3). Suppressor. SEQID NO:25—Pyramimonas cordata A6-elongase. SEQID NO:62 Open reading frame encoding RPV-P0 viral SEQID NO:26—Truncated Pyramimonas cordata A6-elon Suppressor. gase. SEQ ID NO: 63 Arabidopsis thaliana LPAAT2. SEQ ID NO:27 Open reading frame encoding Pavlova SEQ ID NO: 64-Limnanthes alba LPAAT. salina A5-desaturase. SEQ ID NO: 65 Saccharomyces cerevisiae LPAAT. SEQ ID NO:28 Codon-optimized open reading frame for 10 SEQ ID NO: 66 Micromonas pusilla LPAAT. expression of Pavlova Salina A5-desaturase in plants (ver SEQ ID NO: 67 Mortierella alpina LPAAT. sion 1). SEQ ID NO: 68 Braccisa napus LPAAT. SEQ ID NO:29 Codon-optimized open reading frame for SEQ ID NO: 69–Brassica napus LPAAT. expression of Pavlova Salina A5-desaturase in plants (ver SEQID NO: 70 Phytophthora infestans ()3 desaturase. sion 2). 15 SEQID NO: 71—Thalassiosira pseudonana ()3 desaturase. SEQID NO:30 Pavlova salina A5-desaturase. SEQID NO: 72 Pythium irregulare (O3 desaturase. SEQID NO:31—Open reading frame encoding Pyramino nas Cordata A5-desaturase. DETAILED DESCRIPTION OF THE INVENTION SEQID NO:32—Pyramimonas cordata A5-desaturase. SEQID NO:33—Open reading frame encoding Pyramino General Techniques and Definitions nas Cordata A5-elongase. Unless specifically defined otherwise, all technical and SEQ ID NO:34 Codon-optimized open reading frame for scientific terms used herein shall be taken to have the same expression of Pyramimonas cordata A5-elongase in plants meaning as commonly understood by one of ordinary skill in (version 1). the art (e.g., in cell culture, molecular genetics, fatty acid SEQ ID NO:35 Codon-optimized open reading frame for 25 synthesis, transgenic plants, protein chemistry, and biochem expression of Pyramimonas cordata A5-elongase in plants istry). (version 2). Unless otherwise indicated, the recombinant protein, cell SEQ ID NO:36 Codon-optimized open reading frame for culture, and immunological techniques utilized in the present expression of Pyramimonas cordata A5-elongase in plants invention are standard procedures, well known to those (version 3). 30 skilled in the art. Such techniques are described and explained SEQID NO:37—Pyramimonas cordata A5-elongase. throughout the literature in sources such as, J. Perbal, A SEQ ID NO:38 Open reading frame encoding Pavlova Practical Guide to Molecular Cloning, John Wiley and Sons salina A4-desaturase. (1984), J. Sambrook et al., Molecular Cloning: A Laboratory SEQ ID NO:39 Codon-optimized open reading frame for Manual, Cold Spring Harbour Laboratory Press (1989), T. A. expression of Pavlova Salina A4-desaturase in plants (ver 35 Brown (editor), Essential Molecular Biology: A Practical sion 1). Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover SEQ ID NO:40-Codon-optimized open reading frame for and B. D. Hames (editors), DNA Cloning: A Practical expression of Pavlova Salina A4-desaturase in plants (ver Approach, Volumes 1-4, IRL Press (1995 and 1996), F. M. sion 2). Ausubel et al. (editors), Current Protocols in Molecular Biol SEQID NO:41—Pavlova salina A4-desaturase. 40 ogy, Greene Pub. Associates and Wiley-Interscience (1988, SEQ ID NO:42—Open reading frame encoding Isochrysis including all updates until present), Ed Harlow and David galbana A9-elongase. Lane (editors), Antibodies: A Laboratory Manual, Cold SEQID NO:43—Isochrysis galbana A9-elongase. Spring Harbour Laboratory, (1988), and J. E. Coligan et al. SEQ ID NO:44 Open reading frame encoding Emiliania (editors), Current Protocols in Immunology, John Wiley & huxleyi CCMP1516 A9-elongase. 45 Sons (including all updates until present). SEQ ID NO:45 Codon-optimized open reading frame for The term “and/or', e.g., “X and/or Y' shall be understood expression of Emiliania huxleyi A9-elongase in plants. to mean either “X and Y” or “X or Y and shall be taken to SEQ ID NO:46 Emiliania huxleyi CCMP1516 A9-elon provide explicit support for both meanings or for either mean gase. 1ng. SEQID NO:47—Open reading frame encoding Pavlova pin 50 As used herein, the term “about, unless stated to the con guis A9-elongase. trary, refers to +/-10%, more preferably +/-5%, more pref SEQID NO:48—Pavlova pinguis A9-elongase. erably +/-1% of the designated value. SEQ ID NO:49 Open reading frame encoding Pavlova Throughout this specification the word “comprise', or salina A9-elongase. variations such as "comprises' or “comprising, will be SEQID NO:50 Pavlova salina A9-elongase. 55 understood to imply the inclusion of a stated element, integer SEQ ID NO:51—Open reading frame encoding Pavlova or step, or group of elements, integers or steps, but not the salina A8-desaturase. exclusion of any other element, integer or step, or group of SEQID NO:52—Pavlova salina A8-desaturase. elements, integers or steps. SEQ ID NO:53 P19 viral suppressor. Selected Definitions SEQ ID NO:54 V2 viral suppressor. 60 As used herein, the terms “extracted plant lipid and “iso SEQ ID NO:55 P38 viral suppressor. lated plant lipid refer to a lipid composition which has been SEQ ID NO:56 Pe-P0 viral suppressor. extracted from, for example by crushing, a plant or part SEQID NO:57 RPV-P0 viral suppressor. thereof such as seed. The extracted lipid can be a relatively SEQ ID NO:58 Open reading frame encoding P19 viral crude composition obtained by, for example, crushing a plant Suppressor. 65 seed, or a more purified composition where most, if not all, of SEQID NO:59—Open reading frame encoding V2 viral Sup one or more or each of the water, nucleic acids, proteins and pressor. carbohydrates derived from the plant material have been US 8,946,460 B2 33 34 removed. Examples of purification methods are described occurring fatty acids have an even number of carbon atoms below. In an embodiment, the extracted or isolated plant lipid because their biosynthesis involves acetate which has two comprises at least about 60%, at least about 70%, at least carbon atoms. The fatty acids may be in a free State (non about 80%, at least about 90%, or at least about 95% (w/w) esterified) or in an esterified form such as part of a triglycer lipid by weight of the composition. The lipid may be solid or 5 ide, diacylglyceride, monoacylglyceride, acyl-CoA (thio-es liquid at room temperature, when liquid it is considered to be ter) bound or other bound form. The fatty acid may be an oil. In an embodiment, extracted lipid of the invention has esterified as a phospholipid such as a phosphatidylcholine, not been blended with another lipid such as DHA not pro phosphatidylethanolamine, phosphatidylserine, phosphati duced by another source (for example, DHA from fish oil). In dylglycerol, phosphatidylinositol or diphosphatidylglycerol an embodiment, following extraction the ratio of one or more 10 forms. or all of oleic acid to DHA, palmitic acid to DHA, linoleic “Saturated fatty acids’ do not contain any double bonds or acid to DHA, and total ()6 fatty acids: total co3 fatty acids, has other functional groups along the chain. The term "saturated not been significantly altered (for example, no greater than a refers to hydrogen, in that all carbons (apart from the car 10% or 5% alteration) when compared to the ratio in the intact boxylic acid—COOH group) contain as many hydrogens seed or cell. In an another embodiment, the extracted plant 15 as possible. In other words, the omega (co) end contains 3 lipid has not been exposed to a procedure. Such as hydroge hydrogens (CH3—) and each carbon within the chain con nation or fractionation, which may alter the ratio of one or tains 2 hydrogens (—CH2-). more or all of oleic acid to DHA, palmitic acid to DHA. “Unsaturated fatty acids are of similar form to saturated linoleic acid to DHA, and total (O6 fatty acids:total ()3 fatty fatty acids, except that one or more alkene functional groups acids, when compared to the ratio in the intact seed or cell. exist along the chain, with each alkene Substituting a singly When the extracted plant lipid of the invention is comprised in bonded “ CH2-CH2- part of the chain with a doubly an oil, the oil may further comprise non-fatty acid molecules bonded “ CH=CH portion (that is, a carbon double Such as sterols. bonded to another carbon). The two next carbon atoms in the As used herein, the terms “extracted plant oil” and “iso chain that are bound to either side of the double bond can lated plant oil” refer to a Substance or composition compris 25 occur in a cis or trans configuration. ing extracted plant lipid or isolated plant lipid and which is a As used herein, the term “monounsaturated fatty acid liquid at room temperature. The oil is obtained from a plant or refers to a fatty acid which comprises at least 12 carbonatoms part thereof such as seed. The extracted or isolated oil can be in its carbon chain and only one alkenegroup (carbon-carbon a relatively crude composition obtained by, for example, double bond) in the chain. As used herein, the terms “poly crushing a plant seed, or a more purified composition where 30 unsaturated fatty acid' or “PUFA refer to a fatty acid which most, if not all, of one or more or each of the water, nucleic comprises at least 12 carbon atoms in its carbon chain and at acids, proteins and carbohydrates derived from the plant least two alkene groups (carbon-carbon double bonds). material have been removed. The composition may comprise As used herein, the terms "long-chain polyunsaturated other components which may be lipid or non-lipid. In an fatty acid' and “LC-PUFA refer to a fatty acid which com embodiment, the oil composition comprises at least about 35 prises at least 20 carbonatoms in its carbon chain and at least 60%, at least about 70%, at least about 80%, at least about two carbon-carbon double bonds, and hence include VLC 90%, or at least about 95% (w/w) extracted plant lipid. In an PUFAs. As used herein, the terms “very long-chain polyun embodiment, extracted oil of the invention has not been saturated fatty acid” and “VLC-PUFA refer to a fatty acid blended with another oil such as DHA not produced by which comprises at least 22 carbon atoms in its carbon chain another source (for example, DHA from fish oil). In an 40 and at least three carbon-carbon double bonds. Ordinarily, the embodiment, following extraction, the ratio of one or more or number of carbon atoms in the carbon chain of the fatty acids all of, oleic acid to DHA, palmitic acid to DHA, linoleic acid refers to an unbranched carbon chain. If the carbon chain is to DHA, and total (O6 fatty acids:total ()3 fatty acids, has not branched, the number of carbon atoms excludes those in been significantly altered (for example, no greater than a 10% sidegroups. In one embodiment, the long-chain polyunsatu or 5% alteration) when compared to the ratio in the intact seed 45 rated fatty acid is an (D3 fatty acid, that is, having a desatura or cell. In an another embodiment, the extracted plant oil has tion (carbon-carbon double bond) in the third carbon-carbon not been exposed to a procedure, such as hydrogenation or bond from the methyl end of the fatty acid. In another embodi fractionation, which may alter the ratio of one or more or all ment, the long-chain polyunsaturated fatty acid is an ()6 fatty of oleic acid to DHA, palmitic acid to DHA, linoleic acid to acid, that is, having a desaturation (carbon-carbon double DHA, and total (O6 fatty acids: total to 3 fatty acids, when 50 bond) in the sixth carbon-carbon bond from the methylend of compared to the ratio in the intact seed or cell. Extracted plant the fatty acid. In a further embodiment, the long-chain poly oil of the invention may comprise non-fatty acid molecules unsaturated fatty acid is selected from the group consisting of Such as sterols. arachidonic acid (ARA, 20:4A5,8,11,14; ()6), eicosatet As used herein, an “oil is a composition comprising pre raenoic acid (ETA. 20:4A8,11,14, 17, (O3), eicosapentaenoic dominantly lipid and which is a liquid at room temperature. 55 acid (EPA, 20:5A5,8,11,14, 17: (1)3), docosapentaenoic acid For instance, oil of the invention preferably comprises at least (DPA, 22:5A7,10,13,16,19, (D3), or docosahexaenoic acid 75%, at least 80%, at least 85% or at least 90% lipid by (DHA, 22:6A4,7,10,13,16,19, co3). The LC-PUFA may also weight. Typically, a purified oil comprises at least 90% tria be dihomo-y-linoleic acid (DGLA) or eicosatrienoic acid cylglycerols (TAG) by weight of the lipid in the oil. Minor (ETrA, 20:3A11, 14, 17, c)3). It would readily be apparent that components of an oil such as diacylglycerols (DAG), free 60 the LC-PUFA that is produced according to the invention may fatty acids (FFA), phospholipid and sterols may be present as be a mixture of any or all of the above and may include other described herein. LC-PUFA or derivatives of any of these LC-PUFA. In a As used herein, the term “fatty acid refers to a carboxylic preferred embodiment, the co3 fatty acids are at least DHA. acid (or organic acid), often with a long aliphatic tail, either preferably, DPA and DHA, or EPA, DPA and DHA. saturated or unsaturated. Typically fatty acids have a carbon 65 Furthermore, as used herein the terms "long-chain polyun carbon bonded chain of at least 8 carbon atoms in length, saturated fatty acid' and “very long-chain polyunsaturated more preferably at least 12 carbons in length. Most naturally fatty acid refer to the fatty acid being in a free state (non US 8,946,460 B2 35 36 esterified) or in an esterified form such as part of a triglycer c)3 fatty acid contents are determined by conversion of fatty ide, diacylglyceride, monoacylglyceride, acyl-CoA bound or acids in a sample to FAME and analysis by GC, as described other bound form. The fatty acid may be esterified as a phos in Example 1. pholipid such as a phosphatidylcholine (PC), phosphatidyle The desaturase, elongase and acyltransferase proteins and thanolamine, phosphatidylserine, phosphatidylglycerol, genes encoding them that may be used in the invention are any phosphatidylinositol or diphosphatidylglycerol forms. Thus, of those known in the art or homologues or derivatives the LC-PUFA may be present as a mixture of forms in the thereof. Examples of Such genes and encoded protein sizes lipid of a cell or a purified oil or lipid extracted from cells, are listed in Table 1. The desaturase enzymes that have been tissues or organisms. In preferred embodiments, the invention 10 shown to participate in LC-PUFA biosynthesis all belong to provides oil comprising at least 75% or at least 85% triacylg the group of so-called “front-end desaturases. lycerols, with the remainder present as other forms of lipid As used herein, the term “front-end desaturase' refers to a Such as those mentioned, with at least said triacylglycerols member of a class of enzymes that introduce a double bond comprising the LC-PUFA. The oil may subsequently be fur 15 between the carboxyl group and a pre-existing unsaturated ther purified or treated, for example by hydrolysis with a part of the acyl chain of lipids, which are characterized struc strong base to release the free fatty acids, or by distillation or turally by the presence of an N-terminal cytochrome b5 the like. domain, along with a typical fatty acid desaturase domain that As used herein, “total (O6 fatty acids” or “total ()6 fatty acid includes three highly conserved histidine boxes (Napier et al., content” or the like refers to the sum of all the (D6 fatty acids, 1997). esterified and non-esterified, in the extracted lipid, oil, recom Activity of any of the elongases ordesaturases for use in the binanat cell, plant part or seed, as the context determines, invention may be tested by expressing a gene encoding the expressed as a percentage of the total fatty acid content. These enzyme in a cell Such as, for example, a yeast cell, a plant cell ()6 fatty acids include (if present) LA, GLA, DGLA, ARA, 25 or preferably in Somatic embryos or transgenic plants, and EDA and (06-DPA, and exclude any ()3 fatty acids and determining whether the cell, embryo or plant has an monounsaturated fatty acids. increased capacity to produce LC-PUFA compared to a com As used herein, “new co6 fatty acids” or “new co6 fatty acid parable cell, embryo or plant in which the enzyme is not content” or the like refers to the sum of all the (D6 fatty acids 30 expressed. excluding LA, esterified and non-esterified, in the extracted In one embodiment one or more of the desaturases and/or lipid, oil, recombinant cell, plant part or seed, as the context elongases for use in the invention can purified from a determines, expressed as a percentage of the total fatty acid microalga, i.e. is identical in amino acid sequence to a content. These new ()6 fatty acids are the fatty acids that are polypeptide which can be purified from a microalga. produced in the cells, plants, plant parts and seeds of the 35 Whilst certain enzymes are specifically described hereinas invention by the expression of the genetic constructs (exog “bifunctional', the absence of such a term does not necessar enous polynucleotides) introduced into the cells, and include ily imply that a particular enzyme does not possess an activity (if present) GLA, DGLA, ARA, EDA and (06-DPA, but other than that specifically defined. exclude LA and any (D3 fatty acids and monounsaturated fatty 40 Desaturases acids. Exemplary total ()6 fatty acid contents and new (06 As used herein, the term “desaturase' refers to an enzyme fatty acid contents are determined by conversion offatty acids which is capable of introducing a carbon-carbon double bond in a sample to FAME and analysis by GC, as described in into the acyl group of a fatty acid substrate which is typically Example 1. 45 in an esterified form Such as, for example, acyl-CoA esters. As used herein, “total ()3 fatty acids” or “total ()3 fatty acid The acyl group may be esterified to a phospholipid such as content” or the like refers to the sum of all the co3 fatty acids, phosphatidylcholine (PC), or to acyl carrier protein (ACP), or esterified and non-esterified, in the extracted lipid, oil, recom in a preferred embodiment to CoA. Desaturases generally binanat cell, plant part or seed, as the context determines, may be categorized into three groups accordingly. In one expressed as a percentage of the total fatty acid content. These 50 embodiment, the desaturase is a front-end desaturase. c)3 fatty acids include (if present) ALA, SDA, ETrA, ETA, As used herein, a “A4-desaturase' refers to a protein which EPA, DPA and DHA, and exclude any ()6 fatty acids and performs a desaturase reaction that introduces a carbon-car monounsaturated fatty acids. bon double bond at the 4' carbon-carbon bond from the As used herein, “new co3 fatty acids” or “new co3 fatty acid 55 carboxyl end of a fatty acid substrate. The “A4-desaturase' is content” or the like refers to the sum of all the co3 fatty acids at least capable of converting DPA to DHA. The desaturation excluding ALA, esterified and non-esterified, in the extracted step to produce DHA from DPA is catalysed by a A4-desatu lipid, oil, recombinanat cell, plant part or seed, as the context rase in organisms other than mammals, and a gene encoding determines, expressed as a percentage of the total fatty acid this enzyme has been isolated from the freshwater protist content. These new co3 fatty acids are the fatty acids that are 60 species Euglena gracilis and the marine species Thraus produced in the cells, plants, plant parts and seeds of the tochytrium sp. (Qiu et al., 2001; Meyer et al., 2003). In one invention by the expression of the genetic constructs (exog embodiment, the A4-desaturase comprises amino acids hav enous polynucleotides) introduced into the cells, and include ing a sequence as provided in SEQID NO:41, or a Thraus (if present) SDA, ETrA, ETA, EPA, DPA and DHA, but 65 tochytrium sp. A4-desaturase, a biologically active fragment exclude ALA and any (D6 fatty acids and monounsaturated thereof, or an amino acid sequence which is at least 80% fatty acids. Exemplary total (D3 fatty acid contents and new identical to SEQID NO:41. US 8,946,460 B2 37 38 TABLE 1 Cloned genes involved in LC-PUFA biosynthesis Type of Accession Protein size Enzyme organism Species Nos. (aas) References A4-desaturase Protist Eugiena gracilis AY278558 541 Meyer et al., 2003 Algae Paviova initherii AY332747 445 Tonon et al., 2003 Isochrysis galbania AAV33631 433 Pereira et al., 2004b Paviova Saina AAY15136 447 Zhou et al., 2007 Thraustochytrid Thraustochytrium aureum AAN75707 515 NA AAN7S708 AAN7S709 AAN7S710 Thraustochytrium sp. AAMO9688 519 Qiu et al. 2001 ATCC21685 A5-desaturase Mammals Homo sapiens AF199596 444 Cho et al., 1999b Leonard et al., 2000b Nematode Caenorhabditis elegans AF11440, 447 Michaelson et al., 1998b; NM 069350 Watts and Browse, 1999b Fungi Mortierella alpina AFO67654 446 Michaelson et al., 1998a; Knutzon et al., 1998 Pythium irregulare AF419297 456 Hong et al., 2002a Dictyostelium discoideum ABO22097 467 Saito et al., 2000 Saprolegnia diclina 470 WOO2O81668 Diatom Phaeodactylum tricornutum AYO82392 469 Domergue et al., 2002 Algae Thraustochytrium sp AF489588 439 Qiu et al., 2001 Thraustochytrium aureum 439 WOO2O81668 Isochrysis galbania 442 WOO2O81668 Moss Marchantia polymorpha AYS8346S 484 Kajikawa et al., 2004 A6-desaturase Mammals Homo sapiens NM 013402 444 Cho et al., 1999a: Leonard et al., 2000 Mits miscuits NM 019699 444 Cho et al., 1999a Nematode Caenorhabditis elegans Z70271 443 Napier et al., 1998 Plants Borago officinales U79010 448 Sayanova et al., 1997 Echium AYO55117 Garcia-Maroto et al., 2002 AYO55118 Primuia viaii AY234127 453 Sayanova et al., 2003 Anemone ieveiei AF536525 446 Whitney et al., 2003 Mosses Ceratodon purpureus AJ250735 52O Sperling et al., 2000 Marchantia polymorpha AYS83463 481 Kajikawa et al., 2004 Physcomitrella patens CAA11033 525 Girke et al., 1998 Fungi Mortierella alpina AF110510 457 Huang et al., 1999; ABO2OO32 Sakuradani et al., 1999 Pythium irregulare AF419296 459 Hong et al., 2002a Mucor circineioides ABOS2O86 467 NCBI* Rhizopus sp. AY320288 458 Zhang et al., 2004 Saprolegnia diclina 453 WOO2O81668 Diatom Phaeodactylum tricornutum AYO82393 477 Domergue et al., 2002 Bacteria Synechocystis L11421 359 Reddy et al., 1993 Algae Thraustochytrium aureum 456 WOO2O81668 Bifunctional A5. Fish Danio perio AF309556 444 Hastings et al., 2001 A6-desaturase C2O Algae Eugiena gracilis AF13972O 419 Wallis and Browse, 1999 A8-desaturase Plants Borago officinales AAG43277 446 Sperling et al., 2001 A6-elongase Nematode Caenorhabditis elegans NM 069288 288 Beaudoin et al., 2000 Mosses Physcomitrella patens AF428243 290 Zank et al., 2002 Marchantia polymorpha AYS83464 290 Kajikawa et al., 2004 Fungi Mortierella alpina AF206.662 3.18 Parker-Barnes et al., 2000 Algae Pavliova intiheri 5O1 WO O3078.639 Thraustochytrium AX951S6S 271 WO O3093482 Thraustochytrium sp. AX214.454 271 WO O1591.28 PUFA-elongase Mammals Homo sapiens AF231981 299 Leonard et al., 2000b: Leonard et al., 2002 Rattus norvegicus ABO71985 299 nagaki et al., 2002 Rattus norvegicus* ABO71986 267 nagaki et al., 2002 Mits miscuits AF170907 279 Tvrdik et al., 2000 Mits miscuits AF170908 292 Tvrdik et al., 2000 Fish Danio perio AFS32782 291 (282) Agaba et al., 2004 Danio perio NM 199532 266 Lo et al., 2003 Worm Caenorhabditis elegans Z68749 309 Abbott et al., 1998 Beaudoin et al., 2000 Algae Thraustochytrium aureum ** AX464802 272 WO O2O84O1-A2 Pavliova intiheri 320 WO O3078.639 A9-elongase Algae Isochrysis galbania AF3901.74 263 Qi et al., 2002 Eugiena gracilis 258 WO O8.128241 A5-elongase Algae Ostreococcasiatiri AAV67798 300 Meyer et al., 2004 Pyramimonas cordata 268 WO 2010.OS7246 Pavlova sp. CCMP459 AAV33630 277 Pereira et al., 2004b Paviova Saina AAY1513S 3O2 Robert et al., 2009 US 8,946,460 B2 39 40 TABLE 1-continued Cloned genes involved in LC-PUFA biosynthesis Type of Accession Protein size Enzyme organism Species Nos. (aas) References Diatom ThalassioSira pseudonana AAV67800 358 Meyer et al., 2004 Fish Oncorhynchus mykiss CAMSS862 295 WOO6,008099 Moss Marchantia polymorpha BAE71129 348 Kajikawa et al., 2006 *http://www.ncbi.nlm.nih.gov/ **Function not proven not demonstrated

As used herein, a “A5-desaturase' refers to a protein which activity on ALA to produce octadecatetraenoic acid (Steari performs a desaturase reaction that introduces a carbon-car donic acid, SDA, 18:4A6,9,12,15, ()3) with an efficiency of at bon double bond at the 5" carbon-carbon bond from the 15 least 30%, more preferably at least 40%, or most preferably at carboxyl end of a fatty acid substrate. Examples of A5-de least 50% when expressed from an exogenous polynucleotide saturases are listed in Ruiz-Lopezetal. (2012) and Petrie et al. in a recombinant cell such as a plant cell, or at least 35% when (2010a) and in Table 1 herein. In one embodiment, the A5-de expressed in a yeast cell. In one embodiment, the A6-desatu saturase comprises amino acids having a sequence as pro rase has greater activity, for example, at least about a 2-fold vided in SEQ ID NO:30, a biologically active fragment greater A6-desaturase activity, on ALA than LA as fatty acid thereof, or an amino acid sequence which is at least 80% Substrate. In another embodiment, the A6-desaturase has identical to SEQ ID NO:30. In another embodiment, the greater activity, for example, at least about 5 fold greater A5-desaturase comprises amino acids having a sequence as A6-desaturase activity or at least 10-fold greater activity, on provided in SEQ ID NO:32, a biologically active fragment 25 ALA-CoA as fatty acid substrate than on ALA joined to the thereof, or an amino acid sequence which is at least 53% sn-2 position of PC as fatty acid substrate. In a further identical to SEQ ID NO:32. In another embodiment, the embodiment, the A6-desaturase has activity on both fatty acid A5-desaturase is from Thraustochytrium sp. or Emiliania hux Substrates ALA-CoA and on ALA joined to the Sn-2 position leyi. of PC. TABLE 2 Desaturases demonstrated to have activity on an acyl-CoA substrate Type of Accession Protein size Enzyme organism Species Nos. (aas) References A6-desaturase Algae Mantoniella squamata CAQ30479 449 Hoffmann et al., 2008 Ostreococcasiatiri AAW70 159 456 Domergue et al., 2005 Micromonas pusilia EEH58637 Petrie et al., 2010a (SEQID NO: 13) A5-desaturase Algae Mantoniella squamata CAQ30478 482 Hoffmann et al., 2008 Plant Anemone leveillei NA Sayanova et al., 2007 (O3-desaturase Fungi Pythium aphanidermatum FW362186.1 359 Xue et al., 2012: WO2O08,05456S Fungi Phytophthora soiae FW362214.1 363 Xue et al., 2012: (Oomycete) WO2O08,05456S Fungi Phytophthora ramorum FW3622.13.1 361 Xue et al., 2012: (Oomycete) WO2O08,05456S

