Targeting STAT5 Or STAT5-Regulated Pathways

Published OnlineFirst August 28, 2018; DOI: 10.1158/0008-5472.CAN-18-0195

Cancer Molecular Cell Biology Research

Targeting STAT5 or STAT5-Regulated Pathways Suppresses Leukemogenesis of Phþ Acute Lymphoblastic Leukemia Valentina Minieri1, Marco De Dominici1, Patrizia Porazzi1, Samanta A. Mariani2, Orietta Spinelli3, Alessandro Rambaldi3,4, Luke F. Peterson5, Pierluigi Porcu6, Marja T. Nevalainen7, and Bruno Calabretta1

Abstract

Combining standard cytotoxic chemotherapy with BCR- expression of proapoptotic BIM protein. The resulting apoptosis ABL1 tyrosine kinase inhibitors (TKI) has greatly improved the of STAT5-silenced Phþ BV173 cells was rescued by silencing of upfront treatment of patients with Philadelphia chromosome- BIM or restoration of BCL2 expression. Treatment of Phþ ALL positive (Phþ) acute lymphoblastic leukemia (ALL). However, cells, including samples from relapsed/refractory patients, with due to the development of drug resistance through both BCR- the PIM kinase inhibitor AZD1208 and/or the BCL2 family ABL1–dependent and -independent mechanisms, prognosis antagonist Sabutoclax markedly suppressed cell growth and remains poor. The STAT5 transcription factor is activated by leukemogenesis ex vivo and in mice. Together, these studies BCR-ABL1 and by JAK2-dependent cytokine signaling; there- indicate that targeting STAT5 or STAT5-regulated pathways may fore, inhibiting its activity could address both mechanisms of provide a new approach for therapy development in Phþ ALL, resistance in Phþ ALL. We show here that genetic and pharma- especially the relapsed/TKI-resistant disease. cologic inhibition of STAT5 activity suppresses cell growth, induces apoptosis, and inhibits leukemogenesis of Phþ cell Signiﬁcance: Suppression of STAT5 by BCL2 and PIM lines and patient-derived newly diagnosed and relapsed/TKI- kinase inhibitors reduces leukemia burden in mice and resistant Phþ ALL cells ex vivo and in mouse models. STAT5 constitutes a new potential therapeutic approach against silencing decreased expression of the growth-promoting PIM-1 Phþ ALL, especially in tyrosine kinase inhibitor-resistant kinase, the apoptosis inhibitors MCL1 and BCL2, and increased disease. Cancer Res; 78(20); 5793–807. 2018 AACR.

Introduction hematopoietic stem cell transplantation (HSCT) is an effective consolidation therapy for patients with Phþ ALL who have Philadelphia chromosome-positive (Phþ) acute lymphoblas- achieved a complete response (CR) after induction of remission tic leukemia (ALL) is characterized by the t(9;22) translocation chemotherapy (6). However, 10% to 20% of patients fail to that generates the p190- and, less frequently, the p210-BCR-ABL1 achieve CR and allogeneic HSCT is only available for patients fusion protein, both of which have constitutive tyrosine kinase with suitable matched donors. In addition, the odds of treatment- activity (1, 2). The Philadelphia chromosome is the most com- related mortality as well as relapse are high (7). The outcome of mon cytogenetic abnormality in adult patient with ALL, occurring patients with Phþ ALL has improved significantly with the intro- in about 20% to 30% of the cases (3, 4). duction of imatinib and second-generation TKI as a first-line The incidence of Phþ ALL increases with age, with up to 50% therapy, especially when used in combination with chemotherapy being diagnosed in patients older than 60 years (5). Allogeneic (8). However, resistance to TKI develops rapidly in most patients with Phþ ALL and the 5-year overall survival is <50% (9–11). Thus, inhibiting the BCR-ABL1 kinase with TKI fails to eradicate 1Department of Cancer Biology, Sidney Kimmel Cancer Center, Thomas þ 2 most Ph ALL clones due to BCR-ABL1-dependent and -inde- Jefferson University, Philadelphia, Pennsylvania. The Queen's Medical fi Research Institute, Centre for Inflammation Research, The University of pendent mechanisms of resistance (12). Collectively, these nd- fi Edinburgh, Scotland, United Kingdom. 3Hematology and Bone Marrow ings indicate that additional pathways need to be identi ed and Transplant Unit, Ospedale Papa Giovanni XXIII, Bergamo, Italy. 4Universita' targeted for an effective treatment of Phþ ALL. Statale Milano, Italy. 5Department of Internal Medicine, University of Michigan, STAT5 has a pivotal role in promoting cell survival and the 6 Ann Arbor, Michigan. Department of Medical Oncology, Thomas Jefferson subsequent B-cells' expansion during early B-cell development. 7 University, Philadelphia, Pennsylvania. Department of Pathology, Medical CD19-Cre-mediated deletion of STAT5A/B in the B-cell compart- College of Wisconsin Cancer Center, Milwaukee, Wisconsin. ment impairs IL7-activated survival pathways, blocking B-cell dif- Note: Supplementary data for this article are available at Cancer Research ferentiation at the pre-pro-B stage (13–15). Of interest, the defective Online (http://cancerres.aacrjournals.org/). B-cell development induced by genetic deletion of STAT5 was Corresponding Author: Bruno Calabretta, Thomas Jefferson University, 233 S. rescued by restoring expression of STAT5-regulated BCL2 (16). 10th Street, Bluemle Life Science Bld. Suite 630, Philadelphia, PA 19107. Phone: In malignant precursor B cells, deregulated JAK-STAT5 activity 215-503-4522; E-mail: [email protected] may allow survival of leukemic cells independently of stroma- doi: 10.1158/0008-5472.CAN-18-0195 derived cytokine signals (17). The STAT5 pathway is constitutively 2018 American Association for Cancer Research. active in Phþ ALL and in a subset of B-ALL that contains activating

www.aacrjournals.org 5793

Minieri et al.

