Hu Antigen R Regulates Antiviral Innate Immune Responses Through the Stabilization of Mrna for Polo-Like Kinase 2

Hu Antigen R Regulates Antiviral Innate Immune Responses through the Stabilization of mRNA for Polo-like Kinase 2

This information is current as Takuya Sueyoshi, Takumi Kawasaki, Yuichi Kitai, Daisuke of October 1, 2021. Ori, Shizuo Akira and Taro Kawai J Immunol published online 20 April 2018 http://www.jimmunol.org/content/early/2018/04/19/jimmun ol.1701282 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2018/04/19/jimmunol.170128 Material 2.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on October 1, 2021

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2018 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published April 20, 2018, doi:10.4049/jimmunol.1701282 The Journal of Immunology

Hu Antigen R Regulates Antiviral Innate Immune Responses through the Stabilization of mRNA for Polo-like Kinase 2

Takuya Sueyoshi,* Takumi Kawasaki,* Yuichi Kitai,† Daisuke Ori,* Shizuo Akira,‡,x and Taro Kawai*

Retinoic acid–inducible gene I (RIG-I)–like receptors (RLRs), RIG-I, and melanoma differentiation-associated gene 5 (MDA5) play a critical role in inducing antiviral innate immune responses by activating IFN regulatory factor 3 (IRF3) and NF-kB, which regulates the transcription of type I IFN and inflammatory cytokines. Antiviral innate immune responses are also regulated by posttranscriptional and translational mechanisms. In this study, we identified an RNA-binding protein HuR as a regulator for RLR signaling. Overexpression of HuR, but not of other Hu members, increased IFN-b promoter activity. HuR-deficient macrophage cells exhibited decreased Ifnb1 expression after RLR stimulation, whereas they showed normal induction after stimulation with bacterial LPS or immunostimulatory DNA. Moreover, HuR-deficient cells displayed impaired nuclear translocation of Downloaded from IRF3 after RLR stimulation. In HuR-deficient cells, the mRNA expression of Polo-like kinase (PLK) 2 was markedly reduced. We found that HuR bound to the 39 untranslated region of Plk2 mRNA and increased its stabilization. PLK2-deficient cells also showed reduced IRF3 nuclear translocation and Ifnb mRNA expression during RLR signaling. Together, these findings suggest that HuR bolsters RLR-mediated IRF3 nuclear translocation by controlling the stability of Plk2 mRNA. The Journal of Immu- nology, 2018, 200: 000–000.

nnate immune responses to virus infection are initiated upon 3 (IRF3). RLRs and cGAS use the mitochondrial protein IFN-b http://www.jimmunol.org/ the sensing of viral nucleic acid species by host pattern- promoter stimulator 1 (IPS-1) (also called MAVS) and the ER protein I recognition receptors, such as membrane-bound TLR3, STING as an adapter, respectively, which likewise culminates in the TLR7, and TLR9 and cytosolic proteins retinoic acid–inducible gene activation of NF-kB and IRF3 (3, 4). NF-kB largely regulates the I (RIG-I)–like receptors (RLRs) and cyclic GMP-AMP synthase expression of inﬂammatory cytokine genes, whereas IRF3 and IRF7 (cGAS). TLR3 and TLR7 sense dsRNA and ssRNA, respectively, regulate the expression of type I IFNs. whereas TLR9 senses DNA. The RLRs RIG-I and melanoma In the unstimulated condition, IRF3 is expressed in the cytoplasm. differentiation-associated gene 5 (MDA5) are cytoplasmic RNA After viral infection or other simulation, IRF3 is phosphorylated by ε

helicases that sense viral RNA, and cGAS is a cytoplasmic sensor for the kinase TBK1 and/or its related kinase IKKi (also known as IKK ) by guest on October 1, 2021 DNA (1, 2). Upon ligand ligation, they activate downstream sig- (5). This phosphorylation induces conformational changes in IRF3, naling pathways, culminating in the induction of inﬂammatory cy- which result in the formation of an IRF3 homodimer and its sub- tokinesandtypeIIFNs.TLR7andTLR9areknowntoplaycentral sequent translocation into the nucleus, where it binds to target DNA roles in plasmacytoid dendritic cells (DCs) via the recruitment of the and upregulates the transcription of type I IFN genes. The activation adapter MyD88, which eventually activates the transcription factors of IRF3 is tightly regulated by multiple mechanisms. IRF3 binding NF-kB and IRF7. TLR3 is expressed in various cell types, including to the lipid phosphatidylinositol 5-phosphate, which is increased conventional DCs, macrophages, and nonimmune cells, and it uses upon viral infection, causes IRF3 to be phosphorylated by TBK1/ another adapter, TRIF, to activate NF-kB and IFN regulatory factor IKKi (6). The conjugation of the ubiquitin-like protein ISG15 by

*Laboratory of Molecular Immunobiology, Division of Biological Science, Graduate Address correspondence and reprint requests to Prof. Taro Kawai, Laboratory of School of Science and Technology, Nara Institute of Science and Technology, Ikoma, Molecular Immunobiology, Graduate School of Biological Sciences, Nara Institute Nara 630-0192, Japan; †Department of Immunology, Graduate School of Pharma- of Science and Technology, 8916-5 Takayama-cho, Ikoma, Nara 630-0192, Japan. ceutical Sciences, Hokkaido University, Sapporo, Hokkaido 060-0812, Japan; E-mail address: [email protected] ‡Laboratory of Host Defense, Immunology Frontier Research Center, Osaka University, x The online version of this article contains supplemental material. Suita, Osaka 565-0871, Japan; and Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 565-0871, Japan Abbreviations used in this article: avSG, antiviral SG; BMM, bone marrow–derived macrophage; CDS, coding sequence; cGAS, cyclic GMP-AMP synthase; DC, den- Received for publication September 6, 2017. Accepted for publication April 3, 2018. dritic cell; Elavl1, ELAV-like protein 1; G3BP, Ras-GAP SH3 domain binding pro- This work was supported by Japan Ministry of Education, Culture, Sports, Science tein; gRNA, guide RNA; HMW, high m.w.; IPS-1, IFN-b promoter stimulator 1; and Technology KAKENHI Grants-in-Aid for Research Activity (B) 26293107 and IRF3, IFN regulatory factor 3; ISD, IFN stimulatory DNA; KO, knockout; LMW, low 17H04066 (to T. Kawai) and Grants-in-Aid for Young Scientists (B) 17K15598 m.w.; MDA5, melanoma differentiation-associated gene 5; MEF, mouse embryonic (to T. Kawasaki) and 17K15726 (to D.O.). This work was also supported by the ﬁbroblast; miRNA, microRNA; NDV, Newcastle disease virus; pGL3, pGL3- Uehara Memorial Foundation (to T. Kawai), the Takeda Science Foundation (to T. Kawai), Promoter Vector; pGL3-mPlk2 39UTR, pGL3-Promoter Vector harboring mouse the Joint Usage and Joint Research Programs, the Institute of Advanced Medical Plk2 39UTR; PLK, Polo-like kinase; poly(I:C), polyinosinic-polycytidylic acid; Sciences, Tokushima University (H27-28 to T. Kawai), and the Foundation for Nara RBP, RNA-binding protein; RIG-I, retinoic acid–inducible gene I; RLR, RIG-I–like Institute of Science and Technology (H28 to T. Kawai). receptor; RRM, RNA-recognition motif; RT-qPCR, real-time quantitative PCR; SG, stress granule; shRNA, short hairpin RNA; siRNA, small interfering RNA; UTR, T.S. performed the experiments. T.S., T. Kawasaki, Y.K., D.O., and T. Kawai untranslated region; W.B., Western blotting; WT, wild type. designed the experiments. S.A. contributed materials and tools. T.S., T. Kawasaki, and T. Kawai wrote the paper, and T. Kawai supervised the project. All authors Ó approved the ﬁnal version of the manuscript. Copyright 2018 by The American Association of Immunologists, Inc. 0022-1767/18/$35.00 The microarray data presented in this article have been submitted to the Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo/) under accession number GSE103459.