As used herein, a “A6-desaturase' refers to a protein which In one embodiment, the A6-desaturase has no detectable performs a desaturase reaction that introduces a carbon-car A5-desaturase activity on ETA. In another embodiment, the bon double bond at the 6' carbon-carbon bond from the 50 A6-desaturase comprises amino acids having a sequence as carboxyl end of a fatty acid substrate. Examples of A6-de provided in SEQ ID NO:16, SEQ ID NO:19 or SEQ ID saturases are listed in Ruiz-Lopezetal. (2012) and Petrie et al. NO:20, a biologically active fragment thereof, or an amino (2010a) and in Table 1 herein. Preferred A6-desaturases are acid sequence which is at least 77% identical to SEQ ID from Micromonas pusilla, Pythium irregulare or Ostreoco 55 NO:16, SEQ ID NO:19 or SEQ ID NO:20. In another cocus taurii. embodiment, the A6-desaturase comprises amino acids hav In an embodiment, the A6-desaturase is further character ing a sequence as provided in SEQ ID NO:19 or SEQ ID ised by having at least two, preferably all three and preferably NO:20, a biologically active fragment thereof, or an amino in a plant cell, of the following: i) greater A6-desaturase acid sequence which is at least 67% identical to one or both of activity on C-linolenic acid (ALA, 18:3A9,12,15, ()3) than 60 SEQ ID NO:19 or SEQ ID NO:20. The A6-desaturase may linoleic acid (LA, 18:2A9,12, ()6) as fatty acid substrate; ii) also have A8-desaturase activity. greater A6-desaturase activity on ALA-CoA as fatty acid As used herein, a “A8-desaturase' refers to a protein which substrate than on ALA joined to the sn-2 position of PC as performs a desaturase reaction that introduces a carbon-car fatty acid substrate; and iii) A8-desaturase activity on ETrA. bon double bond at the 8” carbon-carbon bond from the Examples of such A6-desaturases are provided in Table 2. 65 carboxyl end of a fatty acid substrate. The A8-desaturase is at In an embodiment the A6-desaturase has greateractivity on least capable of converting ETrA to ETA. Examples of A8-de an (03 Substrate than the corresponding ()6 Substrate and has saturases are listed in Table 1. In one embodiment, the A8-de US 8,946,460 B2 41 42 saturase comprises amino acids having a sequence as pro typically convert either oleoyl-phosphatidylcholine or ole vided in SEQ ID NO:52, a biologically active fragment oyl-CoA to linoleoyl-phosphatidylcholine (18:1-PC) or lino thereof; or an amino acid sequence which is at least 80% leoyl-CoA (18:1-CoA), respectively. The subclass using the identical to SEQID NO:52. PC linked substrate are referred to as phospholipid-dependent As used herein, an “co3-desaturase' refers to a protein A 12-desaturases, the latter Subclass as acyl-CoA dependent which performs a desaturase reaction that introduces a car A 12-desaturases. Plant and fungal A12-desaturases are gen bon-carbon double bond at the 3rd carbon-carbon bond from erally of the former sub-class, whereas animal A12-desatu the methyl end of a fatty acid substrate. A co3-desaturase rases are of the latter subclass, for example the A12-desatu therefore may convert LA to ALA and GLA to SDA (all C18 rases encoded by genes cloned from insects by Zhou et al. fatty acids), or DGLA to ETA and/or ARA to EPA (C20 fatty 10 (2008). Many other A12-desaturase sequences can be easily acids). Some (O3-desaturases (group I) have activity only on identified by searching sequence databases. C18 Substrates, such as plant and cyanobacterial (O3-desatu As used herein, a “A 15-desaturase' refers to a protein rases. Such (03-desaturases are also A15-desaturases. Other which performs a desaturase reaction that introduces a car (03-desaturases have activity on C20 substrates with no activ bon-carbon double bond at the 15" carbon-carbon bond from ity (group II) or some activity (group III) on C18. Substrates. 15 the carboxyl end of a fatty acid substrate. Numerous genes Such (03-desaturases are also A17-desaturases. Preferred encoding A15-desaturases have been cloned from plant and (O3-desaturases are group III type which convert LA to ALA, fungal species. For example, U.S. Pat. No. 5,952,544 GLA to SDA, DGLA to ETA and ARA to EPA, such as the describes nucleic acids encoding plant A15-desaturases Pichia pastoris ()3-desaturase (SEQ ID NO: 12). Examples (FAD3). These enzymes comprise amino acid motifs that of co3-desaturases include those described by Pereira et al. were characteristic of plant A15-desaturases. WO200114538 (2004a) (Saprolegnia diclina (03-desaturase, group II). describes a gene encoding soybean FAD3. Many other A15 Horiguchi et al. (1998), Berberichet al. (1998) and Spychalla desaturase sequences can be easily identified by searching et al. (1997) (C. elegans ()3-desaturase, group III). In a pre sequence databases. ferred embodiment, the (03-desaturase is a fungal (O3-desatu As used herein, a “A 17-desaturase' refers to a protein rase. As used herein, a “fungal (D3-desaturase' refers to an 25 which performs a desaturase reaction that introduces a car (O3-desaturase which is from a fungal source, including an bon-carbon double bond at the 17" carbon-carbon bond from oomycete source, or a variant thereof whose amino acid the carboxyl end of a fatty acid substrate. A A 17-desaturase is sequence is at least 95% identical thereto. Genes encoding also regarded as an (03-desaturase if it acts on a C20 substrate numerous (D3-desaturases have been isolated from fungal to introduce a desaturation at the (03 bond. Sources Such as, for example, from Phytophthora infestans 30 In a preferred embodiment, the A12-desaturase and/or (Accession No. CAJ30870, WO2005083053: SEQ ID NO: A 15-desaturase is a fungal A12-desaturase or fungal A15 70), Saprolegnia diclina (Accession No. AAR20444, Pereira desaturase. As used herein, a “fungal A12-desaturase' or "a et al., 2004a & U.S. Pat. No. 7,21 1,656), Pythium irregulare fungal A15-desaturase refers to a A12-desaturase or A15 (WO2008022963, Group II; SEQ ID NO: 72), Mortierella desaturase which is from a fungal source, including an alpina (Sakuradani et al., 2005; Accession No. BAD91495; 35 oomycete source, or a variant thereof whose amino acid WO2006019 192), Thalassiosira pseudonana (Armbrust et sequence is at least 95% identical thereto. Genes encoding al., 2004: Accession No. XP 002291057; WO2005012316, numerous desaturases have been isolated from fungal SEQ ID NO: 71), Lachancea kluyveri (also known as Sac sources. U.S. Pat. No. 7,21 1,656 describes a A12 desaturase charomyces kluyveri: Oura et al., 2004: Accession No. from Saprolegnia diclina. WO2009016202 describes fungal AB1 18663). Xue et al. (2012) describes ()3-desaturases from 40 desaturases from Helobdella robusta, Laccaria hicolor; Lot the oomycetes Pythium aphanidermatum, Phytophthora tia gigantea, Microcoleus chthonoplastes, Monosiga brevi sojae, and Phytophthora ramorum which were able to effi collis, Mycosphaerella fijiensis, Mycospaerella graminicola, ciently convert (D6 fatty acid Substrates to the corresponding Naegleria gruben, Nectria haematococca, Nematostella c)3 fatty acids, with a preference for C20 substrates, i.e. they vectensis, Phycomyces blakesleeanus, Trichoderma resii, had stronger A17-desaturase activity than A15-desaturase 45 Physcomitrella patens, Postia placenta, Selaginella moellen activity. These enzymes lacked A12-desaturase activity, but dorffii and Microdochium nivale. WO2005/012316 describes could use fatty acids in both acyl-CoA and phospholipid a A 12-desaturase from Thalassiosira pseudonana and other fraction as Substrates. fungi. WO2003/099216 describes genes encoding fungal In a more preferred embodiment, the fungal (O3-desaturase A 12-desaturases and A15-desaturases isolated from Neuro is the Pichia pastoris (also known as Konzagataella pastoris) 50 spora crassa, Aspergillus nidulans, Botrytis cinerea and Mor (03-desaturase/A15-desaturase (Zhanget al., 2008: Accession tierella alpina. WO2007133425 describes fungal A15 desatu No. EF 116884; SEQID NO:12), or a polypeptide which is at rases isolated from: Saccharomyces kluyveri, Mortierella least 95% identical thereto. alpina, Aspergillus nidulans, Neurospora crassa, Fusarium In an embodiment, the (O3-desaturase is at least capable of graminearum, Fusarium moniliforme and Magnaporthe converting one of ARA to EPA, DGLA to ETA, GLA to SDA, 55 grisea. A preferred A12 desaturase is from Phytophthora both ARA to EPA and DGLA to ETA, both ARA to EPA and sojae (Ruiz-Lopez et al., 2012). GLA to SDA, or all three of these. A distinct Subclass of fungal A12-desaturases, and of fun In one embodiment, the (O3-desaturase has A17-desaturase gal A15-desaturases, are the bifunctional fungal A12/A15 activity on a C20 fatty acid which has at least three carbon desaturases. Genes encoding these have been cloned from carbon double bonds, preferably ARA. In another embodi 60 Fusarium monoliforme (Accession No. DQ2725 16, Damude ment, the co3-desaturase has A15-desaturase activity on a C18 et al., 2006), Acanthamoeba castellanii (Accession No. fatty acid which has three carbon-carbon double bonds, pref EF017656, Sayanova et al., 2006), Perkins us marinus erably GLA. Preferably, both activities are present. (WO20070425.10), Claviceps purpurea (Accession No. As used herein, a “A 12-desaturase' refers to a protein EF536898, Meesapyodsuk et al., 2007) and Coprinus which performs a desaturase reaction that introduces a car 65 cinereus (Accession No. AF269266, Zhang et al., 2007). bon-carbon double bond at the 12" carbon-carbon bond from In another embodiment, the co3-desaturase has at least the carboxyl end of a fatty acid substrate. A 12-desaturases Some activity on, preferably greateractivity on, an acyl-CoA US 8,946,460 B2 43 44 Substrate than a corresponding acyl-PC substrate. As used preferably at least 70% or most preferably at least 80% or herein, a “corresponding acyl-PC substrate” refers to the fatty 90%. In a further embodiment, the A5-elongase comprises an acid esterified at the sn-2 position of phosphatidylcholine amino acid sequence as provided in SEQ ID NO:37, a bio (PC) where the fatty acid is the same fatty acid as in the logically active fragment thereof, or an amino acid sequence acyl-CoA substrate. For example, the acyl-CoA substrate which is at least 47% identical to SEQID NO:37. In a further may be ARA-CoA and the corresponding acyl-PC substrate is embodiment, the A6-elongase is from Ostreococcus taurii or sn-2 ARA-PC. In an embodiment, the activity is at least Ostreococcus lucimarinus (US2010/088776). two-fold greater. Preferably, the co3-desaturase has at least As used herein, a “A6-elongase' is at least capable of Some activity on both an acyl-CoA substrate and its corre converting SDA to ETA. Examples of A6-elongases include sponding acyl-PC substrate and has activity on both C18 and 10 those listed in Table 1. In one embodiment, the elongase C20 substrates. Examples of such co3-desaturases are known comprises amino acids having a sequence as provided in SEQ amongst the cloned fungal desaturases listed above. ID NO:25, a biologically active fragment thereof (such as the In a further embodiment, the (p3-desaturase comprises fragment provided as SEQ ID NO:26), or an amino acid amino acids having a sequence as provided in SEQID NO:12, sequence which is at least 55% identical to one or both of SEQ a biologically active fragment thereof, or an amino acid 15 ID NO:25 or SEQID NO:26. In an embodiment, the A6-elon sequence which is at least 60% identical to SEQID NO:12, gase is from Physcomitrella patens (Zanket al., 2002; Acces preferably at least 90% or at least 95% identical to SEQ ID sion No. AF428243) or Thalassiosira pseudonana (Ruiz NO: 12. Lopez et al., 2012). In yet a further embodiment, a desaturase for use in the As used herein, a “A9-elongase' is at least capable of present invention has greater activity on an acyl-CoA Sub converting ALA to ETrA. Examples of A9-elongases include strate than a corresponding acyl-PC substrate. In another those listed in Table 1. In one embodiment, the A9-elongase embodiment, a desaturase for use in the present invention has comprises amino acids having a sequence as provided in SEQ greateractivity on an acyl-PC Substrate than a corresponding ID NO:43, a biologically active fragment thereof, oran amino acyl-CoA substrate, but has some activity on both substrates. acid sequence which is at least 80% identical to SEQ ID As outlined above, a “corresponding acyl-PC substrate' 25 NO:43. In another embodiment, the A9-elongase comprises refers to the fatty acid esterified at the sn-2 position of phos amino acids having a sequence as provided in SEQID NO:46, phatidylcholine (PC) where the fatty acid is the same fatty a biologically active fragment thereof, or an amino acid acid as in the acyl-CoA substrate. In an embodiment, the sequence which is at least 81% identical to SEQID NO:46. In greateractivity is at least two-fold greater. In an embodiment, another embodiment, the A9-elongase comprises amino acids the desaturase is a A5 or A6-desaturase, oran (03-desaturase, 30 having a sequence as provided in SEQID NO:48, a biologi examples of which are provided, but not limited to, those cally active fragment thereof, or an amino acid sequence listed in Table 2. To test which substrate a desaturase acts on, which is at least 50% identical to SEQID NO:48. In another namely an acyl-CoA or an acyl-PC Substrate, assays can be embodiment, the A9-elongase comprises amino acids having carried out in yeast cells as described in Domergue et al. a sequence as provided in SEQ ID NO:50, a biologically (2003) and (2005). Acyl-CoA substrate capability for a 35 active fragment thereof, or an amino acid sequence which is desaturase can also be inferred when an elongase, when at least 50% identical to SEQID NO:50. In a further embodi expressed together with the desaturase, has an enzymatic ment, the A9-elongase has greateractivity on an ()6 Substrate conversion efficiency in plant cells of at least about 90% than the corresponding (D3 substrate, or the converse. where the elongase catalyses the elongation of the product of As used herein, the term "has greater activity on an ()6 the desaturase. On this basis, the A5-desaturase and A4-de 40 substrate than the corresponding (O3 substrate” refers to the saturases expressed from the GA7 construct (Examples 2 and relative activity of the enzyme on substrates that differ by the 3) and variants therefor (Example 5) are capable of desatu action of an ()3 desaturase. Preferably, the ()6 substrate is LA rating their respective acyl-CoA substrates, ETA-CoA and and the (O3 substrate is ALA. DPA-CoA. An elongase with A6-elongase and A9-elongase activity is Elongases 45 at least capable of (i) converting SDA to ETA and (ii) con Biochemical evidence Suggests that the fatty acid elonga Verting ALA to ETrA and has greater A6-elongase activity tion consists of 4 steps: condensation, reduction, dehydration than A9-elongase activity. In one embodiment, the elongase and a second reduction. In the context of this invention, an has an efficiency of conversion on SDA to produce ETA “elongase' refers to the polypeptide that catalyses the con which is at least 50%, more preferably at least 60%, and/oran densing step in the presence of the other members of the 50 efficiency of conversion on ALA to produce ETrA which is at elongation complex, under Suitable physiological conditions. least 6% or more preferably at least 9%. In another embodi It has been shown that heterologous or homologous expres ment, the elongase has at least about 6.5 fold greater A6-elon sion in a cell of only the condensing component (“elongase') gase activity than A9-elongase activity. In a further embodi of the elongation protein complex is required for the elonga ment, the elongase has no detectable A5-elongase activity tion of the respective acyl chain. Thus, the introduced elon 55 Other Enzymes gase is able to Successfully recruit the reduction and dehydra As used herein, the term “1-acyl-glycerol-3-phosphate tion activities from the transgenic host to carry out Successful acyltransferase” (LPAAT), also termed lysophosphatidic acyl elongations. The specificity of the elongation reaction acid-acyltransferase or acylCoA-lysophosphatidate-acyl with respect to chain length and the degree of desaturation of transferase, refers to a protein which acylates sn-1-acyl-glyc fatty acid Substrates is thought to reside in the condensing 60 erol-3-phosphate (sn-1 G-3-P) at the sn-2 position to form component. This component is also thought to be rate limiting phosphatidic acid (PA). Thus, the term “1-acyl-glycerol-3- in the elongation reaction. phosphate acyltransferase activity” refers to the acylation of As used herein, a “A5-elongase' is at least capable of (sn-1 G-3-P) at the sn-2 position to produce PA (EC 2.3.1.51). converting EPA to DPA. Examples of A5-elongases include Preferred LPAATs are those that can use a polyunsaturated those disclosed in WO2005/103253. In one embodiment, the 65 C22 acyl-CoA as substrate to transfer the polyunsaturated A5-elongase has activity on EPA to produce DPA with an C22 acyl group to the sn-2 position of LPA, forming PA. Such efficiency of at least 60%, more preferably at least 65%, more LPAATs are exemplified in Example 13 and can be tested as US 8,946,460 B2 45 46 described therein. In an embodiment, an LPAAT useful for GAP analysis aligns the two sequences over a region of at the invention comprises amino acids having a sequence as least 15 amino acids. More preferably, the query sequence is provided in any one of SEQID NOs: 63 to 69, a biologically at least 50 amino acids in length, and the GAP analysis aligns active fragment thereof, or an amino acid sequence which is the two sequences over a region of at least 50 amino acids. at least 40% identical to any one or more of SEQID NOs: 63 More preferably, the query sequence is at least 100 amino to 69. In a preferred embodiment, an LPAAT useful for the acids in length and the GAP analysis aligns the two sequences invention comprises amino acids having a sequence as pro over a region of at least 100 amino acids. Even more prefer vided in any one of SEQID NOs: 64, 65 and 67, a biologically ably, the query sequence is at least 250 amino acids in length active fragment thereof, or an amino acid sequence which is and the GAP analysis aligns the two sequences over a region at least 40% identical to any one or more of SEQID NOs: 64, 10 of at least 250 amino acids. Even more preferably, the GAP 65 and 67. analysis aligns two sequences over their entire length. The As used herein, the term “diacylglycerol acyltransferase' polypeptide or class of polypeptides may have the same enzy (EC 2.3.1.20; DGAT) refers to a protein which transfers a matic activity as, or a different activity than, or lack the fatty acyl group from acyl-CoA to a diacylglycerol Substrate activity of the reference polypeptide. Preferably, the to produce a triacylglycerol. Thus, the term “diacylglycerol 15 polypeptide has an enzymatic activity of at least 10%, at least acyltransferase activity” refers to the transfer of acyl-CoA to 50%, at least 75% or at least 90%, of the activity of the diacylglycerol to produce triacylglycerol. There are three reference polypeptide. known types of DGAT referred to as DGAT1, DGAT2 and As used hereina “biologically active' fragment is a portion DGAT3 respectively. DGAT1 polypeptides typically have 10 of a polypeptide defined herein which maintains a defined transmembrane domains, DGAT2 typically have 2 transmem activity of a full-length reference polypeptide, for example brane domains, whilst DGAT3 is typically soluble. Examples possessing desaturase and/or elongase activity or other of DGAT1 polypeptides include polypeptides encoded by enzyme activity. Biologically active fragments as used herein DGAT1 genes from Aspergillus fumigatus (Accession No. exclude the fill-length polypeptide. Biologically active frag XP 755172), Arabidopsis thaliana (CAB44774), Ricinus ments can be any size portion as long as they maintain the communis (AAR11479), Vernicia fordii (ABC94472), Ver 25 defined activity. Preferably, the biologically active fragment nonia galamensis (ABV21945, ABV21946), Euonymus ala maintains at least 10%, at least 50%, at least 75% or at least tus (AAV31083), Caenorhabditis elegans (AAF82410), Rat 90%, of the activity of the full length protein. tus norvegicus (NP 445889), Homo sapiens (NP 036211), With regard to a defined polypeptide or enzyme, it will be as well as variants and/or mutants thereof. Examples of appreciated that% identity figures higher than those provided DGAT2 polypeptides include polypeptides encoded by 30 herein will encompass preferred embodiments. Thus, where DGAT2 genes from Arabidopsis thaliana (Accession No. applicable, in light of the minimum '% identity figures, it is NP 566952), Ricinus communis (AAY16324), Vernicia for preferred that the polypeptide? enzyme comprises an amino dii (ABC94474), Mortierella ramanniana (AAK84179), acid sequence which is at least 60%, more preferably at least Homo sapiens (Q96PD7, Q58HT5), Bos taurus (Q70VD8), 65%, more preferably at least 70%, more preferably at least Mus musculus (AAK84175), Micromonas CCMP1545, as 35 75%, more preferably at least 76%, more preferably at least well as variants and/or mutants thereof. Examples of DGAT3 80%, more preferably at least 85%, more preferably at least polypeptides include polypeptides encoded by DGAT3 genes 90%, more preferably at least 91%, more preferably at least from peanut (Arachis hypogaea, Saha, et al., 2006), as well as 92%, more preferably at least 93%, more preferably at least variants and/or mutants thereof. 94%, more preferably at least 95%, more preferably at least Polypeptides/Peptides 40 96%, more preferably at least 97%, more preferably at least The term “recombinant in the context of a polypeptide 98%, more preferably at least 99%, more preferably at least refers to the polypeptide when produced by a cell, or in a 99.1%, more preferably at least 99.2%, more preferably at cell-free expression system, in an altered amount or at an least 99.3%, more preferably at least 99.4%, more preferably altered rate, compared to its native state if it is produced at least 99.5%, more preferably at least 99.6%, more prefer naturally. In one embodiment the cell is a cell that does not 45 ably at least 99.7%, more preferably at least 99.8%, and even naturally produce the polypeptide. However, the cell may be more preferably at least 99.9% identical to the relevant nomi a cell which comprises a non-endogenous gene that causes an nated SEQID NO. altered amount of the polypeptide to be produced. A recom Amino acid sequence variants/mutants of the polypeptides binant polypeptide of the invention includes polypeptides in of the defined herein can be prepared by introducing appro the cell, tissue, organ or organism, or cell-free expression 50 priate nucleotide changes into a nucleic acid defined herein, system, in which it is produced i.e. a polypeptide which has or by in vitro synthesis of the desired polypeptide. Such not been purified or separated from other components of the variants/mutants include, for example, deletions, insertions transgenic (recombinant) cell in which it was produced, and or Substitutions of residues within the amino acid sequence. A polypeptides produced in Such cells or cell-free systems combination of deletion, insertion and Substitution can be which are Subsequently purified away from at least some 55 made to arrive at the final construct, provided that the final other components. peptide product possesses the desired enzyme activity. The terms “polypeptide' and “protein’ are generally used Mutant (altered) peptides can be prepared using any tech interchangeably. nique known in the art. For example, a polynucleotide defined A polypeptide or class of polypeptides may be defined by herein can be subjected to in vitro mutagenesis or DNA the extent of identity (% identity) of its amino acid sequence 60 shuffling techniques as broadly described by Harayama to a reference amino acid sequence, or by having a greater% (1998). Products derived from mutated/altered DNA can identity to one reference amino acid sequence than to another. readily be screened using techniques described herein to The % identity of a polypeptide to a reference amino acid determine if they possess, for example, desaturase or elon sequence is typically determined by GAP analysis (Needle gase activity. man and Wunsch, 1970; GCG program) with parameters of a 65 In designing amino acid sequence mutants, the location of gap creation penalty=5, and a gap extension penalty-0.3. The the mutation site and the nature of the mutation will depend query sequence is at least 15 amino acids in length, and the on characteristic(s) to be modified. The sites for mutation can US 8,946,460 B2 47 48 be modified individually or in series, e.g., by (1) Substituting TABLE 3-continued first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) Exemplary Substitutions. deleting the target residue, or (3) inserting other residues Original Exemplary adjacent to the located site. Residue Substitutions Amino acid sequence deletions generally range from about Ile (I) leu; val; ala 1 to 15 residues, more preferably about 1 to 10 residues and Leu (L) ille; val; met; ala; phe typically about 1 to 5 contiguous residues. Lys (K) arg Substitution mutants have at least one amino acid residue Met (M) leu; phe in the polypeptide molecule removed and a different residue 10 Phe (F) leu; val; ala Pro (P) gly inserted in its place. The sites of greatest interest for substi Ser (S) thr tutional mutagenesis include sites which are not conserved Thr (T) Se amongst naturally occurring desaturases or elongases. These Trp (W) tyr sites are preferably substituted in a relatively conservative Tyr (Y) trp; phe manner in order to maintain enzyme activity. Such conserva 15 Val (V) ille; leu; met; phe, ala tive substitutions are shown in Table 3 under the heading of “exemplary substitutions”. In an embodiment, a polynucleotide of the invention is In a preferred embodiment a mutant/variant polypeptide non-naturally occurring. Examples of non-naturally occur has only, or not more than, one or two or three or four con ring polynucleotides include, but are not limited to, those that servative amino acid changes when compared to a naturally have been mutated (such as by using methods described occurring polypeptide. Details of conservative amino acid herein), and polynucleotides where an open reading frame changes are provided in Table 3. As the skilled person would be aware. Such minor changes can reasonably be predicted encoding a protein is operably linked to a promoter to which not to alter the activity of the polypeptide when expressed in it is not naturally associated (such as in the constructs a recombinant cell. 25 described herein). Polypeptides can be produced in a variety of ways, includ As used herein, the term “gene' is to be taken in its broadest ing production and recovery of natural polypeptides or context and includes the deoxyribonucleotide sequences recombinant polypeptides according to methods known in the comprising the transcribed region and, if translated, the pro art. In one embodiment, a recombinant polypeptide is pro tein coding region, of a structural gene and including duced by culturing a cell capable of expressing the polypep 30 sequences located adjacent to the coding region on both the 5' tide under conditions effective to produce the polypeptide, and 3' ends for a distance of at least about 2kb on either end such as a host cell defined herein. A more preferred cell to and which are involved in expression of the gene. In this produce the polypeptide is a cellina plant, especially in a seed regard, the gene includes control signals such as promoters, in a plant. enhancers, termination and/or polyadenylation signals that Polynucleotides 35 are naturally associated with a given gene, or heterologous The invention also provides and/or uses polynucleotides control signals in which case the gene is referred to as a which may be, for example, a gene, an isolated polynucle "chimeric gene'. The sequences which are located 5' of the otide, a chimeric genetic construct Such as a T-DNA mol protein coding region and which are present on the mRNA are ecule, or a chimeric DNA. It may be DNA or RNA of genomic referred to as 5' non-translated sequences. The sequences or synthetic origin, double-stranded or single-stranded, and 40 which are located 3' or downstream of the protein coding combined with carbohydrate, lipids, protein or other materi region and which are present on the mRNA are referred to as als to perform a particular activity defined herein. The term 3' non-translated sequences. The term “gene' encompasses "polynucleotide' is used interchangeably herein with the both cDNA and genomic forms of a gene. A genomic form or term “nucleic acid molecule'. By "isolated polynucleotide' clone of a gene contains the coding region which may be we mean a polynucleotide which, if obtained from a natural 45 Source, has been separated from the polynucleotide interrupted with non-coding sequences termed “introns' or sequences with which it is associated or linked in its native “intervening regions' or “intervening sequences.” Introns are state, or a non-naturally occurring polynucleotide. Prefer segments of a gene which are transcribed into nuclear RNA ably, the isolated polynucleotide is at least 60% free, more (hnRNA). Introns may contain regulatory elements such as preferably at least 75% free, and more preferably at least 90% 50 enhancers. Introns are removed or “spliced out from the free from other components with which it is naturally asso nuclear or primary transcript, introns therefore are absent in ciated. the messenger RNA (mRNA) transcript. The mRNA func tions during translation to specify the sequence or order of TABLE 3 amino acids in a nascent polypeptide. The term "gene’ 55 includes a synthetic or fusion molecule encoding all or part of Exemplary substitutions. the proteins of the invention described herein and a comple Original Exemplary mentary nucleotide sequence to any one of the above. Residue Substitutions As used herein, a “chimeric DNA or “chimeric genetic Ala (A) val; leu; ile:gly construct” refers to any DNA molecule that is not a native Arg (R) lys 60 DNA molecule in its native location, also referred to hereinas ASn (N) gln; his a “DNA construct”. Typically, a chimeric DNA or chimeric Asp (D) glu gene comprises regulatory and transcribed or protein coding Cys (C) Se sequences that are not found operably linked together in Gln (Q) aSn; his Glu (E) asp nature i.e. that are heterologous with respect to each other. Gly (G) pro, ala 65 Accordingly, a chimeric DNA or chimeric gene may com His (H) aSn; gln prise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and US 8,946,460 B2 49 50 coding sequences derived from the same source, but arranged polynucleotide. At a minimum, each exogenous polynucle in a manner different than that found in nature. otide has a transcription start and stop site, as well as the The term “endogenous” is used herein to refer to a sub designated promoter. An individual exogenous polynucle stance that is normally present or produced in, for example, an otide may or may not comprise introns. unmodified plant at the same developmental stage as the plant 5 With regard to the defined polynucleotides, it will be appre under investigation. An "endogenous gene' refers to a native ciated that % identity figures higher than those provided gene in its natural location in the genome of an organism. As above will encompass preferred embodiments. Thus, where used herein, “recombinant nucleic acid molecule”, “recom applicable, in light of the minimum '% identity figures, it is binant polynucleotide' or variations thereof refer to a nucleic preferred that the polynucleotide comprises a polynucleotide acid molecule which has been constructed or modified by 10 sequence which is at least 60%, more preferably at least 65%, recombinant DNA technology. The terms “foreign poly more preferably at least 70%, more preferably at least 75%, nucleotide' or “exogenous polynucleotide' or "heterologous more preferably at least 80%, more preferably at least 85%, polynucleotide' and the like refer to any nucleic acid which is more preferably at least 90%, more preferably at least 91%, introduced into the genome of a cell by experimental manipu more preferably at least 92%, more preferably at least 93%, lations. Foreign or exogenous genes may be genes that are 15 more preferably at least 94%, more preferably at least 95%, inserted into a non-native organism, native genes introduced more preferably at least 96%, more preferably at least 97%, into a new location within the native host, or chimeric genes. more preferably at least 98%, more preferably at least 99%, A “transgene' is a gene that has been introduced into the more preferably at least 99.1%, more preferably at least genome by a transformation procedure. The terms “geneti 99.2%, more preferably at least 99.3%, more preferably at cally modified”, “transgenic' and variations thereof include least 99.4%, more preferably at least 99.5%, more preferably introducing genes into cells by transformation or transduc at least 99.6%, more preferably at least 99.7%, more prefer tion, mutating genes in cells and altering or modulating the ably at least 99.8%, and even more preferably at least 99.9% regulation of a gene in a cellor organisms to which these acts identical to the relevant nominated SEQID NO. have been done or their progeny. A "genomic region' as used A polynucleotide of the present invention may selectively herein refers to a position within the genome where a trans 25 hybridise, under stringent conditions, to a polynucleotide that gene, or group of transgenes (also referred to herein as a encodes a polypeptide of the present invention. As used cluster), have been inserted into a cell, oran ancestor thereof. herein, stringent conditions are those that (1) employ during Such regions only comprise nucleotides that have been incor hybridisation a denaturing agent such as formamide, for porated by the intervention of man such as by methods example, 50% (v/v) formamide with 0.1% (w/v) bovine described herein. 30 serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 The term “exogenous” in the context of a polynucleotide mM sodium phosphate buffer at pH 6.5 with 750 mM. NaCl, refers to the polynucleotide when present in a cell in an 75 mM sodium citrate at 42°C.; or (2) employ 50% forma altered amount compared to its native state. In one embodi mide, 5xSSC (0.75 MNaCl, 0.075M sodium citrate), 50 mM ment, the cell is a cell that does not naturally comprise the sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, polynucleotide. However, the cell may be a cell which com 35 5xDenhardt’s solution, sonicated salmon sperm DNA (50 prises a non-endogenous polynucleotide resulting in an g/ml), 0.1% SDS and 10% dextran sulfate at 42°C. in 0.2x altered amount of production of the encoded polypeptide. An SSC and 0.1% SDS and/or (3) employ low ionic strength and exogenous polynucleotide of the invention includes poly high temperature for washing, for example, 0.015 M NaCl/ nucleotides which have not been separated from other com 0.0015 M Sodium citrate/O.1% SDS at 50° C. ponents of the transgenic (recombinant) cell, or cell-free 40 Polynucleotides of the invention may possess, when com expression system, in which it is present, and polynucleotides pared to naturally occurring molecules, one or more muta produced in such cells or cell-free systems which are subse tions which are deletions, insertions, or Substitutions of quently purified away from at least some other components. nucleotide residues. Polynucleotides which have mutations The exogenous polynucleotide (nucleic acid) can be a con relative to a reference sequence can be either naturally occur tiguous stretch of nucleotides existing in nature, or comprise 45 ring (that is to say, isolated from a natural Source) or synthetic two or more contiguous stretches of nucleotides from differ (for example, by performing site-directed mutagenesis or ent sources (naturally occurring and/or synthetic) joined to DNA shuffling on the nucleic acid as described above). It is form a single polynucleotide. Typically such chimeric poly thus apparent that polynucleotides of the invention can be nucleotides comprise at least an open reading frame encoding either from a naturally occurring source or recombinant. Pre a polypeptide of the invention operably linked to a promoter 50 ferred polynucleotides are those which have coding regions Suitable of driving transcription of the open reading frame in that are codon-optimised for translation in plant cells, as is a cell of interest. known in the art. As used herein, the term "different exogenous polynucle Recombinant Vectors otides' or variations thereof means that the nucleotide One embodiment of the present invention includes a sequence of each polynucleotide are different by at least one, 55 recombinant vector, which comprises at least one polynucle preferably more, nucleotides. The polynucleotides encode otide molecule defined herein, inserted into any vector RNAs which may or may not be translated to a protein within capable of delivering the polynucleotide molecule into a host the cell. In an example, it is preferred that each polynucleotide cell. Recombinant vectors include expression vectors. encodes a protein with a different activity. In another Recombinant vectors contain heterologous polynucleotide example, each exogenous polynucleotide is less than 95%, 60 sequences, that is, polynucleotide sequences that are not natu less than 90%, or less than 80% identical to the other exog rally found adjacent to polynucleotide molecules defined enous polynucleotides. Preferably, the exogenous polynucle herein that preferably are derived from a species other than otides encode functional proteins/enzymes. Furthermore, it is the species from which the polynucleotide molecule(s) are preferred that the different exogenous polynucleotides are derived. The vector can be either RNA or DNA and typically non-overlapping in that each polynucleotide is a distinct 65 is a plasmid. Plasmid vectors typically include additional region of the, for example, extrachromosomal transfer nucleic acid sequences that provide for easy selection, ampli nucleic acid which does not overlap with another exogenous fication, and transformation of the expression cassette in US 8,946,460 B2 51 52 prokaryotic cells, e.g. pUC-derived vectors, pSK-derived guished from cells that do not have the marker. A selectable vectors, pGEM-derived vectors, pSP-derived vectors, pBS marker gene confers a trait for which one can “select based derived vectors, or preferably binary vectors containing one on resistance to a selective agent (e.g., a herbicide, antibiotic, or more T-DNA regions. Additional nucleic acid sequences radiation, heat, or other treatment damaging to untransformed include origins of replication to provide for autonomous rep cells). A screenable marker gene (or reporter gene) confers a lication of the vector, selectable marker genes, preferably trait that one can identify through observation or testing, i.e., encoding antibiotic or herbicide resistance, unique multiple by “screening” (e.g., O-glucuronidase, luciferase, GFP or cloning sites providing for multiple sites to insert nucleic acid other enzyme activity not present in untransformed cells). sequences or genes encoded in the nucleic acid construct, and The marker gene and the nucleotide sequence of interest do sequences that enhance transformation of prokaryotic and 10 not have to be linked. The actual choice of a marker is not eukaryotic (especially plant) cells. The recombinant vector crucial as long as it is functional (i.e., selective) in combina may comprise more than one polynucleotide defined herein, tion with the cells of choice such as a plant cell. for example three, four, five or six polynucleotides defined Examples of bacterial selectable markers are markers that herein in combination, preferably a chimeric genetic con confer antibiotic resistance such as amplicillin, erythromycin, struct of the invention, each polynucleotide being operably 15 chloramphenicol or tetracycline resistance, preferably kana linked to expression control sequences that are operable in the mycin resistance. Exemplary selectable markers for selection cell of interest. More than one polynucleotide defined herein, of plant transformants include, but are not limited to, a hyg for example 3, 4, 5 or 6 polynucleotides, are preferably gene which encodes hygromycin B resistance; a neomycin covalently joined together in a single recombinant vector, phosphotransferase (nptII) gene conferring resistance to preferably within a single T-DNA molecule, which may then kanamycin, paromomycin, G418; a glutathione-S-trans be introduced as a single molecule into a cell to form a ferase gene from rat liver conferring resistance to glutathione recombinant cell according to the invention, and preferably derived herbicides as, for example, described in EP256223; a integrated into the genome of the recombinant cell, for glutamine synthetase gene conferring, upon overexpression, example in a transgenic plant. Thereby, the polynucleotides resistance to glutamine synthetase inhibitors such as phosphi which are so joined will be inherited together as a single 25 nothricin as, for example, described in WO 87/05327, an genetic locus in progeny of the recombinant cell or plant. The acetyltransferase gene from Streptomyces viridochromoge recombinant vector or plant may comprise two or more Such nes conferring resistance to the selective agent phosphino recombinant vectors, each containing multiple polynucle thricin as, for example, described in EP 275957, a gene otides, for example wherein each recombinant vector com encoding a 5-enolshikimate-3-phosphate synthase (EPSPS) prises 3, 4, 5 or 6 polynucleotides. 30 conferring tolerance to N-phosphonomethylglycine as, for “Operably linked as used herein refers to a functional example, described by Hinchee et al. (1988), a bar gene relationship between two or more nucleic acid (e.g., DNA) conferring resistance against bialaphos as, for example, segments. Typically, it refers to the functional relationship of described in WO91/02071; a nitrilase gene such as bxn from transcriptional regulatory element (promoter) to a transcribed Klebsiella Ozaenae which confers resistance to bromoxynil sequence. For example, a promoter is operably linked to a 35 (Stalker et al., 1988); a dihydrofolate reductase (DHFR) gene coding sequence. Such as a polynucleotide defined herein, if it conferring resistance to methotrexate (Thillet et al., 1988); a stimulates or modulates the transcription of the coding mutant acetolactate synthase gene (ALS), which confers sequence in an appropriate cell. Generally, promoter tran resistance to imidazolinone, Sulfonylurea or other ALS-in Scriptional regulatory elements that are operably linked to a hibiting chemicals (EP154.204); a mutated anthranilate syn transcribed sequence are physically contiguous to the tran 40 thase gene that confers resistance to 5-methyl tryptophan; or scribed sequence, i.e., they are cis-acting. However, some a dalapon dehalogenase gene that confers resistance to the transcriptional regulatory elements, such as enhancers, need herbicide. not be physically contiguous or located in close proximity to Preferred screenable markers include, but are not limited the coding sequences whose transcription they enhance. to, a uidA gene encoding B-glucuronidase (GUS) enzyme for When there are multiple promoters present, each promoter 45 which various chromogenic Substrates are known, a green may independently be the same or different. fluorescent protein gene (Niedz, et al., 1995) or derivatives Recombinant molecules such as the chimeric DNAS or thereof; a luciferase (luc) gene (Ow et al., 1986), which genetic constructs may also contain (a) one or more secretory allows for bioluminescence detection, and others known in signals which encode signal peptide sequences, to enable an the art. By “reporter molecule' as used in the present speci expressed polypeptide defined herein to be secreted from the 50 fication is meant a molecule that, by its chemical nature, cell that produces the polypeptide or which provide for locali provides an analytically identifiable signal that facilitates sation of the expressed polypeptide, for example for retention determination of promoter activity by reference to protein of the polypeptide in the endoplasmic reticulum (ER) in the product. cell or transfer into a plastid, and/or (b) contain fusion Preferably, the nucleic acid construct is stably incorporated sequences which lead to the expression of nucleic acid mol 55 into the genome of the cell. Such as the plant cell. Accord ecules as fusion proteins. Examples of Suitable signal seg ingly, the nucleic acid may comprise appropriate elements ments include any signal segment capable of directing the which allow the molecule to be incorporated into the genome, secretion or localisation of a polypeptide defined herein. preferably the right and left border sequences of a T-DNA Recombinant molecules may also include intervening and/or molecule, or the construct is placed in an appropriate vector untranslated sequences Surrounding and/or within the nucleic 60 which can be incorporated into a chromosome of the cell. acid sequences of nucleic acid molecules defined herein. Expression To facilitate identification of transformants, the nucleic As used herein, an expression vector is a DNA vector that acid construct desirably comprises a selectable or screenable is capable of transforming a host cell and of effecting expres marker gene as, or in addition to, the foreign or exogenous sion of one or more specified polynucleotide molecule(s). polynucleotide. By “marker gene' is meant a gene that 65 Preferred expression vectors of the present invention can imparts a distinct phenotype to cells expressing the marker direct gene expression in yeast and/or plant cells. Expression gene and thus allows Such transformed cells to be distin vectors useful for the invention contain regulatory sequences US 8,946,460 B2 53 54 Such as transcription control sequences, translation control be active in photosynthetically active tissues are ribulose-1, sequences, origins of replication, and other regulatory 5-bisphosphate carboxylase promoters, and Cab promoters. sequences that are compatible with the recombinant cell and A variety of plant gene promoters that are regulated in that control the expression of polynucleotide molecules of the response to environmental, hormonal, chemical, and/or present invention. In particular, polynucleotides or vectors developmental signals, also can be used for expression of useful for the present invention include transcription control genes in plant cells, including promoters regulated by (1) sequences. Transcription control sequences are sequences heat, (2) light (e.g., pea RbcS-3A promoter, maize RbcS which control the initiation, elongation, and termination of promoter); (3) hormones, such as abscisic acid, (4) wounding transcription. Particularly important transcription control (e.g., Wun); or (5) chemicals, such as methyl jasmonate, sequences are those which control transcription initiation, 10 Such as promoter and enhancer sequences. Suitable transcrip salicylic acid, steroid hormones, alcohol, Safeners (WO97/ tion control sequences include any transcription control 06269), or it may also be advantageous to employ (6) organ sequence that can function in at least one of the recombinant specific promoters. cells of the present invention. The choice of the regulatory As used herein, the term “plant seed specific promoter” or sequences used depends on the target organism Such as a plant 15 variations thereofrefer to a promoter that preferentially, when and/or target organ or tissue of interest. Such regulatory compared to other plant tissues, directs gene transcription in sequences may be obtained from any eukaryotic organism a developing seed of a plant. In an embodiment, the seed Such as plants or plant viruses, or may be chemically synthe specific promoter is expressed at least 5-fold more strongly in sized. A variety of Such transcription control sequences are the developing seed of the plant relative to the leaves and/or known to those skilled in the art. Particularly preferred tran stems of the plant, and is preferably expressed more strongly Scription control sequences are promoters active in directing in the embryo of the developing seed compared to other plant transcription in plants, either constitutively or stage and/or tissues. Preferably, the promoter only directs expression of a tissue specific, depending on the use of the plant or parts gene of interest in the developing seed, and/or expression of thereof. the gene of interest in other parts of the plant Such as leaves is A number of vectors suitable for stable transfection of plant 25 not detectable by Northern blot analysis and/or RT-PCR. cells or for the establishment of transgenic plants have been Typically, the promoter drives expression of genes during described in, e.g., Pouwels et al., Cloning Vectors: A Labo growth and development of the seed, in particular during the ratory Manual, 1985, supp. 1987: Weissbach and Weissbach, phase of synthesis and accumulation of storage compounds in Methods for Plant Molecular Biology, Academic Press, 1989; the seed. Such promoters may drive gene expression in the and Gelvin et al., Plant Molecular Biology Manual, Kluwer 30 entire plant storage organ or only part thereof such as the Academic Publishers, 1990. Typically, plant expression vec Seedcoat, or cotyledon(s), preferably in the embryos, in seeds tors include, for example, one or more cloned plant genes of dicotyledonous plants or the endosperm or aleurone layer under the transcriptional control of 5' and 3' regulatory of a seeds of monocotyledonous plants. sequences and a dominant selectable marker. Such plant Preferred promoters for seed-specific expression include i) expression vectors also can contain a promoter regulatory 35 promoters from genes encoding enzymes involved in fatty region (e.g., a regulatory region controlling inducible or con acid biosynthesis and accumulation in seeds, such as desatu stitutive, environmentally- or developmentally-regulated, or rases and elongases, ii) promoters from genes encoding seed cell- or tissue-specific expression), a transcription initiation storage proteins, and iii) promoters from genes encoding start site, a ribosome binding site, an RNA processing signal, enzymes involved in carbohydrate biosynthesis and accumu a transcription termination site, and/or a polyadenylation sig 40 lation in seeds. Seed specific promoters which are suitable are nal. the oilseed rape napin gene promoter (U.S. Pat. No. 5,608, A number of constitutive promoters that are active in plant 152), the Vicial faba USP promoter (Baumlein et al., 1991), cells have been described. Suitable promoters for constitutive the Arabidopsis oleosin promoter (WO98/45461), the expression in plants include, but are not limited to, the cauli Phaseolus vulgaris phaseolin promoter (U.S. Pat. No. 5,504, flower mosaic virus (CaMV) 35S promoter, the Figwort 45 200), the Brassica Bce4 promoter (WO91/13980) or the legu mosaic virus (FMV) 35S, the sugarcane bacilliform virus min LeB4 promoter from Vicia faba (Baumlein et al., 1992), promoter, the commelina yellow mottle virus promoter, the and promoters which lead to the seed-specific expression in light-inducible promoter from the small subunit of the ribu monocots such as maize, barley, wheat, rye, rice and the like. lose-1,5-bis-phosphate carboxylase, the rice cytosolic triose Notable promoters which are suitable are the barley lpt2 or phosphate isomerase promoter, the adenine phosphoribosyl 50 lpt1 gene promoter (WO95/15389 and WO95/23230) or the transferase promoter of Arabidopsis, the rice actin I gene promoters described in WO99/16890 (promoters from the promoter, the mannopine synthase and octopine synthase barley hordein gene, the rice glutelin gene, the rice oryzin promoters, the Adh promoter, the Sucrose synthase promoter, gene, the rice prolamin gene, the wheat gliadin gene, the the R gene complex promoter, and the chlorophyll C/B bind wheat glutelin gene, the maize Zein gene, the oat glutelin ing protein gene promoter 55 gene, the Sorghum kasirin gene, the rye Secalin gene). Other For the purpose of expression in source tissues of the plant, promoters include those described by Broun et al. (1998), such as the leaf, seed, root or stem, it is preferred that the Potenza et al. (2004), US20070192902 and US20030159173. promoters utilized in the present invention have relatively In an embodiment, the seed specific promoteris preferentially high expression in these specific tissues. For this purpose, one expressed in defined parts of the seed such as the embryo, may choose from a number of promoters for genes with 60 cotyledon(s) or the endosperm. Examples of Such specific tissue- or cell-specific or -enhanced expression. Examples of promoters include, but are not limited to, the FP1 promoter such promoters reported in the literature include the chloro (Ellerstrom et al., 1996), the pea legumin promoter (Perrinet plast glutamine synthetase GS2 promoter from pea, the chlo al., 2000), the bean phytohemagglutnin promoter (Perrin et roplast fructose-1,6-biphosphatase promoter from wheat, the al., 2000), the conlinin 1 and conlinin 2 promoters for the nuclear photosynthetic ST-LS1 promoter from potato, the 65 genes encoding the flax 2S storage proteins (Cheng et al., serine/threonine kinase promoter and the glucoamylase 2010), the promoter of the FAE1 gene from Arabidopsis (CHS) promoter from Arabidopsis thaliana. Also reported to thaliana, the BnGLP promoter of the globulin-like protein US 8,946,460 B2 55 56 gene of Brassica napus, the LPXR promoter of the peroxire enzyme described herein. The cell is preferably a cell which doxin gene from Linum usitatissimum. is thereby capable of being used for producing LC-PUFA. The 5' non-translated leader sequence can be derived from The recombinant cell may be a cell in culture, a cell in vitro, the promoter selected to express the heterologous gene or in an organism such as for example a plant, or in an organ sequence of the polynucleotide of the present invention, or such as for example a seed or a leaf. Preferably, the cell is in preferably is heterologous with respect to the coding region of a plant or plant part, more preferably in the seed of a plant. the enzyme to be produced, and can be specifically modified Host cells into which the polynucleotide(s) are introduced if desired so as to increase translation of mRNA. For a review can be either untransformed cells or cells that are already of optimizing expression of transgenes, see Koziel et al. transformed with at least one nucleic acid molecule. Such (1996). The 5' non-translated regions can also be obtained 10 from plant viral RNAs (Tobacco mosaic virus, Tobacco etch nucleic acid molecules may be related to LC-PUFA synthesis, virus, Maize dwarf mosaic virus, Alfalfa mosaic virus, among or unrelated. Host cells of the present invention either can be others) from Suitable eukaryotic genes, plant genes (wheat endogenously (i.e., naturally) capable of producing proteins and maize chlorophyll afb binding protein gene leader), or defined herein, in which case the recombinant cell derived from a synthetic gene sequence. The present invention is not 15 therefrom has an enhanced capability of producing the limited to constructs wherein the non-translated region is polypeptides, or can be capable of producing such proteins derived from the 5' non-translated sequence that accompanies only after being transformed with at least one polynucleotide the promoter sequence. The leader sequence could also be of the invention. In an embodiment, a recombinant cell of the derived from an unrelated promoter or coding sequence. invention has a enhanced capacity to synthesize a long chain Leader sequences useful in context of the present invention polyunsaturated fatty acid. As used herein, the term “cell with comprise the maize Hsp70 leader (U.S. Pat. Nos. 5,362,865 an enhanced capacity to synthesize a long chain polyunsatu and 5,859,347), and the TMV omega element. rated fatty acid' is a relative term where the recombinant cell The termination of transcription is accomplished by a 3' of the invention is compared to the host cell lacking the non-translated DNA sequence operably linked in the chi polynucleotide(s) of the invention, with the recombinant cell meric vector to the polynucleotide of interest. The 3' non 25 producing more long chain polyunsaturated fatty acids, or a translated region of a recombinant DNA molecule contains a greater concentration of LC-PUFA such as DHA (relative to polyadenylation signal that functions in plants to cause the other fatty acids), than the native cell. The cell with an addition of adenylate nucleotides to the 3' end of the RNA. enhanced capacity to synthesize another product, Such as for The 3' non-translated region can be obtained from various example another fatty acid, a lipid, a carbohydrate Such as genes that are expressed in plant cells. The nopaline synthase 30 starch, an RNA molecule, a polypeptide, a pharmaceutical or 3' untranslated region, the 3' untranslated region from pea other product has a corresponding meaning. small subunit Rubisco gene, the 3' untranslated region from Host cells of the present invention can be any cell capable Soybean 7S seed storage protein gene or a flax conlinin gene of producing at least one protein described herein, and are commonly used in this capacity. The 3' transcribed, non include bacterial, fungal (including yeast), parasite, arthro translated regions containing the polyadenylate signal of 35 pod, animal and plant cells. The cells may be prokaryotic or Agrobacterium tumor-inducing (Ti) plasmid genes are also eukaryotic. Preferred host cells are yeast and plant cells. In a suitable. preferred embodiment, the plant cell is a seed cell, in particu Recombinant DNA technologies can be used to improve lar a cell in a cotyledon or endosperm of a seed. In one expression of a transformed polynucleotide molecule by embodiment, the cell is an animal cell or an algal cell. The manipulating, for example, the number of copies of the poly 40 animal cell may be of any type of animal Such as, for example, nucleotide molecule within a host cell, the efficiency with a non-human animal cell, a non-human vertebrate cell, a which those polynucleotide molecules are transcribed, the non-human mammalian cell, or cells of aquatic animals such efficiency with which the resultant transcripts are translated, as, fish or crustacea, invertebrates, insects, etc. The cells may and the efficiency of post-translational modifications. be of an organism suitable for a fermentation process. As used Recombinant techniques useful for increasing the expression 45 herein, the term the "fermentation process” refers to any of polynucleotide molecules defined herein include, but are fermentation process or any process comprising a fermenta not limited to, integration of the polynucleotide molecule into tion step. Examples of fermenting microorganisms include one or more host cell chromosomes, addition of stability fungal organisms, such as yeast. As used herein, “yeast sequences to mRNAS, Substitutions or modifications of tran includes Saccharomyces spp., Saccharomyces cerevisiae, Scription control signals (e.g., promoters, operators, enhanc 50 Saccharomyces carlbergensis, Candida spp., Kluveromyces ers), Substitutions or modifications of translational control spp. Pichia spp., Hansenula spp., Trichoderma spp., Lipomy signals (e.g., ribosome binding sites, Shine-Dalgamo ces starkey, and Yarrowia lipolytica. Preferred yeast include sequences), modification of polynucleotide molecules to cor strains of the Saccharomyces spp., and in particular, Saccha respond to the codon usage of the host cell, and the deletion of romyces cerevisiae. sequences that destabilize transcripts. 55 Transgenic Plants Recombinant Cells The invention also provides a plant comprising a cell of the The invention also provides a recombinant cell, preferably invention, Such as a transgenic plant comprising one or more a recombinant plant cell, which is a host cell transformed with polynucleotides of the invention. The term “plant’ as used one or more recombinant molecules, such as the polynucle herein as a noun refers to whole plants, but as used as an otides, chimeric genetic constructs or recombinant vectors 60 adjective refers to any Substance which is present in, obtained defined herein. The recombinant cell may comprise any com from, derived from, or related to a plant, such as for example, bination thereof, such as two or three recombinant vectors, or plant organs (e.g. leaves, stems, roots, flowers), single cells a recombinant vector and one or more additional polynucle (e.g. pollen), seeds, plant cells and the like. The term "plant otides or chimeric DNAs. Suitable cells of the invention part” refers to all plant parts that comprise the plant DNA, include any cell that can be transformed with a polynucle 65 including vegetative structures such as, for example, leaves or otide, chimeric DNA or recombinant vector of the invention, stems, roots, floral organs or structures, pollen, seed, seed Such as for example, a molecule encoding a polypeptide or parts such as an embryo, endosperm, scutellum or seed coat, US 8,946,460 B2 57 58 plant tissue such as, for example, vascular tissue, cells and conditions. This term does not encompass features of the progeny of the same, as long as the plant part synthesizes lipid plant which may be different to the wild-type plant but which according to the invention. do not effect the usefulness of the plant for commercial pur A “transgenic plant”, “genetically modified plant’ or varia poses such as, for example, a ballerina phenotype of seedling tions thereof refers to a plant that contains a gene construct leaves. (“transgene') not found in a wild-type plant of the same Plants provided by or contemplated for use in the practice species, variety or cultivar. Transgenic plants as defined in the of the present invention include both monocotyledons and context of the present invention include plants and their prog dicotyledons. In preferred embodiments, the plants of the eny which have been genetically modified using recombinant present invention are crop plants (for example, cereals and techniques to cause production of the lipid or at least one 10 pulses, maize, wheat, potatoes, tapioca, rice, Sorghum, millet, polypeptide defined herein in the desired plant or plant organ. cassava, barley, or pea), or other legumes. The plants may be Transgenic plant cells and transgenic plant parts have corre grown for production of edible roots, tubers, leaves, stems, sponding meanings. A “transgene' as referred to herein has flowers or fruit. The plants may be vegetables or ornamental the normal meaning in the art of biotechnology and includes plants. The plants of the invention may be: corn (Zea mays), a genetic sequence which has been produced or altered by 15 canola (Brassica napus, Brassica rapassp.), mustard (Bras recombinant DNA or RNA technology and which has been sica iuncea), flax (Linum usitatissimum), alfalfa (Medicago introduced into a cell of the invention, preferably a plant cell. sativa), rice (Oryza sativa), rye (Secale cerale), Sorghum The transgene may include genetic sequences derived from a (Sorghum bicolour, Sorghum vulgare), Sunflower (Helianthus plant cell which may be of the same species, variety or culti annus), wheat (Tritium aestivum), soybean (Glycine max), var as the plant cell into which the transgene is introduced or tobacco (Nicotiana tabacum), potato (Solanum tuberosum), of a different species, variety or cultivar, or from a cell other peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), than a plant cell. Typically, the transgene has been introduced Sweet potato (Lopmoea batatus), cassava (Manihot escu into the cell. Such as a plant, by human manipulation Such as, lenta), coffee (Cofea spp.), coconut (Cocos nucifera), pine for example, by transformation but any method can be used as apple (Anana comosus), citrus tree (Citrus spp.), cocoa one of skill in the art recognizes. 25 (Theobroma cacao), tea (Camelia Senensis), banana (Musa The terms “seed' and “grain” are used interchangeably spp.), avocado (Persea americana), fig (Ficus Casica), guava herein. “Grain” refers to mature grain such as harvested grain (Psidium guajava), mango (Mangifer indica), olive (Olea or grain which is still on a plant but ready for harvesting, but europaea), papaya (Carica papaya), cashew (Anacardium can also refer to grain after imbibition or germination, accord occidentale), macadamia (Macadamia intergrifolia), almond ing to the context. Mature grain or seed commonly has a 30 (Prunus amygdalus), Sugar beets (Beta vulgaris), oats, or moisture content of less than about 18-20%. “Developing barley. seed’ as used herein refers to a seed prior to maturity, typi In a preferred embodiment, the plant is an angiosperm. cally found in the reproductive structures of the plant after In an embodiment, the plant is an oilseed plant, preferably fertilisation oranthesis, but can also refer to such seeds prior an oilseed crop plant. As used herein, an “oilseed plant' is a to maturity which are isolated from a plant. 35 plant species used for the commercial production of oils from As used herein, the term “obtaining a plant part” or the seeds of the plant. The oilseed plant may be oil-seed rape “obtaining a seed’ refers to any means of obtaining a plant (such as canola), maize, Sunflower, soybean, Sorghum, flax part or seed, respectively, including harvesting of the plant (linseed) or sugar beet. Furthermore, the oilseed plant may be parts or seed from plants in the field or in containment Such as other Brassicas, cotton, peanut, poppy, mustard, castor bean, a greenhouse or growth chamber, or by purchase or receipt 40 sesame, safflower, or nut producing plants. The plant may from a supplier of the plant parts or seed. The seed may be produce high levels of oil in its fruit, such as olive, oil palm or Suitable for planting i.e. able to germinate and produce prog coconut. Horticultural plants to which the present invention eny plants, or alternatively has been processed in Such a way may be applied are lettuce, endive, or vegetable brassicas that it is no longer able to germinate, e.g. cracked, polished or including cabbage, broccoli, or cauliflower. The present milled seed which is useful for food or feed applications, or 45 invention may be applied in tobacco, cucurbits, carrot, Straw for extraction of lipid of the invention. berry, tomato, or pepper. As used herein, the term “plant storage organ” refers to a In a further preferred embodiment, the non-transgenic part of a plant specialized to storage energy in the form of for plant used to produce a transgenic plant of the invention example, proteins, carbohydrates, fatty acids and/or oils. produces oil, especially in the seed, which has i) less than Examples of plant storage organs are seed, fruit, tuberous 50 20%, less than 10% or less than 5% 18:2 fatty acids and/or ii) roots, and tubers. A preferred plant storage organ of the inven less than 10% or less than 5% 18:3 fatty acids. tion is seed. In a preferred embodiment, the transgenic plant is homozy As used herein, the term “phenotypically normal” refers to gous for each and every gene that has been introduced (trans a genetically modified plant or plant organ, particularly a gene) so that its progeny do not segregate for the desired storage organ Such as a seed, tuber or fruit of the invention not 55 phenotype. The transgenic plant may also be heterozygous having a significantly reduced ability to grow and reproduce for the introduced transgene(s), preferably uniformly het when compared to an unmodified plant or plant organ. In an erozygous for the transgene, such as for example in F1 prog embodiment, the genetically modified plant or plant organ eny which have been grown from hybrid seed. Such plants which is phenotypically normal comprises an exogenous may provide advantages such as hybrid vigour, well known in polynucleotide encoding a silencing Suppressor operably 60 the art. linked to a plant storage organ specific promoter and has an Where relevant, the transgenic plants may also comprise ability to grow or reproduce which is essentially the same as additional transgenes encoding enzymes involved in the pro an isogenic plant or organ not comprising said polynucle duction of LC-PUFAs such as, but not limited to, a A6-de otide. Preferably, the biomass, growth rate, germination rate, saturase, a A9-elongase, a A8-desaturase, a A6-elongase, a storage organ size, seed size and/or the number of viable 65 A5-desaturase, an (03-desaturase, a A4-desaturase, a A5-elon seeds produced is not less than 90% of that of a plant lacking gase, diacylglycerol acyltransferase, LPAAT, a A17-desatu said exogenous polynucleotide when grown under identical rase, a A15-desaturase and/or a A12 desaturase. Examples of US 8,946,460 B2 59 60 Such enzymes with one of more of these activities are known the integration of the T-DNA is a relatively precise process in the art and include those described herein. In specific resulting in few rearrangements. In those plant varieties examples, the transgenic plant at least comprises exogenous where Agrobacterium-mediated transformation is efficient, it polynucleotides encoding: is the method of choice because of the facile and defined a) a A4-desaturase, a A5-desaturase, a A6-desaturase, a nature of the gene transfer. Preferred Agrobacterium trans A5-elongase and a A6-elongase, formation vectors are capable of replication in E. coli as well b) a A4-desaturase, a A5-desaturase, a A8-desaturase, a as Agrobacterium, allowing for convenient manipulations as A5-elongase and a A9-elongase, described (Klee et al., In: Plant DNA Infectious Agents, Hohn c) a A4-desaturase, a A5-desaturase, a A6-desaturase, a and Schell, eds. Springer-Verlag, New York, pp. 179-203 A5-elongase, a A6-elongase, and a A15-desaturase, 10 (1985). d) a A4-desaturase, a A5-desaturase, a A8-desaturase, a Acceleration methods that may be used include, for A5-elongase, a A9-elongase, and a A15-desaturase, example, microprojectile bombardment and the like. One e) a A4-desaturase, a A5-desaturase, a A6-desaturase, a example of a method for delivering transforming nucleic acid A5-elongase, a A6-elongase, and a A17-desaturase, or molecules to plant cells is microprojectile bombardment. f) a A4-desaturase, a A5-desaturase, a A8-desaturase, a 15 This method has been reviewed by Yang et al., Particle Bom A5-elongase, a A9-elongase, and a A17-desaturase. bardment Technology for Gene Transfer, Oxford Press, In an embodiment, the exogenous polynucleotides encode Oxford, England (1994). Non-biological particles (micro set of polypeptides which are a Pythium irregulare A6-de projectiles) that may be coated with nucleic acids and deliv saturase, a Thraustochytrid A5-desaturase or an Emiliana ered into cells by a propelling force. Exemplary particles huxleyi A5-desaturase, a Physcomitrella patens A6-elongase, include those comprised oftungsten, gold, platinum, and the a Thraustochytrid A5-elongase or an Ostreoccus taurii like. A particular advantage of microprojectile bombardment, A5-elongase, a Phytophthora infestans (D3-desaturase or a in addition to it being an effective means of reproducibly Pythium irregulare (03-desaturase, and a Thraustochytrid transforming monocots, is that neither the isolation of proto A4-desaturase. plasts, nor the Susceptibility of Agrobacterium infection are In an embodiment, plants of the invention are grown in the 25 required. field, preferably as a population of at least 1,000 or 1,000,000 In another alternative embodiment, plastids can be stably plants that are essentially the same, or in an area of at least 1 transformed. Methods disclosed for plastid transformation in hectare. Planting densities differ according to the plant spe higher plants include particle gun delivery of DNA contain cies, plant variety, climate, Soil conditions, fertiliser rates and ing a selectable marker and targeting of the DNA to the plastid other factors as known in the art. For example, canola is 30 genome through homologous recombination (U.S. Pat. Nos. typically grown at a planting density of 1.2-1.5 million plants 5,451,513, 5,545,818, 5,877,402, 5,932,479, and WO99/ per hectare. Plants are harvested as is known in the art, which 05265). may comprise Swathing, windrowing and/or reaping of Other methods of cell transformation can also be used and plants, followed by threshing and/or winnowing of the plant include but are not limited to introduction of DNA into plants material to separate the seed from the remainder of the plant 35 by direct DNA transfer into pollen, by direct injection of parts often in the form of chaff. Alternatively, seed may be DNA into reproductive organs of a plant, or by direct injection harvested from plants in the field in a single process, namely of DNA into the cells of immature embryos followed by the combining. rehydration of desiccated embryos. Transformation of Plants The regeneration, development, and cultivation of plants Transgenic plants can be produced using techniques 40 from single plant protoplast transformants or from various known in the art, such as those generally described in A. transformed explants is well known in the art (Weissbach et Slater et al., Plant Biotechnology—The Genetic Manipula al., In: Methods for Plant Molecular Biology, Academic tion of Plants, Oxford University Press (2003), and P. Chris Press, San Diego, Calif., (1988). This regeneration and tou and H. Klee, Handbook of Plant Biotechnology, John growth process typically includes the steps of selection of Wiley and Sons (2004). 45 transformed cells, culturing those individualized cells As used herein, the terms “stably transforming”, “stably through the usual stages of embryonic development through transformed and variations thereof refer to the integration of the rooted plantlet stage. Transgenic embryos and seeds are the exogenous nucleic acid molecules into the genome of the similarly regenerated. The resulting transgenic rooted shoots cell Such that they are transferred to progeny cells during cell are thereafter planted in an appropriate plant growth medium division without the need for positively selecting for their 50 Such as soil. presence. Stable transformants, or progeny thereof, can be The development or regeneration of plants containing the selected by any means known in the art such as Southern blots foreign, exogenous gene is well known in the art. Preferably, on chromosomal DNA or in situ hybridization of genomic the regenerated plants are self-pollinated to provide homozy DNA. gous transgenic plants. Otherwise, pollen obtained from the Agrobacterium-mediated transfer is a widely applicable 55 regenerated plants is crossed to seed-grown plants of agro system for introducing genes into plant cells because DNA nomically important lines. Conversely, pollen from plants of can be introduced into cells in whole plant tissues or plant these importantlines is used to pollinate regenerated plants. A organs or explants in tissue culture, for either transient transgenic plant of the present invention containing a desired expression or for stable integration of the DNA in the plant exogenous nucleic acid is cultivated using methods well cell genome. The use of Agrobacterium-mediated plant inte 60 known to one skilled in the art. grating vectors to introduce DNA into plant cells is well To confirm the presence of the transgenes in transgenic known in the art (see, for example, U.S. Pat. Nos. 5,177,010, cells and plants, a polymerase chain reaction (PCR) amplifi 5,104,310, 5,004,863 or 5,159,135) including floral dipping cation or Southern blot analysis can be performed using methods using Agrobacterium or other bacteria that can trans methods known to those skilled in the art. Expression prod fer DNA into plant cells. The region of DNA to be transferred 65 ucts of the transgenes can be detected in any of a variety of is defined by the border sequences, and the intervening DNA ways, depending upon the nature of the product, and include (T-DNA) is usually inserted into the plant genome. Further, Western blot and enzyme assay. Once transgenic plants have US 8,946,460 B2 61 62 been obtained, they may be grown to produce plant tissues or sequence as provided in any one of SEQID NOs 53 to 57, a parts having the desired phenotype. The plant tissue or plant biologically active fragment thereof, or an amino acid parts, may be harvested, and/or the seed collected. The seed sequence which is at least 50% identical to any one or more of may serve as a source for growing additional plants with SEQID NOS 53 to 57 and which has activity as a silencing tissues or parts having the desired characteristics. Suppressor. A transgenic plant formed using Agrobacterium or other As used herein, the terms “stabilising expression”, “stably transformation methods typically contains a single genetic expressed”, “stabilised expression' and variations thereof locus on one chromosome. Such transgenic plants can be refer to level of the RNA molecule being essentially the same referred to as being hemizygous for the added gene(s). More or higher in progeny plants over repeated generations, for preferred is a transgenic plant that is homozygous for the 10 example at least three, at least five or at least 10 generations, added gene(s); i.e., a transgenic plant that contains two added when compared to isogenic plants lacking the exogenous genes, one gene at the same locus on each chromosome of a polynucleotide encoding the silencing Suppressor. However, chromosome pair. A homozygous transgenic plant can be this term(s) does not exclude the possibility that over repeated obtained by self-fertilising a hemizygous transgenic plant, generations there is some loss of levels of the RNA molecule germinating some of the seed produced and analyzing the 15 when compared to a previous generation, for example not less resulting plants for the gene of interest. than a 10% loss per generation. It is also to be understood that two different transgenic The Suppressor can be selected from any source e.g. plant, plants that contain two independently segregating exogenous viral, mammal etc. See WO2010/057246 for a list of viruses genes or loci can also be crossed (mated) to produce offspring from which the Suppressor can be obtained and the protein (eg that contain both sets of genes or loci. Selfing of appropriate B2, P14 etc) or coding region designation for the Suppressor F1 progeny can produce plants that are homozygous for both from each particular virus. Multiple copies of a Suppressor exogenous genes or loci. Back-crossing to a parental plant may be used. Different Suppressors may be used together and out-crossing with a non-transgenic plant are also contem (e.g., in tandem). plated, as is vegetative propagation. Descriptions of other RNA Molecules breeding methods that are commonly used for different traits 25 Essentially any RNA molecule which is desirable to be and crops can be found in Fehr, In: Breeding Methods for expressed in a plant seed can be co-expressed with the silenc Cultivar Development, Wilcox J. ed., American Society of ing Suppressor. The encoded polypeptides may be involved in Agronomy, Madison Wis. (1987). metabolism of oil, starch, carbohydrates, nutrients, etc., or Enhancing Exogenous RNA Levels and Stabilized Expres may be responsible for the synthesis of proteins, peptides, sion 30 fatty acids, lipids, waxes, oils, starches, Sugars, carbohy Silencing Suppressors drates, flavors, odors, toxins, carotenoids. hormones, poly In an embodiment, a cell, plant or plant part of the invention mers, flavonoids. Storage proteins, phenolic acids, alkaloids, comprises an exogenous polynucleotide encoding a silencing lignins, tannins, celluloses, glycoproteins, glycolipids, etc. Suppressor protein. preferably the biosynthesis or assembly of TAG. Post-transcriptional gene silencing (PTGS) is a nucleotide 35 In a particular example, the plants produced increased lev sequence-specific defense mechanism that can target both els of enzymes for oil production in plants such as Brassicas, cellular and viral mRNAs for degradation PTGS occurs in for example canola or Sunflower, Safflower, flax, cotton, Soya plants or fungi stably or transiently transformed with foreign bean, Camelina or maize. (heterologous) or endogenous DNA and results in the reduced Levels of LC-PUFA Produced accumulation of RNA molecules with sequence similarity to 40 The levels of the LC-PUFA or combination of LC-PUFAs the introduced nucleic acid. that are produced in the recombinant cellor plant part such as It has widely been considered that co-expression of a seed are of importance. The levels may be expressed as a silencing Suppressor with a transgene of interest will increase composition (in percent) of the total fatty acid that is a par the levels of RNA present in the cell transcribed from the ticular LC-PUFA or group of related LC-PUFA, for example transgene. Whilst this has proven true for cells in vitro, sig 45 the (03 LC-PUFA or the (06 LC-PUFA, or the VLC-PUFA, or nificant side-effects have been observed in many whole plant other which may be determined by methods known in the art. co-expression studies. More specifically, as described in Mal The level may also be expressed as a LC-PUFA content, such lory et al. (2002), Chapman et al. (2004), Chen et al. (2004), as for example the percentage of LC-PUFA in the dry weight Dunoyer et al. (2004), Zhang et al. (2006), Lewsey et al. of material comprising the recombinant cells, for example the (2007) and Meng et al. (2008) plants expressing silencing 50 percentage of the weight of seed that is LC-PUFA. It will be Suppressors, generally under constitutive promoters, are appreciated that the LC-PUFA that is produced in an oilseed often phenotypically abnormal to the extent that they are not may be considerably higher in terms of LC-PUFA content useful for commercial production. than in a vegetable or a grain that is not grown for oil produc Recently, it has been found that RNA molecule levels can tion, yet both may have similar LC-PUFA compositions, and be increased, and/or RNA molecule levels stabilized over 55 both may be used as sources of LC-PUFA for human or numerous generations, by limiting the expression of the animal consumption. silencing Suppressor to a seed of a plant or part thereof The levels of LC-PUFA may be determined by any of the (WO2010/057246). As used herein, a “silencing suppressor methods known in the art. In a preferred method, total lipid is protein’ or SSP is any polypeptide that can be expressed in a extracted from the cells, tissues or organisms and the fatty plant cell that enhances the level of expression product from 60 acid converted to methyl esters before analysis by gas chro a different transgene in the plant cell, particularly over matography (GC). Such techniques are described in Example repeated generations from the initially transformed plant. In 1. The peak position in the chromatogram may be used to an embodiment, the SSP is a viral silencing suppressor or identify each particular fatty acid, and the area under each mutant thereof. A large number of viral silencing Suppressors peak integrated to determine the amount. As used herein, are known in the art and include, but are not limited to P19, 65 unless stated to the contrary, the percentage of particular fatty V2, P38, Pe-Po and RPV-P0. In an embodiment, the viral acid in a sample is determined as the area under the peak for silencing Suppressor comprises amino acids having a that fatty acid as a percentage of the total area for fatty acids US 8,946,460 B2 63 64 in the chromatogram. This corresponds essentially to a OA to ALA=100x (sum % for ALA, SDA, ETA, ETA, weight percentage (w/w). The identity of fatty acids may be EPA, DPA and DHA)/(sum % for OA, LA, GLA, DGLA, ARA, EDA, ALA, SDA, ETA, ETA, EPA, confirmed by GC-MS. Total lipid may be separated by tech DPA and DHA). 8 niques known in the art to purify fractions such as the TAG fraction. For example, thin-layer chromatography (TLC) may A6-desaturase efficiency(on ()3 substrate ALA)=100x be performed at an analytical scale to separate TAG from (sum 96 for SDA, ETA, EPA, DPA and DHA)/(% other lipid fractions such as DAG, acyl-CoAS orphospholipid ALA, SDA, ETA, ETA, EPA, DPA and DHA). 9 in order to determine the fatty acid composition specifically of TAG. A6-elongase efficiency(on ()3 substrate SDA)=100x In one embodiment, the sum total of ARA, EPA, DPA and 10 (sum % for ETA, EPA, DPA and DHA) (Sum% DHA in the fatty acids in the extracted lipid is between about for SDA, ETA, EPA, DPA and DHA). 10 7% and about 25% of the total fatty acids in the cell. In a A5-desaturase efficiency(on ()3 substrate ETA)=100x further embodiment, the total fatty acid in the cell has less (sum % for EPA, DPA and DHA)/(sum % for than 1% C20:1. In preferred embodiments, the extractable ETA, EPA, DPA and DHA). 11 TAG in the cell comprises the fatty acids at the levels referred 15 to herein. Each possible combination of the features defining A5-elongase efficiency(on ()3 substrate EPA)=100x the lipid as described herein is also encompassed. (sum 96 for DPA and DHA)/(sum 96 for EPA.DPA The level of production of LC-PUFA in the recombinant and DHA). 12 cell, plant or plant part Such as seed may also be expressed as The fatty acid composition of the lipid, preferably seedoil, a conversion percentage of a specific Substrate fatty acid to of the invention, is also characterised by the ratio of co6 fatty one or more product fatty acids, which is also referred to acids:c)3 fatty acids in the total fatty acid content, for either hereinas a “conversion efficiency' or “enzymatic efficiency’. total ()6 fatty acids:total ()3 fatty acids or for new co6 fatty This parameter is based on the fatty acid composition in the acids:new co3 fatty acids. The terms total ()6 fatty acids, total lipid extracted from the cell, plant, plant part or seed, i.e., the c)3 fatty acids, new co6 fatty acids and new co3 fatty acids have amount of the LC-PUFA formed (including other LC-PUFA 25 the meanings as defined herein. The ratios are calculated from derived therefrom) as a percentage of one or more substrate the fatty acid composition in the lipid extracted from the cell, fatty acids (including all other fatty acids derived therefrom). plant, plant part or seed, in the manner as exemplified herein. The general formula for a conversion percentage is: 100x(the It is desirable to have a greater level of co3 than ()6 fatty acids sum of percentages of the product LC-PUFA and all products in the lipid, and therefore an (06:03 ratio of less than 1.0 is derived therefrom)/(the sum of the percentages of the sub 30 preferred. A ratio of 0.0 indicates a complete absence of the strate fatty acid and all products derived therefrom). With defined ()6 fatty acids; a ratio of 0.03 was achieved as regard to DHA, for example, this may be expressed as the described in Example 6. Such low ratios can be achieved ratio of the level of DHA (as a percentage in the total fatty acid through the combined use of a A6-desaturase which has an (03 content in the lipid) to the level of a substrate fatty acid (e.g. Substrate preference together with an (03-desaturase, particu OA, LA, ALA, SDA, ETA or EPA) and all products other than 35 larly a fungal (O3-desaturase such as the Pichia pastoris DHA derived from the substrate. The conversion percentage (O3-desaturase as exemplified herein. or efficiency of conversion can be expressed for a single The yield of LC-PUFA per weight of seed may also be enzymatic step in a pathway, or for part or the whole of a calculated based on the total oil content in the seed and the '% pathway. DHA in the oil. For example, if the oil content of canola seed Specific conversion efficiencies are calculated herein 40 is about 40% (w/w) and about 12% of the total fatty acid according to the formulae: content of the oil is DHA, the DHA content of the seed is about 4.8% or about 48 mg per gram of seed. As described in OA to DHA=100x(%DHA)/(sum % for OA, LA, GLA, Example 2, the DHA content of Arabidopsis seed having DGLAARA, EDA, ALA, SDA, ETA, ETA, EPA, DPA and DHA). 1 about 9% DHA, which has a lower oil content than canola, 45 was about 25 mg/g seed. At a DHA content of about 7%. canola seed or Camelina sativa seed has a DHA content of LA to DHA=100x(% DHA)/(sum % for LA, GLA, DGLA, ARA, EDA ALA, SDA, ETA, ETA, EPA, about 28 mg per gram of seed. The present invention therefore DPA and DHA). 2 provides Brassica napus, B. juncea and Camelina sativa plants, and seed obtained therefrom, comprising at least about ALA to DHA=100x(% DHA)/(sum % for ALA, SDA, 50 28 mg DHA per gram seed. The seed has a moisture content ETA, ETA, EPA, DPA and DHA). 3 as is standard for harvested mature seed after drying down (4-15% moisture). The invention also provides a process for EPA to DHA=100x(% DHA)/(sum 96 for EPA, DPA obtaining oil, comprising obtaining the seed and extracting and DHA). 4 the oil from the seed, and uses of the oil and methods of 55 obtaining the seed comprising harvesting the seeds from the DPA to DHA (A4-desaturase efficiency)=100x(% plants according to the invention. DHA)/(sum 9% for DPA and DHA). 5 The amount of DHA produced per hectare can also be calculated if the seed yield per hectare is known or can be A12-desaturase efficiency=100x (sum % for LA, GLA, estimated. For example, canola in Australia typically yields DGLA, ARA, EDA, ALA, SDA, ETA, ETA, EPA, 60 about 2.5 tonnes seed per hectare, which at 40% oil content DPA and DHA)/(sum % for OA, LA, GLA, yields about 1000 kg of oil. At 12% DHA in the total oil, this DGLA, ARA, EDA, ALA, SDA, ETA, ETA, EPA, provides about 120 kg of DHA per hectare. If the oil content DPA and DHA). 6 is reduced by 50%, this still provides about 60 kg DHA/ha. Evidence to date Suggests that some desaturases expressed ()3-desaturase efficiency=100x(sum % for ALA, SDA, ETA, ETA, EPA, DPA and DHA)/(sum 96 for LA, 65 heterologously in yeast or plants have relatively low activity GLA, DGLA, ARA, EDA, ALA, SDA, ETA, ETA, in combination with some elongases. This may be alleviated EPA, DPA and DHA). 7 by providing a desaturase with the capacity of to use an US 8,946,460 B2 65 66 acyl-CoA form of the fatty acid as a substrate in LC-PUFA results in the separation of most of the phospholipids accom synthesis, and this is thought to be advantageous in recombi panied by trace metals and pigments. The insoluble material nant cells particularly in plant cells. A particularly advanta that is removed is mainly a mixture of phospholipids and geous combination for efficient DHA synthesis is a fungal triacylglycerols and is also known as lecithin. Degumming (O3-desaturase, for example Such as the Pichia pastoris can be performed by addition of concentrated phosphoric (03-desaturase (SEQID NO: 12), with a A6-desaturase which acid to the crude seedoil to convert non-hydratable phosphati has a preference for (D3 acyl substrates Such as, for example, des to a hydratable form, and to chelate minor metals that are the Micromonas pusilla A6-desaturase (SEQ ID NO: 13), or present. Gum is separated from the seedoil by centrifugation. variants thereof which have at least 95% amino acid sequence Alkali Refining identity. 10 Alkali refining is one of the refining processes for treating As used herein, the term “essentially free” means that the crude oil, sometimes also referred to as neutralization. It composition (for example lipid or oil) comprises little (for usually follows degumming and precedes bleaching. Follow example, less than about 0.5%, less than about 0.25%, less ing degumming, the seedoil can treated by the addition of a than about 0.1%, or less than about 0.01%) or none of the sufficient amount of an alkali solution to titrate all of the fatty defined component. In an embodiment, “essentially free” 15 acids and phosphoric acids, and removing the Soaps thus means that the component is undetectable using a routine formed. Suitable alkaline materials include sodium hydrox analytical technique, for example a specific fatty acid (such as ide, potassium hydroxide, Sodium carbonate, lithium hydrox (D6-docosapentaenoic acid) cannot be detected using gas ide, calcium hydroxide, calcium carbonate and ammonium chromatography as outlined in Example 1. hydroxide. This process is typically carried out at room tem Production of Oils perature and removes the free fatty acid fraction. Soap is Techniques that are routinely practiced in the art can be removed by centrifugation or by extraction into a solvent for used to extract, process, and analyze the oils produced by the soap, and the neutralised oil is washed with water. If cells, plants, seeds, etc of the instant invention. Typically, required, any excess alkali in the oil may be neutralized with plant seeds are cooked, pressed, and extracted to produce a Suitable acid such as hydrochloric acid or Sulphuric acid. crude oil, which is then degummed, refined, bleached, and 25 Bleaching deodorized. Generally, techniques for crushing seed are Bleaching is a refining process in which oils are heated at known in the art. For example, oilseeds can be tempered by 90-120° C. for 10-30 minutes in the presence of a bleaching spraying them with water to raise the moisture content to, e.g., earth (0.2-2.0%) and in the absence of oxygen by operating 8.5%, and flaked using a Smooth roller with a gap setting of with nitrogen or steam or in a vacuum. This step in oil pro 0.23 to 0.27 mm. Depending on the type of seed, water may 30 cessing is designed to remove unwanted pigments (caro not be added prior to crushing. Application of heat deactivates tenoids, chlorophyll, gossypol etc), and the process also enzymes, facilitates further cell rupturing, coalesces the oil removes oxidation products, trace metals, sulphur com droplets, and agglomerates protein particles, all of which pounds and traces of Soap. facilitate the extraction process. Deodorization In an embodiment, the majority of the seed oil is released 35 Deodorization is a treatment of oils and fats at a high by passage through a screw press. Cakes expelled from the temperature (200-260°C.) and low pressure (0.1-1 mm Hg). screw press are then solvent extracted, e.g., with hexane, This is typically achieved by introducing steam into the seed using a heat traced column. Alternatively, crude oil produced oil at a rate of about 0.1 ml/minute? 100 ml of seedoil. After by the pressing operation can be passed through a settling about 30 minutes of sparging, the seedoil is allowed to cool tank with a slotted wire drainage top to remove the solids that 40 under vacuum. The seedoil is typically transferred to a glass are expressed with the oil during the pressing operation. The container and flushed with argon before being stored under clarified oil can be passed through a plate and frame filter to refrigeration. This treatment improves the colour of the seed remove any remaining fine solid particles. If desired, the oil oil and removes a majority of the Volatile Substances or odor recovered from the extraction process can be combined with ous compounds including any remaining free fatty acids, the clarified oil to produce a blended crude oil. 45 monoacylglycerols and oxidation products. Once the solvent is stripped from the crude oil, the pressed Winterisation and extracted portions are combined and Subjected to normal Winterization is a process sometimes used in commercial oil processing procedures. As used herein, the term “purified’ production of oils for the separation of oils and fats into solid when used in connection with lipid or oil of the invention (Stearin) and liquid (olein) fractions by crystallization at Sub typically means that that the extracted lipid or oil has been 50 ambient temperatures. It was applied originally to cottonseed Subjected to one or more processing steps of increase the oil to produce a solid-free product. It is typically used to purity of the lipid/oil component. For example, a purification decrease the saturated fatty acid content of oils. step may comprise one or more or all of the group consisting Transesterification of degumming, deodorising, decolourising, drying and/or Transesterification is a process that exchanges the fatty fractionating the extracted oil. However, as used herein, the 55 acids within and between TAGs or transfers the fatty acids to term “purified' does not include a transesterification process another alcohol to form an ester, initially by releasing fatty or other process which alters the fatty acid composition of the acids from the TAGs either as free fatty acids or as fatty acid lipid or oil of the invention so as to increase the DHA content esters, usually fatty acid methyl esters or ethyl esters. When as a percentage of the total fatty acid content. Expressed in combined with a fractionation process, transesterification can other words, the fatty acid composition of the purified lipid or 60 be used to modify the fatty acid composition of lipids (Ma oil is essentially the same as that of the unpurified lipid or oil. rangoniet al., 1995). Transesterification can use either chemi Degumming cal (e.g. strong acid or base catalysed) or enzymatic means, Degumming is an early step in the refining of oils and its the latter using lipases which may be position-specific (sn-1/3 primary purpose is the removal of most of the phospholipids or sn-2 specific) for the fatty acid on the TAG, or having a from the oil, which may be present as approximately 1-2% of 65 preference for some fatty acids over others (Speranza et al. the total extracted lipid. Addition of -2% of water, typically 2012). The fatty acid fractionation to increase the concentra containing phosphoric acid, at 70-80° C. to the crude oil tion of LC-PUFA in an oil can be achieved by any of the US 8,946,460 B2 67 68 methods known in the art, such as, for example, freezing magnesium, manganese, iron, copper, Zinc, Selenium, iodine, crystallization, complex formation using urea, molecular dis and Vitamins A, E, D, C, and the B complex. Other such tillation, Supercritical fluid extraction and silverion complex Vitamins and minerals may also be added. ing. Complex formation with urea is a preferred method for The components utilized in the feedstuff compositions of its simplicity and efficiency in reducing the level of Saturated 5 the present invention can be of semi-purified or purified ori and monounsaturated fatty acids in the oil (GameZ. et al., gin. By semi-purified or purified is meant a material which 2003). Initially, the TAGs of the oil are split into their con has been prepared by purification of a natural material or by stituent fatty acids, often in the form of fatty acid esters, by de novo synthesis. hydrolysis under either acid or base catalysed reaction con A feedstuff composition of the present invention may also ditions, whereby one mol of TAG is reacted with at least 3 mol 10 be added to food even when supplementation of the diet is not ofalcohol (e.g. ethanol for ethyl esters or methanol for methyl required. For example, the composition may be added to food esters) with excess alcohol used to enable separation of the of any type, including (but not limited to): margarine, modi formed alkyl esters and the glycerol that is also formed, or by fied butter, cheeses, milk, yogurt, chocolate, candy, Snacks, lipases. These free fatty acids or fatty acid esters, which are salad oils, cooking oils, cooking fats, meats, fish and bever usually unaltered in fatty acid composition by the treatment, 15 ageS. may then be mixed with an ethanolic solution of urea for The genus Saccharomyces spp is used in both brewing of complex formation. The saturated and monounsaturated fatty beer and wine making and also as an agent in baking, particu acids easily complex with urea and crystallize out on cooling larly bread. Other yeasts such as oleaginous yeast including, and may subsequently be removed by filtration. The non-urea for example, Yarrowia spp., are also useful in LC-PUFA pro complexed fraction is thereby enriched with LC-PUFA. duction. Yeasts may be used as an additive in animal feed, Feedstuffs Such as in aquaculture. It will be apparent that genetically The present invention includes compositions which can be engineered yeast strains can be provided which are adapted to used as feedstuffs. For purposes of the present invention, synthesise LC-PUFA as described herein. These yeast strains, “feedstuffs’’ include any food or preparation for human or or LC-PUFA produced therein, can then be used in foodstuffs animal consumption which when taken into the body (a) serve 25 and in wine and beer making to provide products which have to nourish or build up tissues or Supply energy; and/or (b) enhanced fatty acid content. maintain, restore or support adequate nutritional status or Additionally, fatty acids produced in accordance with the metabolic function. Feedstuffs of the invention include nutri present invention or host cells transformed to contain and tional compositions for babies and/or young children Such as, express the Subject genes may also be used as animal food for example, infant formula, and seedmeal of the invention. 30 Supplements to alter an animal's tissue, egg or milk fatty acid Feedstuffs of the invention comprise, for example, a cell of composition to one more desirable for human or animal con the invention, a plant of the invention, the plant part of the sumption. Examples of such animals include sheep, cattle, invention, the seed of the invention, an extract of the inven horses, poultry Such as chickens and the like. tion, the product of the method of the invention, the product of Furthermore, feedstuffs of the invention can be used in the fermentation process of the invention, or a composition 35 aquaculture to increase the levels of fatty acids in fish or along with a suitable carrier(s). The term “carrier is used in crustaceans such as, for example, prawns for humanoranimal its broadest sense to encompass any component which may or consumption. Preferred fish are salmon. may not have nutritional value. As the skilled addressee will Preferred feedstuffs of the invention are the plants, seed appreciate, the carrier must be suitable for use (or used in a and other plant parts Such as leaves and stems which may be sufficiently low concentration) in a feedstuff such that it does 40 used directly as food or feed for humans or other animals. For not have deleterious effect on an organism which consumes example, animals may graze directly on Such plants grown in the feedstuff. the field or be fed more measured amounts in controlled The feedstuff of the present invention comprises an oil, feeding. The invention includes the use of Such plants and fatty acid ester, or fatty acid produced directly or indirectly by plant parts as feed for increasing the LC-PUFA levels in use of the methods, cells or plants disclosed herein. The 45 humans and other animals. composition may either be in a solid or liquid form. Addition Compositions ally, the composition may include edible macronutrients, pro The present invention also encompasses compositions, tein, carbohydrate, vitamins, and/or minerals in amounts particularly pharmaceutical compositions, comprising one or desired for a particular use. The amounts of these ingredients more of the fatty acids and/or resulting oils produced using will vary depending on whether the composition is intended 50 the methods of the invention. for use with normal individuals or for use with individuals A pharmaceutical composition may comprise one or more having specialized needs, such as individuals suffering from of the fatty acids and/or oils, in combination with a standard, metabolic disorders and the like. well-known, non-toxic pharmaceutically-acceptable carrier, Examples of suitable carriers with nutritional value adjuvant or vehicle Such as phosphate-buffered saline, water, include, but are not limited to, macronutrients such as edible 55 ethanol, polyols, vegetable oils, a wetting agent or an emul fats, carbohydrates and proteins. Examples of such edible fats sion Such as a water/oil emulsion. The composition may be in include, but are not limited to, coconut oil, borage oil, fungal either a liquid or Solid form. For example, the composition oil, black current oil, Soy oil, and mono- and diglycerides. may be in the form of a tablet, capsule, ingestible liquid or Examples of such carbohydrates include (but are not limited powder, injectible, or topical ointment or cream. Proper flu to): glucose, edible lactose, and hydrolyzed starch. Addition 60 idity can be maintained, for example, by the maintenance of ally, examples of proteins which may be utilized in the nutri the required particle size in the case of dispersions and by the tional composition of the invention include (but are not lim use of surfactants. It may also be desirable to include isotonic ited to) soy proteins, electrodialysed whey, electrodialysed agents, for example, Sugars, sodium chloride, and the like. skim milk, milk whey, or the hydrolysates of these proteins. Besides such inert diluents, the composition can also include With respect to vitamins and minerals, the following may 65 adjuvants, such as wetting agents, emulsifying and Suspend be added to the feedstuff compositions of the present inven ing agents, Sweetening agents, flavoring agents and perfum tion: calcium, phosphorus, potassium, Sodium, chloride, ing agents. US 8,946,460 B2 69 70 Suspensions, in addition to the active compounds, may at 5000 g for 15 minat room temperature before being resus comprise Suspending agents such as ethoxylated isostearyl pended to OD600-1.0 in an infiltration buffer containing 10 alcohols, polyoxyethylene Sorbitol and Sorbitan esters, mMMES pH 5.7, 10 mMMgCl2 and 100 uMacetosyringone. microcrystalline cellulose, aluminum metahydroxide, bento The cells were then incubated at 28°C. with shaking for 3 nite, agar-agar, and tragacanth or mixtures of these Sub hours before equal Volumes of Agrobacterium cultures con Stances. taining 35S.p.19 and the test chimeric construct(s) of interest Solid dosage forms such as tablets and capsules can be were mixed prior to infiltration into leaf tissue. The plants prepared using techniques well known in the art. For were typically grown for a further five days after infiltration example, fatty acids produced in accordance with the present before leaf discs were taken and freeze-dried for GC analysis invention can be tableted with conventional tablet bases such 10 of the fatty acids. as lactose, Sucrose, and cornstarch in combination with bind Fatty acid methyl esters (FAME) of total leaf lipids in ers such as acacia, cornstarch or gelatin, disintegrating agents freeze-dried samples were produced by incubating the Such as potato starch or alginic acid, and a lubricant Such as samples in methanol/HCl/dichloromethane (10/1/1 V/v) solu Stearic acid or magnesium Stearate. Capsules can be prepared tion for 2 hours at 80°C. together with a known amount of by incorporating these excipients into a gelatin capsule along 15 hexadecanoic acid as an internal standard. FAMEs were with antioxidants and the relevant fatty acid(s). extracted in hexane/DCM, concentrated to a small volume in For intravenous administration, the fatty acids produced in hexane and injected into a GC. The amount of individual and accordance with the present invention or derivatives thereof total fatty acids present in the lipid fractions were quantified may be incorporated into commercial formulations. on the basis of the known amount of internal standard. A typical dosage of a particular fatty acid is from 0.1 mg to Gas Chromatography (GC) Analysis of Fatty Acids 20 g, taken from one to five times per day (up to 100 g daily) FAME were analysed by gas chromatography using an and is preferably in the range of from about 10 mg to about 1, Agilent Technologies 7890A GC (Palo Alto, Calif., USA) 2, 5, or 10g daily (taken in one or multiple doses). As known equipped with a 30 m SGE-BPX70 column (70% cyanopro in the art, a minimum of about 300 mg/day of fatty acid, pyl polysilphenylene-siloxane, 0.25 mm inner diameter, 0.25 especially LC-PUFA, is desirable. However, it will be appre 25 mm film thickness), an FID, a split/splitless injector and an ciated that any amount of fatty acid will be beneficial to the Agilent Technologies 7693 Series auto sampler and injector. Subject. Helium was used as the carrier gas. Samples were injected in Possible routes of administration of the pharmaceutical split mode (50:1 ratio) at an oven temperature of 150°C. After compositions of the present invention include, for example, injection, the oven temperature was held at 150° C. for 1 min enteral (e.g., oral and rectal) and parenteral. For example, a 30 then raised to 210°C. at 3° C. min', again raised to 240° C. liquid preparation may be administered orally or rectally. at 50° C. min' and finally holding for 1.4 min at 240° C. Additionally, a homogenous mixture can be completely dis Peaks were quantified with Agilent Technologies ChemSta persed in water, admixed under sterile conditions with physi tion software (Rev B.04.03 (16), Palo Alto, Calif., USA) ologically acceptable diluents, preservatives, buffers or pro based on the response of the known amount of the external pellants to form a spray or inhalant. 35 standard GLC-411 (Nucheck) and C17:0-ME internal stan The dosage of the composition to be administered to the dard. patient may be determined by one of ordinary skill in the art Liquid Chromatography-Mass Spectrometry (LC-MS) and depends upon various factors such as weight of the Analysis of Lipids patient, age of the patient, overall health of the patient, past Total lipids were extracted from freeze-dried developing history of the patient, immune status of the patient, etc. 40 seeds, twelve days after flowering (daf), and mature seeds Additionally, the compositions of the present invention after adding a known amount of tri-C17:0-TAG as an internal may be utilized for cosmetic purposes. It may be added to quantitation standard. The extracted lipids were dissolved pre-existing cosmetic compositions such that a mixture is into 1 mL of 10 mM butylated hydroxytoluene in butanol: formed or a fatty acid produced according to the Subject methanol (1:1 V/v) per 5 mg dry material and analysed using invention may be used as the sole “active' ingredient in a 45 an Agilent 1200 series LC and 6410b electrospray ionisation cosmetic composition. triple quadrupole LC-MS. Lipids were chromatographically separated using an Ascentis Express RP-Amide column (50 EXAMPLES minx2.1 mm, 2.7 um, Supelco) operating a binary gradient with a flow rate of 0.2 mL/min. The mobile phases were: A. 10 Example 1 50 mM ammonium formate in H2O:methanol: tetrahydrofuran (50:20:30 v/v/v); B. 10 mM ammonium formate in HO: Materials and Methods methanol: tetrahydrofuran (5:20:75, V/v/v). Multiple reaction monitoring (MRM) lists were based on the following major Expression of Genes in Plant Cells in a Transient Expression fatty acids: 16:0, 18:0, 18:1, 18:2, 18:3, 18:4, 20:1, 20:2, 20:3, System 55 20:4, 20:5, 22:4, 22:5, 22:6 using a collision energy of 30 V Exogenous genetic constructs were expressed in plant cells and fragmentor of 60V. Individual MRMTAG was identified in a transient expression system essentially as described by based on ammoniated precursor ion and production from Voinnet et al. (2003) and Wood et al. (2009). Plasmids con neutral loss of 22:6. TAG was quantified using a 10 uM taining a coding region to be expressed from a strong consti tristearin external standard. tutive promoter such as the CaMV 35S promoter were intro 60 Determination of Seed Fatty Acid Profile and Oil Content duced into Agrobacterium tumefaciens Strain AGL1. A Where seed oil content was to be determined, seeds were chimeric gene 35S:p 19 for expression of the p19 viral silenc dried in a desiccator for 24 hand approximately 4 mg of seed ing Suppressor was separately introduced into AGL1, as was transferred to a 2 ml glass vial containing Teflon-lined described in WO 2010/057246. The recombinant Agrobacte screw cap. 0.05 mg triheptadecanoin dissolved in 0.1 ml rium cells were grown at 28°C. in LB broth supplemented 65 toluene was added to the vial as internal standard. with 50 mg/L. kanamycin and 50 mg/L rifampicinto station Seed FAME were prepared by adding 0.7 ml of 1N metha ary phase. The bacteria were then pelleted by centrifugation nolic HCl (Supelco) to the vial containing seed material, US 8,946,460 B2 71 72 vortexed briefly and incubated at 80°C. for 2 h. After cooling RT-PCR Conditions to room temperature, 0.3 ml of 0.9% NaCl (w/v) and 0.1 ml Reverse transcription-PCR (RT-PCR) amplification was hexane was added to the vial and mixed well for 10 min in typically carried out using the Superscript III One-Step RT HeidolphVibramax 110. The FAME was collected into 0.3 ml glass insert and analysed by GC with a flame ionization PCR system (Invitrogen) in a volume of 25uL using 10 pmol detector (FID) as mentioned earlier. of the forward primer and 30 Lumol of the reverse primer, The peak area of individual FAME were first corrected on MgSO to a final concentration of 2.5 mM, 400 ng of total the basis of the peak area responses of known amount of the RNA with buffer and nucleotide components according to the same FAMEs present in a commercial standard GLC-411 manufacturers instructions. Typical temperature regimes (NU-CHEK PREP, INC., USA). GLC-411 contains equal 10 were: 1 cycle of 45° C. for 30 minutes for the reverse tran amounts of 31 fatty acids (% by wt), ranging from C8:0 to scription to occur; then 1 cycle of 94° C. for 2 minutes C22:6. In case of fatty acids, which were not present in the followed by 40 cycles of 94° C. for 30 seconds, 52° C. for 30 standard, the inventors took the peak area responses of the seconds, 70° C. for 1 minute; then 1 cycle of 72° C. for 2 most similar FAME. For example, peak area response of minutes before cooling the reaction mixtures to 5°C. FAMEs of 16:1d9 was used for 16:1.d7 and FAME response 15 Production of B. napus Somatic Embryos by Induction with of C22:6 was used for C22:5. The corrected areas were used 35S-LEC2 to calculate the mass of each FAME in the sample by com parison to the internal standard mass. Oil is stored mainly in B. napus (cv. Oscar) seeds were sterilized using chlorine the form of TAG and its weight was calculated based on gas as described by (Attila Kereszt et al., 2007). Sterilized FAME weight. Total moles of glycerol was determined by seeds were germinated on /2 strength MS media (Murashige calculating moles of each FAMES and dividing total moles of and Skoog. 1962) with 0.8% agar adjusted to pH 5.8, and FAMEs by three. TAG was calculated as the sum of glycerol grown at 24°C. under fluorescent lighting (50 uE/ms) with a and fatty acyl moieties using a relation:% oil by weight=100x 1876 h (light/dark) photoperiod for 6-7 days. Cotyledonary ((41xtotal mol FAME/3)+(total g FAME-(15xtotal mol petioles with 2-4 mm stalk length were isolated aseptically FAME)))/g seed, where 41 and 15 are molecular weights of 25 from these seedlings and used as explants. Cultures of the glycerol moiety and methyl group, respectively. transformed A. tumefaciens strain AGL1, one harbouring a Analysis of the Sterol Content of Oil Samples seed specific binary vector and a second with a 35S-LEC2 Samples of approximately 10 mg of oil together with an construct were inoculated from single colonies from fresh added aliquot of C24:0 monol as an internal standard were plates and grown in 10 mL of LB medium with appropriate saponified using 4 mL 5% KOH in 80% MeOH and heating 30 antibiotics and grown overnight at 28°C. with agitation at 150 for 2 h at 80° C. in a Teflon-lined screw-capped glass tube. rpm. The bacterial cells were collected by centrifugation at After the reaction mixture was cooled, 2 mL of Milli-Q water 4000 rpm for 5 minutes, washed with MS media containing were added and the sterols were extracted into 2 mL of hex 2%. Sucrose and re-suspended in 10 mL of the same medium ane:dichloromethane (4:1 V/v) by shaking and Vortexing. The and grown with antibiotics for selection as appropriate for 4 mixture was centrifuged and the sterol extract was removed 35 and washed with 2 mL of Milli-Q water. The sterol extract hours after the addition of acetosyringone to 100 uM. Two was then removed after shaking and centrifugation. The hours before addition to the plant tissues, spermidine was extract was evaporated using a stream of nitrogen gas and the added to a final concentration of 1.5 mM and the final density sterols silylated using 200 mL of BSTFA and heating for 2 h of the bacteria adjusted to OD 600 nm=0.4 with fresh at 80° C. 40 medium. The two bacterial cultures, one carrying the seed For GC/GC-MS analysis of the sterols, sterol-OTMSi specific construct and other carrying 35S-Atl EC2, were derivatives were dried under a stream of nitrogen gas on aheat mixed in 1:1 to 1:1.5 ratios. block at 40°C. and then re-dissolved in chloroform or hexane Freshly-isolated B. napus cotyledonary petioles were immediately prior to GC/GC-MS analysis. The sterol-OTMS infected with 20 mL. A. tumefaciens cultures for 6 minutes. derivatives were analysed by gas chromatography (GC) using 45 The cotyledonary petioles were blotted on sterile filter paper an Agilent Technologies 6890AGC (Palo Alto, Calif., USA) to remove excess A. tumefaciens and then transferred to co fitted with an Supelco EquityTM-1 fused silica capillary col cultivation media (MS media with 1 mg/L TDZ, 0.1 mg/L umn (15 mx0.1 mm i.d., 0.1 um film thickness), an FID, a NAA, 100LM acetosyringone supplemented with L-cysteine split/splitless injector and an Agilent Technologies 7683B (50 mg/L), ascorbic acid (15 mg/L) and MES (250 mg/l)). Series auto Sampler and injector. Helium was the carrier gas. 50 Samples were injected in splitless mode at an oven tempera The plates were sealed with micro-pore tape and incubated in ture of 120° C. After injection, the oven temperature was the dark at 24°C. for 48 hrs. The co-cultivated explants were raised to 270° C. at 10° C. min' and finally to 300° C. at 5° transferred to pre-selection media (MS containing 1 mg/L C. min'. Peaks were quantified with Agilent Technologies TDZ, 0.1 mg/L NAA, 3 mg/L. AgNO, 250 mg/L cefotaxime ChemStation software (Palo Alto, Calif., USA). GC results 55 and 50 mg/L timentin) and cultured for 4-5 days at 24°C. with are subject to an error of +5% of individual component areas. a 16 h/8 h photoperiod. The explants were then transferred to GC-mass spectrometric (GC-MS) analyses were per selection media (MS containing 1 mg/LTDZ, 0.1 mg/L NAA, formed on a Finnigan Thermoguest GCO GC-MS and a 3 mg/L. AgNO, 250 mg/L cefotaxime and 50 mg/L timentin) Finnigan Thermo Electron Corporation GC-MS; both sys according to the selectable marker gene on the seed specific tems were fitted with an on-column injector and Thermoduest 60 vector and cultured for 2-3 weeks at 24°C. with a 16 hf.8 h Xcalibur software (Austin, Tex., USA). Each GC was fitted photoperiod. Explants with green embryogenic callus were with a capillary column of similar polarity to that described transferred to hormone free MS media (MS with 3 mg/L above. Individual components were identified using mass AgNO, 250 mg/L cefotaxime, 50 mg/L timentin and the spectral data and by comparing retention time data with those selection agent) and cultured for another 2-3 weeks. Torpedo obtained for authentic and laboratory standards. A full pro 65 or cotyledonary stage embryos isolated from Surviving cedural blank analysis was performed concurrent to the explants on the selection medium were analysed for fatty acid sample batch. composition in their total lipid using GC.. US 8,946,460 B2 73 74 Example 2 which would be likely to not include the selectable marker gene, would not be selected. p.JP3416-GA7 and pP3404 each Stable Expression of Transgenic DHAPathways in contained an RiA4 origin of replication from Agrobacterium Arabidopsis thaliana Seeds rhizogenes (Hamilton, 1997). plP3416-GA7 was generated by synthesising the DNA Binary Vector Construction region corresponding to nucleotides 226-19975 of SEQ ID The binary vectors plP3416-GA7 and plP3404 each con NO:1 (GA7 region) and inserting this region into the recipient tained seven heterologous fatty acid biosynthesis genes, binary vector plP3416 at the PspOMI site. Each fatty acid encoding 5 desaturases and 2 elongases, and a plant selectable biosynthetic gene on GA7 included a Tobacco Mosaic Virus marker between the left and right border repeats of the T-DNA 10 5' untranslated region (5' UTR) sequence which was operably presentineach vector(FIGS. 2 and 3). SEQIDNO:1 provides linked to each coding region, between the promoter and the the nucleotide sequence of the T-DNA region of pP3416 translation initiation ATG, to maximise translation efficiency GA7 from the right to left border sequences. Both genetic of the mRNAs produced from the genes. The GA7 construct constructs contained plant codon-optimised genes encoding a also included two Nicotiana tabacum Rb7 matrix attachment Lachancea kluyveri A12-desaturase (comprising nucleotides 15 region (MAR) sequences, as described by Hall et al. (1991). 14143-16648 of SEQID NO:1), a Pichiapastoris (03-desatu MAR sequences, sometimes termed nuclear attachment rase (comprising nucleotides 7654-10156 of SEQID NO:1), regions, are known to bind specifically to the nuclear matrix a Micromonas pusilla A6-desaturase (comprising nucleotides in vitro and may mediate binding of chromatin to the nuclear 226-2309 of SEQID NO: 1), Pavlova salina A5- and A4-de matrix in vivo. MARs are thought to function to reduce trans saturases (comprising nucleotides 4524-6485 and 10157 gene silencing. In pP3416-GA7 the MARs were also 14142 of SEQ ID NO:1, respectively) and Pyramimonas inserted and positioned within the T-DNA region in order to cordata A6- and A5-elongases (comprising nucleotides 2310 act as DNA spacers to insulate transgenic expression cas 4523 and 17825-19967 of SEQID NO:1, respectively). The settes. The pP3416 vector prior to insertion of the GA7 specific regions of the T-DNA (Orientation: right to left bor region contained only the plant selectable marker cassette der sequences) region of the binary vectorp.JP3416-GA7 with 25 between the borders. respect to SEQID NO:1 are as follows: The genetic construct pP3404 was made by sequential Nucleotides 1-163: Right border; 480-226, Agrobacterium restriction enzyme-based insertions in which gene cassettes tumefaciens nopaline synthase terminator (TER NOS); were added to the binary vector, plP3367, which comprised 1883-489, Micromonas pusilla A6-desaturase: 2309-1952, genes for production of SDA in seeds. This construct con Brassica napus truncated napin promoter (PRO FP1); 23.10 30 tained genes encoding the L. kluvveri A12-desaturase and P 3243, Arabidopsis thaliana FAE1 promoter (PRO FAE 1); pastoris (D3-desaturase, both expressed by the B. napus trun 33 12-4181, Pyramimonas cordata A6-elongase: 4190-4523, cated napin promoter (FP1), and the M. pusilla A6-desaturase Glycine max lectin terminator (TER Lectin); 4524-4881, expressed by the A. thaliana FAE1 promoter (FIG. 4). First, PRO FP1: 4950-6230: Pavlova Salina A5-desaturase; 6231 the A. thaliana FAD2 intron was flanked by EcoRI sites and 6485: TER NOS: 7653-6486, Nicotiana tabacum Rb7 35 cloned into the pP3367 Mfel site to generate plP3395. A matrix attachment region (MAR): 8387-7654, Linum usitatis fragment containing the P cordata A6- and A5-elongase cas simum conlinin1 terminator (TER Cnl1);9638-8388, Pichia settes driven by the FAE1 and FP1 promoters, respectively, pastoris (D3-desaturase: 10156-9707, Linum usitatissimum was cloned into the Kas.I site of plP3395 to generatep)P3398. conlinin1 promoter (PRO Cnl1); 10157-12189, Linum usi plP3399 was then generated by replacing the RK2 origin of tatissimum conlinin1 promoter: 12258-13604, Pavlova 40 replication in plP3398 with a RiA4 origin of replication. The Salina A4-desaturase: 13605-14142, Linum usitatissimum final binary vector, plP3404, was generated by cloning a conlinin2 terminator; 14143-14592, PRO Cnl1: 14661 Sbfl-flanked fragment containing the P. salina A5- and 15914, Lachancea kluyveri A12-desaturase; 15915-16648, A4-desaturase cassettes driven by the FP1 and FAE1 promot TER Cnl1; 17816-16649, MAR; 17825-18758, PRO FAE1; ers, respectively, into the Sbfl site of plP3399. 18827-19633, Pyramimonas cordata A5-elongase; 19634 45 A. Thaliana Transformation and Analysis of Fatty Acid Com 19967, TER Lectin: 19990-20527, Cauliflower mosaic virus position 35S promoter with duplicated enhancer region: 20537 The chimeric vectors were introduced into A. tumefaciens 21088, Streptomyces viridochromogenes phosphinothricin strain AGL1 and cells from cultures of the transformed Agro N-acetyltransferase: 21097-21349, TER NOS: 21367 bacterium used to treat A. thaliana (ecotypes Columbia and a 21527, Left border. 50 fad2 mutant) plants using the floral dip method for transfor The seven coding regions in the constructs were each under mation (Clough and Bent, 1998). After maturation, the T the control of a seed specific promoter three different pro seeds from the treated plants were harvested and plated onto moters were used, namely the truncated Brassica napus napin MS plates containing PPT for selection of plants containing promoter (pBnFP1), the Arabidopsis thaliana FAE1 pro the BAR selectable marker gene. Surviving, healthy T. seed moter (pAtFAE 1) and the Linum usitatissimum conlinin 1 55 lings were transferred to soil. After growth of the plants to promoter (pLuCnl1). The seven fatty acid biosynthesis genes maturity and allowing for self-fertilisation, T. seeds from together coded for an entire DHA synthesis pathway that was these plants were harvested and the fatty acid composition of designed to convert 18:1 (oleic acid) through to 22:6'7' their seed lipid analysed by GC analysis as described in 13,16, 19 (DHA). Both binary vectors contained a BAR plant Example 1. selectable marker coding region operably linked to a Cauli 60 The data for the DHA level in the seed lipids are shown in flower Mosaic Virus (CaMV) 35S promoter with duplicated FIG. 5 (lanes labelled T.) for 13 transformants using enhancer region and A. tumefaciens nos3' polyadenylation plP3416-GA7 into the Columbia genetic background, and for region-transcription terminator. The plant selectable marker six transformants using the Jad2 mutant. The pP3416-GA7 was situated adjacent to the left border of the T-DNA region, construct resulted in the production of slightly higher levels therefore distally located on the T-DNA with respect to the 65 of DHA, as a percentage of total fatty acid content, on average orientation of T-DNA transfer into the plant cells. This than the pP3404 construct. Table 4 shows the fatty acid increased the likelihood that partial transfer of the T-DNA, composition of total seed lipid from the T lines with the US 8,946,460 B2 75 76 highest DHA levels. The calculated conversion efficiencies fad2 mutant background, were plated onto MS media con for each enzymatic step in the production of DHA from oleic taining PPT for selection of transgenic seedlings in vitro. acid in the same seeds are shown in Table 5. Conversion Twenty PPT-resistant seedlings for each line were transferred efficiencies were calculated as (% productsx100)/(% remain to soil and grown to maturity after self-fertilisation. These ing Substrate+% products), thereby expressed as a percent plants were highly likely to be homozygous for the selectable age. marker gene, and therefore for at least one T-DNA insertion in The highest observed level of DHA produced in the the genome of the plants. T seed from these plants were plP3416-GA7 T transformed lines was 6.2%, additionally harvested and analysed for fatty acid composition in their with 0.5% EPA and 0.2% DPA (line #14). These T, seeds seedoil by GC. The data are shown in Table 7. This analysis were still segregating for the transgene i.e. were not yet uni 10 revealed that the pP3416-GA7 construct generated higher formly homozygous. Compiled data from the total seed lipid levels of the co3 LC-PUFA DHA in T. seeds of the homozy profiles from independent transgenic seed (Table 4) are gous plants than in the segregating T. Seed. Up to about 13.9% shown in Table 6. The level of co3 fatty acids produced as a DHA was observed in the T. p.JP3416-GA7 transformed line result of the transgenes in these seeds (total new co3 fatty designated 22.2 in the Columbia background, increased from acids, excluding the level of ALA which was produced 15 about 5.5% in the hemizygous T. seed, with a sum level of endogenously in the Columbia background) was 10.7% while about 24.3% of new co3 fatty acids as a percentage of the total the level of co6 fatty acids (total new (O6 fatty acids but fatty acids in the seed lipid content. New Co6 fatty acids were excluding 18:2''') was 1.5%. This represents an extremely at a level of 1.1% of total fatty acids, representing a very favourable ration of new co3 fatty acids:new co06 fatty acids, favourable ratio of new co3 fatty acids:new ()6 fatty acids, namely 7.3:1. namely about 22:1. Similarly, transformants in the fad2 T. seeds of selected lines transformed with pP3416-GA7, mutant background yielded 20.6% as a sum of new co3 fatty namely for lines designated 7, 10, 14, 22 and 34 in the Colum acids, including 11.5% DHA, as a percentage of the total fatty bia background and for lines designated 18, 21 and 25 in the acids in the seed lipid content. TABLE 4 Fatty acid composition of total seed lipid from independent transgenic T2 Arabidopsis seeds with DHA levels at the higher end of the observed range. plP3404 Col #1 plP3404 FAD2 #31 GA7 Col. #7 GA7 Col #34 GA7 Col #2 GA7 Col #10