mutations in JAK1 or JAK2 (18–20). Importantly, STAT5 can be with IL3 (10 ng/mL), IL6 (10 ng/mL), IL7 (10 ng/mL), Flt3-L activated in Phþ leukemia cells either indirectly through JAK2 (20 ng/mL), and stem cell factor (30 ng/mL; ProSpec). phosphorylation or directly by BCR-ABL1 because STAT5 is a Relapsed/TKI-resistant Phþ ALL samples were assessed for the known substrate of BCR-ABL1 (21), and an intact STAT5 signaling presence of ABL1 TKD mutations by Sanger sequencing; briefly, is required for maintenance of BCR-ABL1-driven leukemias (19). RNA was extractedwithRNAeasy Plus Mini Kit (Qiagen), cDNA was Furthermore, STAT5 is a marker of disease progression in Phþ reverse transcribed by using Superscript III (Thermo Fisher Scien- chronic myeloid leukemia (CML), based on correlation of high tific). The ABL1 TKD was PCR-amplified with a forward primer STAT5 mRNA levels with TKI resistance and advanced disease located on BCR exon 1 (p190 FW: 50-CTCGCAACAGTCCTTC- stages, irrespective of the presence of tyrosine kinase domain GACA-30) or with a forward primer located on exon 12 (P210 FW: (TKD) BCR-ABL1 mutations (22, 23). 50-CTGCAGATGCTGACCAACTC-30) and a common reverse prim- Together, these data suggest that STAT5 itself or STAT5- er (TKD REV: 50-CCTGCAGCAAGGTACTCACA-30). Gel purified regulated pathways could serve as rational targets not only to PCR products were sequenced in both directions using TKD REV circumvent the BCR-ABL1-dependent TKI resistance of Phþ ALL primer or TKD FW primer (50-CCCACTGTCTATGGTGTGTCC-30). but also to suppress growth-promoting STAT5 signals activated through BCR-ABL1-independent mechanisms. In this study, using Cell viability genetic and pharmacologic approaches, we show that STAT5 is Cell viability was assessed by MTT assay in 96-multiwell plates. critical for the growth of Phþ ALL cell lines and of newly Cells were seeded at a concentration of 150,000 or 300,000 diagnosed and relapsed/TKI-resistant patient-derived Phþ ALL cells/mL (depending on length of the treatment and cell line fi cells ex vivo and in mice. Moreover, we found that the growth- growth rate) and then treated with DMSO (Ctrl) or the speci c promoting effects of STAT5 depend on changes in the expression/ drug. At the time point of interest, 100 mL of cell cultures were activity of PIM-1, BIM, and BCL2 and that these proteins can serve transferred in 96-multiwell plates and incubated with 10 mLof ex vivo 0.5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazo- as therapeutic targets and in xenografts of patient-derived Phþ ALL cells. lium bromide (MTT; Sigma Aldrich) at 37 C for 3 hours. Then, formazan crystals were dissolved with 0.1 M HCl in 2-propanol and absorbance was measured at 570 nm using a mQUANT Materials and Methods microplate scanning spectrophotometer (BioTek Instruments) Cell lines, Phþ primary ALL samples, and cell cultures and KC4 V.3.4 software. The SUP-B15 cell line (Phþ ALL) was purchased from ATCC; the Apoptosis Z181 cell line (Phþ ALL) was kindly provided by Dr. Z. Estrov (M. Cells were incubated at 100,000/mL with 1 mL of the CellEvent D. Anderson Cancer Center, Houston, TX); the BV173 cell line (Phþ Caspase 3/7 Green Detection Reagent (Thermo Fisher Scientific) CML-lymphoid blast crisis; ref. 24) was kindly provided by Dr. N. for 25 minutes at 37 C and analyzed by flow cytometry using a Donato (NIH). EBV-immortalized B cells GM03798 and GM12878 488 nm excitation laser. were purchased from the Coriell Institute (Camden, NJ). All these For GFP-positive cell lines, apoptosis was measured by Annexin cell lines and the TKI-resistant T315I-BV173 derivative line (25) V staining: 100,000 cells were washed in Annexin V Binding Buffer were cultured in Iscove's Modified Dulbecco's Medium (Corning) (10 mmol/L HEPES, 140 mmol/L NaCl, and 2.5 mmol/L CaCl2, supplemented with 10% heat-inactivated FBS (Biowest), 1% pen- pH 7.4), spun and resuspended in 50 mL of Annexin V Binding icillin–streptomycin (Thermo Fisher Scientific), and 1% L-gluta- Buffer, then incubated with 1.5 mL of Cy 5.5-Annexin V (BD mine (Thermo Fisher Scientific) at 37 C, 5% CO . The Ph-like ALL 2 Biosciences) for 15 minutes at room temperature. Samples were MUTZ-5 and MHH-CALL-4 cell lines were kindly provided by Dr. analyzed by flow cytometry using a 640 nm laser. M. Carroll (University of Pennsylvania, Philadelphia, PA). These lines were cultured in RPMI supplemented with 20% FBS, 1% Colony formation assays – penicillin streptomycin, and 1% L-glutamine at 37 C, 5% CO2. shRNA lentivirus-transduced or drug-treated SUP-B15, BV173, Mycoplasma Cell lines were tested for every 3 months as or Z181 cells were plated in methylcellulose (Stem Cell Technol- þ described (26). Ph ALL cell lines were routinely authenticated ogies) supplemented with Iscove's Modified Dulbecco's Medium, by monitoring B-cell markers and BCR-ABL1 isoform expression. 10% heat-inactivated FBS, 1% penicillin–streptomycin, and 1% Ph-like cell lines were authenticated by B-cell immunophenotyp- L-glutamine. Colonies were counted 10 days later. ing (CD19 and CD10), and by monitoring CRLF2 and phospho- shRNA lentivirus-transduced or drug-treated blast cells from Phþ þ STAT5 expression. ALL, Ph-like patients, or CD34 cells from healthy donors, were þ Primary adult human Ph ALL cells were kindly provided by: plated in methylcellulose supplemented with SFEM, IL3 (10 ng/mL), Dr. Alessandro Rambaldi (Hematology and Bone Marrow Trans- IL6 (10 ng/mL), IL7 (10 ng/mL), Flt3-L (20 ng/mL), and stem cell plant Unit, Bergamo, Italy), Dr. Luke F. Peterson (University of factor (30 ng/mL). Colonies were counted 7 to 10 days later. Michigan), Dr. Michael Caligiuri (City of Hope Cancer Center, Duarte, CA), Dr. Pierluigi Porcu (Thomas Jefferson University, Lentiviral production and cell transduction Philadelphia, PA), and Dr. Martin Carroll (University of Penn- STAT5 short hairpin RNA (shSTAT5) designed against sylvania). Main characteristics of the samples are described in the STAT5 mRNA sequence ATCTGGCTTGTTAATGAGTAG Supplementary Table S1. G-CSF–mobilized peripheral blood (TRCN0000019356) and SCR short hairpin RNA (shSCR) þ CD34 primary cells (J48 and J50) from healthy donors CCTAAGGTTAAGTCGCCCTCG were obtained in the pLKO.1- were obtained from the Bone Marrow Transplantation Unit, puro vector (Dharmacon) and subsequently cloned in the Thomas Jefferson University. Primary adult human Ph-like Tet-pLKO-puro vector (Addgene) for inducible shRNA expres- cells were provided by Dr. Pierluigi Porcu. Primary cells were sion, using AgeI and EcoRI restriction enzyme sites and following maintained in SFEM (Stem Cell Technologies) supplemented Addgene's protocols.

5794 Cancer Res; 78(20) October 15, 2018 Cancer Research

STAT5 Pathways in Phþ ALL

BIM short hairpin RNA (shBIM) designed against the BIM 1:1000; Abcam; #ab185656), c-MYC (N-262; 1:1000, Santa Cruz; mRNA sequence CCAGACCACTACTGAATATAA (TRCN0000020155) #sc-768), BIM (1:1,000; Cell Signaling Technology; #2818S), and cloned into the Tet-pLKO-Neo lentiviral-vector were kindly NOXA (1:500; Novus Biological; #NB600-1159), PUMA provided by Dr. Z. Jagani (Novartis; ref. 27). (1:1,000; AbCam; #ab9643). The PIM1-s cDNA (NCBI: NM_0026483) was generated from After incubation with HRP-conjugated secondary antibodies total RNA purified from BV173 cells and inserted in the XbaI-SalI (Thermo Fisher Scientific), signals were visualized by chemi- restriction enzyme sites of the pUltra, GFP-expressing, lentiviral luminescent reaction using Supersignal West Pico or Dura vector developed by Dr. Malcolm Moore (Addgene; plasmid Chemiluminescent Substrates (Thermo Fisher Scientific). When #24129). The BCL2 cDNA (isoform a, NM_000633.2) was different antibodies were probed to the same nitrocellulose PCR-amplified from reverse transcribed total RNA of BV173 cells membrane, previous signals were removed by incubation with with a forward primer including the XbaI restriction sequence and 0.5% sodium azide for 10 minutes at room temperature or by with a reverse primer including a HA-tag coding sequence (TACC- stripping in 62 mmol/L Tris-HCL pH 6.8, 2% SDS, 0.7% CATACGATGTTCCAGATTACGCT) and an EcoRI restriction site b-mercaptoethanol for 20 minutes at 50C. sequence. The product was then inserted into the XbaI-EcoRI sites of the pUltra-hot, mCherry expressing, lentiviral vector (Addgene; Quantitative PCR analysis plasmid #24130). RNA was isolated from shSCR–BV173 and shSTAT5–BV173 The FG12 MCL1/IRES-GFP lentivirus was kindly provided by cells, untreated or treated with doxycycline at 2.5 mg/mL, using the Dr. Maria S. Soengas (Spanish National Cancer Centre, Madrid, RNeasy Plus Mini Kit (Qiagen) and reverse-transcribed (2 mg) Spain). with the High-Capacity cDNA Reverse Transcription Kit (Thermo- For lentiviral production, 293T cells were transiently transfected Fisher Scientific). Quantitative PCR was performed with the with the indicated plasmids, the envelope plasmid pMD2.G and QuantStudio 12k Flex (Life Technologies) instrument and Quant- the second-generation lentiviral packaging plasmid psPAX2 Studio 12K Flex software, using the following primers: MYC FW (Addgene). Infectious supernatant was collected at 24 hours, 50-GTCACACCCTTCTCCCTTCG-30; MYC RV 50-ATGTCTCCTCC- concentrated by ultracentrifugation and used to infect Phþ ALL CAGCAGCTC-30; TRIB3 FW 50-TGCGTGATCTCCAAGCTGTGT- cell lines or primary patient's cells by spinoculation. SUP-B15, 30; TRIB3 RV 50-GCTTGTCCCACAGGGAATCA-30; ITGa5FW50- BV173, and Z181 cell lines were transduced with the inducible GGCTTCAACTTAGACGCGGA-30; ITGa5RV50-GGCTGGCTGG- shSTAT5 or shBIM lentivirus and selected in the presence of TATTAGCCTT-30; ITGb1FW50-CCGCGCGGAAAAGATGAATTT- puromycin (3 mg/mL) or G418 (400 mg/mL) for 5 or 14 days, 30; ITGb1RV50-CCACAATTTGGCCCTGCTTG-30; PIM1 FW 50- respectively. shRNAs (shSTAT5 or shBIM) were induced with ACACGGACTTCGATGGGACC-30; PIM1 RV 50-GATGGTCTCA- doxycycline (2.5 mg/mL). Because of the limited viability of pri- GGGCCAAGCA-30; IDH2 FW 50-GCCGGCACTTTCAAAATGG- mary Phþ ALL cells in liquid culture, these cells were transduced 30T; IDH2 RV 50-TCCTTGACACCACTGCCATC-30; UBC FW 50- with the stable shSTAT5 or shSCR pLKO.1 lentivirus 16 hours after GTCGCAGTTCTTGTTTGTGGATC-30; UBC RV 50-GTCTTAC- thawing, and selected in the presence of puromycin. Western blot CAGTCAGAGTCTTCACGAAG-30; GAPDH FW 50-CCCATCAC- lysates were obtained after 60 hours of puromycin selection. CATCTTCCAGGAG-30; GAPDH RV 50-CTTCTCCATGGTGGT- For studies of PIM1-s overexpression, shSTAT5–BV173 cells GAAGACG-30. were transduced with the PIM1-s lentivirus and selected by EGFP sorting, using a BD FACSAria II cell sorter. Animals For studies of MCL1 or BCL2 overexpression, shSTAT5–BV173 Animal experiments were approved by Thomas Jefferson Uni- or shSTAT5–shBIM–BV173 cells were transduced with the MCL1 versity Institutional Animal Care and Use Committee under or BCL2 lentivirus and selected by EGFP or mCherry sorting protocol 00012. respectively, using a BD FACSAria II cell sorter. For leukemogenesis assays, 106 leukemia cells (shSTAT5-cell lines or primary cells from patients with Phþ ALL) were injected Protein analysis intravenously in 7- to 9-week-old NOD/SCID/IL-2Rgnull mice Cells were counted and lysed at a density of 10,000/mLin (The Jackson Laboratory). Laemmli Buffer supplemented with 5% b-Mercaptoethanol. To induce STAT5 downregulation in vivo, mice were continuo- Lysates where run on a 4% to 20% gradient polyacrylamide gel usly treated with doxycycline (2 g/L) in D(þ)-sucrose-supplemented (Biorad) and transferred onto a nitrocellulose membrane (Fisher (30 g/L) drinking water starting 72 hours post-cell injection. Scientific) using a semi-dry trans-blot transfer cell (Bio-Rad). IST5-002 was dissolved in 0.2% hydroxypropyl methylcellu- Membranes were then blocked in 5% nonfat dry milk/TBS-T and lose and administered intraperitoneally (50 or 100 mg/kg) daily incubated with the following primary antibodies: STAT5 (C-17; for a total of 14 days. 1:4,000; Santa Cruz Biotechnology; #sc-835), p-STAT5 (Y649; Sabutoclax (5 mg/kg; ApexBio) was dissolved in 10% 1:1,000; BD #611964), STAT3 (1:1,000; Transduction lab Kolliphor-EL (Sigma-Aldrich)-10% ethanol-80% PBS and #610190), b-actin (8H10D10; 1:4,000; Cell Signaling Tech- administered intraperitoneally every other day for a total of nology; #3700S) or b-actin (D6A8; 1:4,000; Cell Signaling Tech- seven doses (14 days). nology; #8457P), BCL2 (1:1,000; BD #610538), MCL1 (S-19; AZD1208 (100 mg/kg; SelleckChem) was dissolved in 0.5% 1:1,000; Santa Cruz #sc-819), BCL-XL (1:1,000; Cell Signaling hydroxypropyl methylcellulose-0.1% Tween 80 and administrat- Technolgy; #2762S), PIM-1 (1:250; Cell Signaling Technology ed by oral gavage every day for 14 days. #2907S), p-BAD (S112) (40A9; 1:500 Cell Signaling Technology; Leukemia formation was monitored by flow cytometry detec- #5284T), BAD (1:1,000; Santa Cruz; #sc-8044), p-4EBP1 (T37/ tion of the human CD19 antigen (by antibody #555415 from 46; 1:500; Cell Signaling Technology; #236B4), 4EBP1 1:1,000; BD Biosciences) in peripheral blood obtained by retro orbital Cell Signaling Technology; #9644P), p-MYC (phospho-S62; bleeding.