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1701282 2 HuR REGULATES ANTIVIRAL INNATE IMMUNITY

HERC5 is involved in sustained IRF3 activation (7). Additionally, intracellular stimulation. The transcriptional inhibitor actinomycin D was Polo-like kinase (PLK) 2 is associated with IRF3 nuclear transloca- purchased from Sigma-Aldrich. Newcastle disease virus (NDV) was pre- tion (8). In contrast, multiple proteins, including PIN1, YAP, RBCK1, pared as described previously (3). RAUL, PTEN, PP2A, MAPK phosphatase 5, SENP2, TRIM21 Plasmid construction a (Ro52), TRIM26, FoxO1, c-cbl, Rubicon, ERR ,MST1,andAGO2, Full-length mouse HuR, HuB, HuC, HuD, and PLK2 coding sequence (CDS) have been reported to negatively regulate IRF3 activation via distinct were amplified from murine brain, lung, and bone marrow cDNAs and mechanisms such as proteasome-dependent degradation, dephos- inserted into a pFlag-CMV-2 expression vector (Sigma-Aldrich). A series of phorylation, de-SUMOylation, and/or prevention of protein–protein mutants for HuR and PLK2 expression plasmids were generated by PCR from interactions (9–18). the full-length HuR pFlag-CMV-2 expression vector. For constructing the pGL3-Promoter Vector (pGL3) harboring mouse Plk2 39UTR (pGL3-mPlk2 Posttranscriptional modifications, including mRNA decay and 39UTR), the Plk2 39UTR sequence was amplified by PCR from murine bone stabilization, are critical for the regulation of antiviral innate immune marrow cDNA and inserted into XbaI-digested pGL3. Each of the deletion responses. Stabilization and degradation of mRNA for cytokines or mutant vectors was generated by PCR from pGL3-mPlk2 39UTR. The re- b k signaling molecules contribute to maintaining the proper innate porter plasmids for IFN- and NF- B and the expression plasmids for IPS-1, TRIF, and STING were constructed as described previously (3, 28). immune responses. RNA-binding proteins (RBPs), such as Regnase-1 (also known as Zc3h12a or Mcpip1), Roquin, and Arid5a, were found Generation of HuR and PLK2 knockout cells to regulate inflammatory responses by binding to their target mRNAs, Single-guide RNA (gRNA) targeting murine HuR exon 4 (gRNA no. 1, which encode inflammatory cytokines like IL-6. Regnase-1 and 59-GAAGACATGTTTTCTCGGTT-39; gRNA no. 2, 59-GACCATGACAC- Roquin recognize the stem-loop structure of the 39 untranslated re- AGAAGGATG-39) and mouse PLK2 exon 1 (gRNA, 59-GCGGACTATCA- gion (UTR) and promote the degradation of inflammation-related CCTACCAGC-39) were inserted into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene). Partial fractions of the murine HuR and mouse PLK2 CDS, in- Downloaded from mRNAs (19). Regnase-1–deficient mice showed severe autoim- cluding the single-guide RNA–targeted site, were inserted into pCAG-EGxxFP mune inflammatory diseases (20). In contrast, Arid5a increases (29). The pCAG-EGxxFP plasmid was provided by M. Ikawa (Osaka Univer- mRNA stability through binding to the 39UTR of target mRNA (21). sity). These plasmids were electroporated into RAW264.7 cells, and EGFP- HuR (also called ELAV-like protein 1[Elavl1]), an RBP that has positive cells were sorted and plated onto 96-well plates using FACSAria three RNA-recognition motifs (RRMs), belongs to the Hu protein (BD Biosciences). After cells were grown, HuR and PLK2 deficiency was confirmed by sequence analysis and/or Western blotting (W.B.). family, which is composed of HuR, HuB, HuC, and HuD. HuR is ubiquitously expressed, whereas HuB, HuC, and HuD are spe- Abs http://www.jimmunol.org/ cifically expressed in neuronal tissues (22). Normally, HuR is Mouse anti-HuR mAb (3A2; Santa Cruz Biotechnology), rabbit anti-TOM20 localized in the nuclei, but stimulation with UV radiation, alterations polyclonal Ab (FL-145; Santa Cruz Biotechnology), rabbit anti-IRF3 mAb in the microenvironment, or pathogen infections cause HuR reloc- (D83B9; Cell Signaling Technology), rabbit anti–phospho-IRF3 (Ser396) alization to cytoplasmic dotlike structures known as stress granules mAb (4D4G; Cell Signaling Technology), rabbit anti–NF-kB p65 mAb (D14E12; Cell Signaling Technology), rabbit anti-IRF3 polyclonal Ab (FL- (SGs). SGs contain numerous messenger ribonucleoprotein and 425; Santa Cruz Biotechnology), rabbit anti–phospho–NF-kB p65 (Ser536) RBPs, such as TIA1 and TIAR, and are formed under stresses such as mAb (93H1; Cell Signaling Technology), rabbit anti-G3BP polyclonal Ab changes in the microenvironment, chemical compounds, and bacterial (G6046; Sigma-Aldrich), goat anti-actin polyclonal Ab (I-19; Santa Cruz or viral infection. SGs are thought to stall translation during stress Biotechnology), goat anti–lamin B Ab (C-20; Santa Cruz Biotechnology), by guest on October 1, 2021 exposure (23). HuR was shown to interact with U- and AU-rich and mouse anti–FLAG M2 mAb (Sigma-Aldrich) were purchased as com- mercially available products. mRNA within the 39UTR, which are termed AU-rich RNA ele- ments, and HuR positively regulates their mRNA stability and Knockdown analysis translation. Additionally, HuR increases the stability of target mRNAs The small interfering RNA (siRNA) sequences for murine HuR, human by protecting the mRNAs from other RBPs or microRNAs (miRNAs) HuR, and firefly luciferase are as indicated below: murine HuR, that promote mRNA degradation (22, 24). Numerous mRNAs, such 59-AGGUUGAAUCUGCAAAGCUUAUUTT-39 (sense); human HuR, as those for VEGF-A, COX-2, IL-8, CCL2, CCL8, TNF-a,and 59-GCUCAGAGGUGAUCAAAGATT-39 (sense); firefly luciferase, 59-CGUACGCGGAAUACUUCGATT-39 (sense). siRNAs were synthe- cyclins, have been characterized as HuR targets; in this manner, HuR sized and annealed by Fasmac. siRNAs were electroporated into BMM and contributes to many aspects of biological processes, such as devel- THP-1 cells using Neon. Before electroporation of siRNA, THP-1 cells were opment, inflammation, and cancer progression (22, 25–27). However, differentiated in the presence of 100 ng/ml PMA for 24 h. Cells were then function of HuR in antiviral responses remains unclear. washed with PBS and cultured with 10% FBS RPMI 1640 for 48 h before In this study, we found that HuR plays an important role in Ifnb1 electroporation. BMM and THP-1 cells were subjected to experiments 2 d after electroporation. For the construction of short hairpin RNA (shRNA)– induction during RLR signaling. HuR binds to and stabilizes expressing retroviral vectors, the oligo DNA was inserted into the BglII and mRNA for PLK2, a kinase regulating IRF3 nuclear translocation. HindIII sites of pSUPER.retro.puro (OligoEngine). The oligo DNA sequences used are as follows: scrambled shRNA, 59-CCTAAGGCTAT- Materials and Methods GAAGAGATACTTCAAGAGAGTATCTCTTCATAGCCTTATTTTT-39; HuR shRNA, 59-GAGAACGAATTTAATTGTCAACTTTCAAGAGA- Cells, reagents, and virus AGTTGACAATTAAATTCGTTCTC-39. These vectors were transfected HEK293T, RAW264.7, and mouse embryonic fibroblast (MEF) cells were into Platinum-E cells using Lipofectamine 2000. The produced super- m cultured in DMEM (Nacalai Tesque) supplemented with 10% heat- natant was filtered through a 0.22- m filter 48 h after transfection and inactivated FBS in a 5% CO incubator. THP-1 cells were cultured in infected into MEFs. Following 48 h of infection, the cells were treated 2 with 2 mg/ml puromycin and cultured for 48 h. Surviving MEFs were RPMI 1640 supplemented with 10% heat-inactivated FBS in a 5% CO2 incubator. MEF cells were derived from wild type (WT) C57BL/6 mice. used for experiments. Bone marrow–derived macrophages (BMMs) were obtained from mouse Retroviral expression of HuR in RAW264.7 cells bone marrow cells cultured in RPMI 1640 supplemented with 10% FBS, 100 mM 2-ME, and 2 ng/ml mecombinant mouse M-CSF (BioLegend). For the construction of HuR-expressing retroviral vectors, murine HuR CDS High m.w. (HMW) polyinosinic-polycytidylic acid [poly(I:C)], low m.w. was inserted into pMXs-IRES-puro (Cell Biolabs) that contained Flag-tag (LMW) poly(I:C), and LPS were purchased from InvivoGen. Sense and and CMV promoter sequence. The retroviral vectors were transfected into anti-sense IFN stimulatory DNA (ISD) sequences were synthesized (Fasmac) Platinum-E cells using Lipofectamine 2000. The produced supernatant was and annealed manually (sense, 59-TACAGATCTACTAGTGATCTATGAC- filtered with a 0.22-mm filter 48 h after transfection and infected into TGATCTGTACATGATCTACA-39). HMW poly(I:C), LMW poly(I:C), RAW264.7 cells. After 48 h of infection, the cells were treated with 4 mg/ml and ISD were each mixed with Lipofectamine 2000 (Life Technologies) at puromycin for selecting virus-infected cells. Living cells were subjected to a ratio of 1:1 (microgram/microliter) in Opti-MEM (Life Technologies) for following experiments. The Journal of Immunology 3