16:O 9.6 7.8 8.7 8.2 8.7 8.6 18:0 2.9 3.9 3.7 3.9 3.6 3.3 18:1d 11 2.2 1.8 2.O 1.9 2.O 2.3 20:0 1.6 2.3 2.0 2.0 2.1 1.6 20:1d 13 2.2 1.8 1.6 1.5 1.7 1.6 20:1d9 d11 13.0 15.9 16.1 16.1 16.3 1S.O 22:1d 13 1.1 1.2 1.1 1.1 1.3 1.O Other 1.9 1.5 1.5 1.4 1.5 1.3 minor 18:1d9 10.8 14.0 10.6 10.6 10.1 11.1 18:26 28.9 28.3 16.4 16.1 18.2 13.7 18:303 16.6 14.9 29.6 29.6 27.5 32.4 18:36 0.7 O.S O.1 O.1 O.1 O.1 20:26 1.6 1.5 1.1 1.2 1.3 1.O 20:36 O.O O.O O.O O.O O.O O.O 20:406 O.O O.O O.O O.O O.O O.O 22:406 1.6 O6 O.3 O.3 O.3 0.4 22:56 O.1 O.1 O.O O.O O.O O.O 18:403 1.O O.S 1.2 1.1 1.1 1.5 20:303 O.O O.O O.O O6 O.O O.O 20:40)3 0.4 O6 O.6 0.7 O.S O.8 20:53 O.2 O.2 O.3 O.3 O.3 O.3 22:53 O.O O.2 O.2 O.2 O.2 O.2 22:63 3.6 2.4 3.0 3.1 3.3 3.9