www.aacrjournals.org Cancer Res; 78(20) October 15, 2018 5795

Minieri et al.

Statistical analyses survival was statistically significant (P < 0.001; Fig. 1E). Mice Data, expressed as mean SD of three experiments, were injected with shSTAT5–SUP-B15 cells and treated with doxycy- analyzed for statistical significance by unpaired, two-tailed cline survived up to 105 days with a median survival of 82 days, Student t test. P < 0.05 was considered statistically significant. which is significantly longer of that of the untreated mice For drugs combination studies, combination indexes (CI) were (median survival ¼ 55 days; P < 0.001; Fig. 1E). Doxycycline calculated by the Chou–Talalay method (28) and synergism was treatment also induced a statistically significant increase in the defined as CI ¼ 0.1–0.9. survival of NSG mice injected with shSTAT5–Z181 cells (Fig. Kaplan–Meier plots for mice survival experiments were gener- 1E). Untreated mice injected with shSTAT5–Z181 cells survived ated using the GraphPad Prism 6.0 software. Differences in significantly longer (median survival ¼ 102 days) than those survival were assessed by log-rank test. injected with shSTAT5–BV173 or SUP-B15 cells; however, doxycycline-treated mice injected with shSTAT5–Z181 cells survived more than 180 days (Fig. 1E). Results To further evaluate the requirement for STAT5 expression for STAT5 silencing decreases cell growth, increases apoptosis, and growth of primary Phþ ALL cells we utilized colony formation suppresses leukemogenesis of Phþ ALL cells assays of patient-derived primary Phþ ALL cells. For these assays, To investigate the role of STAT5 in Phþ ALL, we transduced peripheral blood blast cells from four patients with Phþ ALL, two human Phþ leukemia cell lines BV173, SUP-B15, and Z181 with a newly diagnosed (ALL #004 and ALL #011) and two from lentiviral plasmid carrying a doxycycline-inducible shSTAT5 relapsed ALL post-therapy with TKIs (ALL #5775 and ALL (shSTAT5-Tet-pLKO) and assessed cell growth and survival upon #3961) were transduced with a lentivirus constitutively expressing doxycycline treatment. a STAT5 shRNA used to silence STAT5 expression in K562 cells Doxycycline treatment induced a decrease in STAT5 expression (30), or a scramble shRNA and plated (105 cells/plate) in meth- in each cell line (Fig. 1A). However, the effect was more pro- ylcellulose in the presence of puromycin. As shown in Fig. 2A, nounced in BV173 cells and became detectable after a 72 hours STAT5 expression was downregulated in shSTAT5 lentivirus-trans- treatment due to the long half-life of the STAT5 protein (29). As duced cells from each patient (left). Expression of STAT5-regu- control, levels of STAT3 were not affected by the doxycycline- lated BCL2 and MCL1 was also downregulated in STAT5-silenced induced shSTAT5 (Fig. 1A). samples, except for BCL2 in sample ALL #004. Importantly, STAT5 silencing markedly reduced cell growth of all three lines, STAT5-silenced cells from patient's samples were markedly less but the effect was more evident in BV173 cells (Fig. 1B), probably clonogenic than the scramble-transduced counterparts (Fig. 2A, reflecting the near complete inhibition of STAT5 expression in right). these cells (Fig. 1A). Of interest, suppression of colony formation and a marked STAT5 silencing caused a marked increase in the apoptosis decrease of BCL2 and MCL1 levels compared with the scramble- of BV173 and SUP-B15 cell lines measured by flow cyto- transduced counterpart was also observed in STAT5-silenced metry detection of caspase 3/7 activation (Fig. 1C). Apoptosis blast cells from a patient with Ph-like ALL (#005, Supplementary was detected at 72 hours and increased after a 96 and Table S2; Fig. 2B). 120 h of doxycycline treatment, consistent with the kinetics of doxycycline-induced STAT5 downregulation. In BV173 cells, Pharmacologic inhibition of phospho-STAT5 suppresses apoptosis induced by STAT5 silencing for 72 to 120 hours Phþ ALL growth ex vivo and in mice ranged from 46% to 95%, whereas in SUP-B15 cells, at the In silico screening of chemical structure databases has recently same time points, it ranged from 20% to 26%. Compared with identified IST5-002 as a candidate small molecule inhibitor of control cells, induction of apoptosis in STAT5-silenced Z181 STAT5 (31). Such activity was confirmed based on its ability to cells was not statistically significant. suppress JAK2 and BCR-ABL1-mediated STAT5 phosphorylation, ThedependenceofPhþ ALL cell lines on STAT5 expression STAT5A/B dimerization, and to inhibit the transcriptional activity was also assessed by methylcellulose colony formation of STAT5A and STAT5B (31). assays. These assays revealed that doxycycline-treated, STAT5- Thus, we assessed if IST5-002 can mimic the ex vivo and in vivo silenced BV173, SUP-B15, and Z181 cells were markedly less effects of STAT5 silencing in Phþ ALL cells. Treatment with clonogenic than the untreated counterparts (Fig. 1D). Doxycy- IST5-002 markedly suppressed the growth of Phþ cell lines, cline treatment had no effect on STAT5 expression, apoptosis, including the TKI-resistant T315I BV173 derivative (Supplemen- or colony formation of shScramble-transduced Phþ ALL cells tary Fig. S2). IST5-002-induced growth suppression was associ- (Supplementary Fig. S1A–S1C). ated with markedly decreased STAT5 phosphorylation (Supple- Next, we assessed STAT5 requirement for leukemia develop- mentary Fig. S2). ment in NOD/SCID-IL-2Rgnull (NSG) mice injected with Phþ More importantly, treatment with IST5-002 also suppressed BV173, SUP-B15, or Z181 cells transduced with the doxycycline STAT5 phosphorylation and colony formation of leukemic blasts inducible shSTAT5 lentivirus. Mice were injected in the tail vein from eight patients with Phþ ALL (Fig. 3A and B), including five with 106 cells and, starting at day 3, doxycycline was added to the samples (ALL #2534, ALL #5775, ALL #1577, ALL#27574, and drinking water while control mice were left untreated. Control ALL #3961) from patients with relapsed leukemia post-therapy mice injected with shSTAT5–BV173 or SUP-B15 cells died of with TKIs. leukemia (bone marrow heavily infiltrated by leukemic cells and The Ph-like ALL cell lines MUTZ-5 and MHH-CALL-4 exhibit splenomegaly) within 60 days of leukemic cell injection (median expression of phospho-STAT5 (Supplementary Fig. S3A) driven survival ¼ 58 days). Mice injected with shSTAT5–BV173 cells and by the IGH/CRLF2 translocation and JAK2 mutation (32). Treat- given doxycycline to induce STAT5 silencing survived up to 188 ment with IST5-002 suppressed STAT5 phosphorylation and days with a median survival of 162 days; such increase in overall growth of these cell lines (Supplementary Fig. S3B) and STAT5