Western blotting amplified and biotinylated using the Ovation RNA Amplification System V2 and Encore Biotin Module (both from NuGEN) according to the m RAW264.7 cells were cultured in six-well plates and stimulated with 1 g/ml manufacturer’s instructions. The biotinylated cDNA was hybridized with a HMW poly(I:C) for 1 or 3 h. Whole-cell lysates were prepared by lysing GeneChip Mouse Gene 2.0 ST Array (Affymetrix) using an Affymetrix cells in 50 mM Tris-HCl (pH 8), 150 mM NaCl, 1% Nonidet P-40, 0.5% GeneChip Fluidics Station 450, and the array was scanned with a Gen- 3 sodium deoxycholate, and 0.1% SDS. After centrifugation at 800 g for 10 eChip Scanner 3000 7G (Affymetrix). The microarray dataset has been min at 4˚C, supernatants were collected and used as whole-cell lysates. deposited in the Gene Expression Omnibus database (https://www.ncbi. Cytoplasmic and nuclear fractions were prepared as follows. Cells were nlm.nih.gov/geo/) under accession number GSE103459. lysed for 5 min on ice using hypotonic buffer (10 mM HEPES-KOH [pH 7.8], 10 mM KCl, 0.1 mM EDTA [pH 8], 0.1% Nonidet P-40, 1 mM DTT, RNA immunoprecipitation and protease inhibitor mixture [Roche]). After centrifugation of the samples at 2300 3 g for 5 min at 4˚C, supernatants were collected and used as cy- For preparing the Ab-conjugated beads, Protein-A Sepharose beads were toplasmic fractions. The remaining pellets were then lysed in hypertonic washed by NT2 buffer (50 mM Tris-Hcl [pH 7.4], 150 mM NaCl, 1 mM buffer (50 mM HEPES-KOH [pH 7.8], 420 mM KCl, 0.1 mM EDTA [pH 8], MgCl2, and 0.05% Nonidet P-40) and incubated with NT2 buffer supplemented with 5% BSA at 4˚C for 2 h. After washing with NT2 buffer, 5 mM MgCl2, 1 mM DTT, and protease inhibitor mixture). The pellets were incubated for 30 min on ice and mixed by vortex every 10 min. After IgG or anti-HuR Ab was added to the bead slurry, and samples were in- centrifugation of the samples at 17,800 3 g for 10 min at 4˚C, supernatants cubated overnight at 4˚C, followed by washing with NT2 buffer. To pre- were collected and used as nuclear fractions. Whole-cell lysates and cyto- pare the messenger ribonucleoprotein lysate, RAW264.7 cells were m plasmic and nuclear fractions were all subjected to SDS-PAGE and trans- stimulated with or without 1 g/ml HMW poly(I:C) using Lipofectamine ferred to an Immun-Blot PVDF membrane (Bio-Rad). The membrane was 2000. Following 8 h of stimulation, the cells were suspended in polysome then immunoblotted with the indicated Abs. The bound Abs were visualized lysis buffer (100 mM KCl, 5 mM MgCl2, 10 mM HEPES [pH 7], 0.5% with HRP-conjugated Abs against mouse, rabbit, or goat IgG (Sigma- Nonidet P-40, 1 mM DTT, RNaseOUT, and protease inhibitor mixture) and Aldrich) using Western Lightning Plus-ECL (PerkinElmer). HRP activity lysed by pumping using a 26G syringe needle (Terumo). After centrifu- 3 was detected by a LAS 4000 (Fujitsu Life Sciences). gation at 15,300 g for 15 min at 4˚C, the resulting supernatants were Downloaded from rotated with the Ab-conjugated beads for 2 h at room temperature. Beads RNA isolation and quantitative real-time PCR were then washed five times with NT2 buffer and treated with TRIzol reagent to extract the RNA. Cells were stimulated with 1 mg/ml HMW or LMW poly(I:C) for 8 h, with 1 mg/ml ISD for 6 h, or with 1 mg/ml LPS for 2 h. To measure mRNA Statistics stability, transcriptional activity was terminated by the addition of actinomycin D (2.5 or 5 mg/ml). Total RNA was extracted with TRIzol reagent Statistical significance was determined by Student unpaired t test and ANOVA with Tukey test. A p value ,0.05 was considered significant. (Invitrogen), and total RNA was used for cDNA synthesis using ReverTra http://www.jimmunol.org/ Ace (Toyobo) according to the manufacturer’s instructions. Real-time quantitative PCR (RT-qPCR) was performed using Power SYBR Green PCR Master Mix (Applied Biosystems) with a LightCycler 96 system Results (Roche Diagnostics). The primers used for RT-qPCR analysis are HuR activates the IFN-b promoter and localizes in SGs described in Supplemental Table I. To understand the involvement of Hu family proteins in antiviral ELISA innate immunity, we constructed expression plasmids for Hu family proteins HuR, HuB, HuC, and HuD (Fig. 1A) and cotransfected Cells were seeded on 96-well plates and stimulated with 1 mg/ml HMW poly(I:C) or 1 mg/ml ISD for 24 h or 1 mg/ml LPS for 12 h. The cytokine HEK293T cells with each individual plasmid along with a lucif- b levels of IFN-b, CXCL10, and IL-10 in the culture supernatant were erase reporter plasmid driven by the IFN- promoter. Over- by guest on October 1, 2021 measured by using a Lumikine mIFN-b (InvivoGen), Mouse CXCL10 expression of HuR, but not of HuB, HuC, or HuD, markedly DuoSet ELISA (R&D Systems), and Mouse IL-10 Uncoated ELISA increased the IFN-b promoter activity (Fig. 1A). Furthermore, (Invitrogen) according to the manufacturer’s instructions. HuR overexpression activated the IFN-b promoter in a dose- Luciferase reporter assay dependent manner, whereas it failed to activate the NF-kB pro- HEK293T cells were harvested in 24-well plates and transiently transfected moter (Fig. 1B). We then constructed a series of deletion mutants with 100 ng of reporter plasmid for IFN-b, NF-kB, Plk2 39UTR, or one of of the HuR expression plasmid in which individual RRM domains the Plk2 3ʹUTR deletion mutants and 500 ng of expression plasmid or were removed. The results showed that the deletion of each RRM empty plasmid. As an internal control, 10 ng of pRL-TK (Promega) was domain abrogated the IFN-b promoter activity, suggesting that transfected simultaneously. The medium was replaced at 6 h post- HuR-mediated IFN-b promoter activity requires its RNA-binding transfection. After 24 or 48 h of transfection, luciferase activity was measured with a TriStar2 LB 942 Multidetection Microplate Reader properties (Fig. 1C). (Berthold) using the Dual-Glo Luciferase System (Promega) according to To examine the cellular localization of HuR, we stained MEF the manufacturer’s instructions. cells with anti-HuR Ab and found that HuR localizes exclusively in Fluorescence microscopy the nuclei (Fig. 1D). Following stimulation with transfection of HMW poly(I:C) (an MDA5 ligand), HuR was observed in dotlike Cells were cultured on poly-L-lysine–coated coverslips in 24-well plates. structures in the cytoplasm that were partially merged with Ras- Cells were stimulated with 1 mg/ml HMW poly(I:C) for 6 h and fixed with 4% paraformaldehyde for 20 min. Cells were washed three times with GAP SH3 domain binding protein (G3BP), a marker of SGs 0.02% Triton(R) X-100 in PBS and permeabilized with PBS containing (Fig. 1D). These results suggest that HuR localizes in a portion of 100 mM glycine and 0.02% Triton(R) X-100 for 30 min. Cells were then SGs in poly(I:C)-stimulated cells. incubated overnight at 4˚C in PBS with 10% FBS and 0.02% Triton(R) X-100, after which they were reacted overnight at 4˚C with the indicated HuR knockdown inhibits IFN-b induction Ab in PBS with 10% FBS and 0.02% Triton(R) X-100. Cells were washed To understand the roles of HuR in antiviral innate immunity, we and incubated for 2 h with anti-mouse and/or anti-rabbit secondary Ab conjugated to Alexa Fluor 488 or 568. Nuclei were stained with Hoechst knocked down HuR expression in BMMs and the human monocyte 33342. Stained cells were mounted with Fluoro-KEEPER Antifade Re- cell line THP-1. Knockdown of HuR mRNA in BMMs was con- agent (Nacalai Tesque). Fluorescence images were obtained by LSM700 firmed by RT-qPCR and Western blot (Fig. 2A, 2B). We found that (Carl Zeiss), and the percentages of cells showing nuclear localization of expression of Ifnb1 and Cxcl10 (encoding IP-10 chemokine) after IRF3 or NF-kB p65 were determined by counting 200 cells per coverslip. HWM poly(I:C) stimulation was decreased in HuR knockdown Microarray BMMs (Fig. 2C). Similarly, HuR knockdown in THP-1 cells also Cells were stimulated with 1 mg/ml HMW poly(I:C) for 8 h. Total RNA inhibited induction of IFNB1 and CXCL10 mRNA in response to was then extracted using TRIzol reagent and purified with an RNeasy Mini poly(I:C) (Fig. 2D–F). Next, we examined the role of HuR in MEF Kit (Qiagen) according to the manufacturer’s instructions. Total RNA was cells. We prepared a shRNA-expressing retrovirus vector targeting 4 HuR REGULATES ANTIVIRAL INNATE IMMUNITY Downloaded from http://www.jimmunol.org/