GA7. Col #22 GA7 Col #14 GA7 FAD2 ii.25 GA7 FAD2 ii.21 GA7 FAD2 #18

16:O 8.3 9.7 7.2 8.5 7.5 18:0 3.4 3.6 3.2 3.9 3.0 18:1d 11 2.3 2.7 1.9 2.0 1.8 20:O 1.6 1.8 1.6 2.2 1.5 20:1d 13 1.5 1.7 1.5 1.7 1.4 20:1d9 d11 13.9 13.5 18.3 15.9 17.0 22:1d 13 1.O 1.O 1.O 1.3 1.2 Other 1.6 1.7 1.6 1.4 1.6 minor 18:1d9 1O.O 7.7 26.0 8.2 20.9 18:26 13.7 11.4 6.6 16.6 4.3 18:303 3O4 32.8 21.9 27.7 30.1 18:36 O.2 O.1 O.1 O.2 O.1 20:26 1.O 1.O 0.4 1.4 0.4 20:36 O.O O.O O.O O.O O.O 20:406 O.O O.O O.O O.O O.O 22:406 O.S 0.4 O.S 0.4 0.4 22:56 O.O O.O O.O O.O O.O US 8,946,460 B2 77 78 TABLE 4-continued Fatty acid composition of total seed lipid from independent transgenic T2 Arabidopsis seeds with DHA levels at the higher end of the observed range. 18:403 2.7 2.7 1.9 1.8 1.7 20:303 O.6 0.7 O.O O.8 O.6 20:403 O.8 0.4 1.O O.8 O.8 20:53 0.7 O.S O.6 0.4 O.S 22:53 O.2 O.2 O.3 O.3 O.3 22:63 5.5 6.2 4.3 4.4 4.8 Col refers to the Columbia ecotype and FAD2 to the fad2 mutant ecotype. *GA7 refers to transformation with the T-DNA of the plP3416-GA7 vector, plP3404 with the T-DNA of the plP3404 vector. 20:1n-9 and 20:1n-11 fatty acids were not resolved in the GC analysis. “Other minor” fatty acids include 14:0, 16:1n7, 16:1n9, 16:1n 13t, 16:2n6, 16:3n3, i18:0, 18:1n5, 20:1n5, 22:0, 22:1 n7, 22:1n 11 in 13, 24:0, 24:1n9.

