Edible Fruits Extracts Affect Intestinal Microbiota Isolated from Patients with Noncommunicable Diseases Associated with Chronic Inflammation

Experimental articles

UDC 579.61 https://doi.org/10.15407.biotech13.05.087

EDIBLE FRUITS EXTRACTS AFFECT INTESTINAL MICROBIOTA ISOLATED FROM PATIENTS WITH NONCOMMUNICABLE DISEASES ASSOCIATED WITH CHRONIC INFLAMMATION

T. V. Meleshko1, 2 1 Uzhhorod National University, Department O. V. Pallah1, 2 of Clinical Laboratory Diagnostics and Pharmacology, R. O. Rukavchuk2 Faculty of Dentistry, Ukraine L. S. Yusko1, 2 2 Uzhhorod National University, N. V. Boyko1, 2 Research Development and Educational Centre of Molecular Microbiology and Mucosal Immunology, Ukraine

E-mail: [email protected] Received 27.07.2020 Revised 08.10.2020 Accepted 31.10.2020

The aim of our study was to investigate the gut microbiota in patients with noncommunicable diseases associated with chronic inflammation, including obesity, type 2 diabetes, atherosclerosis, and cardiovascular disease as well as to find out potential ability of edible plants fruits extracts to inhibit the growth of selected conditionally pathogenic microorganisms. Limited clinical trial was performed and gut microbiota analysis was done using routine methods and qPCR. The antibacterial properties of edible plants fruits in relation to the selected potentially pathogenic microorganisms were studied. The composition of the intestinal microbiota of obese patients was characterized by an increase in the number of Enterococcus spp. and Lactobacillus spp. along with a decrease in the amount of Escherichia coli. Decreases in E. coli and lactobacilli were observed in patients with type 2 diabetes. In atherosclerosis, an increase in streptococci, enterococci, and enterobacteria was observed, whereas in patients with cardiovascular disease there was an additional increase in staphylococci and candida along with a decrease in E. coli. Decreases in Bifidobacterium spp., Bacteroides spp., Roseburia intestinalis and Akkermansia muciniphila were observed in patients of all groups. The growth of Klebsiella spp. was inhibited by red currant (Ribes rubrum) and plum (Prunus domestica) extracts; Enterobacter spp. — cherry (Prunus avium) extract; Proteus spp. — extracts of blueberry (Vaccinium myrtillus) and dogwood (Cornus mas); Staphylococcus spp. — the extracts of black currant (Ribes nigrum), cherry (Prunus avium), plum (Prunus domestica), jostaberry (Ribes nigrum  Ribes divaricatum  Ribes uva-crispa), cherry plum (Prunus cerasifera) and dogwood (Cornus mas). The obtained data can be used for early diagnosis of noncommunicable diseases and for their prevention with the help of personalized nutrition.

Key words: obesity, type 2 diabetes mellitus, atherosclerosis, cardiovascular diseases, gut microbiota, edible plants fruits.

According to the World Health deaths in the world [1]. NCDs result from a Organization (WHO), non-communicable combined influence of genetic, physiological, diseases (NCDs) are chronic diseases that environmental, and behavioral factors [2]. are not transmitted from person to person, Studies of changes in the intestinal have a long course, and progress slowly. In microbiome and its role in the occurrence the late twentieth century, NCDs turned of NCDs have become extremely relevant in into a global epidemic and one of the greatest recent years [3]. Microbiome is part of human threats to human life and health. According physiology and is significantly involved in a to the WHO, 40 million people die annually wide range of vital physiological processes, from NCDs, which accounts for 70% of all including energy homeostasis and metabolism,

87 BIOTECHNOLOGIA ACTA, V. 13, No 5, 2020 synthesis of vitamins and other important fruits which are characterized by high nutrients, endocrine signaling, prevention biologically active compounds (BAC) of colonization by pathogens, regulation contents and ability to stimulate the growth of immune function, and metabolism of of beneficial microorganisms and inhibit xenobiotics, carcinogens, and other harmful the growth of conditionally pathogenic compounds [4]. microorganisms could be perspective Persistent low-grade inflammatory components for personalized nutrition. response underscores metabolic syndrome and Therefore, the aim of our research was to is a risk factor for cardiovascular diseases study intestinal microbiota in patients with (CVDs) [5, 6]. Inflammatory markers are NCDs related to chronic inflammation, namely associated with obesity and the risk of obesity- obesity, T2D mellitus, atherosclerosis, and related CVDs [7]. Perturbation of intestinal CVDs as well as to find out potential ability microbiota and changes in gut permeability of edible plants fruits extracts to inhibit the are triggers for the chronic inflammatory growth of selected conditionally pathogenic state [8]. “Metabolic endotoxaemia” is a term microorganisms. used to describe a link between gut bacteria, endotoxins, and their circulating levels, with Materials and Methods inflammatory-induced obesity and metabolic diseases linking it to CVDs [9]. Participants and study design Some research studies [10] demonstrated In order to study gut microbiota in patients that intestinal microbiota changes related to with NCDs related to chronic inflammation, obesity lead to threshold inflammation. In we performed a limited clinical case study, in obese people, intestinal microbiota changes which four groups were formed: 1 — patients stimulate the absorption of monosaccharides with obesity; 2 — patients with type 2 diabetes; due to the increased number of capillaries 3 — patients with atherosclerosis; 4 — patients in the small intestine epithelium [11] and with cardiovascular diseases. In order to significantly increase the ability to obtain achieve this goal, we examined 10 people from more energy from food by increasing the each group. number of microorganisms capable of The inclusive criteria for obesity were the fermenting indigestible carbohydrates in the value of the body mass index (BMI), which colon [12, 13]. Obesity is a major risk factor exceeds () 30 kg/m2 [19]; signed informed for the development of type 2 diabetes (T2D), consent to participate in the study. Exclusion which leads to the destruction of insulin criteria: smoking, alcohol or drug use, diabetes receptors and causes resistance to insulin. In mellitus, CVDs, clinically significant kidney turn, patients with diabetes also tend to suffer or liver disease (or other organs and organ from comorbidities, such as hypertension and systems), acute inflammatory diseases at dyslipidemia, which further accelerates the the time of examination, cancer; significant atherosclerotic process, and, therefore, such lifestyle changes, mainly of dietary habits and patients have an extremely high cardiovascular physical activity in the period shorter than 6 risk [14]. Atherosclerosis is a major risk months. factor for CVDs assuming accumulation of Patients with T2D were selected according cholesterol and macrophages on arteries to the criteria typical of this nosology [20]: walls, thus contributing to the formation fasting plasma glucose  6.1 mmol/l; impaired of atherosclerotic plaques [15]. Recent glucose tolerance — two hours after the oral studies suggest that intestinal microbiota dose a plasma glucose 7.8–11.1 mmol/l; disruption may also enhance development of glycated hemoglobin (HbA1c)  6.5%; signed atherosclerosis and CVDs [16, 17]. informed consent to participate in the study. In our opinion, among numerous NCDs, it Exclusionary criteria were smoking, alcohol, is necessary to distinguish a group of diseases or drug abuse; pregnancy; an unstable medical directly relating to changes in the microbiome status; significant lifestyle changes, mainly and the main trigger of which is chronic of dietary habits and physical activity in the inflammation, that is obesity, T2D mellitus, period shorter than 6 months. No participants atherosclerosis, and CVDs. had clinically significant cardiovascular, renal Nutrition is the most important factor or liver disease or a history of cancer. that regulates gut microbiota composition. Inclusion criteria for atherosclerosis were Personalized nutrition is one of the most [21]: patients with a BMI in the range of normal effective approaches for prevention and weight; low cardiovascular risk (SCORE  1%); treatment of NCDs [18]. The edible plants’ total cholesterol level below 8 mmol/l; total