FIGURE 1. HuR activates IFN-b promoter and localizes in SGs. (A) Conserved domains of Hu family proteins. Hu family proteins are RBPs that have by guest on October 1, 2021 three RRMs (left). An expression plasmid for each Hu family protein was transfected with the IFN-b–driven luciferase reporter plasmid and the pRL-TK plasmid into HEK293T cells. Luciferase activity was measured at 48 h posttransfection. Expression of these plasmids was conﬁrmed by W.B. (right). (B) HEK293T cells were transfected with a mock plasmid or HuR expression plasmid together with a reporter plasmid driven by either IFN-b (left) or NF-kB (right) and the pRL-TK plasmid. Luciferase activity was measured 48 h after transfection. (C) Schematic diagrams of HuR and the HuR deletion mutants are shown (upper). HEK293T cells were transfected with the expression plasmid for each domain-deleted HuR, the IFN-b–driven luciferase reporter plasmid, and the pRL-TK plasmid. Luciferase activity was measured 48 h posttransfection. Cell lysates prepared from HEK293T cells transfected with the indicated plasmid were subjected to W.B. (lower). (D) Fluorescence confocal microscopy of endogenous HuR and G3BP in MEF cells stimulated with HMW poly(I:C). MEF cells were stained with Ab against HuR (green), Ab against G3BP (red), and Hoechst 33342 (blue). Data are representative of three independent experiments, and mean values and SEs are depicted. *p , 0.01, one-way ANOVA with Tukey test.