TABLE 5 Conversion efficiencies of the individual enzymatic steps for production of DHA from oleic acid, observed in total seed lipid from independent transgenic Seed as for Table 4. plP3404 Col #1 plP3404 FAD2 #31 GA7 Col. #7 GA7 Col #34 GA7 Col #2 GA7 Col #10 d12-des 69.6% 62.5% 66.4% 66.6% 66.7% 67.5% d15-des 39.8% 37.8% 66.1% 66.8% 62.3% 72.1% Omega-6 d6-des 4.5% 2.5% O.7% O.7% O.7% O.9% (d.9-elo) 3.1% 3.1% 2.2% 2.3% 2.4% 1.8% d6-elo 71.4% 56.9% 83.3% 83.4% 83.0% 84.7% d5-des 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% d5-elo 100.0% 97.8% 100.0% 100.0% 100.0% 100.0% d4-des 6.2% 13.0% O.0% O.0% O.0% O.0% Omega-3 d6-des 23.9% 21.0% 15.2% 15.4% 16.4% 17.1% (d.9-elo) O.0% O.0% O.0% 1.8% O.0% O.0% d6-elo 80.6% 86.6% 77.79 79.6% 79.4% 77.59% d5-des 93.7% 92.1% 91.7% 91.4% 91.5% 92.6% d5-elo 93.7% 92.1% 91.7% 91.4% 91.5% 92.6% d4-des 100.0% 90.6% 94.8% 94.0% 95.3% 94.4%

GA7. Col. ii.22 GA7 Col #14 GA7 FAD2 ii.25 GA7 FAD2 ii.21 GA7 FAD2 #18

d12-des 70.2% 72.7% 45.9% 69.5% 53.7% d15-des 72.7% 77.29% 79.7% 66.0% 88.1% Omega-6 dé-des 1.3% 1.0% 1.6% 1.1% 1.1% (d9-elo) 1.8% 1.7% 1.2% 2.7% O.9% d6-elo 70.3% 74.5% 85.5% 66.1% 88.0% d5-des 100.0% 100.0% 100.0% 100.0% 100.0% d5-elo 100.0% 100.0% 100.0% 100.0% 100.0% d4-des O.0% O.0% O.0% O.0% O.0% Omega-3 d6-des 24.7% 23.6% 27.1% 21.9% 21.0% (d9-elo) 2.0% 2.2% O.0% 2.6% 2.1% d6-elo 72.7% 73.0% 76.79% 77.4% 79.2% d5-des 89.6% 92.4% 88.0% 91.8% 91.0% d5-elo 89.6% 92.4% 88.0% 91.8% 91.0% d4-des 95.8% 96.9% 93.1% 92.9% 94.2%

TABLE 6 Compiled data from the total seed lipid profiles from independent transgenic seed shown in Table 2. Calculations do not include the minor fatty acids in Table 4. Parameter plP3404 Col #1 plP3404 FAD2 #31 GA7 Col. #7 GA7 Col #34 GA7 Col #2 GA7 Col #10 total wiš (% of total FA) 21.8 18.8 34.9 35.6 32.9 39.1 total w8 (% of total FA) 32.9 31.0 17.9 17.7 19.9 15.2 w3/wó ratio O.66 O.61 1.95 2.01 1.65 2.57 w6fw3 ratio 1.51 1.65 O.S1 OSO O.6O O.39 total novel wiš (% of total FA) 5.2 3.9 5.3 6.O 5.4 6.7 total novel w8 (% of total FA) 4.0 2.7 1.5 1.6 1.7 1.5 novel wif w8 ratio 1.30 1.44 3.53 3.75 3.18 4.47 novel w8/w3 ratio O.77 O.69 O.28 0.27 O.31 O.22 OA to EPA efficiency 4.8% 3.5% 4.3% 4.4% 4.7% 5.4% OA to DHA efficiency 4.5% 3.0% 3.7% 3.8% 4.1% 4.8% LA to EPA efficiency 6.9% 5.6% 6.6% 6.8% 7.2% 8.1% US 8,946,460 B2 79 80 TABLE 6-continued Compiled data from the total seed lipid profiles from independent transgenic seed shown in Table 2. Calculations do not include the minor fatty acids in Table 4. LA to DHA efficiency 6.6% 4.8% 5.7% 5.8% 6.3% 7.2% ALA to EPA efficiency 17.4% 14.9% 10.0% 10.1% 11.6% 11.3% ALA to DHA efficiency 16.5% 12.8% 8.6% 8.7% 10.0% 10.0% total Saturates 14.1 14.O 14.4 14.1 14.4 13.5 total monounsaturates 29.3 34.7 31.4 31.2 31.4 31.0 total polyunsaturates 54.7 49.8 52.8 53.3 52.8 S4.3 total C20 17.4 2O 19.7 20.4 20.1 18.7 total C22 6.4 4.5 4.6 4.7 S.1 5.5 C20C22 ratio 2.72 4.44 4.28 4.34 3.94 340

Parameter GA7 Col. #22 GA7 Col #14 GA7 FAD2 #25 GA7 FAD2 #21 GA7 FAD2 #18 total wiš (% of total FA) 40.9 43.5 3O.O 36.2 38.8 total w8 (% of total FA) 15.4 12.9 7.6 18.6 5.2 w3/w6 ratio 2.66 3.37 3.95 1.95 7.46 w6.w3 ratio O.38 O.30 O.25 O.S1 O.13 total novel wiš (% of total FA) 1O.S 10.7 8.1 8.5 8.7 total novel w8 (% of total FA) 1.7 1.5 1.O 2.O O.9 novel wif w8 ratio 6.18 7.13 8.10 4.25 9.67 novel w8w3 ratio O16 O.14 O.12 O.24 O.10 OA to EPA efficiency 7.9% 8.8% 6.3% 6.4% 6.7% OA to DHA efficiency 6.8% 7.9% 5.2% 5.5% 5.8% LA to EPA efficiency 11.4% 12.2% 13.8% 9.3% 12.7% LA to DHA efficiency 9.8% 11.0% 11.4% 8.0% 10.9% ALA to EPA efficiency 15.6% 15.9% 17.3% 14.1% 14.4% ALA to DHA efficiency 13.4% 14.3% 14.3% 12.2% 12.4% total Saturates 13.3 15.1 12.O 14.6 12.0 total monounsaturates 28.7 26.6 48.7 29.1 423 total polyunsaturates 56.3 56.4 37.6 54.8 44.0 total C20 18.5 17.8 21.8 21 20.7 total C22 7.2 7.8 6.1 6.4 6.7 C20C22 ratio 2.57 2.28 3.57 3.28 3.09

TABLE 7 Fatty acid composition of total seed lipid from independent transgenic T and TArabidopsis progeny seeds obtained from plant lines as in Table 3. The error shown in the T4 generation denotes the SD of n = 10. GA7 Col. 7.2 GA7 Col. 34.2 GA7 Col. 10.13 GA7 Col. 22.2 GA7 Col. 14.19

16:O 9.8 9.0 9.5 11.2 10.4 18:0 4.0 3.8 4.2 3.4 3.5 18:17 2.O 1.9 2.2 2.9 2.5 20:O 2.2 1.9 1.7 1.4 2.3 20:1d 13 1.4 1.3 1.2 1.6 2.5 20:1d911 13.6 14.7 12.4 9.S. 13.0 22:1d 13 1.2 1.2 O.8 O6 1.6 Other 1.8 1.5 1.5 2.1 2.6 minor 18:1d9 5.5 6.7 6.8 4.6 6.9 18:26 7.5 7.9 7.4 S.6 14.8 18:303 33.7 33.7 36.1 31.5 26.1 18:36 O.2 O.2 O.2 0.4 O.1 20:26 1.O 1.O 0.7 0.7 1.4 20:36 O O O O O 20:406 O O O O O 22:406 O O O O O 22:56 O O O O O 18:43 3.1 2.6 3.0 5.3 3.3 20:303 1.4 1.3 1.2 1.3 1.2 20:43 0.7 O.6 O.6 O.9 O.2 20:53 O.9 O.9 0.7 1.9 O.8 22:53 0.7 O.6 O.6 1.O 0.4 22:63 9.5 9.2 9.4 13.9 6.6 GA7 FAD2- GA7 FAD2- GA7 FAD2- T. Col 22.2 T. Col 22.2 25.10 21.2 1814 (meant SD) best line

16:O 8.1 10.7 7.7 10.6 - 0.9 12.2 18:0 3.5 3.8 3.3 3.5 + 0.4 3.6 18:17 1.7 2.2 1.6 2.30.2 2.6 20:O 1.8 2.0 1.9 1.90.3 2.0 20:1d 13 1.2 1.4 1.3 1.6 0.2 1.9 US 8,946,460 B2 81 82 TABLE 7-continued Fatty acid composition of total seed lipid from independent transgenic T and TArabidopsis progeny seeds obtained from plant lines as in Table 3. The error shown in the T4 generation denotes the SD of n = 10. 20:1d911 15.7 12.4 18.4 11.7 - 1.7 9.5 22:1d 13 1.O 1.1 1.5 O.90.1 O.8 Other 1.7 1.9 1.6 1.90.1 2.3 minor 18:1d9 11.3 4.2 11.5 4..6+ 1.0 3.3 18:26 5.8 8.9 S.6 5.3 0.9 4.3 18:303 28.3 28.9 30.8 31.01.1 29.5 18:36 O.3 O.6 O.1 O4 0.1 0.4 20:26 O6 1.2 O.6 O.90.1 O.9 20:36 O O O 20:406 O O O 22:406 O O O O.1 O.O O.1 22:56 O O O 18:403 3.7 5.2 2.6 48 0.9 5.5 20:303 1.1 1.3 1.3 1.5 + 0.2 1.7 20:403 1.7 O.9 O.9 O.80.2 O.8 20:53 1.2 1.O O.8 1.5 + 0.3 1.8 22:53 O.8 O.6 O.S 1.1 - 0.2 1.5 22:63 10.3 11.5 7.9 13.3 1.6 15.1

Enzymatic conversion efficiencies for each enzyme step in GLA was presentata level of only 0.4% and was the only new the pathway for production of DHA from oleic acid are shown ()6 product aside from 20:2a)6 detected in the T seeds with in Table 8 for the T seeds with the higher DHA levels. The 25 the highest DHA content. Compiled data from the total seed A 12-desaturase conversion efficiency in seeds of line 22.2 lipid profiles from independent transgenic seed (Table 7) are was 81.6% and the co3-desaturase efficiency was 89.1%, both shown in Table 9. This data for the line with the greatest DHA of them remarkably high and indicating that these fungal level included a total (O6 FA (including LA) to total (O3 FA (yeast) enzymes were able to function well in developing (including ALA) ratio of 0.10. The new ()6 FA (excluding seeds. The activities of the other exogenous enzymes in the 30 LA) to new co3 FA (excluding ALA) ratio in the lipid of this DHA pathway were similarly high for co3 substrates with the line was 0.05. Total polyunsaturated fatty acid levels were A6-desaturase acting at 42.2% efficiency, A6-elongase at more than 50% in these lines, and greater than 60% in at least 76.8%, A5-desaturase at 95.0%. A5-elongase at 88.7% and 4 of the lines. Overall conversion efficiencies were calculated A4-desaturase at 93.3% efficiency. The A6-desaturase activ 35 to be: OA to EPA=21.8%, OA to DHA=18.0%, LA to ity on the co6 substrate LA was much lower, with the A6-de EPA=26.9%, LA to DHA=22.2%, ALA to EPA=30.1%, ALA saturase acting at only 0.7% conversion efficiency on LA. to DHA=24.9%. TABLE 8 Conversion efficiencies of the individual enzymatic steps for the production of DHA from oleic acid, observed in total seed lipid from transgenic T. Arabidopsis seeds as in Table 7. GA7 Col. 7.2 GA7 Col. 34.2 GA7 Col. 10.13 GA7 Col. 22.2 GA7 Col. 14.19

d12-des 75.4% 73.1% 75.70% 81.6% 73.4% d15-des 85.3% 84.4% 86.2% 89.1% 70.2% Omega-6 d6-des O.3% O.3% O.3% O.7% O.3% (d.9-elo) 1.7% 1.7% 1.2% 1.2% 2.6% d6-elo d5-des d5-elo d4-des Omega-3 d6-des 30.7% 29.3% 28.2% 42.2% 30.2% (d.9-elo) 2.7% 2.7% 2.3% 2.4% 3.0% d6-elo 79.0% 81.1% 79.0% 76.8% 70.9% d5-des 94.0% 94.6% 94.5% 95.0% 97.9% d5-elo 91.9% 91.7% 93.6% 88.7% 89.5% d4-des 93.2% 93.7% 94.4% 93.3% 93.7%

GAT. FAD2- GA7 FAD2- T. Col 22.2 TA Col 22.2 25.10 GA7 FAD2-21.2 18.14 (mean) bestline

d12-des 66.6% 78.59% 63.1% 67.6% 82.7% d15-des 87.59% 82.2% 87.6% 81.0% 90.9% Omega-6 dé-des O.6% 1.0% O.2% 1.3% O.7% (d9-elo) 1.1% 2.0% 1.3% 1.6% 1.5% d6-elo d5-des d5-elo d4-des US 8,946,460 B2 83 84 TABLE 8-continued Conversion efficiencies of the individual enzymatic steps for the production of DHA from oleic acid, observed in total seed lipid from transgenic T. Arabidopsis seeds as in Table 7. Omega-3 d6-des 38.5% 40.0% 29.2% 41.0% 45.7% (d9-elo) 2.3% 2.7% 2.9% 2.8% 3.1% d6-elo 79.2% 73.2% 79.1% 77.59% 77.70% d5-des 87.8% 93.3% 91.1% 95.0% 95.8% d5-elo 89.9% 92.2% 91.6% 90.8% 90.2% d4-des 92.5% 95.0% 93.9% 92.2% 90.9%

TABLE 9 Compiled data from the total seed lipid profiles from independent transgenic seed shown in Table 5. Calculations do not include the minor fatty acids in Table 7. Parameter GA7-Col. 7.2 GA7-Col. 34.2 GA7-Col 10.13 GA7-Col. 22.2 GA7-Col. 14.19 total wiš (% of total FA) SO.O 48.9 51.6 55.8 38.6 total w8 (% of total FA) 8.7 9.1 8.3 6.7 6.3 w3/wó ratio 5.75 5.37 6.22 8.33 2.37 w6fw3 ratio O.17 O.19 O16 O.12 O.42 total novel wiš (% of total FA) 16.3 15.2 15.5 24.3 2.5 total novel w8 (% of total FA) 1.2 1.2 O.9 1.1 1.5 novel wif w8 ratio 13.58 12.67 17.22 22.09 8.33 novel w8/w3 ratio O.O7 O.08 O.O6 O.OS O.12 OA to EPA efficiency 14.1% 13.3% 13.4% 21.8% O.2% OA to DHA efficiency 12.0% 11.4% 11.8% 18.0% 8.6% LA to EPA efficiency 18.9% 18.4% 17.9% 26.9% 4.2% LA to DHA efficiency 16.2% 15.9% 15.7% 22.2% 2.0% ALA to EPA efficiency 22.2% 21.9% 20.7% 30.1% 20.2% ALA to DHA efficiency 19.0% 18.8% 18.2% 24.9% 7.1% otal Saturates 16.0 14.7 15.4 16.0 6.2 otal monounsaturates 23.7 25.8 23.4 19.2 26.5 otal polyunsaturates 58.7 58.0 59.9 62.5 S4.9 otal C20 19 19.8 16.8 15.9 9.1 otal C22 11.4 11 10.8 15.5 8.6 C20C22 ratio 1.67 18O 1.56 1.03 2.22 T. Col 22.2 TA Col 22.2 Parameter GA7-FAD2-25.10 GA7-FAD2-21.2 GA7-FAD2-18.14 (mean + SD) bestline otal wiš (% of total FA) 47.1 49.4 44.8 S4O 55.9 otal w8 (% of total FA) 6.7 10.7 6.3 6.7 5.7 w3/wó ratio 7.03 4.62 7.11 8.06 9.81 w6fw3 ratio O.14 O.22 O.14 O.12 O.10 otal novel wiš (% of total FA) 18.8 2O.S 14.O 23.0 26.4 otal novel w8 (% of total FA) O.9 1.8 O.7 1.4 1.4 novel wif w8 ratio 20.89 11.39 2O.OO 16.43 18.86 novel w8/w3 ratio O.OS O.09 O.OS O.O6 O.OS OA to EPA efficiency 15.0% 16.8% 11.2% 20.4% 24.5% OA to DHA efficiency 12.6% 14.8% 9.6% 17.1% 20.1% LA to EPA efficiency 22.9% 21.8% 18.0% 26.2% 29.9% LA to DHA efficiency 19.1% 19.1% 15.5% 21.9% 24.5% ALA to EPA efficiency 26.1% 26.5% 20.5% 29.4% 32.9% ALA to DHA efficiency 21.9% 23.3% 17.6% 24.6% 27.0% total Saturates 13.4 16.5 12.9 16.O 17.8 total monounsaturates 30.9 21.3 34.3 21.1 18.1 total polyunsaturates 53.8 60.1 51.1 60.7 61.6 total C20 21.5 18.2 23.3 18 16.6 total C22 12.1 13.2 9.9 15.4 17.5 C20C22 ratio 1.78 1.38 2.35 1.17 O.9S

T. seeds from the pP3416-GA7 line 22.2 in the Columbia The total (O6 FA (including LA) to co3 FA (including ALA) background, which were progeny from T line 22, were sown ratio in the line with the highest DHA level was 0.102. The directly to Soil and the fatty acid composition of mature seed new ()6 FA (excluding LA) to new co3 FA (excluding ALA) 60 ratio in the line with the highest DHA level was 0.053. The from the resultant T. plants analysed by GC. The average level of total saturated fatty acids was about 17.8% and the DHA level of these seeds was 13.3%+1.6 (n=10) as a percent level of monounsaturated fatty acids was about 18.1%. The age of total fatty acids in the seed lipid. As shown in Table 6 level of total (O6-fatty acids was about 5.7% and the level of (right hand column), the line with the highest level of DHA ()3-fatty acids was about 55.9%. Overall conversion efficien contained 15.1% DHA in the total fatty acids of the seed lipid. 65 cies were calculated to be: OA to EPA=24.5%, OA to The enzymatic conversion efficiencies are shown in Table 8 DHA=20.1%, LA to EPA=29.9%, LA to DHA=24.5%, ALA for each step in the production of DHA from oleic acid. to EPA 32.9%, ALA to DHA=27.0%. Total omega-3 fatty US 8,946,460 B2 85 86 acids were found to accumulate to 55.9% of total fatty acids TABLE 10-continued whereas omega-6 fatty acids were 5.7% of the total profile. Proportion and amount of DHA in GA7 Southern blot hybridisation analysis was performed. The transformed Arabidopsis seeds. results showed that the high-accumulating DHA lines were either single- or double-copy for the T-DNA from the 5 DHA 9. es DHA t plP3416-GA7 construct with the exception of transgenic line (% list ( 5. GE) Columbia#22, which had three T-DNA insertions in the genome of the Arabidopsis plant. The T5 generation seed was A. 8. 33 3. also analysed and found to have up to 13.6% DHA in the total to seed lipids. The GA7 construct was found to be stable across multiple generations in terms of DHA production capability. Example 3 Determination of Oil Content in Transgenic A. Thaliana DHA Lines Stable Expression of a Transgenic DHA Pathway in The oil content of transgenic A. thaliana seeds with various 15 Camelina sativa Seeds levels of DHA was determined by GC as described in Example 1. The data are shown in FIG. 6, graphing the oil The binary vector plP3416-GA7 as described above was content (% oil by weight of seed) against the DHA content (as introduced into A. tumefaciens Strain AGL1 and cells from a a percentage of total fatty acids). Up to 26.5 mg of DHA per culture of the transformed Agrobacterium used to treat C. gram of seed was observed (Table 10). The oil content of the 20 satiya flowering plants using a floral dip method for transfor transgenic Arabidopsis seeds was found to be negatively cor- E. E.d sts 2. it. E. and it. f lated with DHA content. The amount of DHA per weight of eplants, the I seeds from the treated plants were harvested, E. was greater in the transformed seeds with a DHA level of RESEN"E"EN sE. about 9% relative to the seeds with about 14% DHA. Whether as transgenic for, and expressing, the bar selectable marker gene this would be true for seeds other than Arabidopsis has not present on the T-DNA of plP3416-GA7. Surviving T plants been determined. which were tolerant to the herbicide were grown to maturity after allowing them to self-fertilise, and the resultant T. seed TABLE 10 harvested. Five transgenic plants were obtained, only three of which contained the entire T-DNA. Proportion and amount of DHA in GA7- 30 Lipid was extracted from a pool of approximately twenty - transioned drabidopsis seeds. seeds from each of the three plants that contained the entire Oil content DHA content T-DNA. Two of the pooled samples contained very low, DHA content (% oil per per weight barely detectable levels of DHA, but the third pool contained (% of TFA) g seeds) (mg/g seed) about 4.7% DHA (Table 12). Therefore, lipid was extracted 35 from 10 individual T seeds from this plant and the fatty acid A. iii. 3. composition analysed by GC. The fatty acid composition data GA7 col 22.2-3 14.O 15.92 21.2 of the individual seeds for this transformed line is also shown GA7 col 10.15-1 8.7 30.23 25.06 in Table 11. Compiled data from the total seed lipid profiles (Table 11) are shown in Table 12. TABLE 11 Fatty acid composition of total seed lipids from transgenic T2 Camelina Saiiva seeds transformed with the T-DNA from pP3416-GA7. The fatty acid composition is shown for a pooled seed batch (FD5.46) and for 10 single seeds ranked (left to right) from highest to lowest DHA.

FDS.46 Fatty acid pooled # 2 #4 # 8 # 7 # 9 # 1 # 3 # 5 # 6 # 10 14:O O O2 O2 O.1 O2 O2 O2 O2 O.1 O2 (0.2 16:O 11.6 12.1 12.3 121 13.2 12.3 128 11.9 11.4 11.5 11.7 16:1 O2 O.O. O.1 O.1 O.O. O.2 O.O O2 O2 O2 O2 16:3 O.3 O O.O O.O. O.O. O.O. O.O. O.O. O.O. O.O. O.O 18:0 3.7 33 3.2 3.2 3.0 3.1 3.2 3.3 3.1 3.2 3.2 18:1 10.8 8.0 8.O 8.6 8.5 9.4 11.0 102 8.3 94 8.6 18:1d 11 1.7 13 1.4 14 1.7 14 15 1.3 1.3 13 1.3 18:2 24.7 18.2 19.S. 19.2 18.5 20.1 23.8 32.2 30.3 29.8 31.6 18:303 27.4 26.7 26.6 27.3 28.9 28.2 27.4 28.3 29.2 29.S. 28.2 18:36 O.2 14 O.3 O3 O.4 O2 (0.5 O.O. O.S 04 0.6 20:O 1.6 1.4 1.3 1.4 1.2 1.4 1.4 1.8 2.1 1.9 2.0 18:403 2.2 6.8 6.4 5.7 7.2 5.7 4.1 O.O. O.O. O.O. O.O 20:1d 11 5.3 44 4.6 4.8 33 41 3.5 4.4 6.1 5.8 5.5 20:1 iso O.4 O.3 0.3 0.3 0.3 0.3 O.O. O.S. O.6 OS. O.S 20:26 O.8 O.8 O.9 O.8 O.6 0.8 O.7 13 1.5 14 14 20:303 O.6 0.8 O.8 O.8 O.7 O.8 O.7 O.6 0.7 O.7 O.6 22:O O.4 O.S. O.S. O.S. O.4 O.5 OS 06 0.6 06 0.6 20:403 O2 O.3 O.3 O3 O.4 O.4 OS O.O. O.O. O.O. O.O 22:1 1.1 1.1 12 11 O.S. O.9 O.8 1.6 2.2 19 2.0 20:53 0.7 13 1.6 15 1.6 11 17 O.O. O.O. O.O. O.1 22:2006 O.1 O.O O.O. O.O. O.O. O.O. O.O O2 O.3 O2 (0.2 22:406 - 22:303 O3 O2 (0.3 O3 O.O. O.3 O.O. O.4 O.6 OS O.S 24:O O3 O.3 O.3 O3 O.O. O.3 O.O. O.4 O.4 O.4 O.4 US 8,946,460 B2 87 88 TABLE 11-continued Fatty acid composition of total seed lipids from transgenic T2 Camelina Saiva seeds transformed with the T-DNA from plP3416-GA7. The fatty acid composition is shown for a pooled seed batch (FD5.46) and for 10 single seeds ranked (left to right) from highest to lowest DHA.

FDS46 Fatty acid pooled # 2 #4 #8 # 7 # 9 #1 # 3 24:1 O.3 O.4 O.4 O3 O.O. O.3 O.O 22:53 O.3 1.1 1.2 1.1 11 O.9 O.8 22:63 4.7 9.0 8.5 8.3 8.3 7.1 4.9

TABLE 12 Compiled data from the total seed lipid profiles from transgenic seed shown in Table 11. Calculations do not include the minor fatty acids in Table 11. FDS.46 Parameter pooled # 2 ii. 4 # 8 i 7 # 9 # 1 # 3 # 5 # 6 # 10 total wiš (% of total FA) 36.1 46 45.4 45 48. 2 44.2 40.1 28.9 29.9 30.2 28.9 total w8 (% of total FA) 25.8 20.4 20.7 20.3 19. 5 21.1 25 33.7 32.6 31.8 33.8 w3/wó ratio 140 2.25 2.19 2.22 2. 47 2.09 1.60 O.86 0.92 O.95 0.86 w6fw3 ratio O.71 0.44 O46 O.45 O. 40 O.48 O.62 1.17 109 1.OS 1.17 total novel wiš (% of total FA) 8.1 18.5 18 16.9 18. 6 15.2 12 O O O O.1 total novel w8 (% of total FA) 1.1 2.2 1.2 1.1 1 1 1.2 1.5 2.3 2 2.2 novel wif w8 ratio 7.36 841 1S.OO 15.36 18. 60 15.20 1O.OO O.OS novel w8/w3 ratio O.14 O.12 O.O7 O.O7 O. 05 O.O7 O.10 22.00 OA to EPA efficiency 8.2%. 15.6%. 15.5%. 15.1% 15. 196 12.8%. 10.5% 0.0% O.O% 0.0% 0.1% OA to DHA efficiency 6.7%. 12.3%. 11.6%. 11.5%. 11. 4% 10.0% 7.0% 0.0% 0.0% 0.0% 0.0% LA to EPA efficiency 9.2%. 17.2%. 17.1% 16.7%. 16. 296 13.9%. 11.4% 0.0% O.O% 0.0% 0.2% LA to DHA efficiency 7.6%. 13.6%. 12.9%. 12.7%. 12. 3% 10.9% 7.5% 0.0% 0.0% 0.0% 0.0% ALA to EPA efficiency 15.8% 24.8% 24.9%. 24.2%. 22. 8% 20.6%. 18.5% 0.0% O.0% 0.0% 0.3% ALA to DHA efficiency 13.0%. 19.6%. 18.7%. 18.4%. 17. 296 16.1% 12.2% 0.0% O.O% 0.0% 0.0% total Saturates 17.6 17.8 17.8 17.6 18 17.8 18.1 18.2 17.7 17.8 18.1 total monounsaturates 19.8 15.5 16 16.6 14. 3 16.6 16.8 18.7 19.3 19.6 18.6 total polyunsaturates 62.5 66.6 66.4 65.6 67. 7 65.6 65.1 63 63.1 62.S. 63.2 total C20 9.6 9.3 9.8 9.9 8. 1 8.9 8.5 8.6 11 10.3 10.1 total C22 5.4 10.3 10 9.7 9. 4 8.3 5.7 O.6 O.9 0.7 0.7 C20C22 ratio 1.78 O.90 O.98 1.02 O. 86 1.07 1.49 14.33 1222 14.71. 14.43