88 Experimental articles triglycerides levels below 2.3 mmol/l; signed fold serial dilution of samples was performed informed consent to participate in the study. in PBS and plated correspondingly on the Exclusion criteria: patients receiving lipid- following nutrient media: Mitis Salivarius lowering therapy (statins, ezetimibe, etc.) or Agar, Bile Esculin Agar, Mannitol Salt patients who do not meet the minimum period Agar, Endo Agar, Bismuth Sulphite Agar, of 3 months of discontinuation of therapy; HiCrome Clostridial Agar, Sabouraud the lipid profile outside the inclusion criteria; Dextrose Agar, Lactobacillus MRS Agar, diabetes mellitus; SCORE > 1%; proven Bifidobacterium Agar, Bacteroides bile secondary causes of dyslipidemia; presence of esculin agar, Propionibacter Isolation Agar, manifest cardiovascular system disease in the L.D. Esculin HiVegTM Agar (manufactured form of coronary artery disease, past stroke, by HiMedia Laboratories, India), UriSelect™ TIA, MI, etc.; presence of acute diseases, 4 Medium (Bio-Rad Laboratories, Inc, USA), chronic deterioration, or presence of infection, and Blaurock semi-liquid modified hepatic which may distort the laboratory parameters; medium (manufactured by Liofilchem, Italy). significant lifestyle changes, mainly of dietary Identification of isolated microorganisms was habits and physical activity in the period performed using biochemical test systems shorter than 6 months. ANAERO-23, ENTERO-24, NEFERM-test, The following inclusion criteria were Candida-23, STAPHY-16, and STREPTO test used to select patients with CVDs: diagnosed 24 (Erba Lachema s.r.o., Czech Republic). coronary heart disease, stroke, carotid artery Real-time polymerase chain reaction stenosis [22]; SCORE 5%; hyperlipidemia; (qPCR) was performed on an AriaMx signed informed consent to participate in instrument (manufactured by Agilent the study. Exclusion criteria were smoking, Technologies, USA) using specific primers alcohol, or drug abuse; pregnancy; an unstable (Table 1). Isolation of bacterial DNA was medical status; clinically significant renal or performed using the ZymoBIOMICS DNA liver disease, acute inflammatory diseases at Mini Kit (Zymo Research, USA) according to the time of examination or a history of cancer; the instructions for use. The concentration of significant lifestyle changes, mainly of dietary isolated DNA in the samples was checked on habits and physical activity in the period a DeNovix DS-11 FX + spectrophotometer/ shorter than 6 months. fluorometer (DeNovix Inc., USA). The Transcarpathian Regional Clinical Cardiology Dispensary was the place of Extracts preparation inpatient examination of patients diagnosed Using Grindomix™ electric mixer, with atherosclerosis and CVDs, and for we obtained native homogenates of the patients with obesity and T2D — the following edible plants fruits (grown in the therapeutic department of the Mukachevo mountainous regions of Zakarpattia): Ribes Central District Hospital. rubrum (red currant), Prunus avium (sweet According to the conclusions of the cherry), Prunus  domestica (plum), Ribes  Commission on Biomedical Ethics (Protocol nidigrolaria (jostaberry), Vaccinium myrtillus №6/1 of 26.05.2020), all studies were (blueberry), Ribes nigrum (black currant), performed in compliance with the basic Prunus cerasifera (alycha) and Cоrnus mas L. provisions of the Good Clinical Practice (cornelian cherry). The obtained homogenates (GMP) (1996), Convention on Human Rights were filtered through nylon nanofilters with a and Biomedicine of the Council of Europe pore width of 44 μm (BD Falcon, USA). (04.04.1997), the World Medical Association We studied the antibacterial properties of Declaration of Helsinki — Ethical Principles the above-mentioned edible plants fruits in for Medical Research Involving Human relation to the selected microorganisms such Subjects (1964–2013), and the orders of as Escherichia coli, Enterobacter cloacae, the Ministry of Health of Ukraine №690 of Klebsiella pneumoniae, Klebsiella oxytoca, 23.09.2009 and №616 of 03.08.2012, in which Proteus mirabilis, Pseudomonas aeruginosa, a person is an object of research. All patients Streptococcus pyogenes, Staphylococcus gave informed consent to participate in the aureus, Enterococcus faecalis, Candida study. albicans by culturing them in extracts obtained from these edible plants fruits [23]. The initial Analysis of gut microbiota concentration of the selected bacterial strains In order to study gut microbiota the was 1.5108 CFU/ml. After 24, 48 and 72 faecal samples were diluted with pre-reduced hour of their co-incubation the ten-fold serial phosphate-buffered saline (PBS), then the ten- dilution of samples was performed and plated