5796 Cancer Res; 78(20) October 15, 2018 Cancer Research

STAT5 Pathways in Phþ ALL

Figure 1. Effect of STAT5 silencing on cell growth, apoptosis, and leukemogenesis of Phþ leukemia cell lines. A–D, Western blot analysis (A), cell growth (B), apoptosis (C), and colony formation (D) of untreated or doxycycline (Doxy)-treated shSTAT5 Phþ cell lines. Cell growth was determined by MTT assays and data are expressed as optical density (OD). For Z181 cells, MTT assays were performed until 144 hours. Apoptosis was measured as the percentage of cells expressing activated caspase 3/7 by flow cytometry analysis. For colony formation assays, cells were seeded in methylcellulose plates (2,500–5,000 cells/dish), with or without doxycycline. Colonies were counted 7 to 10 days after plating. Results are expressed as percentage inhibition of colony formation in doxycycline-treated versus untreated plates. (no asterisk, not significant; , P < 0.05; , P < 0.01; , P < 0.001). E, Kaplan–Meier survival plot of untreated or doxycycline-treated NSG mice injected with shSTAT5 Phþ leukemia cell lines. P values indicate statistical significance of the difference in survival between untreated and doxycycline-treated mice.

www.aacrjournals.org Cancer Res; 78(20) October 15, 2018 5797

Minieri et al.

phosphorylation and colony formation of a primary Ph-like ALL sample (#005) also carrying the IGH/CRLF2 translocation (Supplementary Table S2; Supplementary Fig. S3C). To assess whether IST5-002 treatment has detrimental effects on normal hematopoietic cells, we performed colony formation assays of cytokine-treated stem cell-enriched G-CSF–mobilized þ CD34 cells, samples J48 and J50, from two healthy donors. Treatment with IST5-002 (5 or 10 mmol/L) suppressed cytokine- dependent STAT5 phosphorylation in both samples (Supplemen- tary Fig. S4); however, IST5-002 had no effect on colony formation at the 5 mmol/L concentration and partially reduced colony formation in sample J50 only at the 10 mmol/L concentration (Supplementary Fig. S4). Then, we tested whether treatment with IST5-002 suppressed leukemogenesis in NSG mice injected with Phþ ALL cells. For these experiments, we used the Phþ ALL SUP-B15 cell line and primary cells from a patient with a TKI-resistant Phþ ALL with the T315I ABL1 kinase domain mutation. In the SUP-B15 model, mice were treated with vehicle (10/group) only or with 50 mg/kg IST5-002 (6/group) for 14 consecutive days starting 7 days after cell injection. Vehicle-treated mice had a median survival of 56 days; by contrast, mice treated with IST5-002 survived up to 89 days, with a median survival of 68 days (P < 0.05; Fig. 3C). In the TKI-resistant Phþ ALL primary cells model, mice (four/ group) were injected with 106 cells/mouse and when peripheral þ blood CD19 cells were 5% to 9% (6 weeks post cell injection) mice were treated intraperitoneally for 14 days with a daily dose of 100 mg/kg IST5-002 or with diluent only. Peripheral blood leukemia burden was assessed at the end of the treatment by þ ﬂow cytometry analysis of CD19 cells. Although vehicle-treated þ mice showed an increase in the percentage of CD19 leukemia cells from 5% to 8% to about 20%, leukemia growth was essen- tially blocked in the IST5-002–treated mice (Fig. 3D). These ﬁndings support the concept that STAT5 or STAT5-regulated pathways may serve as targets for the treatment of Phþ ALL.

Mechanisms involved in the growth suppression of STAT5-silenced Phþ ALL cells: role of BCL2 family members The growth suppression of Phþ ALL cells induced by STAT5 silencing is largely caused by enhanced apoptosis (Fig. 1C). Thus, we assessed the expression of members of the BCL2 family, some of which were previously reported to be regulated by STAT5 (33–36); such analysis is a necessary ﬁrst step to further investigate if there is a functional link between changes in the expression of BCL2 family proteins and apoptosis induced by STAT5 silencing. Compared with the untreated counterparts, doxycycline-treated shSTAT5-BV173, shSTAT5-SUP-B15, and shSTAT5-Z181 cells exhibited a decrease in the expression of anti-apoptotic BCL2 and MCL1 proteins (Fig. 4A). Decreased expression of anti-apoptotic BCL2 and MCL1 proteins was also observed in STAT5- silenced Phþ primary ALL cells and the Ph-like primary sample #005 (Fig. 2). Figure 2. Doxycycline-treated shSTAT5-BV173, shSTAT5-SUP-B15, and Effect of STAT5 silencing on primary Phþ or Ph-like ALL cells. A and B, shSTAT5-Z181 cells also exhibited an increase in the expression of Western blot analysis and colony formation of Phþ ALL primary cells (newly the BH3-only proapoptotic BIM protein, although such an diagnosed or relapsed/TKI-resistant; A) or a newly diagnosed Ph-like ALL increase was detected at 72 but not at 96 hours in Z181 cells sample (B) transduced with a scramble or a STAT5 shRNA lentivirus. A total (Fig. 4A). Expression of anti-apoptotic BCL-XL protein was of 100,000 cells/plate were seeded in the presence of puromycin. Colonies were counted 7 to 10 days after plating. Results are expressed as percentage unchanged (Fig. 4A). inhibition of colony formation of shSTAT5-transduced versus scramble- To investigate whether increased BIM expression can explain transduced Phþ or Ph-like ALL primary cells (, P < 0.001). the enhanced apoptosis of STAT5-silenced Phþ ALL cells, we

5798 Cancer Res; 78(20) October 15, 2018 Cancer Research

STAT5 Pathways in Phþ ALL

Figure 3. Effect of the STAT5 inhibitor IST5-002 on colony formation and leukemogenesis of Phþ ALL cells. Western blot analysis (A) and colony formation (B)of IST5-002–treated primary Phþ ALL cells. For Western blot analysis, cells from Phþ ALL samples were left untreated (Ctrl) or treated with 5 or 10 mmol/L IST5-002 for 24 hours. Whole cell lysates were blotted with anti-p-STAT5, STAT5 and b-actin antibodies. For colony formation assays, cells (100,000/dish) were seeded in methylcellulose plates in presence of medium only or with 5 or 10 mmol/L IST5-002. Colonies were counted after 10 days. Results are expressed as percentage inhibition of colony formation from IST5-002–treated versus untreated cells (, P < 0.001). C, Kaplan–Meier survival plot of NSG mice injected with SUP- B15 Phþ ALL cells (106 cells/mouse) and treated with vehicle only or with IST5-002 (50 mg/kg/14 consecutive days) starting 7 days post-cell injection. , P < 0.05, statistical signiﬁcance of the difference in survival between IST5-002–treated versus diluent-treated mice. D, Peripheral blood leukemia load measured as percentage of CD19þ cells in NSG mice injected with ALL#557 sample before or after treatment with vehicle or IST5-002 (100 mg/kg/14 consecutive days; right); fold-change (log2 % CD19 positivity) in leukemia burden based on data shown in right panels (left). NS, not signiﬁcant; , P < 0.05; , P < 0.01; , P < 0.001.

www.aacrjournals.org Cancer Res; 78(20) October 15, 2018 5799

Minieri et al.