DHA was present in six of the 10 individual seeds. The four 40 being extracted from the seed using a variety of methods other seeds did not have DHA and were presumed to be null including SOXhlet, acetone and hexane extractions. segregants which did not have the T-DNA, based on hemizy Since the number of independently transformed lines of C. gosity of the T-DNA insertion in the parental plant. Extracted lipid from the single seed with the highest level of DHA had sativa obtained as described above was low, further experi 9.0% DHA while the sum of the percentages for EPA, DPA 45 ments to transform C. sativa with pP3416-GA7 are per and DHA was 11.4%. The sum of the percentages for the new formed. The inventors predict that DHA levels of greater than c)3 fatty acids produced in this seed as a result of the trans 10% as a percentage of total fatty acids in seed oil will be formation (SDA, ETrA, ETA, EPA, DPA, DHA) was 19.3% achieved in further transformed lines, and plants which are whilst the corresponding sum for the new (O6 fatty acids homozygous for the T-DNA to 20% DHA. Twenty C. sativa (GLA, EDA, DGLA, ARA and any ()6 elongation products) 50 GA7 modH events were generated and seed is being analy was 2.2%-only GLA and EDA were detected as new ()6 fatty sed for DHA content. Three GA7 modB events were gener acids. The total ()6 FA (including LA) to ()3 FA (including ated and analysis of the T1 seed from event CMD 17.1 ALA) ratio was found to be 0.44. The new co6 FA (excluding revealed a pooled seed DHA content of 9.8%. The highest LA) to new co3 FA (excluding ALA) ratio in the seed with the single seed DHA value was found to be 13.5%. highest DHA level was 0.12. The level of total saturated fatty 55 acids was about 17.8% and the level of monounsaturated fatty Example 4 acids was about 15.5%. The level of total (O6-fatty acids was about 20.4% and the level of co3-fatty acids was about 46%. Stable Expression of Transgenic DHAPathways in Overall conversion efficiencies were calculated to be: OA to Brassica napus Seeds EPA=15.6%, OA to DHA=12.3%, LA to EPA=17.2%, LA to 60 DHA=13.6%, ALA to EPA=24.8%, ALA to DHA=19.6%. B. Napus Transformation and Analysis of Fatty Acid Com Homozygous seed from this line was obtained in the T4 position Using Single Vector generation. Up to 10.3% DHA was produced in event FD5 The binary vector pP3416-GA7 was used to generate 46-18-110 with an average of 7.3% DHA observed across the transformed Brassica napus plants and seeds from the plants. entire T4 generation. 65 The vectorp)P3416-GA7 as described above was introduced Homozygous seed was planted out across several glass into Agrobacterium tumefaciens Strain AGL1 via Standard houses to generate a total of over 600 individual plants. Oil is electroporation procedures. Cultures of the transgenic Agro US 8,946,460 B2 89 90 bacterium cells were grown overnight at 28° C. in LB about 35% of the total fatty acids, in these seeds which was medium with agitation at 150 rpm. The bacterial cells were not being converted efficiently to SDA or following products collected by centrifugation at 4000 rpm for 5 minutes, washed in the pathway. with Winans AB medium (Winans, 1988) and re-suspended in Fatty acid profile analysis of single B. napus seeds from a 10 mL of Winans AB medium (pH 5.2) and growth continued 5 T event, CT125-2, was performed to better determine the overnight in the presence of kanamycin (50 mg/L), rifampicin amount of DHA produced in transgenic seeds. Seeds were (25 mg/L) and 100 uM acetosyringone. Two hours before found to contain between 0% (null seeds) and 8.5% DHA infection of the Brassica cells, spermidine (120 mg/L) was (Table 13). added and the final density of the bacteria adjusted to an OD 600 nm of 0.3-0.4 with fresh AB media. Freshly isolated 10 Some of the seeds from the plant line CT116 as well as cotyledonary petioles from 8-day old Brassica napus seed other transgenic lines showing DHA production were sown to lings grown on /2 MS (Murashige and Skoog. 1962) or hypo produce progeny plants. RT-PCR was performed on total cotyl segments preconditioned by 3-4 days on MS media with RNA isolated from developing embryos from these plants in order to determine why the GA7 construct performed poorly 1 mg/L thidiaZuron (TDZ) and 0.1 mg/L C.-naphthaleneacetic 15 acid (NAA) were infected with 10 mL Agrobacterium cul for DHA production relative to transgenic A. thaliana and C. tures for 5 minutes. The explants infected with Agrobacte sativa having the same construct, and poorly relative to the rium were then blotted on sterile filter paper to remove the combination of the genes on plP31 15 and pP31 16 (below). excess Agrobacterium and transferred to co-cultivation media RT-PCR was performed on total RNA using a one-step RT (MS media with 1 mg/L TDZ, 0.1 mg/L NAA and 100 uM PCR kit (Invitrogen) and gene-specific primers targeting each acetosyringone) Supplemented with or without different anti transgene. This confirmed that each of the genes in the GA7 oxidants (L-cysteine 50 mg/L and ascorbic 15 mg/L). All the construct was expressed well in the B. napus transformants plates were sealed with parafilm and incubated in the dark at except for the A6-desaturase which was poorly expressed in 23-24°C. for 48 hrs. the majority of transformed seeds. The other genes from this The treated explants were then washed with sterile distilled 25 construct functioned well in both B. napus and A. thaliana water containing 500 mg/L cefotaxime and 50 mg/L timentin seeds, for example the A12- and A115-desaturases which for 10 minutes, rinsed insterile distilled water for 10 minutes, functioned to produce increased levels of LA and ALA in the blotted dry on sterile filter paper, transferred to pre-selection seeds whilst decreasing oleic acid levels. A representative media (MS containing 1 mg/LTDZ, 0.1 mg/L NAA, 20 mg/L RT-PCR gel is shown in FIG. 7 which clearly shows the low adenine sulphate (ADS), 1.5 mg/L. AgNO, 250 mg/L cefo 30 expression of the A6-desaturase relative to the other trans taxime and 50 mg/L timentin) and cultured for five days at 24° genes from pP3416-GA7. C. with a 16 h/8h photoperiod. They were then transferred to Transgenic plants and seed which are homozygous for the selection media (MS containing 1 mg/LTDZ, 0.1 mg/L NAA, transgenes are generated by planting out progeny from the 20 mg/L ADS, 1.5 mg/L. AgNO, 250 mg/L cefotaxime and lines with the highest DHA. 50 mg/L timentin) with 1.5 mg/L glufosinate ammonium as 35 the agent for selection of transformed cells, and cultured for 4 weeks at 24°C. with 16 h/8 h photoperiod with a biweekly TABLE 13 Subculture on to the same media. Explants with green callus Fatty acid composition as a percentage of total fatty acids in were transferred to shoot initiation media (MS containing 1 Seedoil from independent T. Brassica naptis seed mg/L kinetin, 20 mg/L ADS, 1.5 mg/L. AgNO, 250 mg/L 40 transformed with pP3416-GA7, lines CT116-11 and CT-125-2 compared to wild-type (untransformed) control. 22:603 is cefotaxime, 50 mg/L timentin and 1.5 mg/L glufosinate DHA. Data from single CT125-2 B. napus seeds is denoted ammonium) and cultured for another 2-3 weeks. Shoots by SS. emerging from the resistant explants were transferred to shoot CT116- CT125- CT125-2 CT125-2 CT125-2 elongation media (MS media with 0.1 mg/L gibberelic acid, Control 11 2 #2 SS #3 SS #10 SS 20 mg/L ADS, 1.5 mg/L. AgNO, 250 mg/L cefotaxime and 45 1.5 mg/L glufosinate ammonium) and cultured for another 14:O O.1 O.2 O.1 O. O.1 O.1 two weeks. Healthy shoots 2-3 cm long were selected and 16:O 4.3 7.2 5.2 6.5 4.7 7.7 16: O.2 O.S 0.4 O.3 O.3 O.8 transferred to rooting media (/2 MS containing 1 mg/L NAA, 16:3 O.2 O.2 O.2 O. O.2 O.2 20 mg/L ADS, 1.5 mg/L AgNO, and 250 mg/L cefotaxime) 18:0 2.1 2.2 2.4 2.3 2.3 2.8 and cultured for 2-3 weeks. Wellestablished shoots with roots 50 18:1d9 59.1 27.0 38.1 34.0 19.3 14.8 were transferred to pots containing seedling raising mix and 18:1d 11 3.7 6.6 4.2 4.4 4.3 9.6 18:2 19.7 14.1 16.6 13.9 10.2 10.2 grown in a growth cabinet for two weeks and Subsequently 18:303 8.3 35.2 27.7 34. 49.5 37.9 transferred to a glasshouse. Approximately 40 (To) plants 20:O O.6 O.S O6 0.4 O.3 0.7 transformed with the GA7 construct were obtained by this 18:43 O.O O.9 O.3 O.S O.6 2.6 method. 55 20:1d 11 1.2 1.1 1.O 1.O O.8 O6 20:1 is0 O.2 O. O.2 Plants were grown to maturity after being allowed to self 20:26 O.1 O.1 O.1 O. O.1 O.1 fertilise. Seeds obtained from transformed plants were analy 20:303 1.3 0.7 O.8 1.6 O.9 sed for fatty acid composition in their seedoil as described in 22:O O.3 0.4 O.3 O. O.1 0.4 Example L. Data for a transformed line with the highest DHA 20:43 O.1 O.3 0.4 O.6 O.S 22: 60 level are shown in Table 13. DHA levels on average were 20:53 O.1 O.3 significantly lower in the seedoil of the B. napus seeds trans 22:303 O.1 formed with the T-DNA from plP3416-GA7 than in A. 24:O O.2 0.4 O.3 O. O.1 O.3 thaliana seeds (Example 2) or Camelina seeds (Example 3) 24: O.1 O.3 O.1 O. O.2 O.1 22:53 O.1 O.1 O. O.1 O.S transformed with the same construct. The highest level of 22:63 1.52 1.2 1.3 2.7 8.5 DHA in approximately 40 lines was found to be 1.52% with 65 the majority of the transgenic lines having detectable DHA. It was noted that there was a Substantial accumulation of ALA, US 8,946,460 B2 91 92 B. Napus Transformation and Analysis of Fatty Acid Com fatty acid composition in their seedoil. Transformation with position Using Two Vectors the T-DNA from plP31 15 was expected to result in EPA In another experiment in B. napus and as an alternative production from endogenously produced ALA whilst trans format for introducing the transgenes, the binary vectors formation with the T-DNA from plP31 16 was expected to result in increased ALA production from LA. Several plants plP31 15 and plP31 16 as described in WO 2010/057246 were were identified which displayed these phenotypes. The used to separately generate transformed B. napus plants and majority of events displayed a decreased OA/increased LA transformed seeds were obtained from the plants. The T-DNA phenotype due to A12 desaturation with a low level of EPA on pP31 15 comprised chimeric genes encoding the Crepis production. Up to 2.6% EPA was observed in pP31 115 trans palestina A12-desaturase, Micromonas pusilla A6-desatu 10 genic pooled seed. Similarly, the majority of pP31 16 events rase, Pyramimonas cordata A6-elongase and Pavlova Salina were found to have an elevated ALA phenotype due to A15 A5-desaturase and the T-DNA on plP31 16 contained chi desaturase activity. Up to 18.5% ALA was found in pooled meric genes encoding Perilla frutescens A15-desaturase, seed transformed with the T-DNA from plP31 16. Pyramimonas Cordata A5-elongase and Pavlova Salina T plants from the lines with the highest levels of EPA and A4-desaturase. The two T-DNAs, when present together and 15 ALA were crossed and the progeny seed (F1) from 24 recov expressed in developing seeds, formed a 7-gene pathway for ered events analysed for DHA content. DHA was found in 17 producing DHA from endogenously produced oleic acid. of these events with up to 1.9% DHA found in pooled seed These vectors were introduced into Agrobacterium tumefa from these events. Single-seed analysis was performed to ciens strain AGL1 via Standard electroporation procedures determine the range of DHA production the data are shown and the transformed cells used independently to transform B. in Table 14. A large range of DHA levels were observed in the napus using the method as described above to generate stably crossed progeny, probably due to the hemizygous nature of transformed T plants. 29 p.JP31 15 and 19 p.JP31 16 transfor the T-DNAs in the parental plants, so that some seeds did not mants were obtained and these plants were grown to maturity receive both T-DNAs. Up to 6.7% DHA was observed in total and seeds obtained after self-fertilisation were analysed for seed lipid. TABLE 1.4 Fatty acid composition as a percentage of total fatty acids in seedoil from B. naptis F1 single seeds that were from a cross of plants transgenic for the T-DNA from pP31 15 with plants transgenic for the T-DNA from plP3116. B1, B2 and B4 designate events. 0.0 = not detectable by the GC method. B1.1 B1.2 B1.3 B1.4-g B1.5-g B2.1 B2.2 B2.3g B2.4g B2.5g B3.1 B3.2 14:0 O.1 O.1 O.1 O.2 O2 O.1 O.1 O2 O.2 O.1 01 0.1 16:O 6.6 6.4 4.5 12.3 7.9 S.1 S.O. 10.1 8.5 6.8 S.3 7.2 16:1 0.4 O.S O.2 1.O O.6 0.4 O.4 O.6 1.1 O.S. O.S. O.6 16:3 O.1 O.1 O.1 O.1 O.1 01 01 01 O.2 O.1 01 0.2 18:0 2.3 2.6 2.2 1.6 2.9 2.9 3.4 2.2 1.8 2.9 3.4 24 18:1 34.1 39.3 46.9 14.9 20.7 416 46.3 14.4 23.4 383 43.6 32.O 18:1d 11 4.6 5.8 2.7 6.8 6.2 3.8 4.9 5.9 8.7 4.S. S.S. S.1 18:2 33.6 30.7 30.4 29.2 34.4 31.7 27.7 33.2 23.9 33.3 27.9 33.4 18:36 O.2 O.3 O.1 0.4 O4 O2 O2 O.7 O.1 O2 O2 (0.3 18:303 10.3 7.1 7.7 18.7 14.9 8.2 59 14.8. 28.1 6.3 7.3 10.O 20:0 O.6 0.7 O6 O.S O.7 O.8 O.9 O.6 0.4 O.7 O.9 O.7 18:403 O.2 O.1 O.1 O.8 O5 O2 O2 O.8 O.O O2 O2 (0.2 20:1d 11 1.O 1.1 1.1 0.7 O.8 11 11 O.S O.9 1.1 11 O.9 20:1 iso O.1 O.1 O.O O.1 O.1 01 01 01 O.3 O.1 01 0.1 20:26 0.4 O.3 O.2 O.S OS 04 O.3 O.4 O.S O.S. O.3 O.S 20:36 O.O O.O O.O O.O O.O O.O. O.O. O.O O.O O.O O.O. O.O 20:406 O.O O.O O.O O.O O.O O.O. O.O. O.1 O.O O.O O.O. O.O 20:303 1.8 1.6 1.1 2.8 2.1 1.1 1.O 2.7 0.7 14 O.9 16 22:0 O.3 0.4 O.3 O.3 O4 O.4 O.S. O.3 O.3 O4 OS 04 20:40)3 O.3 O.2 O.2 0.4 O4 O1 O.1 O.S O.O O2 O.1 O2 22:1 O.O O.O O.O O.O O.O O.O. O.O. O.O O.O O.O O.O. O.O 20:53 O.O O.O O.O O.1 O1 O.O. O.O O2 O.O O.O O.O. O.O 22:2006 O.O O.O O.O O.O O.O O.O. O.O. O.O O.O O.O O.O. O.O 22:406 O.1 O.2 O.1 O.2 O.2 01 01 0.4 O.2 O2 O.1 O2 24:O O.3 0.4 O.2 O.2 O.3 0.3 0.3 0.3 0.4 O4 O.4 O.3 22:56 O.1 O.2 O.1 O.2 O3 O1 O.1 O.S O.O O2 O.1 O2 24:1 O.2 O.2 O.2 O.3 O3 O2 O2 O.3 O.3 O2 O2 (0.2 22:53 0.7 0.7 O.3 2.1 16 O3 O.4 3.2 O.O OS 04 12 22:63 1.4 1.O O.S 5.5 3.9 O.8 O.7 6.7 O.O 11 08 2.0

TABLE 1.5 Compiled data from the total seed lipid profiles from transgenic seed shown in Table 14. Calculations do not include the minor fatty acids in Table 14. Parameter B1.1 B1.2 B1.3 B1.4-g B1.5-g B2.1 B2.2 B2.3g B2.4g B2.5g B3.1 total wiš (% of total FA) 4.6 3.9 2.3 12.1 9 2.7 2.6 14.8 O.8 3.6 2.6 total w8 (% of total FA) 445 38.5 38.5 48.8 S.O.3 40.S. 34.1 49.4 52.7 4OS 35.7 w3/wó ratio O.10 O.10 O.O6 O.25 O.18 O.O7 O.O8 O.30 O.O2 O.O9 O.O7 US 8,946,460 B2 93 94 TABLE 15-continued Compiled data from the total seed lipid profiles from transgenic seed shown in Table 14. Calculations do not include the minor fatty acids in Table 14. Parameter B1.1 B1.2 B1.3 B1.4-g B1.5-g B2.1 B2.2 B2.3g B2.4g B2.5g B3.1 w6fw3 ratio 9.67 9.87 16.74 4.03 5.59 1S.OO 13.12 3.34 65.88 11.25 13.73 total novel wiš (% of total FA) 2.6 2 1.1 8.9 6.5 1.4 1.4 1.4 O 2 1.5 total novel w8 (% of total FA) 1O.S 7.5 7.9 19.1 15.4 8.4 6.1 5.8 28.3 6.7 7.5 novel wif w8 ratio O.25 0.27 O.14 O.47 O42 O.17 O.23 O.72 O.OO O.30 O.20 novel w8/w3 ratio 4.04 3.75 7.18 2.15 2.37 6.OO 4.36 1.39 3.35 S.OO OA to EPA efficiency 2.5% 2.1% O.9%. 10.1% 6.9% 1.3%. 1.3%. 12.8% 1.9%. 1.4% OA to DHA efficiency 1.7% 1.2% O.6% 7.2% 4.8% O.9% 0.8% 8.5% 1.3%. 1.0% LA to EPA efficiency 4.3% 4.0% 2.0%. 12.6% 9.4% 2.5% 3.0% 15.7% 3.6%. 3.1% LA to DHA efficiency 2.9% 2.4% 1.2% 9.0% 6.6% 1.9%. 1.9%. 10.4% 2.5% 2.1% ALA to EPA efficiency 47.7%. 44.7%. 36.4% 68.1%. 65.9% 44.0% 45.8% 72.1% 47.1% SO.0% ALA to DHA efficiency 31.8%. 26.3%. 22.7% 48.7% 45.9% 32.0% 29.2% 47.9% 32.4%. 33.3% total Saturates 10.2 10.6 7.9 15.1 12.4 9.6 10.2 3.7 11.6 11.3 10.6 total monounsaturates 40.4 47 51.1 23.8 28.7 47.2 S3 21.8 34.7 44.7 S1 total polyunsaturates 49.2 42.5 40.9 61 59.4 43.3 36.8 64.3 53.7 44.2 38.4 total C20 4.2 4 3.2 S.1 4.7 3.6 3.5 S.1 2.8 4 3.4 total C22 2.6 2.5 1.3 8.3 6.4 1.7 1.8 1.1 O.S 2.4 1.9 C20C22 ratio 1.62 1.60 2.46 O.61 0.73 2.12 1.94 O46 S. 60 1.67 1.79

Compiled data from the total lipid profiles (Table 14) are P. cordata A5-elongase cassette. This construct was further shown in Table 15. From the data in Table 15, the total (06 FA modified by exchanging the FP1 promoter driving the M. (including LA) to co3 FA (including ALA) ratio in the seed 25 pusilla A6-desaturase with a conlinin Cnl2 promoter with the highest level of DHA was 3.34. The new co06 FA (pLuCnl2) to yield pP3416-GA7-modB. This modification (excluding LA) to new (03 FA (excluding ALA) ratio was was made in an attempt to increase the A6-desaturase expres 1.39. The level of total saturated fatty acids was about 13.7% sion and thereby enzyme efficiency. It was thought that the and the level of monounsaturated fatty acids was about Cnl2 promoter might yield higher expression of the transgene 21.8%. The level of total (O6-fatty acids was about 46.4% and 30 in B. napus than the truncated napin promoter. pUP3416 the level of co3-fatty acids was about 14.8%. Overall conver GA7-modC was produced by adding a second M. pusilla sion efficiencies were calculated to be: OA to EPA=12.8%, A6-desaturase cassette with slightly different codon usage OA to DHA=8.5%, LA to EPA=15.7%, LA to DHA=10.4%, (SEQID NO:15) and driven by the FP1 promoter, which was ALA to EPA=72.1%, ALA to DHA=47.9%. The reduced inserted at the PmeI site just inside the right border of efficiency of the Co6 fatty acids to co3 fatty acids conversion 35 plP3416-GA7-modB. The second A6-desaturase cassette observed in this experiment with the combination of the was added to both pP3416-GA7-modB and pP3416-GA7 plP31 15 and pP31 16 was thought to be due to a lower modF in order to increase the A6-desaturase expression level efficiency of the plant A15-desaturase compared to the fungal and extend the time period during seed development for A15/o3 desaturase (Examples 2 and 3) when combined with expression of A6-desaturase by the use of multiple promoters. the genes for conversion of ALA to DHA. 40 Different codon usages were used in the two nucleotide Progeny from DHA-containing lines which are homozy sequences to result in the translation of the same protein gous for all of the introduced transgenes are generated for sequence without risking co-suppression from similar coding analysis. regions within the same T-DNA. p.JP3416-GA7-modD and plP3416-GA7-modE were similar variants in which a third Example 5 45 MAR sequence, corresponding to nucleotides 16649-17816 of SEQID NO: 1, was added to plP3416-GA7 and pP3416 Modifications to T-DNAS Encoding DHA Pathways GA7-modB, respectively, at the PmeI site. p.JP3416-GA7 in Plant Seeds modF was produced by adding a second M. pusilla A6-de saturase cassette containing the native A6-desaturase In order to improve the DHA production level in B. napus 50 nucleotide sequence and driven by the FP1 promoter at the beyond the levels described in Example 4, the binary vectors Pmel site at the right border of plP3416-GA7-modB. plP3416-GA7-modA, plP3416-GA7-modB, p.JP3416-GA7 plP3416-GA7-modG was made by first replacing the M. modC, p.JP3416-GA7-modD, p.JP3416-GA7-modE and pusilla A6-desaturase cassette with a Cnl2:P. cordata plP3416-GA7-modF were constructed as follows. These A5-elongase cassette by restriction cloning at the AscI-PacI binary vectors were variants of the pP3416-GA7 construct 55 sites. p.JP3416-GA7-modG was then made by replacing the described in Example 2 and were designed to further increase original FAE 1: P. cordata A5-elongase cassette with a FAE 1: the synthesis of DHA in plant seeds, particularly by improv M. pusilla A6-desaturase cassette by restriction cloning at the ing A6-desaturase and A6-elongase functions. SDA had been SbfI sites. The nucleotide sequences of the T-DNAs from observed to accumulate in some seed transformed with the each of these genetic constructs are shown as: p.JP3416-GA7 GA7 construct due to a relatively low elongation efficiency 60 modB (SEQ ID NO:2), p.JP3416-GA7-modC (SEQ ID compared to the A5-elongase, so amongst other modifica NO:3), p.JP3416-GA7-modD (SEQ ID NO:4), p.JP3416 tions, the two elongase gene positions were Switched in the GA7-modE (SEQID NO:5), p.JP3416-GA7-modF (SEQ ID T-DNA NO:6) and pP3416-GA7-modG (SEQID NO:7). The two elongase coding sequences in plP3416-GA7 were The binary vectors plP3416-GA7-modB, p.JP3416-GA7 switched in their positions on the T-DNA to yield pP3416 65 modC, plP3416-GA7-modD, p.JP3416-GA7-modE, GA7-modA by first cloning a new P cordata A6-elongase plP3416-GA7-modF and pP3416-GA7-modG are used to cassette between the Sbfl sites of plP3416-GA7 to replace the generate transformed Brassica Somatic embryos and Bras US 8,946,460 B2 95 96 sica napus, Camelina sativa and Arabidopsis thaliana plants from a half cotyledon from each of the individual seeds. The and progeny seeds. Data for plP3416-GA7-modB are shown other half cotyledons with embryonic axes were kept and in the next Example. cultured on media to maintain the specific progeny lines. The Eight transgenic plP3416-GA7-modBA. thaliana events fatty acid composition in the oil was determined; the data is and 15 transgenic plP3416-GA7-modG A. thaliana events shown in Table 16 for CT132.5. The DHA level in ten of the were generated. Between 3.4% and 7.2% DHA in pooled 20 seeds analysed was in the range of 7-20% of the total fatty plP3416-GA7-modB seed was observed and between 0.6 and acid content as determined by the GC analysis. Other seeds 4.1% DHA in pooled T2 p.JP3416-GA7-modG seed was had less than 7% DHA and may have contained a partial observed. Several of the highest pP3416-GA7-modB events (incomplete) copy of the T-DNA from pP3416-GA7-modB. were sown out on selectable media and Surviving seedlings 10 The transgenic line appeared to contain multiple transgene taken to the next generation. Seed is being analysed for DHA insertions that were genetically unlinked. The seeds of trans content. Since the pooled T1 seeds represented populations genic line CT133.15 exhibited DHA levels in the range 0-5%. that were segregating for the transgenes and included any null Seeds with no DHA were likely to be null segregants. These segregants, it is expected that the homozygous seeds from data confirmed that the modB construct performed well for progeny plants will have increased levels of DHA, up to 20% 15 DHA production in canola seed. of the total fatty acid content in the seed oil. The other modi The plP3416-GA7-modB and pP3416-GA7-modF con fied constructs were used to transform A. thaliana. Although structs were also used to generate transformed Camelina only a small number of transformed lines were obtained, none sativa plants. At least 24 independent transformed plants yielded higher levels of DHA than the modB construct. (TO) were obtained and examined in more detail by progeny The pP3416-GA7-modB construct was also used to gen analysis. Seed (T1 seed) was harvested from these transgenic erate transformed B. napus plants of cultivar Oscar and in a lines. Pools of seed were tested for levels of DHA in the seed breeding line designated NX005. Ten independent trans oil, and 6 lines which showed the highest levels of DHA formed plants (TO) were obtained so far for the Oscar trans (between 6% and 9%) were selected. The DHA levels in 20 formation, and 20 independent lines for NX005. Seed (T1 T1 seeds from each line were analysed-most seeds exhibited seed) was harvested from these transgenic lines. Pools of seed 25 DHA levels in the range of 6-14% of the total fatty acid were tested for levels of DHA in the seed oil, and two lines content as determined by the GC analysis. The fatty acid which showed the highest levels were selected, these were composition in the oil was determined; the data is shown in designated lines CT132.5 (in cultivar Oscar) and CT133.15 Table 17 for several transgenic seeds. These data confirmed (in NX005). Twenty seeds from CT132.5 and 11 seeds from that the modB and modF constructs both performed well for CT 133.15 were imbibed and, after two days, oil was extracted DHA production in Camelina seed. TABLE 16 Fatty acid profiles of half cotyledons of germinating T1 transgenic B. naptis seeds containing the modB construct. Up to 18.1% DHA was observed with numerous samples containing greater than 10% DHA. Seed 14:0 16:0 16:1d32 16:1 16:3 18:0 18:1 18:1d 11 18:2 18:3n6 18:3m3 20:0 18:4n3 C20:1d 11 20:1d 13

1 O. 4.2 O. O. O.2 1.8. 29.9 2.5 9.9 O.1 38.4 O.S O.8 O O.O 2 O. 4.7 O. O. O.2 4.O 23.0 2.3 7.4 O.3 29.3 1.O 4.3 .1 O.O 3 O. 3.7 O.2 O. O.2 1.8 SS.1 .9 4.7 O.2 15.2 O.8 1.8 .4 O.O 4 O. 4.6 O.2 O.2 O.2 2.9 22.1 8 6.6 0.4 26.5 1.O 7.2 O O.O 5 O. 4.0 O. O. O.2 1.7 27.4 2.1 8.1 O.3 26.4 O.6 2.8 O O.O 6 O. 3.5 O. O. O.2 1.6 S9.8 2.0 4.3 O.1 18.5 O.6 O.S 3 O.O 7 O. 6.O O.3 O.3 O.3 1.7 16.6 2.6 23.9 1.O 23.2 O.6 5.4 O.8 O.O 8 O. 4.9 O. O. O.2 2.7 12.9 .4 11.7 O.3 34.3 O.9 S.O O.9 O.O 9 O. 3.9 O. O. O.1 2.4 41.6 7 21.5 O.O 23.4 0.7 O.O .2 O.O 10 O. 3.7 O.2 O. O.1 2.1 30.9 7 19.2 0.4 23.6 0.7 2.1 .1 O.O 11 O. 5.7 0.4 O.3 O.2 3.8 41.2 2.4 26.7 2.1 7.2 1.3 O.3 .2 O.O 12 O. 4.6 O.O O. O.2 2.4 25.5 7 16.1 O.3 28.9 O.8 3.9 .1 O.O 13 O. 4.3 O. O. O.1 4.2 19.4 .6 9.2 O.1 45.5 1.O O.2 .1 O.O 14 O. 6.3 O.2 O.2 O.2 4.0 10.5 2.3 8.4 O.3 31.1 1.3 3.9 O.8 O.O 15 O. S.1 O. O.2 O.2 33 16.8 2.4 11.2 O.3 28.8 1.O 4.5 O.9 O.O 16 O. 4.4 O. O. O.2 4.0 16.2 5 11.6 O.2 33.5 O.9 2.8 .1 O.O 17 O.2 7.2 O.2 O.2 O.2 4.9 15.O 2.1 8.9 O.3 25.9 1.4 S.1 O.9 O.O 18 O. 4.0 O. O. O.2 2.3 64.8 .2 7.2 O.1 12.5 1.O 3.5 .5 O.O 19 O. 3.9 O. O. O.2 4.6 36.9 7 7.1 O.2 28.6 1.2 1.8 .2 O.O 2O O. 4.8 O. O. O.2 6.0 18.5 .2 12.8 O.2 34.8 1.4 2.4 .1 O.O

Seed C20:2n6 C20:3m3 C22:O 20:4n3 20:53 22:33 C24:O C24:1 22:53 C22:63

1 O.1 2.1 O.3 2.8 O.3 O.1 O.2 O.2 O.S 3.9 2 O.1 1.9 0.4 6.9 1.O O.O O.3 O.1 1.7 9.5 3 O.1 O.3 O.S 11.3 O.O O.O O.3 O.2 O.O O.O 4 O.1 O.8 O.S 11.2 1.9 O.O O.2 O.2 1.7 8.7 5 O.1 1.5 O.3 7.6 1.5 O.O O.1 O.1 1.8 12.2 6 O.O 0.7 O.3 6.O O.O O.O O.2 O.1 O.O O.O 7 O.2 O.6 0.4 2.6 1.1 O.O O.3 O.3 1.7 9.9 8 O.2 2.4 O.S 4.1 1.3 O.O O.2 O.2 1.8 13.8 9 O.1 2.2 0.4 O.O O.O O.1 O.3 O.2 O.O O.O 10 O.1 1.5 0.4 3.6 O6 O.O O.2 O.1 0.7 6.9 11 O.2 O.3 0.8 4.8 O.O O.O O6 O.3 O.O O.O 12 O.1 1.9 0.4 3.9 O6 O.O O.2 O.O 1.1 6.2 13 O.1 5.2 0.4 2.6 O.3 O.2 O.2 O.1 0.4 3.4 14 O.1 2.3 0.6 4.6 1.8 O.1 O.3 O.2 2.5 18.1 US 8,946,460 B2 97 98 TABLE 16-continued Fatty acid profiles of half cotyledons of germinating T1 transgenic B. naptis seeds containing the modB construct. Up to 18.1% DHA was observed with numerous samples containing greater than 10% DHA. 15 O.1 2.1 O6 3.2 1.5 O.1 O.3 O.1 1.8 15.1 16 O.2 3.7 0.4 4.6 O.7 O.1 O.3 O.1 1.3 12.1 17 O.O 1.6 O.8 4.9 2.1 O.O O6 O.3 2.2 1S.O 18 O.1 O.O 0.7 O.O O.O O.O O.S O.2 O.O O.O 19 O.1 1.4 O.S 4.3 O4 O.O 0.4 O.1 O.8 4.3 2O O.1 3.4 O6 3.2 O4 O.1 O.3 O.1 0.7 7.6

TABLE 17 Fatty acid profiles of T1 transgenic C. Saiva seeds containing the modB or modF constructs

C14:O C16:O C16:1 C18:O C18:1 C18:111 C18:2 C18:36 C18:33 C2O:O

123-8 O.1 7.3 O.O 5.2 7.9 1.O 7.7 0.7 29.9 2.3 123-12 O.1 8.3 O.O 5.3 7.2 1.2 8.7 O.9 27.2 2.5 S-8 O.1 8.3 O.1 3.5 9.4 1.3 8.1 1.1 29.0 1.O S-9 O.1 8.1 O.O 3.5 9.4 1.2 8.4 1.2 29.2 1.O 17-10 O.1 8.7 O.1 4.1 8.4 1.3 5.5 1.2 26.1 1.6 17-26 O.1 8.8 O.1 5.5 S.O 1.3 7.6 O.9 27.8 2.7

18:4n3 C20:1d 11 20:1d 13 C2O:2nö C20:36 C20:4né C2O:3m3 C22:O 20:4n3

123-8 6.O 7.1 0.4 0.7 O.O O.O O.9 0.4 1.3 123-12 5.7 6.9 O.S 0.7 O.O O.1 O.9 O.S 1.5 S-8 9.3 7.9 0.4 O.6 O.O O.O O.8 O.2 0.4 S-9 9.0 8.1 O.3 O.6 O.O O.O O.8 O.2 O.S 17-10 11.8 7.2 O.3 O.O 0.4 O.O3 O.8 O.3 0.4 17-26 10.1 6.2 O.3 O.O O.7 O.O3 1.1 0.6 0.5

C22:1 20:53 C22:26 22:3m3 C24:O C24:1 22:53 C22:63

123-8 1.O 4.6 O.O O.1 O.2 O.3 1.5 13.3 123-12 1.2 S.O O.O O.1 O.2 0.4 1.5 13.2 S-8 O.8 3.4 O.O O.1 O.2 0.4 O.9 12.6 S-9 O.8 3.5 O.O O.1 O.1 O.3 O.9 12.6 17-10 0.7 5.5 O.O O.O O.2 O.3 1.3 13.5 17-26 1.O 4.7 O.1 O.1 O.3 0.4 1.O 13.1

The inventors considered that, in general, the efficiency of Example 6 rate-limiting enzyme activities in the DHA pathway can be 45 greater in multicopy T-DNA transformants compared to Activity of Seed-Specific Constructs in Somatic single-copy T-DNA transformants, or can be increased by Embryos inserting into the T-DNA multiple genes encoding the enzyme which might be limiting in the pathway. Evidence for In order to establish a rapid assay system which was pre the possible importance of multi-copy transformants was 50 dictive of expression of genetic constructs in seeds under the seen in the Arabidopsis seeds transformed with the GA7 control of seed-specific promoters, a Somatic embryo system construct (Example 2), where the highest yielding DHA event was set up for Brassica napus. This used a vector to express the LEC2 transcription factor which is involved in initiation had three T-DNAs inserted into the host genome. The mul of Somatic embryogenesis. As a demonstration, the binary tiple genes can be identical, or preferably are different vari 55 ants that encode the same polypeptide, or are under the con vectors 35S:LEC2 and pP107 (Petrie et al., 2010a and b) trol of different promoters which have overlapping were introduced into Agrobacterium tumefaciens Strain expression patterns. For example, increased expression could AGL1 via Standard electroporation and the Agrobacterium be achieved by expression of multiple A6-desaturase coding transformants used to co-transform Brassica napus by co 60 cultivation. The T-DNA region of pP107 contained genes regions, even where the same protein is produced. In encoding the Isochrysis galbana A9-elongase, P Salina plP3416-GA7-modF and pP3416-GA7-modC, for instance, A8-desaturase and P Salina A5-desaturase with each gene two versions of the M. pusilla A6-desaturase were present and expressed by a seed-specific promoter. A control transforma expressed by different promoters. The coding sequences had tion used the 35S:LEC2 vector alone. 35S:LEC2 expression different codon usage and therefore different nucleotide 65 resulted in the generation of somatic embryos in tissue culture sequences, to reduce potential silencing or co-suppression directly from the transformed B. napus callus tissue as effects but resulting in the production of the same protein. described in Example 1. US 8,946,460 B2 99 100 Fatty acid analysis showed that the seed-specific genes on to DHA=9.7%, 24.2%; LA to EPA=15.4%, 30.7%; LA to the T-DNA of the construct plP107 were expressed in the DHA=10.7%, 25.0%; ALA to EPA=22.1%, 33.3%; ALA to transgenic Somatic embryos in the presence of the co-trans DHA=15.3%, 27.0%. These efficiencies were similar, or formed LEC2 gene and functioned to produce ARA (20:4 greater than in the case of #284, to those observed for the T 8,11,14) from LA and EPA (20:5^*'''''7) from ALA. The plP3416-GA7 Arabidopsis lines which indicated that the data for three co-transformed somatic embryos are shown in plP3416-GA7-modB vector was capable of functioning well Table 18 and the fatty acid composition of each compared to in B. napus cells. The SDA level was below 3.0%, indicating the fatty acid composition of seed oil from Brassica napus that the A6-elongase was performing even better than the seed which was transgenic for, and expressing, the T-DNA of GA7 construct. The individual enzyme efficiencies achieved plP107 (Petrie et al., 2010a and b). Similar total percentages 10 of ARA and the intermediate fatty acids EDA (20:2006) and in #284 were: A12-desaturase, 97.4%; (03-desaturase, 92.3%: DGLA (20:3(O6), as well as conversion efficiencies, were A6-desaturase, 38.2%; A6-elongase, 88.2%; A5-desaturase, observed in Somatic embryo tissue when compared with sta 98.8%; A5-elongase, 94.1%; and A4-desaturase, 86.3%. Total bly-transformed seed profiles. Similar results were observed saturates were 21.2%, total monounsaturates were 10.2%, in the fatty acid compositions of the stable T transgenic seed 15 total polyunsaturates were 68.6%. and somatic embryos: (6 fatty acids were at a level of 26.6% and 25.6% (on average), respectively, whilst ARA levels were The inventors believe this was the highest level of DHA found to be 9.7% and 10.6% (on average), respectively. achieved in B. napus cells to date, except for further data When 35S:LEC2 alone was introduced and the somatic described below. This also demonstrated that the modifica embryos analysed in a time-course, the fatty acid profile was tion in plP3416-GA7-modB relative to plP3416-GA7 was found to change to a more embryo-like profile with 18:3^ effective in increasing the level of expression of the A6-de 12.15 decreasing and 18:1° increasing in an inversely corre saturase gene. The binary vectors pP3416-GA7, p.JP3416 lated manner (FIG. 8). These results indicated that the GA7-modA, p.JP3416-GA7-modC, p.JP3416-GA7-modD, Somatic embryos were indeed becoming seed-like in charac plP3416-GA7-modE and plP3416-GA7-modF as described ter and the genes on the T-DNA from plP107 were expressed. 25 above are co-transformed with 35S:LEC2 to generate trans This demonstrated that the somatic embryo system allowed a formed B. napus somatic embryos. Up to 7.0% DHA was rapid characterisation of transgenic seed-specific constructs observed in modD embryos, 9.9% in modE embryos, 8.3% in in B. napus without requiring the full process of producing a modF embryos and 3.6% in a small number of modG transgenic plant and, from that, mature seed. embryos. TABLE 1.8

Fatty acid composition of lipid obtained from Brassica naptis somatic embryos generated by co-transforming pP107 with 35S:LEC2, compared to the control untransformed (WT) and T2 seeds transformed with pP107. Individual enzymatic conversion efficiencies are shown in brackets after the relevant enzymatic steps. D9-Elo is A9-elongase, D8-Des is A8-desaturase and D5-Des is A5-desaturase.