HuR and transferred it into MEF cells. The efficiency of HuR Cxcl10 were lower in HuR-deficient cells compared with WT cells knockdown was verified by RT-qPCR (Fig. 2G) and W.B. (Fig. 3C, 3D). In contrast, Il10 expression was comparable be- (Fig. 2H). The expression of Ifnb1 and Cxcl10 after HMW poly(I:C) tween WT and HuR-deficient cells. Moreover, the mRNA ex- stimulation was reduced in HuR knocked-down cells compared pression of Ifnb1, Cxcl10, and Il10 was unimpaired in response to with that in control cells (Fig. 2I). In contrast, the inductions of ISD or LPS in HuR-deficient cells (Fig. 3E, 3F). Consistent with Ifnb1 and Cxcl10 were comparable between control and HuR mRNA expression, IFN-b and CXCL10 protein production in- knocked-down cells following stimulation with bacterial LPS duced by HMW poly(I:C) was also reduced in HuR-deficient cells (a TLR4 agonist) or ISD (a cGAS agonist) (Fig. 2I). These results (Fig. 3G). In contrast, protein levels of IFN-b and CXCL10 after suggest that HuR is required for expression of IFN-b following stimulation with ISD and LPS were comparable between WT and poly(I:C) stimulation. HuR-deficient cells (Fig. 3H, 3I). We also generated HuR- deficient RAW264.7 cells using another sequence of gRNA b HuR-deficiency reduced IFN- production by RLR ligands (Supplemental Fig. 1B–E), which also showed reduced Ifnb1 and Using the CRISPR/Cas9 systems, we established a macrophage cell Cxcl10 expression after poly(I:C) stimulation (Supplemental Fig line RAW264.7 that lacks HuR (knockout [KO]1, KO2). The HuR 1C). We then evaluated the responses of HuR-deficient cells deficiency of these cells was verified by DNA sequencing and against virus infection. Ifnb1 and Cxcl10 mRNA expression levels Western blot analyses (Fig. 3A, 3B, Supplemental Fig. 1A). We following infection with NDV, which is sensed by RIG-I, were measured the expression levels of Ifnb1, Cxcl10, and Il10 fol- markedly reduced in HuR-deficient cells compared with those in lowing stimulation with HMW poly(I:C), LMW poly(I:C) (a RIG- WT cells (Fig. 3J). Additionally, the amount of NDV transcript I agonist), ISD, or LPS (Fig. 3C–F). After stimulation with HMW was higher in HuR-deficient cells than in WT cells, as measured or LMW poly(I:C), the mRNA expression levels of Ifnb1 and by RT-qPCR (Fig. 3K). We also confirmed that complementation The Journal of Immunology 5 Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021