89 BIOTECHNOLOGIA ACTA, V. 13, No 5, 2020

Table 1. Primers used in the present study for real-time PCR analysis

Target group Primer sequence Reference

GAAGGTCCCCCACATTG Bacteroides spp. [23] CGCKACTTGGCTGGTTCAG

GGAGGAAGAAGGTCTTCGG Faecalibacterium prausnitzii [24] AATTCCGCCTACCTCTGCACT

GCGGTRCGGCAAGTCTGA Roseburia intestinalis [25] CCTCCGACACTCTAGTMCGA

CAGCACGTGAAGGTGGGGAC Аkkermansia muciniphila [26] CCTTGCGGTTGGCTTCAGAT

GGGTGGTAATGCCGGATG Bifidobacterium spp. [27] TAAGCCATGGACTTTCACACC correspondingly on an appropriate nutrient with CVDs, while an increase in the amount medium. The test cultures of microorganisms of streptococci was observed in patients with without edible plants fruits extracts were the atherosclerosis and CVDs. An increase in the control in the study. amount of enterococci was observed in patients Data analysis with obesity, atherosclerosis, and CVDs. Statistical analyses were performed using Therefore, an increase in the amount of coccal the statistical program Origin 2019 (OriginLab microorganism forms, namely Enterococcus Corporation, USA). All data are presented as spp., Streptococcus spp., and Staphylococcus median and interquartile range or the mean spp., within gut microbiota may indicate the ± SD. Nonparametric comparisons were done development of atherosclerosis and CVDs. using multiple comparisons Kruskal-Wallis In the intestinal microbiota of patients ANOVA with Dunn’s Test as post-hoc analysis. with obesity and T2D, Enterobacteriaceae P values < 0.05 were considered statistically demonstrated a significant decrease in the significant. Normally disturbed date were amount of normally fermenting Escherichia compared using Student’s t-test. coli at the normal concentration of Proteus vulgaris, Klebsiella spp., and Enterobacter spp. In patients with atherosclerosis, gut Results and Discussion microbiota demonstrated a significant Among the coccal microorganism forms increase in the amount of Klebsiella spp. and of the intestinal microbiota of obese patients, Enterobacter spp., while the amounts of E. coli there was a significant increase in the and P. vulgaris slightly exceeded the norm. amount of enterococci, while the amounts of In the intestinal microbiota of patients with streptococci and staphylococci were within CVDs, there was an increase in the amounts of the norm. The level of bacteria of the genera Enterobacter spp. and P. vulgaris, a decrease Enterococcus spp., Streptococcus spp., and in the value of E. coli, and a normal amount of Staphylococcus spp. in the gut microbiota Klebsiella spp. (Fig. 2). of patients with T2D was within the norm. According to the data obtained in the In patients with atherosclerosis, intestinal study, an increase in the amount of Klebsiella microbiota demonstrated an increase in the spp. was characteristic only of patients with amounts of enterococci and streptococci atherosclerosis, while an increase in the along with the normal value of staphylococci amounts of P. vulgaris and Enterobacter spp. amount. Under CVDs, patients showed an was observed in patients with atherosclerosis increase in the amounts of bacteria of the and CVDs. The concentration of E. coli was genera Enterococcus spp., Streptococcus spp., below the norm in patients with obesity, T2D, and Staphylococcus spp. in gut microbiota and CVDs, but in patients with atherosclerosis (Fig. 1). there was a slight excess of this bacterium. Analysis of the obtained data reveals Given the above, an increase in the amount of that an significant increase in the amount of enterobacteria, especially Klebsiella spp. and staphylococci within intestinal microbiota was Enterobacter spp., indicates the development characteristic only of the group of patients of atherosclerosis.

90 Experimental articles

Fig. 1. The patients gut microbiota composition: coccal microorganisms (n = 10) Bar graph showing the median values and interquartile range * represent significantly different values (P < 0.05)

Fig. 2. The patients gut microbiota composition: Enterobacteriaceae (n = 10) Bar graph showing the median values and interquartile range * represent significantly different values (P < 0.05)