WT T2 plP107 transgenic seed LEC2: #45 LEC2: #57 LEC2: #58

18:1A9 57.2 45.7 3.8 2.5 1.9 18:249.12 19.1 8.7 10 10.6 10 18:349,12,15 10.2 4.1 22.5 27.5 24.2 20:2 all.14 7.1 + 1.9 (67% D9-elo) 5.2 (61.8% D9-elo) 3.7 (56.7% D9-elo) 4.6 (61.8% D9-elo) 20:3A8.11.14 1.1 + 0.2 (60% D8-des) 0.4 (67% D8-des) 0.2 (73% D8-des) 0.4 (73% D8-des) 204A5,8,11,14 9.7 + 0.9 (90% D5-des) 10.6 (98% D5-des) 10 (96% D5-des) 11.2 (97% D5-des) 20:3A11.14.17 4.O. O.8 9.9 5.5 7.3 20:4A8.11.14.17 O3 + 0.1 0.4 O.3 0.4 20:5A5.8.11.14.17 2.4 + 0.2 7.6 6.4 7.9 Total new 24.6 34.1 26.1 31.8

Using the same system to generate Somatic embryos, Bras TABLE 19 sica napus cells were transformed separately with pP3416 Fatty acid composition of oil from Brassica naptis Somatic GA7-modB and pP3416-GA7-modD. 42 embryos were embryos #270 and #284 generated by co-transforming obtained, 18 for modB and 24 for modD. Total lipid was 55 the seed-specific DHA acid construct pP3416-GA7-modB extracted from the embryos and analysed for fatty acid com with 35S:LEC2, and #286 and #289 (p.JP3416-GA7-modD). position. The embryos contained between 0% and up to 16.9% DHA (Table 19). The results with 0% DHA was pre #270 #284 #286 #289 sumed to be due to integration of only a partial T-DNA or an 14:O O.3 O.2 O.2 O.2 insertion into a transcriptionally silent region of the genome. 60 16:O 14.0 15.7 17.2 16.6 The total (O3 FA (including ALA) to total ()6 FA (including 16:1d9 0.7 0.4 O.8 O.8 16:3 O.S O.6 1.1 1.3 LA) ratio was found to be 2.3 for embryo #270 and 11.96 for 18:0 2.6 2.4 2.5 2.5 embryo #284. The total (O6 FA (including LA) to total co3 FA 18:1d9 6.6 1.8 1.5 1.1 (including ALA) ratio was 0.08 for #284. The new ()6 FA 18:1d 11 6.3 6.8 6.5 6.7 (excluding LA) to new co3 FA (excluding ALA) ratio was 0.03 65 18:2 18.9 4.5 1O.O 9.8 for #284. Overall conversion efficiencies were calculated to 18:36 0.7 O.8 O.3 O.3 be: (for embryos #270, #284) OA to EPA-14.0%, 29.8%; OA US 8,946,460 B2 101 102 TABLE 19-continued Example 8 Fatty acid composition of oil from Brassica naptis somatic embryos #270 and #284 generated by co-transforming Predicting DHA Production in B. Napus Seeds the seed-specific DHA acid construct pP3416-GA7-modB with 35S:LEC2, and #286 and #289 (p.JP3416-GA7-nodD). 5 Efficient production of DHA in Arabidopsis seeds at a 15% level using the GA7 genetic construct was demonstrated in H270 #284 #286 #289 Example 2. The same construct in Brassica napus seeds pro 18:303 33.0 37.2 42.O 41.5 duced only about 1.5% DHA in many (but not all) of the 20:O O.9 O.9 O.8 O.8 transformants, primarily due to the poor expression of the 18:43 1.9 2.8 3.6 4.5 10 20:1d 11 O.2 O.1 O.1 O.1 A6-desaturase gene of GA7 in this species (Example 4). 20:26 O.1 O.1 O.1 O.2 Based on the realisation that modifications to the GA7 con 20:303 O.S O.O O.S O.6 22:O O.8 1.5 O.6 0.7 struct would overcome the A6-desaturase gene expression 20:43 O.2 O.9 0.7 0.7 problem (see Example 5, as demonstrated in Example 6), 20:53 0.7 O.2 O.3 O.3 15 calculations were performed to determine the likely fatty acid 22:2006 O.O 1.2 O.O O.O profile of B. napus transgenic seeds expressing the genes 22:303 O.O O.1 O.O O.1 24:O O.8 1.O 1.O 1.O from a variant of pP3416-GA7, where each transgene-en 24:1 O.8 1.O 0.7 O.9 coded enzyme was performing as efficiently as was observed 22:53 2.4 2.7 3.2 3.0 in A. thaliana with the GA7 construct. The predicted fatty 22:63 7.0 16.9 6.1 6.4 acid compositions for three calculations (#1, #2, #3) are shown in Table 20. This was based on a wild-type (non transformed) fatty acid composition for B. napus that included 59% oleic acid, 20% LA and 8% ALA. The three Example 7 predicted partial fatty acid profiles shown in the lower half of the table were based on the conversion efficiencies for each 25 Analysis of TAG from Transgenic A. thaliana Seeds enzymatic step shown in the upper half of the table. In pre Producing DHA diction #2, a combination of A12-desaturation at 75% effi ciency. A 15-desaturation at 75%, A6-desaturation at 35%, A6-elongation at 80%, A5-desaturation at 90%, A5-elonga The positional distribution of DHA on the TAG from the tion at 90% and A4-desaturation at 90% would result in the transformed A. thaliana seed was determined by NMR. Total 30 lipid was extracted from approximately 200 mg of seed by production of approximately 10% DHA in a typical canola first crushing them under hexane before transferring the transgenic seed. These efficiencies were all lower or about crushed seed to a glass tube containing 10 mL hexane. The equal to the individual efficiencies seen in Arabidopsis, so tube was warmed at approximately 55°C. in a water bath and prediction #2 represented a conservative estimate. The con 35 version efficiencies listed in #3 were approximations based then Vortexed and centrifuged. The hexane solution was on the efficient conversions seen in A. thaliana transformed removed and the procedure repeated with a further 4x10 mL. with pP3416-GA7. DHA was predicted to be produced at The extracts were combined, concentrated by rotary evapo ration and the TAG in the extracted lipid purified away from about 15% of the total fatty acid content in seedoil produced polar lipids by passage through a short silica column using 20 in B. napus seed, a result that mirrored the most efficient mL of 7% diethyl ether in hexane. Acyl group positional 40 production levels observed in A. thaliana. Insertion of mul distributions on the purified TAG were determined quantita tiple T-DNAs in the homozygous state is expected to raise the tively as previously described (Petrie et al., 2010a and b). DHA level to 20% in B. napus. The analysis showed that the majority of the DHA in the TABLE 20 total seed oil was located at the sn-1/3 positions of TAG with little found at the sn-2 position (FIG. 9). This was in contrast 45 Predicted fatty acid composition for selected fatty acids as a percentage of total fatty acid content in seedoil from Brassica naptis transformed to TAG from ARA producing seeds which demonstrated that with a DHA pathway construct, based on observed enzymatic efficiencies 50% of the ARA (20:4'''''') was located at the sn-2 posi in transgenic Arabidopsis. The enzymes are listed in order in the tion of transgenic canola oil whereas only 33% would be pathway for producing DHA from oleic acid. des = desaturase, elo = expected in a random distribution (Petrie et al., 2012). elongase. Predicted fatty acid compositions #1, #2 and #3 are 50 Positional distribution of DHA in the TAG from the B. based on the efficiencies in the upper half of the Table. napus seeds transformed with pP3416-GA7 or with the com WT #1 #2 #3 bination of plP31 15 and pP31 16 is determined by essen tially the same method. Enzyme The total lipid from transgenic A. thaliana seeds was also 55 d12-des 70% 75% 80% d15-des 70% 75% 80% analysed by triple quadrupole LC-MS to determine the major d6–des (c)3) 30% 35% 40% DHA-containing triacylglycerol (TAG) species (FIG. 10). d6-elo 80% 80% 90% The most abundant DHA-containing TAG species was found d5-des 80% 90% 90% d5-elo 80% 90% 90% to be DHA-18:3-18:3 (TAG 58:12: nomenclature not descrip d4-des 80% 90% 90% tive of positional distribution) with the second-most abundant 60 Fatty acid being DHA-18:3-18:2 (TAG 58:11). Tri-DHA TAG (TAG 66:18) was observed in total seed oil, albeit at low but detect 18:1d9 59% 26% 22% 18% able levels. Other major DHA-containing TAG species 18:26 20% 1996 1796 14% 18:36 196 2% 3% included DHA-34:3 (TAG 56:9), DHA-36:3 (TAG 58:9), 18:303 30% 32% 34% DHA-36:4 (TAG 58:10), DHA-36:7 (TAG 58:13) and DHA 65 18:43 3% 3% 296 38:4 (TAG 60:10). The identities of the two major DHA 20:43 296 190 296 containing TAG were further confirmed by Q-TOF MS/MS. US 8,946,460 B2 103 104 TABLE 20-continued TABLE 21 Predicted fatty acid composition for selected fatty acids as a percentage Fatty acid composition of total leaf lipid from transgenic of total fatty acid content in seedoil from Brassica naptis transformed Nicotiana benthamiana (transient) and Nicotiana tabacum with a DHA pathway construct, based on observed enzymatic efficiencies (stable primary transformant) events with the highest in transgenic Arabidopsis. The enzymes are listed in order in the 5 EPA levels from each experiment. pathway for producing DHA from oleic acid. des = desaturase, elo = elongase. Predicted fatty acid compositions #1, #2 and #3 are N. benihamiana N. tabacum based on the efficiencies in the upper half of the Table. 4:0 O.1 O.1 WT #1 #2 #3 6:O 18.5 17.8 10 6:1 w13t 2.2 3.8 20:53 296 190 296 6:1d9 O.1 O 22:53 196 190 296 6:3 6.2 5.7 22:63 59 10% 15% 8:0 3.4 3.2 8:1d 11 O.3 O.3 20:O O.S O.S 15 22:O O.2 O.3 24:O O.1 0.4 Example 9 8:1 2.9 1.6 8:26 12.6 14.5 Omega-6 8:3)6 2.3 2.9 Stable Expression of a Transgenic EPA Pathway in 20:2006 O.O O.O 20:36 O.1 O.O Plant Leaf 20:406 O.3 0.7 Omega-3 8:303 37.1 32.4 8:4c03 1.6 1.9 Binary Vector Construction 20:303 O.1 O.3 A binary vector, pORE04+11ABGBEC Cowpea E 20:43 O.3 1.1 PA insert (SEQID NO:8), was designed for introduction of a 20:53 10.7 12.1 T-DNA into plants for the synthesis of EPA in leaf tissues. It 25 22:53 O.3 0.4 contained chimeric genes encoding the enzymes: M. pusilla A6-desaturase (SEQ ID NO:16), P cordata A6-elongase Leaf samples of N. tabacum cultivar W38 grown in vitro (SEQ ID NO:25) and P. salina A5-desaturase (SEQ ID were excised and cut into square sections around 0.5-1 cm in NO:30), each under the control of the CaMV 35S and A. size with a sharp scalpel while immersed in the A. tumefa thaliana rubisco small subunit (SSU) promoters (FIG.9). The 30 ciens solution. The wounded N. tabacum leaf pieces sub binary vector was constructed by synthesising the region merged in A. tumefaciens were allowed to stand at room 199-10878 of SEQ ID 2 and cloning this into the recipient temperature for 10 minutes prior to being blotted dry on a binary vector pORE04 (Coutu et al., 1997) at the BsiWI and sterile filter paper and transferred onto MS plates without Kasl sites. The three fatty acid biosynthesis genes coded for Supplement. Following a co-cultivation period of two days at the enzymes required to convert ALA, 18:3''''' to EPA, 35 24° C., the explants were washed three times with sterile, 20:5A5,8,11,14.17. liquid MS medium, then blotted dry with sterile filter paper and placed on the selective MSagar supplemented with 1.0 Transient Expression of EPA Construct in N. benthamiana mg/L benzylaminopurine (BAP), 0.25 mg/L indoleacetic Leaf Cells acid (IAA), 50 mg/L. kanamycin and 250 mg/L cefotaxime. To test that the construct was correct and would express the 40 The plates were incubated at 24°C. for two weeks to allow for genes efficiently in leaf tissues, the chimeric vectorpORE04+ shoot development from the transformed N. tabacum leaf 11 ABGBEC Cowpea EPA insert was introduced into A. pieces. tumefaciens strain AGL1. The chimeric vector 35S:p 19 was To establish rooted transgenic plants invitro, healthy green also introduced into A. tumefaciens strain AGL1 as described shoots were cut off and transferred into 200 mL tissue culture in Example 1. Cells from cultures of these infiltrated into leaf 45 tissue of Nicotiana benthamiana plants in a 24°C. growth pots containing MSagar medium Supplemented with 25 g/L room. Several direct comparisons were infiltrated with the IAA, 50 mg/L. kanamycin and 250 mg/L cefotaxime. Trans samples being compared located on either side of the same genic shoots were transferred to Soil after rooting and grown leaf. Experiments were performed in triplicate. Following to maturity in the glasshouse. Sufficiently large leaf discs infiltration, the plants were grown for a further five days were taken from 21 mature transgenic plants from and analy before leaf discs were taken for fatty acid profile analysis by 50 sed for fatty acid profile as described in Example 1. All GC as described in Example 1. GC analysis revealed that the transgenic samples were found to contain EPA (Table 21) EPA vector was functioning to produce EPA in Nicotiana with the highest level of EPA in a hemizygous primary trans benthamiana leaf (Table 21) with the highest level of EPA formant found to be 12.1% of total leaf lipids. The leaf found to be 10.7% of total leaf lipids. samples also contained a small amount (<0.5%) of DPA in Nicotiana Tabacum Stable Transformation 55 their lipid, which resulted from elongation of the EPA by a The chimeric vector pCRE04+11ABGBEC Cowpea E low level of A5-elongation activity of the A6-elongase. The PA insert was used to stably transform Nicotiana tabacum. total (O3 FA (including ALA) to ()6 FA (including LA) ratio The vector was introduced into A. tumefaciens strain AGL1 was found to be 2.7. Overall conversion efficiencies were via standard electroporation procedure. The transformed calculated to be: OA to EPA=18.4%, LA to EPA=18.9%, cells were grown on Solid LB media Supplemented with kana 60 ALA to EPA-25.9%. The production of 12.1% EPA is mycin (50 mg/L) and rifampicin (25 mg/L) and incubated at notable especially since the events were hemizygous primary 28°C. for two days. A single colony was used to initiate fresh transformants. The ALA to EPA efficiency in particular is culture. Following 48 h vigorous culture, the cells were col close to that observed in stable seed transformants. It is worth lected by centrifugation at 2,000xg and the Supernatant was noting that the construct did not contain a A12 or A15-desatu removed. The cells were resuspended in fresh solution con 65 rase to increase the conversion of OA and LA to ALA. taining 50% LEB and 50% MS medium at the density of Increased efficiencies would be expected with addition of ODoo-0.5. these activities. US 8,946,460 B2 105 106 Seed from hemizygous transformants is being harvested Stable Transformation of Cowpea and sown out to generate homozygous plants. The chimeric vector pCRE04+1ABGBEC-Cowpea-EPA Seed set in the top EPA lines appeared normal and seed insert was transformed into cowpea (Vigna unguiculata) as from lines #10 and #17 germinated well to establish the T. follows. Mature dry seeds are the preferred starting material generation. The ratio of EPA to null (no EPA) lines indicated 5 that event #28 was single-locus and the T. generation of this although seeds harvested from immature pods at maximum line was therefore also established. Fatty acid profile analysis fresh weight of seeds can also be used. Dry seeds are threshed of the Ts population indicated that the transgenes were by hand to avoid cracking of seed coats and thus reduce homozygous with no null events found and a stable amount of contamination with microorganisms. EPA. The average amount of EPA in the total leaflipids in the Dry seeds or immature pods are submerged in 70% ethanol entire T. population was found to be 9.4%+0.3 (Table 22). for 2 min and then treated for 30 min in 20% commercial TABLE 22

Representative fatty acid profiles of total leaf lipids from wildtype (WT) and independent transgenic or transiently-transformed lines (EPA). Species are Nicotiana benthamiana (transient transformation), N. tabacum (a stably transformed T. population), Vignatinguiculata (stably transformed T1 event). The errors denote standard deviation of multiple samples. Apparent conversion efficiencies shown at the bottom describe the (03 pathway and are calculated as the sum of product FAssum of substrate + product FAs.

N. benihamiana N. tabacum V. linguiculata

WT EPA WT EPA WT EPA

16:O 17.7 0.1 18.7 O2 15.O. O.6 16.5 - O.S 18.0 18.2 0.2 16:113t 3.20.1 2.2 - O 3.5 + 0.1 3.O. O.3 3.8 2.O. O.9 16:3 6.8 O.1 6.2. O.1 5.20.5 54 - 0.3 18:0 3.1 - O 3.5 - 0.3 22 O.2 2.60.1 1.8 4.5 O.4 Minor 1.4 - O 1.4 + 0.1 3.10.4 2.5 + 0.3 2.3 2.5 + 0.4 OA 17 O.1 2.7 O2 1.6 0.3 2.1 - 0.3 2.O 4.3 1.3 LA 12.5 0.4 12.7 O2 17.O. 11 18.0 - 0.9 13.4 18.23.O ALA 53.30.2 37.2 O2 52.2 1.9 34.O. O.6 58.6 38.2 - O Omega-6 GLA 23 O.1 2.3 - 0.3 O.6 0.2 20:26 O.1 - O O.1 - O O.1 - O O.1 - O DGLA O.1 - O O.1 - O ARA O3 O O.7 0.1 O.2 - O Omega-3 SDA 1.5 + 0.1 1.6 0.1 1.5 - O 20:303 O.1 - O O.1 - O O.1 - O O.3 O O.1 - O 1.5 + 0.1 ETA O4 O 1.1 + 0.1 O3 + 0.2 EPA 10.2 - O.S 9.4 - 0.3 7.1 - 0.2 DPA O3 + 0.1 O.4 O O.801 Omega-3 A6-des 25% 27% 20% conversion A6-elo 88% 87% 85% A5-des 97% 90% 96% A5-elo 3% 4% 10%

Leaf samples of homozygous T3 N. tabacum plants were 55 bleach (8.4 g/L sodium hypochlorite final concentration). The subjected to further biochemical analysis. Total lipids were seeds are then washed several times with sterile water. Imma extracted from freeze-dried leaf material and fractionated by ture seeds are removed aseptically from pods while mature thin-layer chromatography (TLC). EPA was found to be seeds are imbibed overnight. Two different explants can be used for multiple shoot production, ie the embryonic axis and present in N. tabacum TAG at up to 30.1% as well as in the 60 the cotyledon itself, preferably the cotyledon with the polar lipids at 6.3% (Table 23). It was interesting to note that bisected embryonic axis attached. The shoot and root tips are the EPA produced by the transgenic pathway was present in removed from the axis before wounding at the cotyledonary all of the lipid fractions assessed including TAG, MGDG, node, i.e. the point of attachment of the axis to the cotyledon. DGDG, SQDG, PG, PC, PE, PI and PS. All lipid pools con From an initial comparison of 19 cultivars and lines, it is now tained low levels of novel intermediate or to 6 LC-PUFA fatty 65 clear that most lines of cowpea can be transformed, the only acids with the TAG ratio of novel ()3 to co6 fatty acids being caveat being that different tissue culture conditions need to be 10:1. optimised for each line. US 8,946,460 B2 107 108 TABLE 23 Analysis of young and mature (young mature) lea lipid fractions triacylglycerol (TAG), total polar lipid (PL), monogalactosyldiacylglycerol (MGDG), digalactosyl iacylglycerol (DGDG), Sulfoquinovosyldiacylglycerol (SQDG), phosphatidylglycerol (PG), phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine (PS) from transgenic Nicotiana tabacum leaf samples. The errors denote standard deviation of multiple samples. Up to 30% EPA was observed in leaf TAG with EPA also distributed throughout the polar lipids. Differences between yound and nature leaf profiles were also observed for several fatty acids. Chloroplastidic Extra-chloroplastidic

TAG PL MGDG DGDG SQDG PG PC PE PI PS 6:O 9.818.3 17.823.8 3.13.2 18.016.8 48.350.O 21.026.4 22.93.O.O 24.O3O.S 38.743.3 31.936.2 6:113t OO 3.43.1 OO OO OO 34.032.O OO OO OO 1.01.4 6:3 O.20.9 5.66.4 14.819.4 1.218 0.41.2 OO OO OO OO OO 8:0 7.33.7 2.93.9 1.11.2 3.53.5 S.47.1 4.76.9 6.69.1 11.0114 9.49.3 20.219.4 Minor 2.52.9 1.42.4 1.O.O.4 O.81.O 1.92.1 1.015 1.41.6 4.94.1 6.57.7 2.53.7 OA S.S.O.8 2.81.1 O.803 1.81.O 2.71.3 S.34.9 8.12.9 2.51.1 2.50.8 4.92.3 LA 27.713.7 17.312.3 8.06.8 9.21O.S 11.78.9 17.113.2 39.225.2 37.928.5 22.O13.4 24.417.1 ALA 9.617.2 39.034.4 60.3519 61.258.6 23.721.S 15.714.1 7.318.2 5.510.5 7.61O.O 4.81O.S Omega-6 GLA 2.53.O 1521 2.13.O 1.11.8 1419 O.2O 1.82.5 1.72.7 O.809 1.11.3 20:26 OO O.11.1 OO OO OO OO OO O.SO OO OO DGLA OO OO OO OO OO OO OO OO OO OO ARA O.609 O.10.2 O.204 OO OO OO O.303 O.404 O4O6 OO.2 Omega-3 SDA 4.O7.6 1.62.O 1.72.O O.60.7 1.21.2 OO 2.13.6 1.32.O O.80.8 O.91.6 20:303 O.2O3 O.10.2 OO O.2O3 OO OO.1 O.2O O3O4 OO OO ETA O.90.2 O.20.3 OO2 OO.3 OO OO O.2O O4O2 O.10.2 OO EPA 28.830.1 6.16.3 6.9112 2.33.6 3.44.6 1.O.O.8 9.76.4 9.17.8 11212.8 8.46.2 DPA O4.O.S OO OO1 OO OO OO O3O4 OSO4 OO.2 OO.1

The selectable marker genes, bar or NptII can be used for The majority of the regenerated shoots can be rooted in transformation. The Agrobacterium tumefaciens strain AGL1 vitro, and the rooted plants are transferred to soil and allowed is the preferred strain for cowpea transformation. Agrobacte 30 to establish in a high humidity chamber for 14-21 days before rium containing the pCORE04+11 ABGBEC-Cowpea-EPA- transfer to ambient greenhouse conditions. insert vector is cultured overnight at 28°C. on a shaker at 180 To enhance gene transfer to cowpea, co-culture media is rpm and the suspension is centrifuged at 8000 g for 10 min Supplemented with thiol compounds. The addition of L-cys and re-suspended in Medium 1 (MS-basic medium diluted teine, dithiothreitol, and sodium thiosulfate reduces brown one in ten and containing 30 g/l sucrose, 20 mM 2-MES, 35 ing of wounded tissue. adjusted to pH 5.6 prior to autoclaving, Supplemented with Large numbers of cowpea explants can be processed in a filter sterilized MS-vitamins, 100 mg/l myoinositol, 1.7 mg/1 simplified protocol. In brief, the protocol consists of the fol BAP, 0.25 mg/l GA, 0.2 mMacetosyringone, 250 mg/l Na- lowing steps: imbibition of sterilized mature seeds overnight thiosulphate, 150 mg/l dithiothreitol and 0.4 g/l L-cysteine). in water, explants are derived by longitudinally bisecting the The explants are submerged without shaking in the bacterial 40 seed as a result of which, the split embryonic axis (with shoot suspension for one hour following wounding in the meristem- and root apices removed) is still attached to the cotyledon, atic regions with a scalpel. The treated explants are then infection with Agrobacterium strain AGL1 aided by local blotted on sterile filter paper and transferred to solidified wounding 1. the meristematic regions, co-culture O medium Medium 2 (Medium 1 containing 0.8% agar) overlayed with containing thiol compounds over 4 days at 25 C. in light, filter paper. After four davs of co-cultivation. explants are shoot initiation and elongation on medium containing selec pap y exp tive agents, shoots are rooted in vitro and transferred to green transferred to Medium 3 (full strength MS medium, supple- h ouse conditionsditi for flowering and seed setting, PCR or mented with 100 mg/l myo-inositol, 150 mg/l timentin, 30 enzyme analysis of putative transgenic plants, and Screening g/L sucrose, 3 mM MES, 1.7 mg/L BAP s mg/L PPT or 25-50 of next generation progeny by PCR or enzyme activity. mg/L geneticin or 150 mg/L kanamycin, O.8 gLagar and so The progeny of transgenic To plants are normal in pheno adjusted to pH 5.6) for shoot initiation and selection oftrans- type. The transgenes are transmitted to the progeny and formed shoots. After two weeks the first shoots are visible. homozygous T plants are identified by Screening their T The cotyledons are removed from the cotyledonary node progeny for enzyme activity or by PCR. region and cultures are transferred to fresh Medium 3. Cul- Using this transformation system about 10 transgenic tures are transferred to fresh Medium 3 every two weeks 55 plants are produced per 1000 explants, which is similar to the following removal of dead and dying tissue. The first four transformation frequency for other legumes. Depending on Subcultures are on kanamycin selection followed by alternat- the cultivar or line to be transformed, this protocol requires ing with geneticin and kanamycin. After six Sub-cultures, the 5-8 months from explant preparation to harvested T seeds. surviving green shoots are transferred to Medium 4 (Medium The transformation system is used to introduce the 3 without BAP but supplemented with 0.5 mg/l GA., 50 mg/l 60 pCRE04+11 ABGBEC-Cowpea-EPA-insert binary vector asparagine, 0.1 mg/l 3-indoleacetic acid (IAA), 150 mg/1 into regenerated, transformed cowpea plants. timentin, and either PPT (10 mg/l), geneticin (50 mg/L) or Modifications to the pORE04+11ABGBEC-Cowpea kanamycin (150 mg/L), for shoot elongation. The shoots are EPA-insert binary vector are made in which genes encoding a Sub-cultured every two weeks until single shoots are more A5-elongase and A4-desaturase are added, to provide a than 1 cm long. These larger shoots are transferred from petri 65 genetic construct which confers the ability to further convert dishes to culturejars (80 mm height) for further growth under the produced EPA to DHA. The construct is transformed into selection. plants for production of DHA in vegetative tissues. US 8,946,460 B2 109 110 EPA was found to be present in the small number of events saturase and M. pusilla A6-desaturase, each under the control Surviving chemical selection. The highest line contained of seed-specific promoters (FIG. 12). The combination of the 7.1%+0.2 EPA in the total leaf lipids. The rate of transforma three fatty acid biosynthesis enzymes, namely A12-desatu tion was lower thanusually experienced for cowpea with only rase, (D3-desaturase and A6-desaturase, was designed to six lines confirmed transgenic. It is, as yet, unknown what assemble a pathway to convert oleic acid (18:1°) to SDA caused this effect although it is interesting to note that a larger (18:4'''''). Assays were therefore carried out to measure than usual proportion of transgenic events contained incom the level of SDA production in transformed seeds. plete T-DNA regions. It is possible that the large construct A. thaliana and B. napus Transformation and Analysis The size contributed to the reduced efficiency. The apparent con chimeric binary vectors were introduced into A. tumefaciens version efficiencies of each of the three transgenic enzymes 10 were also calculated (Table 22). Results were broadly similar strain AGL1 and cells from cultures of the transformed Agro in all three species with good conversion to EPA after initial bacterium used to transform fad2 mutant A. thaliana plants A6-desaturation of the native ALA. Some A5-elongation of using the floral dip method for transformation (Clough and EPA to DPA was noted despite the absence of a specific Bent, 1998). After maturation, the T seeds from the treated A5-elongase. The P cordata A6-elongase has previously been 15 plants were harvested and plated on MS plates containing shown to have a low level of A9-elongase activity (i.e. 18:3^ kanamycin for selection of plantlets having the NptII select 12.15 to 20:3'''''''' conversion) although no A5-elongase able marker gene present on the T-DNA of each chimeric activity was detected in a yeast assay. vector. Surviving T seedlings were transferred to soil. After allowing the plants to self-fertilise and growing them to matu Example 10 rity, the T seeds from these plants were harvested and the fatty acid composition of seed lipids analysed by G.C. Testing Variations of A12-Desaturase Genes The chimeric vectorp.JP3367 was also used to transform B. napus by the method described in Example 4 to generate 12 Binary Vector Construction transgenic events. SDA was found to range from 0.6% to In an attempt to test and compare a series of chimeric 25 2.2% in pooled seed of the plants, and nine individual seeds A 12-desaturase genes, several binary vectors were made from the transgenic plant with the highest SDA transgenic which were used to transform A. thaliana and B. napus. The plant were analysed for fatty acid composition. Fatty acid binary vectors plP3365, p.JP3366, p.JP3367, p.JP3368 and composition data from Such analysis is shown in Table 24. plP3369 each contained genes that encoded the P. pastoris The data showed that the A12-desaturase activity (03-desaturase (SEQID NO:12) and M. pusilla A6-desaturase 30 (SEQID NO:16) enzymes, and one of a series of A12-desatu expressed from each of the T-DNAs in both A. thaliana and B. rases. The A12-desaturases were from Cryptococcus neofor napus were unexpectedly low, providing an enzyme conver mans (Accession No. XP 570226 in plP3365), a version of sion efficiency of about 20% rather than the 70-80% seen with the Cryptococcus neoformans A12-desaturase which con the same expression cassette in the GA7 construct (Examples tained a L151M mutation in an attempt to increase gene 35 2 and 3). The reason for this relatively poor expression of the activity (in plP3366), Lachancea kluyveri (SEQID NO:10 in A 12-desaturase genes from these vectors is unclear but could plP3367), Synechocystis PCC6803 (Accession No. be related to the position of the genes in the construct as a BAA 18169 in pP3368) and Crepis palaestina (Accession whole. No. CAA76157, Lee et al., 1998, in pP3369). The Crepis In contrast, RT-PCR expression analysis demonstrated that desaturase was the only plant desaturase in the series; the 40 the P. pastoris (D3-desaturase and M. pusilla A6-desaturase others were fungal enzymes. The vectors were made by genes on the T-DNAs were relatively well expressed in the inserting a plant codon-optimised protein coding region, transformed seed. Table 24 includes the A6-desaturase con except for the Crepis palestina A12-desaturase which was version efficiencies in the transformed seeds, which ranged wildtype, for each A12-desaturase into the NotI site of the from about 11% to about 25% in the one B. napus trans vector plP3364 (see FIG. 12), in the orientation operably 45 formed line. This was considerably higher than the A6-de linked to the FP1 promoter to provide for seed-specific saturase conversion efficiency of about 7% seen in the B. expression of each desaturase. The vector plP3364 already napus seeds transformed with the GA7 construct (Example contained the chimeric genes encoding the P pastoris (D3-de 4). TABLE 24 Fatty acid composition as a percentage of total fatty acids in seed oil from single seeds from a T. Brassica napus plant transformed with the T-DNA from plP3367. SDA (18:403) is shown in bold. CT110 CT110- CT110- CT110- CT110- CT110- CT110- CT110- CT110 Sample 3#1 3#2 3#3 3hE4 3H5 3#6 3#7 3#8 3#9

C14:O O.1 O.1 O.1 O.1 O.1 O.1 O.1 O.1 O.1 C16:O 4.3 4.2 4.1 4.5 3.8 4.3 4.0 S.O 4.7 16:17 O.1 O.1 O.1 O.1 O.O O.1 O.1 O.1 O.1 C16:1d9 O.2 O.2 O.2 O.2 O.2 O.2 O.2 O.3 O.3 16:3 O.2 O.2 O.2 O.2 O.2 O.2 O.2 O.2 O.2 C18:0 1.9 1.9 1.3 1.8 2.1 1.8 2.4 3.1 2.2 C18:1 S8.1 59.4 55.5 59.1 62.1 56.0 57.2 52.O 53.2 C18:1d 11 3.5 3.6 3.0 3.2 2.9 3.6 3.2 4.4 3.5 C18:2 18.4 17.1 19.2 17.3 17.4 18.7 19.0 20.3 2O2 C18:36 O.3 O.2 O.3 O.2 O.2 O.2 O.2 O.2 O.3 C18:303 8.2 9.0 11.1 8.6 7.5 10.2 9.8 9.3 9.8 C2O:O O.S O.S 0.4 O.S O6 O.S O6 0.7 O.6 US 8,946,460 B2 111 112 TABLE 24-continued Fatty acid composition as a percentage of total fatty acids in seed oil from single seeds from a T. Brassica napus plant transformed with the T-DNA from pIP3367. SDA (18:403) is shown in bold. CT110- CT110- CT110- CT110- CT110- CT110- CT110 CT110- CT110 Sample 3#1 3#2 3#3 3ia. 3#5 3#6 3#7 3#8 3#9

18:463 2.4 20 2.8 2.5 1.4 2.6 13 2.4 3.2 C20:1d 11 1.1 1.1 1.2 1.2 1.2 1.1 1.2 1.1 1.1 20:1 iso O.O3 O.O3 O.O3 O.O3 O.O1 O.O3 O.O2 O.O3 O.O2 C2O:2006 O.1 O.1 O.1 O.1 O.1 O.1 O.1 O.1 O.1 C22:O O.2 O.2 O.2 O.2 O.2 O.2 O.2 O.3 O.2 C24:O O.1 O.1 O.1 O.2 O.1 O.1 O.2 O.3 O.2 C24:1 O.1 O.1 O.1 O.1 O.1 O.1 O.1 O.1 O.1 A6-des% 22.9 17.9 20.3 22.8 15.8 2O2 11.7 20.9 24.9