FIGURE 2. HuR knockdown inhibits IFN-b induction. (A and B) Elavl1 was knocked down in BMMs by siRNA electroporation. Knockdown efficacy was confirmed based on mRNA levels as quantified by RT-qPCR (A) and protein levels as assessed by W.B. (B). (C) BMMs electroplated with luciferase or HuR siRNA were stimulated with HMW poly(I:C). Following stimulation, the expression of Ifnb1 and Cxcl10 mRNA was measured by RT-qPCR. (D and E) THP-1 cells were electroporated with siRNA targeting ELAVL1, and knockdown was confirmed by RT-qPCR (D) and W.B. (E). (F) siRNA-electroporated THP-1 cells were stimulated with HMW poly(I:C), and expression levels of IFNB1 and CXCL10 were quantified by RT-qPCR. (G and H) MEFs were infected with HuR shRNA–expressing retrovirus. After puromycin selection, the efficiency of HuR knockdown was quantified by RT-qPCR (G) and W.B. (H). (I) MEF cells treated with scrambled or HuR-specific shRNA were stimulated with HMW poly(I:C), ISD, or LPS. Following stimulation, the expression levels of Ifnb1 and Cxcl10 were measured by RT-qPCR. Data are representative of three independent experiments, and mean values and SEs are depicted. *p , 0.05, Student t test. of Flag-tagged HuR into HuR-deficient cells restored the mRNA measure the expression level of signaling molecules that are in- expression of Ifnb1 and Cxcl10 in response to HMW poly(I:C) volved in innate immune responses. The mRNA expression level (Fig. 3L, 3M). These results suggest that HuR regulates RLR- of Plk2 was lower in HuR-deficient cells, whereas that of other mediated antiviral innate immune responses. PLK family members (Plk1, Plk3, and Plk4) was not different To examine the involvement of HuR in SG formation, SGs from those in WT cells (Fig. 4A, Supplemental Fig. 2D). Expres- induced by poly(I:C) stimulation were examined in WT and HuR- sion levels of RLR signaling molecules, such as Mavs, Tmem173 deficient RAW264.7 cells using anti-G3BP Ab (Supplemental Fig. (encoding STING), Ticam1 (TRIF), Tbk1, Traf2, Traf6, Mapk14 2A). G3BP was recruited into cytosolic dotlike structures in both (p38a), and Map3k7 (TAK1), were not different in HuR-deficient WT and HuR-deficient cells, suggesting that HuR deficiency does cells (Fig. 4B). In addition, restoration of HuR expression into HuR- not affect the induction of SG formation. deficient cells increased Plk2 mRNA expression (Fig. 4C). These results suggest that HuR affects the abundance of Plk2 mRNA. Reduced Plk2 expression in HuR-deficient RAW264.7 cells We conducted microarray analyses of poly(I:C)-stimulated WTand PLK2 is required for induction of antiviral responses HuR-deficient RAW264.7 cells (Supplemental Fig. 2B, 2C). To understand the roles of PLK2 in the induction of antiviral innate Compared with WT cells, HuR-deficient cells showed lower ex- immune responses, we examined whether PLK2 enhanced IFN-b pression levels of various chemokine genes, such as Ccl2, Ccl7, promoter activity. Overexpression of PLK2 in HEK293T cells and Ccl12. Additionally, the transcript amount of Plk2 was also increased the IFN-b promoter activity (Fig. 5A). By contrast, lower in HuR-deficient cells. We then performed RT-qPCR to overexpression of a kinase-negative mutant PLK2 (K108M) failed 6 HuR REGULATES ANTIVIRAL INNATE IMMUNITY Downloaded from http://www.jimmunol.org/

FIGURE 3. HuR deficiency reduced production of IFN-b by RLR ligands. (A) A partial sequence of the Elavl1 exon 4 and the sequence targeted by gRNA no. 1 are shown (upper). A schematic drawing of the Elavl1 exon map is shown, and the mutation site is depicted by a white line (lower). (B) The cell lysates from WT and HuR KO RAW264.7 cells were subjected to W.B. to examine the depletion of HuR. (C–F) RT-qPCR of Ifnb1, Cxcl10, and Il10 mRNA expression in WT and HuR KO RAW264.7 cells stimulated with HMW poly(I:C) (C), LMW poly(I:C) (D), ISD (E), or LPS (F). (G–I) Protein levels of IFN- b, CXCL10, and IL-10 in the supernatant of WT and HuR KO1 RAW264.7 cells stimulated with HMW poly(I:C) (G), ISD (H), and LPS (I) were measured by ELISA. (J and K) WT and HuR KO1 RAW264.7 cells were infected with NDV (multiplicity of infection [MOI] = 1, 5). The amounts of Ifnb1 and Cxcl10 by guest on October 1, 2021 mRNA (J) and NDV transcripts (K) in each cell group were measured by RT-qPCR. (L) HuR KO1 cells were infected with retroviruses encoding Flag- tagged HuR. HuR expression was confirmed by W.B. (M) mRNA expression of Ifnb1 and Cxcl10 after HMW poly(I:C) stimulation in WT, HuR KO1, and HuR-expressing HuR KO1 cells were measured by RT-qPCR. Data are representative of three independent experiments, and mean values and SEs are depicted. *p , 0.05, **p , 0.01, Student t test. to enhance the IFN-b promoter activity (Fig. 5B). These results IRF3 (8). Therefore, we next investigated if HuR affects IRF3 suggest that PLK2 promotes IFN-b induction via its kinase ac- translocation to the nucleus. We stimulated WT and HuR-deficient tivity. Moreover, the expression level of Plk2 was upregulated in RAW264.7 cells with HMW poly(I:C), and then whole-cell lysates response to poly(I:C) stimulation in RAW264.7 cells, whereas the were prepared and blotted with anti-IRF3 or anti-phosphorylated expression of Plk1, Plk3, and Plk4 was not altered (Fig. 5C). IRF3 (p-IRF3) Ab (Fig. 6A). HuR deficiency did not influence We then generated PLK2-deficient RAW264.7 cells using IRF3 phosphorylation. We then examined IRF3 nuclear translo- CRISPR/Cas9 systems. We obtained PLK2-deficient cells with cation by separating the cell lysates into nuclear and cytoplasmic deletion of 1 and 2 bp in the PLK2 exon1 sequence, creating fractions. The amount of phosphorylated IRF3 and total IRF3 in frameshift mutations (Supplemental Fig. 3A, 3B). Expression of the nuclei were both increased 3 h after poly(I:C) stimulation in Plk2 mRNA was decreased in PLK2-deficient cells compared with WT cells, and these were significantly reduced in HuR-deficient WT cells, as verified by RT-qPCR (Supplemental Fig. 3C). We cells (Fig. 6A, 6B). IRF3 phosphorylation in the cytoplasmic measured the expression levels of Ifnb1 and Cxcl10 in PLK2- fraction was unaffected in HuR-deficient cells (Fig. 6A, 6B). To deficient cells stimulated with poly(I:C) or ISD. The induction confirm further that HuR deficiency abrogates IRF3 nuclear of Ifnb1 and Cxcl10 mRNA after poly(I:C) stimulation was re- translocation, we verified cellular localization of IRF3 by immu- duced in PLK2-deficient cells when compared with WT cells, nofluorescence. In WT cells, IRF3 localized to the cytoplasm in whereas expression of these cytokines in mRNA after ISD stim- unstimulated condition. After poly(I:C) stimulation, ∼80% of cells ulation was comparable between WT and PLK2-deficient cells showed IRF3 nuclear localization. However, cells displaying IRF3 (Fig. 5D, 5E). These results suggest that PLK2 contributes to in- nuclear localization were significantly reduced in HuR-deficient duction of antiviral innate immune responses to poly(I:C). cells (Fig. 6C). In contrast, nuclear translocation of NF-kB p65 subunit after poly(I:C) stimulation was comparable between WT HuR and PLK2 are required for poly(I:C)-induced IRF3 and HuR-deficient cells (Fig. 6D). We next examined IRF3 and nuclear translocation NF-kB p65 nuclear translocation in PLK2-deficient cells. Whereas A previous study indicated that PLK2 is involved in the production IRF3 nuclear translocation was significantly reduced in PLK2- of antiviral cytokines via mediating the nuclear translocation of deficient cells (Fig. 6E), NF-kB p65 nuclear translocation was The Journal of Immunology 7 Downloaded from