91 BIOTECHNOLOGIA ACTA, V. 13, No 5, 2020

Anaerobic and facultative-anaerobic gut S. aureus after 48 h of co-cultivation and microbiota of obese patients was characterized K. pneumoniae, K. oxytoca, and P. aeruginosa by an increase in the value of Lactobacillus on 72 h of co-cultivation. The Prunus avium spp., normal values of Clostridium spp., extract totally inhibited growth of E. cloacae Faecalibacterium prausnitzii and yeast- and S. aureus on 48 h of co-cultivation as like fungi of the genus Candida, as well as a well as K. pneumoniae, K. oxytoca, P. aeru- decrease in the levels of Bifidobacterium spp., ginosa, E. faecalis, and P. mirabilis on 72 h of Bacteroides spp., Roseburia intestinalis, and co-cultivation. The growth of such bacterial Аkkermansia muciniphila. strains as K. pneumoniae, K. oxytoca, S. aureus, In the intestinal microbiota of patients and C. albicans was totally inhibited by Prunus with T2D, there was a decrease in the amounts domestica extract on 48 h of co-cultivation, of Bifidobacterium spp., Lactobacillus spp., while the strains of E. coli, E. cloacae, Bacteroides spp., F. prausnitzii, R. intestinalis, P. mirabilis, P. aeruginosa, and S. pyogenes and A. muciniphila, while the amounts of strains were totally inhibited after 72 h of yeasts of the genus Candida and Clostridium co-cultivation. The Ribes nigrum  Ribes spp. were within the norm. In the intestinal divaricatum  Ribes uva-crispa extract totally microbiota of patients with atherosclerosis inhibited growth of P. aeruginosa and S. aureus and CVDs, there was a decrease in the after 48 h of co-cultivation and E. cloacae values of Bifidobacterium spp., Bacteroides after 72 h of co-cultivation. The extract of spp., F. prausnitzii, R. intestinalis, and Vaccinium myrtillus on 48 h of co-cultivation A. muciniphila, as well as normal values totally inhibited growth of P. mirabilis as well of Lactobacillus spp., Clostridium spp. as s K. pneumoniae, K. oxytoca, and S. aureus An significant increase in the amount of after 72 h of co-cultivation. The growth Candida spp. within intestinal microbiota was of P. aeruginosa and S. aureus was totally characteristic only of the group of patients inhibited by Prunus cerasifera extract on 48 h with CVDs (Fig. 3 and Fig. 4). of co-cultivation, while such bacterial strains While analyzing the data obtained, we could as E. cloacae, K. pneumoniae, K. oxytoca, see that an increase in the concentration of P. mirabilis, E. faecalis, and C. albicans totally lactobacilli within gut microbiota is observed in inhibited after 72 h of co-cultivation. The obese patients, a decrease in the concentration Cornus mas extract totally inhibited growth of Lactobacillus spp. is characteristic of of P. mirabilis, S. aureus, and C. albicans after the microbiota of patients with T2D, while 48 h of co-cultivation. in patients with atherosclerosis and CVDs Analyzing the data obtained in these study, the amount of lactobacilli is within the it can be concluded that extracts of Ribes norm. Intestinal microbiota of patients rubrum and Prunus domestica can be used for of all groups was characterized by normal inhibition of the growth of Klebsiella spp.; amounts of Clostridium spp., while the normal the extract of Prunus avium can be used for concentration of F. prausnitzii was observed inhibition of Enterobacter spp. growth; the only in patients with obesity. Decrease in the extracts of Vaccinium myrtillus and Cornus amounts of Bifidobacterium spp., Bacteroides mas are effective growth inhibitors of Proteus spp., R. intestinalis, and A. muciniphila within spp.; the extracts of Prunus domestica and gut microbiota was observed in patients of all Cornus mas can be used for growth inhibition nosological groups. of Candida spp.; the extracts of Ribes nigrum, In previous studies, we obtained data Prunus avium, Prunus domestica, Ribes nigrum demonstrating the content of biologically  Ribes divaricatum  Ribes uva-crispa, Prunus active compounds of selected edible plants cerasifera and Cornus mas are effective growth fruits and their potential ability to stimulate inhibitors of Staphylococcus spp. the growth of lactic acid bacteria [29]. Here Current research studies consider we present the results of the studied effect of a potential role of gut microbiota in edible plants fruits extracts on commensal, the development of obesity and related beneficial, potentially pathogenic bacterial comorbidities. Gut microbiota can influence strains (Table 2). energy extraction from food, lipid metabolism, According to the data obtained (Table 2), immune response, and endocrine functions the Ribes rubrum extract totally inhibited the and its profile has shown differences between growth of K. pneumoniae, K. oxytoca, and obese and non-obese subjects [30]. Our study P. aeruginosa on 48 h of co-cultivation as well as revealed that intestinal microbiota of obese S. aureus on 72 h of co-cultivation. The extract patients was characterized by a sharp increase of Ribes nigrum totally inhibited growth of in the amount of enterococci and a decrease

92 Experimental articles

Fig. 3. The patients’ gut microbiota composition: Anaerobes and facultative-anaerobes (n = 10) Bar graph showing the median values and interquartile range * represent significantly different values (P < 0.05)

Fig. 4. The patients’ gut microbiota composition: obligate anaerobes (n = 10) Bar graph showing the median values and interquartile range * represent significantly different values (P < 0.05)

93 BIOTECHNOLOGIA ACTA, V. 13, No 5, 2020

Table 2. Biological influence of edible plants fruits extracts on growth of selected microorganisms in dynamics Co-cultivation, hours and number No Tested extract Tested microorganism of cultured microorganisms, CFU/ml 24 h 48 h 72 h Escherichia coli (2.6±0.58)·108 (4.67±0.57)·107 (3.67±0.57)·106 Enterobacter cloacae (3±1)·109 (4±1.73)·106 (2.67±1.53)·104 Klebsiella pneumoniae (4.33±1.52)·104*0 0 Klebsiella oxytoca (8±1)·103*0 0 Proteus mirabilis (6.33±1.52)·108 (4.33±0.57)·106 (3.3±1.15)·105 1 Ribes rubrum Pseudomonas aeruginosa (7±1)·105*0 0 Streptococcus pyogenes (6.67±1.52)·108 (5±2)·106 (1±0.57)·104 Staphylococcus aureus (7.33±0.57)·108 (6±1)·104*0 Enterococcus faecalis (4.33±1.52)·107 (3±1.73)·106 (1.67±0.57)·105 Candida albicans (6±1)·109 (4±1)·108 (2.67±0.57)·107 Escherichia coli (6.67±1.53)·107 (5.33±0.57)·105 (3.33±1.53)·102 Enterobacter cloacae (7.33±1.15)·108 (6.33±2.08)·105 (3.66±2.51)·102 Klebsiella pneumoniae (8.66±1.53)·107 (5±2.65)·103*0 Klebsiella oxytoca (6.33±1.15)·108 (4.66±2.52)·104*0 Proteus mirabilis (8.33±2.89)·108 (3 ±1.73)·106 (4 ±2)·106 2 Ribes nigrum Pseudomonas aeruginosa (6.33±3.51)·107 (5 ±1)·103*0

Streptococcus pyogenes (7.66±1.53)·108 (3.67±2.08)·106 (5.67±1.53)·106 Staphylococcus aureus (6 ±2)·105*0 0 Enterococcus faecalis (7 ±1)·107 (6.33±1.15)·105 (7.33±1.15)·103 Candida albicans (3.33±1.52)·108 (4.67±2.08)·106 (6.33±0.57)·106

Escherichia coli (3.67±1.15)·108 (3.67±1.15)·106 (7±1)·106 Enterobacter cloacae (7.33±1.15)·103*0 0 Klebsiella pneumoniae (6.67±1.52)·107 (4±1)·103*0 Klebsiella oxytoca (7.33±1.52)·107 (6±1.72)·104*0

Proteus mirabilis (7±1)·108 (2.33±0.58)·104*0

3 Prunus avium Pseudomonas aeruginosa (8.66±0.58)·107 (5.3±1.53)·104*0

Streptococcus pyogenes (5±2)·107 (2.67±1.15)·106 (1.33±0.58)·106

Staphylococcus aureus (7.66±1.52)·105*0 0

Enterococcus faecalis (6.33±1.52)·107 (4.33±1.15)·104 0

Candida albicans (4±1.73)·108 (5.67±2.51)·106 (3.33±1.52)·105

Escherichia coli (7±1)·108 (5.3±1.52)·103 0

5 2 Prunus x do- Enterobacter cloacae (3±1.73)·10 * (4.67±2.08)·10 *0 4 mestica Klebsiella pneumoniae (8.66±0.57)·104*0 0 Klebsiella oxytoca (6.66±0.57)·104*0 0