Figure 4. Effect of BIM silencing or BCL2/MCL1 expression on the apoptosis of STAT5-silenced Phþ ALL cells. A, B, and E, Western blot analysis shows expression of BCL2, MCL1, and BIM in the indicated STAT5-silenced Phþ ALL cell lines (A) and in the shSTAT5-BV173 derivative line transduced with the doxycycline (Doxy)-regulated shBIM lentivirus (B), or in shSTAT5-BV173 ectopically expressing MCL1 or BCL2 (E; left), or in the shSTAT5-shBIM-BV173 line expressing MCL1 or BCL2 (E; right); percentage of apoptotic cells detected by Annexin V staining in shSTAT5-BV173 parental and derivative cell lines, untreated or doxycycline- treated to silence STAT5 expression (C and D).

generated the shSTAT5-BV173 derivative cell line transduced with whether restoring BCL2 or MCL1 expression would also rescue the a doxycycline-regulated BIM shRNA lentivirus (shSTAT5–shBIM– apoptosis of STAT5-silenced BV173 cells. In these lines, we BV173 line; Fig. 4B) and assessed apoptosis induced by STAT5 assessed apoptosis only by Annexin V staining because GFP silencing. As shown in Fig. 4C and D and Supplementary Fig. S5, expression does not allow to measure active caspase 3/7. As shown downregulation of BIM expression suppressed apoptosis induced in Figure 4C and D, expression of BCL2 was as effective as BIM by STAT5 silencing; however, a fraction of doxycycline-treated silencing in inhibiting apoptosis induced by STAT5 silencing shSTAT5–shBIM BV173 cells were apoptotic at 96 hours (Fig. 4D), while the effect of MCL1 expression was negligible. Based on in spite of apparently complete inhibition of BIM expression (Fig. these ﬁndings, we generated the shSTAT5-shBIM-BCL2-BV173 4B). Next, we generated the shSTAT5–BCL2–BV173 or the and the shSTAT5–shBIM–MCL1–BV173 derivative lines (Fig. shSTAT5–MCL1–BV173 derivative line (Fig. 4E, left) and assessed 4E, right) and asked whether combining BIM silencing with BCL2

5800 Cancer Res; 78(20) October 15, 2018 Cancer Research

STAT5 Pathways in Phþ ALL

or MCL1 expression would be more effective than BIM silencing or BCL2/MCL1 expression alone in blocking apoptosis induced by STAT5 silencing. As shown in Fig. 4C and D, combining BIM silencing with BCL2 or MCL1 expression rescued almost completely the apoptosis of STAT5-silenced BV173 cells.

Role of the STAT5-regulated PIM-1 gene in the growth of Phþ ALL cells In a previous study (31), we performed oligonucleotide microarray hybridization to generate the gene expression profile of STAT5-silenced Phþ K562 cells. Thus, we assessed whether the expression of selected STAT5-regulated genes identified in K562 cells was also modulated in STAT5-silenced BV173 cells. As shown in Supplementary Fig. S6, expression of MYC, TRIB3, ITGB1, IDH2, ITGA5, PIM1 was markedly reduced in STAT5-silenced BV173 cells, compared with control cells. Then, we focused on STAT5-regulated PIM-1 because of: (i) its established oncogenic effects (35); (ii) commercially available compounds that inhibit PIM-1 and PIM-2 (37–39); (iii) the efficacy of the selective PIM kinase inhibitor AZD1208 in preclinical models of acute myeloid leukemia (40). First, we assessed if PIM-1 protein levels were reduced in STAT5- silenced Phþ ALL cell lines. doxycycline-treated shSTAT5 Phþ cell lines all showed decreased expression of the short isoform of PIM-1 (PIM1-s; Supplementary Fig. S7A). Expression of PIM1-s in blast cells from patients with Phþ ALL showed sample-to-sample variation; however, it correlated well with levels of total and tyrosine phosphorylated STAT5 (Supple- mentary Fig. S7B). Of interest, levels of PIM1 and STAT5A or STAT5B mRNAs were also correlated in a microarray dataset from patients with acute B- cell leukemia; in the Phþ subset, only the STAT5A–PIM1 correlation was statistically significant (Supplementary Fig. S7C–S7F). However, assessing levels of phospho-STAT5 is likely to be more informative than evaluating mRNA levels in correlative studies (41). Then, we asked whether restoring PIM-1s expression in STAT5 silenced BV173 cells would rescue the growth inhibition of these cells. PIM-1s overexpression did not enhance the overall growth of STAT5-silenced BV173 cells because apoptosis and BIM expression induced by STAT5 silencing was not rescued (Supplementary Fig. S8A and S8B). These findings indicate that STAT5 activation downstream of BCR-ABL1 promotes growth and survival of Phþ ALL cells through different effectors. The role of the PIM-1 kinase in Phþ ALL cells was assessed Figure 5. by pharmacologic inhibition with the pan-PIM inhibitor Effect of PIM kinase inhibition or STAT5 silencing on signal transduction pathways in Phþ ALL cells. Western blot analysis of PIM-1-regulated proteins AZD1208 (40). in AZD1208-treated Phþ ALL lines (A) and primary Phþ ALL samples (B) BV173, SUP-B15, and Z181 cell lines were treated with or in STAT5-silenced Phþ ALL lines (C). 3 mmol/L AZD1208 and PIM kinase-regulated pathways were analyzed by Western blotting (Fig. 5A). Previous studies showed that PIM-1 stabilizes c-MYC expres- As expected, treatment of Phþ ALL cell lines with AZD1208 led sion through phosphorylation of Serine 62 (42, 43). Consistent to a decrease in S112 phosphorylation with no changes in total with these findings, AZD1208-treated BV173, SUP-B15, or Z181 levels of BAD (Fig. 5A). cells exhibited reduced levels of phospho (S62) MYC, but total The translation regulator eukaryotic elongation factor 4E- levels of c-MYC were little changed (Fig. 5A). BP1 is also regulated by PIM kinases, directly at the Threonines Phosphorylation of BAD by PIM-1 at serine 112 is a mechanism 37/46 priming sites and indirectly via mTOR-dependent through which BAD is sequestered in the cytoplasm in complex mechanisms, causing the dissociation from eukaryotic initia- with 14-3-3 allowing mitochondrial BCL2 to suppress BAX- tion factor 4, and promoting the activation of cap-dependent dependent apoptosis (44). translation (45–47).

www.aacrjournals.org Cancer Res; 78(20) October 15, 2018 5801

Minieri et al.