FIGURE 4. Reduced Plk2 expression in HuR-deﬁcient RAW264.7 cells. (A and B) Expression of Plk2, Plk1, Plk3, and Plk4 (A) and Tbk1, Mavs, Tmem173, Mapk14, Map3k7, Traf2, Traf6, and Ticam1 (B) in WT and HuR KO RAW264.7 cells with or without HMW poly(I:C) stimulation were measured by RT-qPCR. (C) mRNA expression of Plk2 in WT, HuR KO1, and HuR-expressing HuR KO1 RAW264.7 cells with or without HMW poly(I:C) stimulation was measured by RT-qPCR. Data are representative of three independent experiments, and mean values and SEs are depicted. **p , 0.01, Student t test. http://www.jimmunol.org/ unimpaired in these cells (Fig. 6F). These results strongly suggest prepared from RAW264.7 cells stimulated with HMW poly(I:C) that the HuR–PLK2 axis mediates antiviral innate immune re- were subjected to immunoprecipitation using control IgG or anti- sponses via regulating the nuclear translocation of IRF3. HuR Ab. Following RNA extraction from these immunoprecipitates, we measured the abundance of Plk2 mRNA and found that HuR regulates Plk2 mRNA stability the amount of Plk2 mRNA was enriched in anti-HuR immuno- We next examined the interaction between HuR and Plk2 mRNA in precipitates (Fig. 7A). In contrast, the amounts of Plk1, Plk3, RAW264.7 cells by RNA immunoprecipitation. The cell lysates Plk4,andMavs mRNA were comparable between IgG and by guest on October 1, 2021

FIGURE 5. PLK2 is involved in IFN-b induction through RLR signaling. (A) HEK293T cells were transfected with mock plasmid or PLK2 expression plasmid together with the pRL-TK plasmid and a reporter plasmid driven by IFN-b promoter. The luciferase activity was measured 24 h after transfection. (B) HEK293T cells were transfected with mock, PLK2 expression, or PLK2 K108M expression plasmid together with the pRL-TK plasmid and a reporter plasmid driven by IFN-b promoter. The luciferase activity was measured 24 h after transfection. (C) Expression levels of Plk1, Plk2, Plk3, and Plk4 in WT RAW264.7 cells stimulated with HMW poly(I:C) for the indicated times were detected by RT-qPCR. (D and E) WT and PLK2 KO RAW264.7 cells were stimulated with HMW poly(I:C) (D) and ISD (E). Following stimulation, expression of Ifnb1 and Cxcl10 mRNA was quantiﬁed by RT-qPCR. Data are representative of three independent experiments, and mean values and SEs are depicted. *p , 0.05, **p , 0.01, Student t test. 8 HuR REGULATES ANTIVIRAL INNATE IMMUNITY Downloaded from http://www.jimmunol.org/

FIGURE 6. HuR and PLK2 are required for RLR-dependent IRF3 nuclear translocation. (A and B) WT and HuR KO1 RAW264.7 cells were stimulated with HMW poly(I:C). Whole-cell lysate (upper), the nuclear fraction (middle), and the cytoplasmic fraction (lower) were extracted and immunoblotted

using the indicated Abs (A). Densitometric quantification of three independent experiments are shown (B). (C and D) Fluorescence confocal microscopy of by guest on October 1, 2021 IRF3 (C) and NF-kB p65 (D) in WT and HuR KO1 RAW264.7 cells stimulated with HMW poly(I:C). Cells were stained with Abs against IRF3 or p65 (green) and Hoechst 33342 (blue). Cells with nuclear IRF3 or p65 were counted and are presented as percentage of a total of 200 cells. (E and F) Fluorescence confocal microscopy of IRF3 (E) and NF-kB p65 (F) in WT and PLK2 KO RAW264.7 cells stimulated with HMW poly(I:C). Cells were stained with Abs against IRF3 or p65 (green) and Hoechst 33342 (blue). Cells with nuclear IRF3 or p65 were counted and are presented as percentage of a total of 200 cells. Cells with nuclear IRF3 or p65 are indicated by white arrows. Scale bar, 10 mm. Data are representative of three independent experiments, and mean values and SEs are depicted. *p , 0.05, **p , 0.01, Student t test. anti-HuR Ab immunoprecipitates (Fig. 7A). To determine if HuR 2626–2655 (D2), 2687–2711 (D3), and 2744–2760 (D4) (Fig. 7E). affects the mRNA stability of Plk2, we then measured the t1/2 of We then transfected these reporter plasmids into HEK293T cells Plk2 mRNA. WT and HuR-deficient RAW264.7 cells were treated and measured the resulting luciferase activity. The luciferase ac- with poly(I:C) and actinomycin D, which is a transcriptional in- tivity was decreased in cells transfected with the D4 mutant hibitor, and the t1/2 of Plk2 mRNA was quantified by RT-qPCR. In (Fig. 7F) but not in those transfected with any of the other mu- HuR-deficient cells, Plk2 mRNA was destabilized compared with tants. Taken together, these results suggest that HuR regulates WT cells (Fig. 7B). Conversely, HEK293T cells overexpressing Plk2 mRNA stability by interacting with the Plk2 39UTR. HuR showed sustained PLK2 mRNA expression compared with control cells (Fig. 7C). Discussion To understand the involvement of the Plk2 39UTR in Plk2 In this study, we identified HuR, an RBP, as a critical regulator in mRNA stability, we constructed a luciferase plasmid harboring the antiviral innate immunity. HuR positively mediates antiviral im- mouse Plk2 39UTR, which consists of the sequence 2183–2802 of mune responses through stabilizing Plk2 mRNA. It has been mouse Plk2 mRNA (pGL3-mPlk2 39UTR). We transfected reported that HuR binds to numerous target mRNAs, including HEK293T cells with the control pGL3 plasmid or the pGL3- Ifnb1 mRNA (32). However, our results demonstrate that HuR mPlk2 39UTR plasmid, together with a mock or HuR expression overexpression induced IFN-b promoter activity and HuR defi- plasmid. HuR overexpression increased the luciferase activity in ciency suppressed the expression of Ifnb1 as well as that of other cells transfected with pGL3-mPlk2 39UTR but not in those cytokines and chemokines in response to poly(I:C) stimulation or transfected with control pGL3 (Fig. 7D). It has been reported that RNA virus infection. Moreover, IRF3 nuclear translocation was HuR preferentially binds to AU- and U-rich sequences (30, 31), also suppressed by HuR deficiency. These findings suggest that and the Plk2 39UTR contains four AU- and U-rich consecutive HuR regulates antiviral innate immune responses by stabilizing sequences. To clarify the involvement of these sequences in the mRNA encoding RLR signaling molecules. Among the innate stability of Plk2 mRNA, we constructed a series of deletion mu- immune molecules tested in this study, we found that Plk2 tant plasmids lacking the Plk2 39UTR sequences 2183–2214 (D1), mRNA was strikingly reduced in HuR-deficient cells. Our RNA The Journal of Immunology 9 Downloaded from http://www.jimmunol.org/