94 Experimental articles

Table 2. (Continued)

12 3 4 56

Proteus mirabilis (8±1.73)·108 (7.67±1.52)·104*0

Pseudomonas aeruginosa (5±2)·109 (6.66±2.08)·104 0

Streptococcus pyogenes (5.33±3.21)·106 (6.33±2.51)·103 0

Staphylococcus aureus (8.33±0.57)·105*0 0

Enterococcus faecalis (5.66±1.52)·106 (4±2.64)·106 (2±1)·105

Candida albicans (7±2.65)·105*0 0

Escherichia coli (4.33±3.51)·108 (3±1.73)·107 (7±2.64)·106

Enterobacter cloacae (6.67±2.51)·105* (5±1.73)·102*0

Klebsiella pneumoniae (3±2)·108 (4.66±2.08)·107 (3.33±0.57)·107

Klebsiella oxytoca (4±1)·108 (5.67±2.08)·108 (3.66±1.52)·107

Proteus mirabilis (7.66±1.52)·108 (8.33±1.52)·107 (5.33±0.57)·106 Ribes x nidi- 5 grolaria Pseudomonas aeruginosa (8±2.65)·104*0 0

Streptococcus pyogenes (6.33±1.53)·108 (7.66±1.53)·105 (4.66±1.53)·104

Staphylococcus aureus (9.66±0.57)·104*0 0

Enterococcus faecalis (2.67±1.52)·107 (4±1)·107 (3.33±1.53)·105

Candida albicans (7±1)·108 (6.33±2.08)·106 (5.66±1.52)·104

Escherichia coli (8±1.73)·108 (5±1)·108 (4.33±1.53)·108

Enterobacter cloacae (7.33±1.53)·108 (8.67±1.53)·108 (5 ±1)·107

Klebsiella pneumoniae (9 ±1)·107 (8.33±0.57)·104*0

Klebsiella oxytoca (7±2.65)·108 (6.33±2.08)·105*0

4 Vaccinium Proteus mirabilis (9.33±1.15)·10 *0 0 6 myrtillus Pseudomonas aeruginosa (7.33±0.57)·109 (6±1.73)·108 (3.66±0.58)·107

Streptococcus pyogenes (9.67±0.58)·108 (5.67±3.05)·107 (5±1)·107

Staphylococcus aureus (5.33±0.58)·108 (6.33±1.53)·106 0

Enterococcus faecalis (8.33±0.58)·108 (6.67±2.52)·106 (5.67±1.52)·106

Candida albicans (8±1)·108 (7±1.73)·106 (5.67±2.08)·105

95 BIOTECHNOLOGIA ACTA, V. 13, No 5, 2020

Table 2. (End)

12 3 4 56

Escherichia coli (5.33±2.89)·108 (3.33±4.04)·105 (6.33±2.08)·102

Enterobacter cloacae (8±3.46)·105* (7.33±2.89)·102*0

Klebsiella pneumoniae (6.67±2.31)·108 (4±2)·104*0

Klebsiella oxytoca (6±3.46)·107 (7.33±3.79)·103 0

Proteus mirabilis (5.67±1.15)·107 (4.67±1.52)·105*0 Prunus 7 cerasifera Pseudomonas aeruginosa (8 ±2)·103*0 0

Streptococcus pyogenes (6.33±0.57)·108 (8±1.73)·106 (5.33±2.31)·104

Staphylococcus aureus (5±2.65)·103*0 0

Enterococcus faecalis (7±3)·107 (6.66±1.53)·105 0

Candida albicans (4.66±3.06)·107 (7±2.65)·104*0

Escherichia coli (6±4.36)·107 (5.33±1.53)·106 (4.33±0.57)·104

Enterobacter cloacae (6.33±1.53)·108 (8±1)·108 (5±3)·107

Klebsiella pneumoniae (6±1)·107 (4.33±2.51)·106 (6.67±1.52)·104

Klebsiella oxytoca (5±1.73)·108 (7±1)·107 (7.67±2.52)·105

Proteus mirabilis (3.33±1.52)·107 00 8 Cornus mas Pseudomonas aeruginosa (6.33±2.31)·107 (6±1.73)·105 (6.67±1.52)·105

Streptococcus pyogenes (4.33±1.52)·107 (4.67±1.52)·105 (5.33±2.08)·104

Staphylococcus aureus (7.67±1.15)·105*0 0

Enterococcus faecalis (5.33±1.52)·105 (3.67±2.08)·106 (6±2)·106

Candida albicans (4.67±3.06)·104*0 0

Note: * the data were statistically significant as compared with the control (Р < 0.05); concentration of E. cloacae, K. pneumoniae, K. oxytoca, P. mirabilis, P. aeruginosa, C. albicans on 24 h of cultivation — 2·109 CFU/ml, 48 h — 1.5·107 CFU/ml, 72 h — 1·105 CFU/ml as well as concentration of E. coli, S. pyogenes, S. aureus, E. faecalis, C. albicans on 24 h of cultivation — 1.5·108 CFU/ml, 48 h — 2.5·105 CFU/ml, 72 h — 2·104 CFU/ml were used as a control. in the amounts of normally fermenting E. coli recognized [32]. Trimethylamine (TMA), and bifidobacteria, which are early diagnostic which is produced by gut microbial enzymes markers of metabolic disorders [31]. TMA lyases, is a precursor of TMAO. As A close relationship between the different gut microbial compositions generate gut microbe-dependent production of different levels of TMAO [33], higher blood trimethylamine-N-oxide (TMAO), derived TMAO levels and an increased development from specific dietary nutrients, such of atherosclerosis and CVDs risk can be as choline and carnitine, and future attributed to a TMA-producing microbiome cardiovascular events has been widely harboring TMA lyases. Our research results