Multiple bands, indicative of hyperphosphorylated 4E-BP1, The combined treatment had synergistic effects at all drug were detected in untreated BV173, SUP-B15, and Z181 cells (Fig. concentrations except one in parental and TKI-resistant BV173 5A). Treatment with AZD1208 induced a marked decrease of cells and in Z181 cells while the effect was predominantly additive phospho (T37/46)-4E-BP1 expression in SUP-B15, BV173, and in SUP-B15 cells (Supplementary Fig. S10E–S10H). Z181 cells (Fig. 5A) but total 4E-BP1 levels did not change Interestingly, cotreatment with the two drugs also enhanced (Fig. 5A). apoptosis of Ph-like MUTZ-5 and MHH-CALL-4 cell lines com- Consistent with the effect of AZD1208 in Phþ ALL cell lines, pared with treatment with AZD1208 or Sabutoclax alone (Sup- AZD1208-treated blast cells from three patients with Phþ ALL plementary Fig. S11). also showed decreased phosphorylation of BAD (S112), c-MYC To further analyze the efficacy of the combined AZD1208/ (S62), and 4E-BP1 (T37/46; Fig. 5B). Levels of total BAD and 4E- Sabutoclax treatment on Phþ ALL cells, we performed methyl- BP1 remained unchanged (Fig. 5B) cellulose colony assays of drug-treated BV173, BV173 (T315I), Of interest, STAT5 silencing in BV173, SUP-B15, or Z181 cells SUP-B15 cell lines, and nine primary samples from patients with had effects similar to those of AZD1208 treatment on the phos- Phþ ALL. These samples are from six newly diagnosed and three phorylation of c-MYC (S62), 4E-BP1 (T37/46), and BAD patients with relapsed/TKI-resistant ALL (sample #557 expresses (S112; Fig. 5C), likely reflecting downregulation of PIM-1 levels. the p210 isoform and carries the T315I ABL1 mutation; sample However, total levels of c-MYC were markedly reduced only #3961 expresses the p190 isoform and carries the T315I mutation; after STAT5 silencing, suggesting that STAT5 regulates c-MYC and sample #11463 expresses the p190 isoform with no muta- expression through multiple pathways, including enhanced tran- tions detected in the TKD). Treatment with AZD1208 or Sabu- scription (see Supplementary Fig. S6). Expression of PUMA and toclax alone suppressed, with varying degrees, colony formation NOXA was not affected by STAT5 silencing in Ph+ ALL cell lines in each case, with the exception of Sabutoclax treatment of ALL (Fig. 5C). samples #1539 and #3934, but the most marked effect was Together, these data indicate that PIM-1 might regulate cell observed when the two drugs were used in combination growth of Phþ ALL cells via activation of multiple pathways and (Fig. 6A and B). suggest that pharmacologic inhibition of PIM-1 could suppress Next, we assessed the effect of the AZD1208/Sabutoclax com- Phþ ALL cell growth. bination in leukemia progression in vivo. NSG mice were injected with Phþ ALL #004, #536, or #557 (T315I) cells and, when þ The PIM kinase inhibitor AZD1208 cooperates with the BCL2 peripheral blood CD19 cells were 5% to 20%, mice were treated family antagonist Sabutoclax to suppress Phþ ALL cell growth for 14 days with AZD1208 alone, Sabutoclax alone, or with both ex vivo and in NSG mice drugs. Then, peripheral blood leukemia burden was assessed; the Changes in the expression of BCL2 and BIM appear to be AZD1208/Sabutoclax combination was more effective than either essential for the apoptosis of STAT5-silenced Phþ ALL cells (Fig. 4) drug alone in suppressing Phþ ALL, resulting in leukemia burdens and several growth-promoting pathways are suppressed in these lower than those observed before the treatment, in each Phþ ALL cells by pharmacologic inhibition of STAT5-regulated PIM kinase sample (Fig. 7A and B). (Fig. 5). Thus, we tested the effects of the PIM kinase inhibitor AZD1208 and the pan-BCL2 family inhibitor Sabutoclax in Phþ ALL cells ex vivo and in NSG mice. Discussion Sabutoclax functions as a BH3 mimetic that, like BIM, binds In this study, we assessed the dependence of Phþ ALL cells on anti-apoptotic members of the BCL2 family (BCL2, BCL-XL, the expression/activity of STAT5 and its downstream effectors and MCL1) blocking their anti-apoptotic activity (48, 49). used such knowledge for targeted therapy of Phþ ALL in patient- MTT assays revealed that treatment with AZD1208 or Sabuto- derived xenografts. clax suppressed the growth of BV173, SUP-B15, and Z181 cells, The role of STAT5 for in vivo maintenance of oncogenic Abl- including the TKI resistant BV173 (T315I) cell line and that the driven ALL was previouslyinvestigated in p210-BCR-ABL1 orv-Abl- combined treatment was more effective than either drug alone induced leukemia upon conditional deletion of STAT5A/B (18, 19, (Supplementary Fig. S9A–S9D), suggesting that these drugs target 50). STAT5 expression was found to be dispensable for p210-BCR- nonoverlapping pathways. ABL1-driven B-cell leukemia in Balb/c mice whereas STAT5A/B Although treatment with Sabutoclax alone strongly increased deletion markedly suppressed v-Abl- and p190-BCR-ABL1-driven apoptosis in each Phþ ALL cell line, treatment with AZD1208 B-cell leukemia in C57BL/6 mice (18, 19, 50). Whether such alone did not. However, the AZD1208/Sabutoclax combination outcomes reflect differences in genetic background of recipient further increased apoptosis in BV173, BV173 (T315I), SUP-B15, mice and/or biological properties of p210-BCR-ABL1 versus v- and Z181 cells (Supplementary Fig. S9E–S9H). These findings Abl-transformed B-cell precursors is, at the moment, unclear. suggest that suppressing PIM kinase signaling (e.g., phosphory- Despite the potential relevance of STAT5 in BCR-ABL1-driven lation of BAD) is insufficient to provide a strong apoptotic signal, leukemia, the role of STAT5 expression has not been previously but it enhanced apoptosis induced by the BCL2 family antagonist assessed in human Phþ ALL cells. Using Phþ ALL cell lines Sabutoclax. expressing a doxycycline-regulated shSTAT5 that inhibits the These findings also suggest that the AZD1208/Sabutoclax com- expression of both STAT5 isoforms, we show here that down- bination may inhibit synergistically the growth of Phþ ALL cells. regulation of STAT5 expression leads to markedly decreased Thus, Phþ ALL cell lines were treated with three doses of proliferation and colony formation, induction of apoptosis, and AZD1208 and/or Sabutoclax, and the effects on cell growth were significantly prolonged survival of NSG mice injected with Phþ analyzed by MTT assay (Supplementary Fig. S10A–S10D). Com- ALL cells. Of interest, FACS-sorted CD19þ BV173 cells isolated bination indexes (CI) were calculated using CompuSyn software from the bone marrow of a mouse that developed leukemia, in and plotted in Supplementary Fig. S10E–S10H. spite of being continuously treated with doxycycline, expressed

5802 Cancer Res; 78(20) October 15, 2018 Cancer Research

STAT5 Pathways in Phþ ALL

Figure 6. Effect of AZD1208 and Sabutoclax on colony formation of Phþ leukemia cell lines and primary Phþ ALL cells. Methylcellulose colony formation of BV173, SUP-B15, and BV173 (T315I) cell lines (A) or primary Phþ ALL samples (B), untreated or treated with AZD1208 (3 mmol/L), Sabutoclax (80 nmol/L), or a combination of AZD1208 and Sabutoclax. Colonies were counted 7 to 10 days after plating; results are expressed as percentage inhibition of colony formation from drug-treated versus untreated cells. , P < 0.05; , P < 0.01; , P < 0.001.

www.aacrjournals.org Cancer Res; 78(20) October 15, 2018 5803

Minieri et al.

Figure 7. Effect of AZD1208 and Sabutoclax on Phþ ALL burden in NSG mice. A, Percentage of CD19þ cells in NSG mice injected with ALL#004, ALL#557, or ALL# 536 sample before or after treatment with vehicle only, AZD1208, Sabutoclax, or AZD1208 and

Sabutoclax. B, fold-change (log2 % CD19 positivity) in leukemia burden based on data shown in A. NS, not signiﬁcant; , P < 0.05; , P < 0.01; , P < 0.001.

STAT5, suggesting that re-expression of STAT5 caused the re- Based on these ﬁndings, we assessed the reliance of Phþ ALL growth of Phþ ALL. cells on STAT5 activity by ex vivo and in vivo assays using IST5-002, STAT5-silenced primary Phþ ALL cells from patients with a small molecule inhibitor of STAT5A/B tyrosine phosphorylation newly diagnosed or relapsed/TKI-resistant disease were and dimerization, recently identiﬁed through structure-based markedly less clonogenic than the empty vector-transduced in silico screening of compounds binding to the STAT5 SH2 counterpart. domain (31). Of interest, STAT5 silencing also suppressed colony formation Such STAT5 inhibitor was highly effective in suppressing col- from blast cells of a patient with IGH/CRLF2-positive Ph-like ALL. ony formation and proliferation of Phþ and Ph-like ALL cells