Therefore, to take advantage of the higher A6-desaturase and Avril giving rise to a 9560 bp fragment. The A9-elongase conversion efficiencies conferred by the T-DNA from coding region on this fragment was joined to an A. thaliana plP3367, B. napus plants transformed with this T-DNA were FAE1 promoter (pAtFAE 1) and a conlinin transcription ter crossed to plants transformed with the T-DNA from plP3416 mination/polyadenylation region (Lu(Onl2-3"). The desatu GA7 (Example 4) to produce progeny plants and seeds car rase coding regions were each joined to a truncated napin FP1 rying both T-DNAs. The fatty acid composition of oil promoter (pBnFP1) and a nos3' transcription termination/ extracted from F1 seeds is analysed by GC for DHA content polyadenylation region. The three fatty acid biosynthesis and other fatty acid contents. Increased DHA levels are genes on this fragment were oriented and spaced in the same observed as a consequence of increased expression of the 25 manner as in plP107 (Petrie et al., 2012) and encoded the A6-desaturase. Plants which are homozygous for both same proteins as pP107. The DNA fragment also comprised T-DNAs are produced and should produce higher levels of a pFP1:GFiP:nos3' gene from pCW141 (see WO2010/ DHA 057246) which encoded a green fluorescent protein (GFP). 30 This screenable marker gene was used as a visual seed-spe Example 11 cific marker, allowing simple and non-destructive identifica tion and thereby selection of transgenic seed comprising and Increasing Accumulation of Fatty Acids by Using expressing the gene. Silencing Suppressor Proteins The PmeI-Avril fragment was inserted into the Pmel-Avril 35 site of each of a series of five vectors, each containing a Binary Vector Construction different SSP gene (WO2010/057246), resulting in the WO 2010/057246 describes the use of silencing suppressor genetic constructs designated pFNO45, pFNO46, pFNO47, proteins (SSP) to increase transgene expression in the seeds pFNO48 and pFNO49. These comprise the genes encoding the of plants. To demonstrate that the use of such proteins could SSPs P0, p38, p 19, 35S:V2 and V2, respectively. Each of enhance and stabilise the production of LC-PUFA in oilseeds 40 the SSP genes was under the control of the FP1 promoter and over several generations, several SSP were selected for test ocs3' transcription termination/polyadenylation region ing, namely V2 (Accession No. GU178820.1), p.19 (Acces except in the construct pFNO48 where the V2 coding region sion No. AJ288943.1), p38 (Accession No. DQ286869.1) and was under the control of the constitutive CaMV 35S pro P0 (Accession No. L04573.1). p19 is a suppressor protein moter. The SSP gene in each case was within the T-DNA from Tomato Bushy Stunt Virus (TBSV) which binds to 21 45 region of the constructs, adjacent to the right border (RB) of nucleotide long siRNAS before they guide Argonaute-guided the T-DNA. A sixth construct, pFN050 which lacked any SSP cleavage of homologous RNA (Voinnet et al., 2003). V2, a coding sequence, was made by digesting pFN045 with AhdI suppressor protein from Tomato Yellow Leaf Curl Virus and Nhe followed by recircularisation with DNA ligase to (TYLCV), binds to the plant protein SGS3 (Glick et al., delete the FP1:P0 gene. Each of the six constructs com 2008), a protein thought to be required for the production of 50 prised an NptII selectable marker gene within the T-DNA and double stranded RNA intermediates from ssRNA substrates adjacent to the left border of the T-DNA. All of the constructs (Beclinet al., 2002), or binds to dsRNA structures that have a had an RK2 origin of replication for maintenance of the 5' overhangs (Fukunaga et al., 2009). p38 is a suppressor plasmids in Agrobacterium. protein from Turnip Crinkle Virus (TCV) which interferes Transformation of A. thaliana with ARA Expression Vectors with plant silencing mechanisms by binding to Dicer and 55 in Combination with SSPS Argonaute proteins (Azevedo et al., 2010). P0 proteins such To transform the genotype MC49 of Arabidopsis, which is as P0 and RPV-P0, from poleroviruses, target Argonaut a fad2/fael double mutant with highlinoleic acid levels in its proteins for enhanced degradation (Baumberger et al., 2007: seed lipid, plants were treated by the floral dip method Bortolamiolet al., 2007, Fusaro et al., 2012). Genetic con (Clough and Bent, 1998) with A. tumefaciens strain GV3101 structs were therefore prepared for expression of these SSP in 60 separately transformed with each of the six constructs plant seed in combination with a set of fatty acid biosynthesis pFNO45-pfNO50. The treated plants were grown to maturity genes for production of ARA (20:4^*''') from LA (18: and T seeds harvested from them were plated on MS media 1^''), as follows. containing kanamycin to select for transformed T plants. The fatty acid biosynthesis genes encoding the Isochrysis Screening for GFP expression in the seed was also used as a galbana A9-elongase and the Pavlova Salina A8- and A5-de 65 visual marker for transformed T seeds. The seedlings which saturases and the bacterial selection marker were obtained on survived on MS/Kan plates or which were obtained from a single DNA fragment from plP3010 by digestion with PmeI GFP-positive seeds were transferred to soil and grown to US 8,946,460 B2 113 114 maturity for T. seeds. The numbers of transformed plants seed-specific promoters were preferred. The construct obtained were 5, 14, 32, 8, 23 and 24 for the transformations designed to express the p38 SSP was defective and no useful with pFN045, pFN046, pFN047, pFN048, pFN049 and data were obtained with this construct. The V2 SSP and its pFNO50, respectively. It was discovered at this stage that the homologs from other viruses are thought to be particularly gene encoding p38 in pFNO46 was not functional and there preferred because they allow maximal expression of the bio fore plants transformed with the vectorpFNO46 were consid synthetic pathway genes and the simultaneous silencing of ered as additional controls i.e. essentially the same as for pFN050. other genes in the same cells in the developing seed. About 100 pooled T. seeds were taken from each trans Example 12 formed plant for fatty acid composition determination of seed 10 lipid by FAME preparation and GC analysis. Six T seedlings Assaying Sterol Content and Composition in Oils from each transgenic line were also grown to produce T. seeds. The fatty acid composition in total lipid extracted from the The phytosterols from 12 vegetable oil samples purchased T. Seeds was determined using GC. The analysis showed a 15 from commercial Sources in Australia were characterised by range of levels of ARA and the intermediates EDA (20:2006) GC and GC-MS analysis as O-trimethylsilyl ether (OTMSi and DGLA (20:3c)6) in the T. populations. The data for ARA ether) derivatives as described in Example 1. Sterols were is shown in FIGS. 13 and 14. identified by retention data, interpretation of mass spectra and FIG. 13 shows a box-plot analysis of the ARA level in the comparison with literature and laboratory standard mass lipid of the populations of the T seeds. It was evident that the spectral data. The sterols were quantified by use of a 5B (H)- median (50" percentile) level of ARA in the populations of Cholan-24-ol internal standard. The basic phytosterol struc seeds which contained the FP1:p 19 and 35S:V2 genes in ture and the chemical structures of some of the identified addition to the ARA biosynthetic genes was significantly Sterols are shown in FIG. 19 and Table 25. higher than in seeds containing the defective FP1:p38 gene or The vegetable oils analysed were from: Sesame (Sesamum the control T-DNA from pFP050 which did not contain an 25 indicum), olive (Olea europaea), Sunflower (Helianthus SSP gene. The average ARA levels for seeds transformed annus), castor (Ricinus communis), canola (Brassica napus), with genes encoding p19 and V2 were greater than for seeds safflower (Carthamus tinctorius), peanut (Arachis transformed with the p38 gene or those without an SSP (FIG. hypogaea), flax (Linum usitatissimum) and Soybean (Glycine 14). One FP1:p 19 and two FP1:V2 lines exhibited about 19%, max). In decreasing relative abundance, across all of the oil 20% and 23% ARA, respectively. These were outliers and 30 samples, the major phytosterols were: B-sitosterol (range therefore not included in the calculations for the box-plot 28-55% of total sterol content), A5-avenasterol (isoflucos analysis. Fewer plants transformed with the T-DNAs com terol) (3-24%), campesterol (2-33%), A5-stigmasterol (0.7- prising the genes FP1:P0 and 35S:V2 survived compared to 18%), A7-stigmasterol (1-18%) and A7-avenasterol the other constructs; it is thought that these genes could be (0.1-5%). Several other minor sterols were identified, these detrimental to plant health in the MC49 background. 35 were: cholesterol, brassicasterol, chalinasterol, campestanol Not only were the ARA levels significantly different and eburicol. Four C29:2 and two C30:2 sterols were also among the constructs, the levels in seed lipid of the first detected, but further research is required to complete identi intermediate of the pathway from LA to ARA, namely EDA fication of these minor components. In addition, several other (20:2006), was observed to be lower in lines expressing unidentified sterols were present in some of the oils but due to either V2 or p 19 than in seeds lacking an SSP or containing 40 their very low abundance, the mass spectra were not intense the p38 construct (FIG. 15). In T. seeds, one population enough to enable identification of their structures. containing the construct expressing p19 exhibited 38% ARA The sterol contents expressed as mg/g of oil in decreasing as a percentage of total fatty acids in the seed lipid. amount were: canola oil (6.8 mg/g), Sesame oil (5.8 mg/g), A range of transgenic T lines were progressed to the T flax oil (4.8–5.2 mg/g), Sunflower oil (3.7-4.1 mg/g), peanut generation. The levels of ARA in the T seeds expressing V2 45 oil (3.2 mg/g), safflower oil (3.0 mg/g), soybean oil (3.0 were either the same as compared to the previous generation, mg/g), olive oil (2.4 mg/g), castor oil (1.9 mg/g). The % sterol or indeed exhibited increased levels compared to their T3 compositions and total sterol content are presented in Table parents (FIG. 16). The lines expressing p19 showed more 26. varied ARA levels. The ARA level was decreased in some lines while in others it was the same or increased compared to 50 TABLE 25 the T3 parents. In contrast, the lines containing the defective p38 gene or lacking an SSP generally showed a decline in the IUPAC Systematic names of identified Sterols. level of ARA and an increase in the levels of intermediates Sterol (FIG. 18). In some of these lines, ARA was reduced to about No. Common name(s) IUPAC/Systematic name 1% and levels of EDA had increased to about 20%. The mean 55 1 cholesterol cholest-5-en-3?-ol levels of ARA in T. seeds were higher for lines expressing 2 brassicasterol 24-methylcholesta-5,22E-dien p19 and V2 compared to lines expressing p38 or lacking an 3?-ol SSP (FIG. 17). 3 chalinasterol. 24-methylene 24-methylcholesta-5,24(28)E- cholesterol dien-3?-ol This experiment showed that the expression of an SSP in 4 campesterol. 24-methyl- 24-methylcholest-5-en-3?-ol seeds of a transgenic plant along with additional genes for a 60 cholesterol LC-PUFA biosynthetic pathway not only increased the level 5 campestanol/24-methyl- 24-methylcholestan-3?-ol of production of the desired fatty acid in the first generation of cholestanol progeny, but also stabilised the level of the fatty acid produc 7 A5-stigmasterol 24-ethylcholesta-5,22E-dien 3?-ol tion in later generations such as the third or fourth generation 9 ergost-7-en-3?-ol 24-methylcholest-7-en-3?-ol of progeny. The increased fatty acid production was accom 65 eburicol 44,14-trimthylergosta-8.24(28)- panied by decreased levels of intermediate fatty acids in the biosynthetic pathway. The SSP's p19 and V2 expressed from US 8,946,460 B2 115 116 TABLE 25-continued Among all the seed oil samples, the major phytosterol was generally B-sitosterol (range 30-57% of total sterol content). IUPAC systematic names of identified sterols. There was a wide range amongst the oils in the proportions of the other major sterols: campesterol (2-17%), A5-stigmas Sterol is terol (0.7-18%), A5-avenasterol (4-23%), A7-stigmasterol No. Common name(s) IUPAC/Systematic name (1-18%). Oils from different species had a different sterol 12 B-sitosterol/24- 24-ethylcholest-5-en-3?-ol profile with some having quite distinctive profiles. In the case ethylcholesterol of canola oil, it had the highest proportion of campesterol 13 D5-avenasterol isofucosterol 24-ethylcholesta-5,24(28)Z-dien- (33 .6%), while the other species samples generally had lower 3?-ol 10 levels, e.g. up to 17% 1n peanut oil. Safflower oil had a 19 D7-stigmasterol stigmast- 24-ethylcholest-7-en-3?-ol relatively high proportion of A7-stigmasterol (18%), while 7-en-3b-ol this sterol was usually low in the other species oils, up to 9% 20 D7-avenasterol 24-ethylcholesta 7,24(28)-dien- in sunflower oil. Because they were distinctive for each spe 3?-ol cies, sterol profiles can therefore be used to help in the iden tification of specific vegetable or plant oils and to check their genuineness or adulteration with other oils. TABLE 26

Sterol content and composition of assayed plant oils.

Sun- Saf flower flower Sterol Sterol common Sun- cold- Saf- cold- Flax Flax Soy number name Sesame Olive flower pressed Castor Canola flower pressed Peanut (linseed) (linseed) bean

1 cholesterol O.2 O.8 O.2 O.O 0.1 O.3 O.2 O.1 O.2 0.4 0.4 O.2 2 brassicasterol O.1 O.O O.O O.O O.3 O.1 O.O O.O O.O O.2 O.2 O.O 3 chalinasterol. 24- 1.5 O.1 O.3 O.1 1.1 2.4 O.2 O.1 O.9 1.5 1.4 O.8 methylene cholesterol 4 campesterol. 24- 16.2 2.4 7.4 7.9 8.4 33.6 12.1 8.5 17.4 15.7 14.4 16.9 methylcholesterol 5 campestanol/24- 0.7 0.3 0.3 0.1 0.9 0.2 0.8 0.8 0.3 0.2 O.2 0.7 methylcholestanol 6 C29:2: O.O O.O O.1 O.2 O.O O.1 O.S O.S O.O 1.2 1.3 O.1 7 A5-stigmasterol 6.4 1.2 7.4 7.2 18.6 0.7 7.0 4.6 6.9 S.1 5.8 17.6 8 unknown O.S 1.3 0.7 O.6 0.8 0.7 0.7 1.3 0.4 0.7 O6 1.3 9 ergost-7-en-3?-ol O.1 O.1 1.9 1.8 O.2 0.4 2.7 4.0 1.4 1.4 1.4 1.O O unknown O.O 1.3 O.9 O.8 1.2 O.9 1.8 0.7 1.2 0.7 O.S 0.7 1 eburicol 1.6 1.8 4.1 4.4 1.5 1.O 1.9 2.9 1.2 3.5 3.3 O.9 2 B-sitosterol/24- 55.3 45.6 43.9 43.6 37.7 SO.8 40.2 35.1 57.2 29.9 28.4 40.2 ethylcholesterol 3 A5-avenasterol 8.6 16.9 7.2 4.1 19.3 4.4 7.3 6.3 5.3 23.0 24.2 3.3 isoflucosterol 4 triterpenoid O.O 2.4 O.9 1.1 O.O O.O 1.6 1.9 O.O O.O O.O O.9 alcohol 5 triterpenoid O.O O.O 0.7 O.6 O.O O.O 2.8 1.8 O.O O.O O.3 O.O alcohol 6 C29:2: O.O O.S 0.7 0.7 1.5 1.2 2.8 1.9 2.0 1.O 0.7 O.S 7 C29:2: 1.O O.9 2.3 2.4 0.6 0.4 1.3 1.9 O.9 1.O 1.O 1.O 8 C30:28 O.O O.O O.O O.O 1.9 O.O O.O O.O O.O O.O O.O O.O 9 A7-stigmasterol 2.2 7.1 9.3 10.9 2.3 O.9 1O.S 18.3 1.1 7.9 8.7 S.6 Stigmast-7-en-33 ol 2O A7-avenasterol 1.3 O.1 4.0 3.6 0.6 O.2 2.0 4.7 0.7 0.4 0.4 O.6 21 unknown 0.7 7.1 O.9 O.8 O.O 0.4 O.3 0.4 O.O 3.0 3.6 O.O 22 unknown O.3 O.O O.3 O.9 O.O O.O 1.2 1.3 O.2 O.1 O.O O.3 23 unknown O.2 O.2 O.3 O.3 O.2 O.1 O.3 O.2 O.2 O.1 O.2 O.S 24 unknown O.O 3.1 O.9 1.3 0.6 0.4 O.2 0.4 0.7 1.7 1.9 O.8 25 unknown O.9 0.4 O.3 O.S O.3 O.1 O.S 0.7 O.3 O.1 O.1 O.6 26 C30:2 2.2 6.O 4.6 5.7 1.4 O.6 1.O 1.2 1.2 1.2 1.1 5.2 27 unknown O.O 0.4 0.4 O.3 O.3 O.2 O.1 O.2 O.3 O.1 O.O O.3

Sum 1OOO 1OO.O 1OOO 1OO.O 1OO.O 1OO.O 1OOO 1OOO 1OO.O 1OO.O 1OOO 1OO.O Total sterol (mgg 5.8 2.4 4.1 3.7 1.9 6.8 3.2 3.0 3.2 4.8 5.2 3.0 oil)

C29:2* and and C30:2* denotes a C29 sterol with two double bonds and a C30 sterol with two double bonds, respectively US 8,946,460 B2 117 118 Two samples each of sunflower and safflower were com had previously been shown to have activity on EPA and DHA pared, in each case one was produced by cold pressing of fatty acid Substrates in transgenic Yarrowia lipolytica (U.S. seeds and unrefined, while the other was not cold-pressed and Pat. No. 7,879,591). refined. Although some differences were observed, the two Additional LPAATs were identified by the inventors. Sources of oils had similar sterol compositions and total sterol Micromonas pusilla is a microalga that produces and accu contents, suggesting that processing and refining had little mulates DHA in its oil, although the positional distribution of effect on these two parameters. The Sterol content among the the DHA on TAG in this species has not been confirmed. The samples varied three-fold and ranged from 1.9 mg/g to 6.8 Micromonas pusilla LPAAT (SEQID NO: 66. Accession No. mg/g. Canola oil had the highest and castor oil the lowest XP 002501997) was identified by searching the Micromo sterol content. 10 nas pusilla genomic sequence using the Arabidopsis LPAAT2 as a BLAST query sequence. Several candidate sequences Example 13 emerged and the sequence XP 002501997 was synthesised for testing as a likely LPAAT enzyme with activity on C22 Increasing Accumulation of DHA at the sn-2 TAG LC-PUFA. The Ricinus communis LPAAT was annotated as a Position 15 putative LPAAT in the castor genome sequence (Chan et al., 2010). Four candidate LPAATs from the castor genome were The present inventors considered that DHA accumulation synthesised and tested in crude leaf lysates of infiltrated N. at the Sn-2 position in TAG could be increased by co-express benthamiana leaf tissue. The candidate sequence described ing an 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) here showed LPAAT activity. together with the DHA biosynthesis pathway such as con A number of candidate LPAATs were aligned with known ferred by the GA7 constructor its variants. Preferred LPAATs LPAATs on a phylogenetic tree (FIG. 20). It was noted that are those which can act on polyunsaturated C22 fatty acyl the putative Micromonas LPAAT did not cluster with the CoA as Substrate, resulting in increased insertion of the poly putative C22 LPAATs but was a divergent sequence. unsaturated C22 chain at the sn-2 position of LPA to form PA, As an initial test of various LPAATs for their ability to use relative to the endogenous LPAAT. Cytoplasmic LPAAT 25 DHA-CoA as Substrate, chimeric genetic constructs are made enzymes often display varied Substrate preferences, particu for constitutive expression of exogenous LPAATs in N. larly where the species synthesises and accumulates unusual benthamiana leaves, each under the control of the 35S pro fatty acids in TAG. A LPAAT2 from Limnanthes douglasii moter, as follows: 35S: Arath-LPAAT2 (Arabidopsis ER was shown to use erucoyl-CoA (C22:1-CoA) as a substrate LPAAT): 35S:Ricco-LPAAT2: 35S:Limal-LPAAT (Limnan for PA synthesis, in contrast to an LPAAT1 from the same 30 thes alba LPAAT): 35S:Sacce-Slclp (S. cerevisiae LPAAT): species that could not utilise the C22 substrate (Brown et al., 35S: Micpu-LPAAT (Micromonas pusilla LPAAT): 35S: 2002). Moral-LPAATI (Mortierella alpina LPAAT). A 35S:p 19 con Known LPAATs were considered and a number were struct lacking an exogenous LPAAT is used as a control in the selected for testing, including some which were not expected experiment. Each of these constructs is introduced via Agro to increase DHA incorporation at the Sn-2 position, as con 35 bacterium into N. benthamiana leaves as described in trols. The known LPAATs included: Arabidopsis thaliana Example 1, and 5 days after infiltration, the treated leaf Zones LPAAT2: (SEQID NO: 63, Accession No. ABG48392, Kim are excised and ground to make leaf lysates. Each lysate et al., 2005), Limnanthes alba LPAAT (SEQ ID NO: 64, includes the exogenous LPAAT as well as the endogenous Accession No. AAC491.85, Lassner et al., 1995), Saccharom enzymes for synthesizing LPA. In vitro reactions are set up by nyces cerevisiae Slclp (SEQ ID NO: 65. Accession No. 40 separately adding '"C-labelled-OA, -LA or -ALA (C18 sub NP 010231, Zou et al., 1997), Mortierella alpina LPAATI strates), -ARA (a C20 substrate) and -DHA (C22) to the (SEQ ID NO: 67, Accession No. AED33305; U.S. Pat. No. lysates, in triplicate. Reactions are incubated at 25°C. and the 7,879,591) and Brassica napus LPAATs (SEQID NO: 68 and level of incorporation of the ''C labelled fatty acids into PA SEQID NO:69, Accession Nos ADC97479 and ADC97478 determined by TLC. The ability of each LPAAT to use DHA respectively). These were chosen to cover three groups of 45 relative to ARA and the C18 fatty acids is calculated. The LPAAT enzymes: 1) control plant seed LPAATs with typi meadowfoam, Mortierella and Saccharomyces LPAATs were cally low activity on unusual long-chain polyunsaturated found to have activity on DHA substrate, with radiolabelled fatty acids (including the Arabidopsis and Brassica LPAATs), PA appearing for these but not the other LPAATs. All LPAATs 2. LPAATs that had previously been demonstrated to act on were confirmed active by a similar oleic acid feed. C22 fatty acids by using C22 acyl-CoA as substrate, in this 50 To test LPAAT activity in seeds, several of the protein case erucic acid C22:1 (including the Limnanthes and Sac coding sequences or LPAATs are inserted into a binary vector charomyces LPAATs). 3. LPAATs which the inventors con under the control of a conlinin (pLuCnl1) promoter. The sidered likely to be able to utilise long-chain polyunsaturated resultant genetic constructs containing the chimeric genes, fatty acids such as EPA and DHA as substrates (including the Cnl1: Arath-LPAAT (negative control), Cnl1:Limal-LPAAT, Mortierella LPAAT). 55 Cnl:Sacce-Slclp, and Cnl1:Moral-LPAAT, respectively, are The Arabidopsis LPAAT2 (also designated LPAT2) is an then used transform B. napus and A. thaliana plants to gen endoplasmic reticulum-localised enzyme shown to have erate stable transformants expressing the LPAATs in a seed activity on C16 and C18 substrates, however activity on C20 specific manner. The transformed plants having the Cnl1: or C22 substrates was not tested (Kim et al., 2005). Limnan LPAAT constructs are crossed with plants expressing the thes alba LPAAT2 was demonstrated to insert a C22:1 acyl 60 GA7 construct or its variants (Example 5) which produce chain into the sn-2 position of PA, although the ability to use DHA in the seed to result in increased incorporation of DHA DHA as a substrate was not tested (Lassner et al., 1995). The at the sn-2 position of TAG. The constructs are also used to selected S. cerevisiae LPAAT Slclp was shown to have activ transform B. napus, C. sativa and A. thaliana plants that ity using 22:1-CoA in addition to 18:1-CoA as substrates, already contain the GA7 construct and variants thereof (Ex indicating a broad Substrate specificity with respect to chain 65 amples 2 to 5) to generate progeny carrying both the parental length (Zou et al., 1997). Again, DHA-CoA and other LC and LPAAT genetic constructs. Increased incorporation of PUFAs were not tested as substrates. The Mortierella LPAAT DHA at the sn-2 position of TAG is expected relative to the US 8,946,460 B2 119 120 incorporation in plants lacking the LPAAT encoding trans Gamez et al. (2003) Food Res International 36: 721-727. genes. Oil content is also improved in the seeds, particularly Garcia-Maroto et al. (2002) Lipids 37:417-426. for seeds producing higher levels of DHA, counteracting the Girke et al. (1998) Plant J. 15:39-48. trend seen in Arabidopsis seed as described in Example 2. Glicket al. (2008) Proc. Natl. Acad. Sci. U.S.A. 105-157-161. It will be appreciated by persons skilled in the art that Grant et al. (1995) Plant Cell Rep. 15:254-258. numerous variations and/or modifications may be made to the Hall et al. (1991) Proc. Natl. Acad. Sci. USA 88: 9320-9324 invention as shown in the specific embodiments without Hamilton and Baulcombe (1999) Science 286:950-952. departing from the spirit or scope of the invention as broadly Hamilton et al. (1997) Gene 200:107-16. described. The present embodiments are, therefore, to be Harayama (1998). Trends Biotechnol. 16: 76-82. considered in all respects as illustrative and not restrictive. 10 Hastings et al. (2001) Proc. Natl. Acad. Sci. U.S.A. 98:14304 The present application claims priority from U.S. 61/660, 14309. 392 filed 15 Jun. 2012, U.S. 61/663,344 filed 22 Jun. 2012, Hinchee et al. (1988) Biotechnology 6:915-922. U.S. 61/697,676 filed 6 Sep. 2012 and U.S. 61/782,680 filed Hoffmann et al. (2008) J. Biol. Chem. 283:22352-22362. 14 Mar. 2013, the entire contents of each of which are incor Hong et al. (2002a) Lipids 37:863-868. porated herein by reference. 15 Horiguchi et al. (1998) Plant Cell Physiol. 39:540-544. All publications discussed and/or referenced herein are Horvath et al. (2000) Proc. Natl. Acad. Sci. U.S.A. 97:1914 incorporated herein in their entirety. 1919. This application incorporates herein by reference U.S. Huang et al. (1999) Lipids 34:649-659. 61/660,392 filed 15 Jun. 2012, U.S. 61/663,344 filed 22 Jun. Inagaki et al. (2002) Biosci. Biotechnol. Biochem. 66:613 2012 and U.S. 61/697,676 filed 6 Sep. 2012. 621. Any discussion of documents, acts, materials, devices, Johansen and Carrington (2001) Plant Physiol. 126-930-938. articles or the like which has been included in the present Kajikawa et al. (2004) Plant Mol. Biol. 54:335-52. specification is solely for the purpose of providing a context Kajikawa et al. (2006) FEBS Lett 580:149-154. for the present invention. It is not to be taken as an admission Kim et al. (2005) Plant Cell. 2005 1073-89. that any or all of these matters form part of the prior art base 25 Knutzon et al. (1998).J. Biol Chem. 273:29360-6. or were common general knowledge in the field relevant to Koziel et al. (1996) Plant Mol. Biol. 32:393-405. the present invention as it existed before the priority date of Lassner (1995) Plant Physiol. 109:1389-94. each claim of this application. Leonard et al. (2000) Biochem. J.347.719-724. References Leonard et al. (2000b) Biochem. J. 350:765-770. Abbadi et al. (2004) Plant Cell 16:2734-2748. 30 Leonard et al. (2002) Lipids 37:733–740. Abbott et al. (1998) Science 282:2012-2018. Lewsey et al. (2007) Plant J. 50:240-252. Abdullah et al. (1986) Biotech. 4:1087. Lo et al. (2003) Genome Res. 13:455-466. Agaba et al. (2004) Marine Biotechnol. (NY) 6:251-261. Lu and Kang (2008) Plant Cell Rep. 27:273-8. Alvarez et al. (2000) Theor Appl Genet 100:319-327. Mallory et al. (2002) Nat. Biotech. 20:622-625. Armbrust et al. (2004) Science 306:79-86. 35 Marangoni et al. (1995) Trends in Food Sci. Technol. 6: Attila Keresztet al. (2007) Nature Protocols 2:948-952. 329-335. Baumberger et al. (2007) Curr. Biol. 17:1609-1614. Meesapyodsuket al. (2007) J Biol Chem 282: 20191-20199. Baumlein et al. (1991) Mol. Gen. Genet. 225:459-467. Meng et al. (2008) J. Gen. Virol. 89:2349-2358. Baumlein et al. (1992) Plant J. 2:233-239. Meyer et al. (2003) Biochem. 42:9779-9788. Beaudoinet al. (2000) Proc. Natl. Acad. Sci. U.S.A. 97:6421 40 Meyer et al. (2004) Lipid Res 45:1899-1909. 6426. Michaelson et al. (1998a) J. Biol. Chem. 273:19055-19059. Beclinet al. (2002) Curr. Biol. 12:684-688. Michaelson et al. (1998b) FEBS Lett. 439:215-218. Berberich. et al. (1998) Plant Mol. Biol. 36:297-306. Murashige and Skoog (1962) Physiologia Plantarum 15:473 Bortolamiolet al. (2007) Curt. Biol. 17:1615-1621. 497. Broun et al. (1998) Plant J. 13:201-210. 45 Napier et al. (1998) Biochem. J. 330:611-614. Brown et al. (2002) Biochem J.364:795-805. Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453. Chapman et al. (2004) Gen. Dev. 18:1179-1186. Niedz et al. (1995) Plant Cell Reports 14:403. Chen et al. (2004) The Plant Cell 16:1302-1313. Ow et al. (1986) Science 234:856-859. Cheng et al. (1996) Plant Cell Rep. 15:653-657. Parker-Barnes et al. (2000) Proc. Natl. Acad. Sci. USA Cheng et al. (2010) Transgenic Res 19: 221-229. 50 97:8284-8289. Chikwamba et al. (2003) Proc. Natl. Acad. Sci. U.S.A. 100: Pereira et al. (2004a) Biochem. J. 378:665-671. 11127-11132. Pereira et al. (2004b) Biochem. J. 384:357-366. Cho et al. (1999a).J. Biol. Chem. 274:471-477. Perrinet al. (2000) Mol Breed 6:345-352. Cho et al. (1999b) J. Biol. Chem. 274:37335-37339. Petrie et al. (2010a) Metab. Eng. 12:233-240. Clough and Bent (1998) Plant J. 16:735-43. 55 Petrie et al. (2010b) Plant Methods 11:6:8. Coutu et al. (2007) Transgenic Res. 16: 771-781. Petrie et al. (2012) Transgenic Res. 21:139-147. Damude et al. (2006). Proc Natl Acad Sci USA 103: 9446 Potenza et al. (2004) In Vitro Cell Dev Biol Plant 40:1-22. 9451. Prasher et al (1985) Biochem. Biophys. Res. Commun. 127: Denic and Weissman (2007) Cell 130:663-677. 31-36. Domergue etal (2002) Eur. J. Biochem. 269:4105-41 13. 60 Qi et al. (2002) FEBS Lett. 510:159-165. Domergue et al. (2002) Eur. J. Biochem. 269:4105-41 13. Qi et al. (2004) Nat. Biotech. 22:739-745. Domergue et al. (2003) J. Biol. Chem. 278: 35115-35126. Qiu et al. (2001).J. Biol. Chem. 276:31561-31566. Domergue et al. (2005) Biochem. J. 1389: 483-490. Reddy and Thomas (1996) Nat. Biotech. 14:639-642. Dunoyer et al. (2004) The Plant Cell 16:1235-1250. Reddy et al. (1993) Plant Mol. Biol. 22:293-300. Ellerstromet al. (1996) Plant Mol. Biol. 32:1019-1027. 65 Robert et al. (2005) Func. Plant Biol. 32:473-479. Fujimura et al. (1985) Plant Tissue Culture Lett. 2:74. Robert et al. (2009) Marine Biotech 11:410-418. Fukunaga (2009) EMBO J. 28:545-55. Ruiz-Lopez et al. (2012) Transgenic Res. 21:139-147. US 8,946,460 B2 121 122 Saha et al. (2006) Plant Physiol. 141:1533-1543. Trautwein (2001) European J. Lipid Sci. and Tech. 103:45 Saito et al. (2000) Eur. J. Biochem. 267: 1813-1818. 55. Sakuradani et al. (1999) Gene 238:445-453. Tvrdik (2000) J. Cell Biol. 149:707-718. Sato et al. (2004) CropSci. 44: 646-652. Venegas-Caleron et al. (2010) Prog. Lipid Res. 49:108-119. 5 Voinnet et al. (2003) Plant J. 33:949-956. Sakuradani et al. (2005) Appl. Microbiol. Biotechnol. Wallis and Browse (1999) Arch. Biochem. Biophys. 365:307 66:648-654. 316. Sayanova et al. (2006) J Biol Chem 281: 36533-36541. Watts and Browse (1999b) Arch. Biochem. Biophys. 362: Sayanova et al. (1997) Proc. Natl. Acad. Sci. U.S.A. 94:4211 175-182. 4216. 10 Weiss et al. (2003) Int. J. Med. Microbiol. 293:95:106. Sayanova et al. (2003) FEBS Lett. 542:100-104. Whitney et al. (2003) Planta 217:983-992. Sayanova et al. (2006) Planta 224:1269-1277. Winans (1988) J. Bacteriol. 170:4047-54. Sayanova et al. (2007) Plant Physiol 144:455-467. Wood (2009) Plant Biotechnol J. 7:914-24. Singh et al. (2005) Curr. Opin. in Plant Biol. 8:197-203. Wu et al. (2005) Nat. Biotech. 23:1013-1017. Speranza et al. (2012) Process Biochemistry (In Press). Yang et al. (2003) Planta 216:597-603. Sperling et al. (2000) Eur. J. Biochem. 267:3801-3811. Zanket al. (2002) Plant J.31:255-268. Sperling et al. (2001) Arch. Biochm. Biophys. 388:293-8. Zanket al. (2005) WO 2005/012316 Sprecher et al. (1995) J. Lipid Res. 36:2471-2477. Zhang et al. (2004) FEBS Lett. 556:81-85. Spychalla et al., (1997) Proc. Natl. Acad. Sci. U.S.A. Zhang et al. (2006) 20:3255-3268. 94:1142-1147. Zhang et al. (2007a) FEBS Letters 581: 315-319. Stalker et al. (1998).J. Biol. Chem. 263:6310-6314. Zhang et al. (2008)Yeast 25: 21-27. Thillet et al. (1988).J. Biol. Chem. 263:12500-12508. Zhou et al. (2007) Phytochem. 68:785-796. Tonon et al. (2003) FEBS Lett. 553:440-444. Zhou et al. (2008) Insect Mol Biol 17: 667-676. Toriyama et al. (1986) Theor. Appl. Genet. 205:34. Zou et al. (1997) Plant Cell. 9:909-23.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 72

<21 Oc SEO ID NO 1 <211 LENGTH: 21527 <212> TYPE DNA <213> ORGANISM: Artificial Sequence <22 Os FEATURE; OTHER INFORMATION: p.JP3416-GAT nucleotide sequence. <4 OOs SEQUENCE: 1 toctdtggitt gg catgcaca tacaaatgga cqaacggata aaccttitt.ca cqcc ctittta 60 aatat cogat tattotaata aacgctic titt totcittaggit ttaccc.gc.ca atatat cotg 12O tdaaacactg at agtttaaa citgaaggcgg gaaacgacaa totgct agtg gatctoccag 18O

to acgacgtt gtaaaacggg cqc.ccc.gcgg aaagcttgcg gcc.gc.ccgat ct agta acat 24 O

agatgacacic gogog.cgata atttatcct a gtttgcgc.gc tatattttgt tttctatogc 3 OO

gtattaaatg tataattgcg ggactictaat cataaaaacc catctgataa ataacgtcat 360 gcattacatgttaattatta cqtgcttaac gtaattcaac agaaattata tdataatcat 42O

cgcaagaccg gcaa.caggat tcaat cittaa gaaactittat togccaaatgt ttgaacgatc 48O gg.cgc.gc.ctic attagtgagc cttct cago C titt.ccgittaa cqtagtag td citgtc.ccacc 54 O

ttatcaaggit tagagaaagt agcct tccala gCaccgtagt aagaga.gcac Cttgtagttg 6 OO agt cc cc act tcttagcigala aggaacgaat cittctgctaa cct caggctg. tctgaattga 660

ggcatat cag ggaagaggtg gtggatalacc tacagttaa ggitat.cccat aagc.cagttc 72O

acgitatic ct c tagaaggat c gatat caacg gtgttgat Caa cagcgtagtt aacccaagaa 78O

aggtgctitat cagatggaac aacagggagg tag tatgag aagtagagala gtgagcgaaa 84 O

agg tacatgt aagcgatcca gtttc.cgaaa gtgalaccacc agtaagcaac aggccalagag 9 OO

tat coagtag caagcttgat aacagcggitt Ctaacaa.cat gagaaacgag catcCaagaa 96.O

gcctictt.cgt agttctt Ctt acggagaact ttctagggit ggagaacgta gatc.ca.gaaa 102O

gcttgaacaa galagt ccaga ggtaa.cagga acgaaagttcc aagcttgaag totagoccaa 108O