96 Experimental articles demonstrate that intestinal microbiota of which are associated with NCDs. patients with atherosclerosis and CVDs is Thus, from the work presented here, it characterized by an increase in the amounts can be concluded that the gut microbiota of Streptococcus spp., E. coli, and Klebsiella alteration contributes to the development spp. This is confirmed by the fact that these of NCDs such as obesity, T2D mellitus, bacteria are able to produce TMA [34]. atherosclerosis, and CVDs. Thus, such One of the most important metabolic knowledge can be applied in early activity of gut microbiota is the production diagnosis of those diseases. Analyzing the of non-gaseous SCFAs (acetate, propionate, experimental data obtained, and taking and butyrate), through fermentation of into account results of our previous microbiotaaccessible, complex carbohydrates studies, we can suggest that selected (e.g., oligosaccharides, resistant starch, edible plants fruits extracts can be used as and plant cell wall materials) [35]. Butyrate components of personalized nutrition for plays a significant role in the maintenance prevention and treatment of NCDs related of intestinal epithelial cell integrity with to chronic inflammation. However, in vivo important functions in the prevention investigations are necessary to confirm the of ‘leaky gut’ associated with diabetes. interactions between microbiota modulating Therefore, the role of SCFA, particularly and intestinal beneficial effects. butyrate and butyrate-producing bacteria such as Bifidobacterium spp., Bacteroides This work was supported by the Ministry spp., F. prausnitzii and R. intestinalis are of Education and Science of Ukraine, grant crucial for health in obesity and diabetes [36]. no. 0117U000379 the introduction of new Taking into account this fact we can conclude approaches to the creation and use of modern that the decreased level of butyrate-producing pharmabiotics. bacteria indicates inflammation processes

REFERENCES 1. WHO Organization Fact sheet: the top 10 23, 6(1):e000993. https://doi.org/10.1136/ causes of death. World Health Organization, openhrt-2018-000993 Geneva, Switzerland. 2017. 8. Cox A.J., West N.P., Cripps A.W. Obesity, in- 2. West C. E., Renz H., Jenmalm M. C., Kozyrskyj A. L., flammation, and the gut microbiota. Lan- Allen K. J., Vuillermin P., Prescott S. L.; in- cet Diabetes Endocrinol. 2015 Mar, 3(3), FLAME Microbiome Interest Group. The gut 20715. https://doi.org/10.1016/S2213- microbiota and inflammatory noncommuni- 8587(14)70134-2. cable diseases: associations and potentials for 9. Piya M.K., Harte A.L., McTernan P.G. Meta- gut microbiota therapies. J. Allergy. Clin. Im- bolic endotoxaemia: is it more than just a munol. 2015, 135(1), 313. quiz 14. https:// gut feeling? Curr Opin Lipidol. 2013 Feb, doi.org/10.1016/j.jaci.2014.11.012. 24(1), 7885. https://doi.org/10.1097/ 3. Lazar V., Ditu L.M., Pircalabioru G.G., Picu A., MOL.0b013e32835b4431. Petcu L., Cucu N., Chifiriuc M.C. Gut microbio- 10. G érard P. Gut microbiota and obesity. Cell Mol. ta, host organism, and diet trialogue in diabetes Life Sci. 2016 Jan;73(1), 14762. https://doi. and obesity. Front Nutr. 2019 Mar 13, 621. org/10.1007/s00018-015-2061-5. https://doi.org/10.3389/fnut.2019.00021 . 11. Tazoe H., Otomo .Y., Kaji I., Tanaka R., Kara- 4. Lloyd-Price J., Abu-Ali G., Huttenhower C. The ki S.I., Kuwahara A. Roles of short-chain fat- healthy human microbiome. Genome Med. 2016 ty acids receptors, GPR41 and GPR43 on co- Apr 27, 8(1), 51. https://doi.org/10.1186/ lonic functions. J. Physiol. Pharmacol. 2008 s13073-016-0307-y. Aug 59, Suppl 2, 251262. 5. Hotamisligil G.S. Inflammation and metabolic dis- 12. Boulangé C. L, Neves A. L, Chilloux J., Nich- orders. Nature. 2006 Dec 14, 444(7121), 860867. olson J. K., Dumas M. E. Impact of the gut https://doi.org/10.1038/nature05485 . microbiota on inflammation, obesity, and 6. Hotamisligil G.S. Endoplasmic reticulum metabolic disease. Genome Med. 2016 Apr 20, stress and the inflammatory basis of metabolic 8(1), 42. https://doi.org/10.1186/s13073- disease. Cell. 2010 Mar 19, 140(6), 900917. 016-0303-2. https://doi.org/10.1016/j.cell.2010.02.034. 13. Remely M., Tesar I., Hippe B., Gnauer S., Rust P., 7. Forkosh E., Ilan Y. The heart-gut axis: new Haslberger A. G. Gut microbiota composition target for atherosclerosis and congestive correlates with changes in body fat content heart failure therapy. Open Heart. 2019 Apr due to weight loss. Benef Microbes. 2015,