5804 Cancer Res; 78(20) October 15, 2018 Cancer Research

STAT5 Pathways in Phþ ALL

þ while sparing a large fraction of normal stem cell-enriched CD34 primary samples, including sample #557, which carries the hematopoietic cells, in spite of suppressing STAT5 phosphoryla- TKI-resistant T315I mutation. tion very effectively also in these cells. The in vivo effects of Although these assays are not directly comparable, it should be IST5-002 were more modest of those induced by STAT5 silencing; noted that in vivo growth suppression by treatment with AZD1208 since it is unclear whether any of the commercially available or Sabutoclax alone did not correlate exactly with data from STAT5 inhibitors, including IST5-002, will be ever used in clinical colony formation assays. In particular, leukemia load was trials, we investigated if Phþ ALL cells are dependent on STAT5- markedly suppressed by treatment with Sabutoclax alone whereas regulated pathways that may provide alternative targets for the treatment with AZD1208 alone was effective only in one of three therapy of Phþ ALL. Targeting such pathways should phenocopy, Phþ ALL samples, in contrast to the statistically significant inhi- in part, the effects induced by STAT5 silencing or pharmacologic bition of colony formation induced by AZD1208 in eight of nine inhibition. samples. We found that the marked apoptosis induced by silencing Although these data point to the need of performing additional STAT5 expression in Phþ BV173 cells was largely dependent on studies to assess the extent the which treatment with AZD1208 downregulation of BCL2 or upregulation of proapoptotic BIM suppresses Phþ ALL growth ex vivo, they support the main finding while modulating MCL1 expression had negligible effects. of our in vivo studies, which is the marked suppression of leukemia Although these findings suggest that levels of BCL2 and BIM are load induced by the AZD1208/Sabutoclax combination. critical for STAT5-regulated survival of BV173 cells, other Phþ ALL In summary, our data indicate that targeting STAT5 or STAT5- cell lines and patients'-derived primary ALL cells may have dif- regulated pathways by pharmacologic approaches might provide ferent requirements for STAT5-regulated BCL2 family members. an alternative treatment for patients with Phþ ALL, especially In particular, this would not be surprising based on our findings those with relapsed or TKI-resistant disease. that levels of BCL2 family members exhibit wide variations in Phþ ALL cells (51). Disclosure of Potential Conflicts of Interest The growth and colony formation of Phþ ALL cells, including No potential conflicts of interest were disclosed. those derived from blast cells of newly diagnosed or relapsed/ TKI-resistant Phþ ALL patients, was also markedly suppressed by Authors' Contributions pharmacologic inhibition of the STAT5-regulated PIM1 kinase. Conception and design: V. Minieri, B. Calabretta However, restoring PIM1 expression was insufficient to rescue the Development of methodology: V. Minieri, M. De Dominici, S.A. Mariani, M.T. Nevalainen impaired growth of STAT5-silenced BV173 cells. These findings Acquisition of data (provided animals, acquired and managed patients, suggest that the anti-apoptotic signals that may be mediated by provided facilities, etc.): V. Minieri, M. De Dominici, P. Porazzi, O. Spinelli, the PIM1 kinase through phosphorylation of the BH3-only pro- A. Rambaldi tein BAD cannot compensate for the increased expression of BIM Analysis and interpretation of data (e.g., statistical analysis, biostatistics, protein induced by STAT5 silencing. computational analysis): V. Minieri, M. De Dominici, P. Porazzi, O. Spinelli, However, PIM kinase inhibition suppressed growth-promoting P. Porcu, B. Calabretta Writing, review, and/or revision of the manuscript: V. Minieri, P. Porazzi, pathways dependent on c-MYC expression and 4EBP-1 phosphor- – ex vivo A. Rambaldi, P. Porcu, M.T. Nevalainen, B. Calabretta ylation (42, 45 47), likely explaining the growth inhibitory Administrative, technical, or material support (i.e., reporting or organizing effects of AZD1208 in Phþ ALL cells. data, constructing databases): L.F. Peterson Given that that Phþ ALL cells rely for their growth on the Study supervision: V. Minieri, B. Calabretta expression/activity of STAT5-regulated effectors that can be targeted pharmacologically, we assessed the growth of Phþ Acknowledgments ALL cells ex vivo and in NSG mice, upon treatment with the PIM This work was supported, in part, by NCI grant RO1-CA167169 kinase inhibitor AZD1208 and the pan-BCL2 inhibitor to B. Calabretta, RO1-CA113580 to M.T. Nevalainen, and R21CA178755 to M.T. Nevalainen. We thank Dr. C.M. Eischen for critically reviewing the article. Sabutoclax. We thank Dr. Z. Jagani (Novartis) for kindly providing the Tet-pLKO-Neo shBIM In most Phþ ALL samples, including three samples from lentiviral vector, Dr. M. Carroll from the Stem Cell and Xenograft Core of the patients with relapsed/TKI-resistant disease, cotreatment with University of Pennsylvania for providing primary Phþ ALL samples, and Dr. N. Sabutoclax and AZD1208 had synergistic or additive growth- Flomenberg and the Bone Marrow Transplantation unit at Thomas Jefferson þ suppressive effects compared with the treatment with single University for providing CD34 human hematopoietic progenitor cells. agents; these findings are not surprising since AZD1208 and The costs of publication of this article were defrayed in part by the payment of Sabutoclax inhibit non-overlapping pathways regulated, at least advertisement þ page charges. This article must therefore be hereby marked in in part, by STAT5 in Ph ALL cells. accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The additive growth-suppressive effect of the AZD1208/ in vivo Sabutoclax combination was also detected by leukemo- Received January 19, 2018; revised June 25, 2018; accepted August 21, 2018; genesis assays in NSG mice injected with three Phþ ALL published first August 28, 2018.

References 1. Faderl S, Kantarjian HM, Talpaz M, Estrov Z. Clinical signiﬁcance of 3.WetzlerM,DodgeRK,MrozekK,CarrollAJ,TantravahiR,BlockAW, cytogenetic abnormalities in adult acute lymphoblastic leukemia. Blood et al. Prospective karyotype analysis in adult acute lymphoblastic 1998;91:3995–4019. leukemia: the cancer and leukemia Group B experience. Blood 2. Lugo TG, Pendergast AM, Muller AJ, Witte ON. Tyrosine kinase activity and 1999;93:3983–93. transformation potency by bcr-abl oncogene products. Science 1990; 4. Gleissner B, Gokbuget N, Bartram CR, Janssen B, Rieder H, 247:1079–1082. Janssen JW, et al. Leading prognostic relevance of the BCR-ABL

www.aacrjournals.org Cancer Res; 78(20) October 15, 2018 5805

Minieri et al.