97 BIOTECHNOLOGIA ACTA, V. 13, No 5, 2020

6(4), 431439. https://doi.org/10.3920/ communities in feces from healthy elderly BM2014.0104. volunteers and hositalized elderly patients 14. Long A. N., Dagogo-Jack S. Comorbidities by using real-time PCR and effects of an- of diabetes and hypertension: mechanisms tibiotic treatment on the fecal microbio- and approach to target organ protection. J. ta. Appl Environ Microbiol. 2004, V. 70, Clin. Hypertens (Greenwich). 2011, 13(4), 3575–3581. 244-251. https://doi.org/10.1111/j.1751- 24. Ramirez-Farias C., Slezak K., Fuller Z., Dun- 7176.2011.00434.x can A., Holtrop G., Louis P. Effect of inulin 15. Gui T., Shimokado A., Sun Y., Akasaka T., on the human gut microbiota: stimulation of Muragaki Y. Diverse roles of macrophages Bifidobacterium adolescentis and Faecalibac- in atherosclerosis: from inflammatory biol- terium prausnitzii. British Journal of Nutri- ogy to biomarker discovery. Mediators In- tion. 2008, 101(4), 541550. flamm. 2012, Article ID 693083. https:// 25. Gui Q., Li H., Wang A., Zhao X., Tan Z., Chen L., doi.org/10.1155/2012/693083 . Xu K., Xiao, C. The association between gut 16. Gregory J. C., Buffa J. A., Org E., Wang Z., butyrate‐producing bacteria and non‐small‐ Levison B. S., Zhu W., Wagner M. A., Ben- cell lung cancer. Journal of Clinical Labora- nett B. J., Li L., DiDonato J. A., Lusis A. J., tory Analysis. 2020, e23318. Hazen S. L. Transmission of atherosclerosis 26. Everard A., Belzer C., Geurts L., Ouwerkerk J. P., susceptibility with gut microbial transplan- Druart C., Bindels L. B., Guiot Y., Derrien M., tation. J Biol Chem. 2015 Feb 27, 290(9), Muccioli G. G., Delzenne N. M., Cani P. D., De 56475660. https://doi.org/10.1074/jbc. Vos, W. M. Cross-talk between Akkermansia M114.618249 . muciniphila and intestinal epithelium con- 17. Jie Z., Xia H., Zhong S.L., Feng Q., Li S., Liang S., trols diet-induced obesity. Proceedings of the Zhong H., Liu Z., Gao Y., Zhao H., Zhang D., national academy of sciences. 2013, 110(22), Su Z., Fang Z., Lan Z., Li J., Xiao L., Li J., Li R., 90669071. Li X., Li F., Ren H., Huang Y., Peng Y., 27. Fijan S., Šulc D., Steyer A. Study of the in Li G., Wen B., Dong B., Chen J.Y., Geng Q.S., vitro antagonistic activity of various single- Zhang Z.W., Yang H., Wang J., Wang J., strain and multi-strain probiotics against Zhang X., Madsen L., Brix S., Ning G., Xu X., Escherichia coli. International journal of Liu X., Hou Y., Jia H., He K., Kristiansen K. environmental research and public health. The gut microbiome in atherosclerotic car- 2018, 15(7), 1539. diovascular disease. Nat Commun. 2017 Oct 28. Vinnikova O. I., Morgul I. M. Practicum on 10, 8(1), 845. https://doi.org/10.1038/ microbiology: methodical recommendations. s41467-017-00900-1 2nd edition, amended. KhNU named after 18. Ercolini, D., Fogliano, V. Food design to feed V. N. Karazin. 2009. the human gut microbiota. Journal of Agri- 29. Pallah O. V., Meleshko T. V., Bati V. V., cultural and Food Chemistry. 2018, 66(15), Boyko N. V. Extracts of edible plants stimula- 37543758. https://doi.org/10.1021/acs. tors for beneficial microorganisms. Biotech- jafc.8b00456. nol. Acta. 2019, 12(3), 6774 https://doi. 19. Obesity and overweight WHO Organization org//10.15407/biotech12.03.067. Available at: https://www.who.int/news- 30. Al-Assal K., Martinez A. C., Torrinhas R. S., room/fact-sheets/detail/obesity-and-over- Cardinelli C., Waitzberg D. Gut microbio- weight (accessed. 6 October 2020) ta and obesity. Clinical Nutrition Experi- 20. Care D. Medical Care in Diabetes 2020. Diabe- mental. 2018. V.20, 6064. https://doi. tes Care. 2020, 43, S135. org/10.1016/j.yclnex.2018.03.001. 21. T óth Š., Fedačko J., Pekárová T., Hertelyová Z., 31. Petrov V. O., Boyko N. V. Early markers for di- Katz M., Mughees A., Kuzma J., Štefanič P., agnostics of obesity, diabetes, and metabolic Kopolovets I., Pella, D. Elevated circulating syndrome. Ukraine Patent. 90788 U June, 10 PCSK9 concentrations predict subclinical 2014. atherosclerotic changes in low risk obese and 32. Heidenreich P.A., Trogdon J.G., Khavjou O.A., non-obese patients. Cardiol Ther 6, 281–289 Butler J., Dracup K., Ezekowitz M.D., Finkel- (2017). https://doi.org/10.1007/s40119- stein E.A., Hong Y., Johnston S.C., Khera A., 017-0092-8. Lloyd-Jones D.M., Nelson S.A., Nichol G., Oren- 22. World Health Organization Cardiovascular stein D., Wilson P.W., Woo Y.J. Forecasting the Disease. Available at: https://www.who.int/ future of cardiovascular disease in the United cardiovascular_diseases/about_cvd/en/ (ac- States: a policy statement from the American cessed. 6 October 2020) Heart Association. Circulation. 2011 Mar 1, 23. Bartosch S, Fite A, Macfarlane G. T., Mc- 123(8), 933944. https://doi.org/10.1161/ Murdo M. E. Characterization of bacterial CIR.0b013e31820a55f5

98 Experimental articles

33. Cho C. E., Taesuwan S., Malysheva O. V., Bend- 35. Lazar V., Ditu L.M., Pircalabioru G. G., Picu A., er E., Tulchinsky N. F., Yan J., Sutter J. L., Petcu L., Cucu N., Chifiriuc M. C. Gut mi- Caudill M. A. Trimethylamine-N-oxide crobiota, host organism, and diet trialogue (TMAO) response to animal source foods in diabetes and obesity. Front Nutr. 2019 varies among healthy young men and is in- Mar 13, No 6, 21. https://doi.org/10.3389/ fluenced by their gut microbiota composi- fnut.2019.00021 tion: A randomized controlled trial. Mol. 36. Patterson E., Ryan P. M., Cryan J. F., Di- Nutr. Food Res. 2017 Jan, 61(1). https://doi. nan T. G., Ross R. P., Fitzgerald G. F., Stan- org/10.1002/mnfr.201600324 ton C. Gut microbiota, obesity and diabe- 34. Biscetti F., Nardella E., Cecchini A.L., Land- tes. Postgrad Med J. 2016 May, 92(1087), olfi R., Flex A. The role of the microbiota in 286300. https://doi.org/10.1136/ the diabetic peripheral artery disease. Me- postgradmedj- 2015-133285 diators Inflamm. 2019, May 8, 4128682. https://doi.org/10.1155/2019/4128682