translocation in adult acute B-lineage lymphoblastic leukemia: a indicate disease progression in chronic myeloid leukemia. Blood prospective study of the German Multicenter Trial Group and 2011.117:3409–20. confirmed polymerase chain reaction analysis. Blood 2002;99: 24. Pegoraro L, Matera L, Ritz J, Levis A, Palumbo A, Biagini G. Establishment of 1536–43. a Ph1-positive human cell line (BV173). J Natl Cacer Inst 1987;70: 5. El Fakih R, Jabbour E, Ravandi F, Hassanein M, Anjum F, Ahmed S, 447–453. et al. Current paradigms in the management of Philadelphia chromo- 25. Wu J, Meng F, Ying Y, Peng Z, Daniels L, Bornmann WG, et al. ON012380, a some positive acute lymphoblastic leukemia in adults. Am J Hematol putative BCR-ABL kinase inhibitor with a unique mechanism of action in 2018;93:286–95. imatinib-resistant cells. Leukemia 2010;24:869–872. 6. Bassan R, Rossi G, Pogliani EM, Di Bona E, Angelucci E, Cavattoni I, et al. 26. Young L, Sung J, Stacey G, Masters JR. Detection of Mycoplasma in cell Chemotherapy-phased imatinib pulses improve long-term outcome of cultures. Nat Protoc 2010;5:929–34. adult patients with Philadelphia chromosome-positive acute lymphoblas- 27. Jagani Z, Wiederschain D, Loo A, He D, Mosher R, Fordjour P, et al. The tic leukemia: Northern Italy Leukemia Group protocol 09/00. J Clin Oncol Polycomb group protein BMI-1 is essential for the growth of multiple 2010;28:3644–52. myeloma cells. Cancer Res 2010;70:5528–38. 7. Stirewalt DL, Guthrie KA, Beppu L, Bryant EM, Doney K, Gooley T, et al. 28. Chou TC. Drug combination studies and their synergy quantification using Predictors of relapse and overall survival in Philadelphia chromosome- the Chou-Talalay method. Cancer Res 2010;70:440–6. positive acute lymphoblastic leukemia after transplantation. Biol Blood 29. Chia DJ, Subbian E, Buck TM, Hwa V, Rosenfeld RG, Skach WR, et al. Marrow Transplant 2003;9:206–12. Aberrant folding of a mutant Stat5b causes growth hormone insensitivity 8. Yanada M, Takeuchi J, Sugiura I, Akiyama H, Usui N, Yagasaki F, et al. High and proteasomal dysfunction. J Biol Chem 2006;281:6552–8. complete remission rate and promising outcome by combination of 30. Soliera AR, Mariani SA, Audia A, Lidonnici MR, Addya S, Ferrari-Amorotti imatinib and chemotherapy for newly diagnosed BCR-ABL-positive acute G, et al. Gfi-1 inhibits proliferation and colony formation of p210BCR/ lymphoblastic leukemia: a phase II study by the Japan Adult Leukemia ABL-expressing cells via transcriptional repression of STAT 5 and Mcl-1. Study Group. J Clin Oncol 2006;24:460–6. Leukemia 2012;26:1555–63. 9. Rowe JM, Buck G, Burnett AK, Chopra R, Wiernik PH, Richards SM, et al. 31. Liao Z, Gu L, Vergalli J, Mariani SA, De Dominici M, Lokareddy RK, et al. Induction therapy for adults with acute lymphoblastic leukemia: results of Structure-based screen Identifies a potent small molecule inhibitor of more than 1500 patients from the international ALL trial: MRC UKALL XII/ Stat5a/b with therapeutic potential for prostate cancer and chronic myeloid ECOG E2993. Blood 2005;106:3760–7. leukemia. Mol Cancer Ther 2015;14:1777–93. 10. Dores GM, Devesa SS, Curtis RE, Linet MS, Morton LM. Acute leukemia 32 Tasian SK, Doral MY, Borowitz MJ, Wood BL, Chen IM, Harvey RC, et al. incidence and patient survival among children and adults in the United Aberrant STAT5 and PI3K/mTOR pathway signaling occurs in human States, 2001–2007. Blood 2012;119:34–43. CRLF2-rearranged B-precursor acute lymphoblastic leukemia. Blood 11. Pulte D, Jansen L, Gondos A, Katalinic A, Barnes B, Ressing M, et al. Survival 2012;120:833–842. of adults with acute lymphoblastic leukemia in Germany and the United 33. Yoshimoto G, Miyamoto T, Jabbarzadeh-Tabrizi S, Iino T, Rocnik JL, States. PLoS One 2014;9:e85554. Kikushige Y, et al. FLT3-ITD up-regulates MCL1 to promote survival of 12. Soverini S, De Benedittis C, Papayannidis C, Paolini S, Venturi C, Iacobucci stem cells in acute myeloid leukemia via FLT3-ITD-specific STAT5 activa- I, et al. Drug resistance and BCR-ABL kinase domain mutations in Phila- tion. Blood 2009;114:5034–5043. delphia chromosome-positive acute lymphoblastic leukemia from the 34. Gesbert F, Griffin JD. Bcr/Abl activates transcription of the Bcl-X gene imatinib to the second-generation tyrosine kinase inhibitor era: the main through STAT5. Blood 2000;96:2269–2276. changes are in the type of mutations, but not in the frequency of mutation 35. Lord JD, McIntosh BC, Greenberg PD, Nelson BH. The IL-2 receptor involvement. Cancer 2014.120:1002–9. promotes lymphocyte proliferation and induction of the c-myc, bcl-2, 13. Goetz CA, Harmon IR, O'Neil JJ, Burchill MA, Farrar MA. STAT5 activation and bcl-x genes through the trans-activation domain of Stat5. J Immunol underlies IL7 receptor-dependent cell development. J Immunol 2004; 2000;164:2533–41. 172:4770–4778. 36. Nawijn MC, Alendar A, Berns A. For better or for worse: the role of Pim 14. Dai X, Chen Y, Di L, Podd A, Li G, Bunting KD, et al. Stat5 is essential for oncogenes in tumorigenesis. Nat Rev Cancer 2011;11:23–34. early B cell development but not for B cell maturation and function. 37. Chen LS, Redkar S, Bearss WG, Wierda NG, Gandhi V. Pim kinase inhibitor, J Immunol 2007;179:1068–1079. SGI-1776, induces apoptosis in chronic lymphocytic leukemia cells. Blood 15. Malin S, McManus S, Busslinger M. STAT5 in B cell development and 2009;114:4150–4157. leukemia. Curr Opin Immunol 2010;22:168–176. 38. Xia Z, Knaak C, Ma J, Beharry ZM, Mciness C, Wang W, et al. Synthesis and 16. Malin S, McManus S, Cobaleda C, Novatchkova M, Delogu A, Bouillet P, evaluation of novel inhibitors of PIM-1 and PIM-2. J Med Chem et al. Role of STAT5 in controlling cell survival and immunoglobulin gene 2009;52:74–86. recombination during pro-B cell development. Nat Immunol 2010;11: 39. Curi DA, Beauchamp EM, Blyth GT, Arslan AD, Donato NJ, Giles FJ, et al. 171–179. Pre-clinical evidence of PIM kinase inhibitor activity in BCR-ABL1 unmu- 17. Roberts KG, Morin RD, Zhang J, Hirst M, Zhao Y, Su X, et al. Genetic tated and mutated Philadelphia chromosome-positive (Phþ) leukemias. alterations activating kinase and cytokine receptor signaling in high-risk Oncotarget 2015;6:33206–16 acute lymphoblastic leukemia. Cancer Cell 2012;22:153–166. 40. Keeton EK, McEachern K, Dillman KS, Palakurthi S, Cao Y, Grondine MR, 18. Hoelbl A, Kovacic B, Kerenyi MA, Simma O, Warsch W, Cui Y, et al. et al. AZD1208, a potent and selective pan-Pim kinase inhibitor, demon- Clarifying the role of Stat5 in lymphoid development and Abelson- strates efficacy in preclinical models of acute myeloid leukemia. Blood induced transformation. Blood 2006;107:4898–906. 2014;123:905–13. 19. Hoelbl A, Schuster C, Kovacic B, Zhu B, Wickre M, Hoelzl MA, et al. Stat5 is 41. Heltemes-Harris LM, Willette MJ, Ramsey LB, Qiu YH, Neeley ES, indispensable for the maintenance of bcr/abl-positive leukaemia. EMBO Zhang N, et al. Ebf1 or Pax5 haploinsufficiency synergizes with STAT5 Mol Med 2010.2:98–110. activation to initiate acute lymphoblastic leukemia. J Exp Med 2011; 20. Schwaller J, Parganas E, Wang D, Cain D, Aster JC, Williams IR, et al. Stat5 is 208:1135–49. essential for the myelo- and lymphoproliferative disease induced by TEL/ 42. Zhang Y, Wang Z, Li X, Magnuson NS. Pim kinase-dependent inhibition of JAK2. Mol Cell 2000;6:693–704. c-Myc degradation. Oncogene 2008;27:4809–19. 21. Xie S, Wang Y, Liu J, Sun T, Wilson MB, Smithgall TE, et al. Involvement of 43. Horiuchi D, Camarda R, Zhou AY, YauC,MomcilovicO,Balakrishnan Jak2 tyrosine phosphorylation in Bcr-Abl transformation. Oncogene S, et al. PIM1 kinase inhibition as a targeted therapy against triple- 2001.20:6188–95. negative breast tumors with elevated MYC expression. Nat Med 2016; 22. Nelson EA, Walker SR, Weisberg E, Bar-Natan M, Barrett R, Gashin LB, et al. 22:1321–9 The STAT5 inhibitor pimozide decreases survival of chronic myelogenous 44. Aho TL, Sandholm J, Peltola KJ, Mankonen HP, Lilly M, Koskinen PJ. leukemia cells resistant to kinase inhibitors. Blood 2011;117:3421–9. Pim-1 kinase promotes inactivation of the pro-apoptotic Bad protein by 23. Warsch W, Kollmann K, Eckelhart E, Fajmann S, Cerny-Reiterer S, phosphorylating it on the Ser112 gatekeeper site. FEBS Lett 2004;571: Holbl A, et al. High STAT5 levels mediate imatinib resistance and 43–9.

5806 Cancer Res; 78(20) October 15, 2018 Cancer Research

STAT5 Pathways in Phþ ALL

45. Yang Q, Chen LS, Neelapu SS, Miranda RN, Medeiros LJ, Gandhi V. totic B-cell lymphoma/leukemia-2 (Bcl-2) family proteins. J Med Chem Transcription and translation are primary targets of Pim kinase 2010;53:4166–4176. inhibitor SGI-1776 in mantle cell lymphoma. Blood 2012;120: 49. Goff DJ, Court Recart A, Sadarangani A, Chun HJ, Barrett CL, Krajewska 3491–500. M, et al. A Pan-BCL2 inhibitor renders bone-marrow-resident human 46.TamburiniJ,GreenAS,BardetV,ChapuisN,ParkS,WillemsL,etal. leukemia stem cells sensitive to tyrosine kinase inhibition. Cell Stem Protein synthesis is resistant to rapamycin and constitutes a promising Cell 2013;12:316–28. therapeutic target in acute myeloid leukemia. Blood 2009;114: 50. Walz C, Ahmed W, Lazarides K, Betancur M, Patel N, Hennighausen L, 1618–27. et al. Essential role for Stat5a/b in myeloproliferative neoplasms 47. Zhang F, Beharry ZM, Harris TE, Lilly MB, Smith CD, Mahajan S, et al. PIM1 induced by BCR-ABL1 and JAK2(V617F) in mice. Blood 2012.119: protein kinase regulates PRAS40 phosphorylation and mTOR activity in 3550–60. FDCP1 cells. Cancer Biol Ther 2009;8:846–53. 51. De Dominici M, Porazzi P, Soliera AR, Mariani SA, Addya S, Fortina P, et al. 48. Wei J, Stebbins JL, Kitada S, Dash R, Placzek W, Rega MF, et al. BI-97C1, an Targeting CDK6 and BCL2 exploits the "MYB addiction" of Phþ acute optically pure Apogossypol derivative as pan-active inhibitor of antiapop- lymphoblastic leukemia. Cancer Res 2018;78:1097–1109.

www.aacrjournals.org Cancer Res; 78(20) October 15, 2018 5807

Targeting STAT5 or STAT5-Regulated Pathways Suppresses Leukemogenesis of Ph+ Acute Lymphoblastic Leukemia

Valentina Minieri, Marco De Dominici, Patrizia Porazzi, et al.

Cancer Res 2018;78:5793-5807. Published OnlineFirst August 28, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-18-0195

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2018/08/28/0008-5472.CAN-18-0195.DC1

Cited articles This article cites 51 articles, 29 of which you can access for free at: http://cancerres.aacrjournals.org/content/78/20/5793.full#ref-list-1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/78/20/5793. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.