ВПЛИВ ЕКСТРАКТІВ ЇСТІВНИХ ПЛОДІВ ВЛИЯНИЕ ЭКСТРАКТОВ СЪЕДОБНЫХ НА КИШКОВУ МІКРОБІОТУ, ПЛОДОВ НА МИКРОБИОТУ ВИДІЛЕНУ З ПАЦІЄНТІВ КИШЕЧНИКА, ВЫДЕЛЕННОЙ З НЕКОМУНІКАТИВНИМИ ИЗ ПАЦИЕНТОВ ЗАХВОРЮВАННЯМИ, ПОВ'ЯЗАНИМИ С НЕКОММУНИКАТИВНЫМИ З ХРОНІЧНИМ ЗАПАЛЕННЯМ ЗАБОЛЕВАНИЯМИ, СВЯЗАННЫМИ С ХРОНИЧЕСКИМ ВОСПАЛЕНИЕМ Т. В. Мелешко 1, 2, О. В. Паллаг 1, 2, Р. О. Рукавчук 2, Л. С. Юсько 1, 2, Н. В. Бойко 1, 2 Т. В. Мелешко 1, 2, О. В. Паллаг 1, 2, Р. А. Рукавчук 2, Л. С. Юсько 1, 2, Н. В. Бойко 1, 2 1Ужгородський національний університет, кафедра клініко-лабораторної діагностики 1Ужгородский национальный университет, та фармакології, стоматологічний факультет, кафедра клинико-лабораторной Україна диагностики и фармакологии, 2Ужгородський національний університет, стоматологический факультет, Украина науково-дослідний і навчальний центр 2Ужгородский национальный университет, молекулярної мікробіології та імунології научно-исследовательский и учебный центр слизових оболонок, Україна молекулярной микробиологии и иммунологии слизистых оболочек, Украина E-mail: [email protected] E-mail: [email protected] Метою роботи було дослідити кишкову мікробіоту у пацієнтів з некомунікативними Целью работы было исследовать микробио- захворюваннями, пов’язаними з хронічним ту кишечника у пациентов с некоммуникатив- запаленням, зокрема ожирінням, цукровим ными заболеваниями, связанными с хрониче- діабетом 2-го типу, атеросклерозом та сер- ским воспалением, в частности с ожирением, цево-судинними захворюваннями, а також сахарным диабетом 2-го типа, атеросклерозом з’ясувати потенційну здатність екстрактів и сердечно-сосудистыми заболеваниями, а так- плодів їстівних рослин пригнічувати ріст ок- же выяснить потенциальную способность экс- ремих умовно-патогенних мікроорганізмів. трактов плодов съедобных растений подавлять В обмеженому клінічному дослідженні рост отдельных условно-патогенных микроор- аналіз мікробіоти кишечника проводили ру- ганизмов. тинним методом, а також за допомогою qPCR. В ограниченном клиническом исследова- Вивчено антибактеріальні властивості екстрак- нии анализ микробиоты кишечника проводили тів плодів їстівних рослин стосовно відібраних рутинным методом, а также с помощью qPCR. умовно-патогенних мікроорганізмів. Изучены антибактериальные свойства плодов Склад кишкової мікробіоти пацієнтів з съедобных растений по отношению к отобран- ожирінням характеризувався збільшенням ным условно-патогенным микроорганизмам. кількості Enterococcus spp. та Lactobacillus Состав микробиоты кишечника пациентов с spp. поряд зі зменшенням кількості ожирением характеризовался увеличением ко- Escherichia coli. Зниження рівня E. coli та личества Enterococcus spp. и Lactobacillus spp.

99 BIOTECHNOLOGIA ACTA, V. 13, No 5, 2020

лактобактерій спостерігали у пацієнтів з цук- наряду с уменьшением количества Escherichia ровим діабетом 2-го типу. За атеросклерозу coli. Снижение уровня E. coli и лактобакте- відзначали збільшення стрептококів, ентеро- рий наблюдали у пациентов с сахарным диа- коків та ентеробактерій, тоді як у пацієнтів бетом 2-го типа. При атеросклерозе отмечали із серцево-судинними захворюваннями на- увеличение количества стрептококков, энте- явним було додаткове підвищення кількості рококков и энтеробактерий, в то время как стафілококів та кандид поряд зі зниженням у пациентов с сердечно-сосудистыми заболе- E. coli. Зменшення кількості Bifidobacterium ваниями характерным было дополнительное spp., Bacteroides spp., Roseburia intestinalis увеличение количества стафилококков и кан- та Аkkermansia muciniphila спостерігали у дид наряду со снижением E. coli. Уменьшение пацієнтів усіх груп. Ріст Klebsiella spp. при- количества Bifidobacterium spp., Bacteroides гнічували екстракти червоної смородини spp., Roseburia intestinalis и Аkkermansia (Ribes rubrum) і сливи (Prunus domestica); muciniphila наблюдали у пациентов всех Enterobacter spp. — екстракт черешні групп. Рост Klebsiella spp. ингибировался экс- (Prunus avium); Proteus spp. — екстрак- трактами красной смородины (Ribes rubrum) ти чорниці (Vaccinium myrtillus) та кизилу и сливы (Prunus domestica); Enterobacter (Cornus mas); Staphylococcus spp. — екстрак- spp. — экстрактом черешни (Prunus avium); ти чорної смородини (Ribes nigrum), черешні Proteus spp. — экстрактами черники (Prunus avium), сливи (Prunus domestica), (Vaccinium myrtillus) и кизила (Cornus mas); йошти (Ribes nigrum  Ribes divaricatum  Staphylococcus spp. — экстрактами черной Ribes uva-crispa), аличі (Prunus cerasifera) та смородины (Ribes nigrum), черешни (Prunus кизилу (Cornus mas). avium), сливы (Prunus domestica), йошты Отримані дані можуть бути використані (Ribes nigrum  Ribes divaricatum  Ribes uva- для ранньої діагностики некомунікативних crispa), алычи (Prunus cerasifera) и кизила захворювань та для їх профілактики за допо- (Cornus mas). могою персоніфікованого харчування. Полученные данные могут быть использо- ваны для ранней диагностики некоммуника- тивных заболеваний и для их профилактики с Ключові слова: ожиріння, цукровий діабет помощью персонифицированного питания. 2-го типу, атеросклероз, серцево-судинні захворювання, кишкова мікробіота, плоди їстівних рослин. Ключевые слова: ожирение, сахарный диабет 2-го типа, атеросклероз, сердечно-сосудистые заболевания, микробиота кишечника, плоды съедобных растений.

100