FIGURE 7. HuR regulates Plk2 mRNA stability. (A) Whole-cell lysates from WT RAW264.7 cells stimulated with or without HMW poly(I:C) were immunoprecipitated with IgG or anti-HuR Ab-conjugated beads. cDNA was synthesized from RNA in the immunoprecipitates, and the amounts of Plk2, Plk1, Plk3, Plk4, and Mavs mRNA were determined by RT-qPCR. N.D., not detected. (B) WT and HuR KO1 cells were stimulated with HMW poly(I:C) for m

8 h. After medium replacement, the cells were treated with actinomycin D (Act D; 2.5 g/ml) at the indicated times. The mRNA levels were measured by by guest on October 1, 2021 RT-qPCR. Data were normalized to mRNA amount at time zero. (C) HEK293T cells transfected with mock or HuR expression plasmid were stimulated with HMW poly(I:C) for 8 h. After medium replacement, the cells were treated with 5 mg/ml actinomycin D at the indicated times. The mRNA levels were quantified by RT-qPCR. Data were normalized to the mRNA amount at time zero. (D) HEK293T cells were transfected with the pGL3 or pGL3-mPlk2 39UTR and the pRL-TK plasmid with or without the HuR expression plasmid. The luciferase activity was measured at 24 h posttransfection. (E) Schematic diagrams of the pGL3 harboring the full-length Plk2 39UTR (WT) and its deletion mutants (D1, D2, D3, and D4) are shown. (F) HEK293T cells were transfected with a pGL3 harboring the WT, D1, D2, D3, or D4 Plk2 39UTR and pRL-TK plasmid. The luciferase activity was measured at 24 h posttransfection. Data are representative of three independent experiments, and mean values and SEs are depicted. *p , 0.05, **p , 0.01 (Student t test), ***p , 0.01 (one-way ANOVA with Tukey test). immunoprecipitation experiment using anti-HuR Ab showed that lation, HuR localizes to cytoplasmic dotlike structures known as HuR bound to Plk2 mRNA and that the overexpression of HuR SGs. SGs have been shown to play a role in protecting mRNAs stabilized Plk2 mRNA. Although PLK2 and PLK4 have been from harmful conditions, and they contain a number of RBPs. shown to regulate TLR-mediated IRF3 nuclear translocation in Notably, RIG-I is also retained in a subset of SGs termed antiviral DCs (8), our results suggest that the HuR-mediated stabilization of SGs (avSGs), and the inhibition of avSG formation abrogates Plk2 mRNA is required for IRF3 nuclear translocation during RLR RIG-I signaling, thus indicating that avSGs are a platform for viral signaling. Intriguingly, the mRNA expression of Plk2, but not that RNA detection and the initiation of antiviral innate immune re- of Plk4, was increased after poly(I:C) stimulation in RAW264.7 sponses (34, 35). In HuR-deficient cells, the formation of SGs was cells. Furthermore, PLK2-deficient RAW264.7 cells showed re- not abrogated, which suggests that the observed reduction of IFN- duced expression of Ifnb1 in response to poly(I:C). These findings b induction in HuR-deficient cells was not due to impaired SG suggest that PLK2 plays a major role in antiviral responses in formation (Supplemental Fig. 2A). Therefore, it is unlikely that macrophages. HuR-deficient cells exhibited impaired IRF3 nuclear HuR regulates RIG-I-mediated RNA sensing and the subsequent translocation during RLR signaling, whereas the phosphorylation activation of downstream signaling. Rather, it may indirectly of cytoplasmic IRF3 was unimpaired in these cells. Therefore, it regulate antiviral innate immune responses through the stabiliza- may be possible that PLK2 catalyzes the phosphorylation of the tion of signaling molecules, such as PLK2, and the modulation of substrate responsible for IRF3 nuclear trafficking. IRF3 translo- IRF3 translocation. However, it remains unclear how PLK2 reg- cation was shown to be mediated by PTEN, Rubicon, and IPO5/ ulates IRF3 nuclear translocation during RLR signaling. PLK2 Importin-b3 (13, 14, 33), which may be regulated by PLK2. may be recruited to SGs or mitochondria for interaction with RIG- HuR-deficient cells showed an impairment of IFN-b induction I or IPS-1, which triggers RLR-mediated IRF3 nuclear translo- against cytosolic RNA, whereas they exhibited normal IFN-b cation. Alternatively, PLK2 may be activated in response to RNA induction responses against LPS and ISD. After poly(I:C) stimu- virus infection. We previously reported that the intracellular level 10 HuR REGULATES ANTIVIRAL INNATE IMMUNITY of phosphatidylinositol 5-phosphate (PI5P) is increased during 8. Chevrier, N., P. Mertins, M. N. Artyomov, A. K. Shalek, M. Iannacone, M. F. Ciaccio, I. Gat-Viks, E. Tonti, M. M. DeGrace, K. R. Clauser, et al. 2011. RLR signaling, which acts as the second messenger that directly Systematic discovery of TLR signaling components delineates viral-sensing binds and activates IRF3, and it is produced by the lipid kinase circuits. Cell 147: 853–867. PIKfyve (6). Thus, it is speculated that PLK2 is directly activated 9. He, X., S. Ma, Y. Tian, C. Wei, Y. Zhu, F. Li, P. Zhang, P. Wang, Y. Zhang, and H. Zhong. 2017. ERRa negatively regulates type I interferon induction by by PIKfyve-dependent phosphorylation. This should be clarified inhibiting TBK1-IRF3 interaction. PLoS Pathog. 13: e1006347. in the future. 10. Heaton, S. M., N. A. Borg, and V. M. Dixit. 2016. Ubiquitin in the activation and Previous studies reported that HuR profoundly interacts with the attenuation of innate antiviral immunity. J. Exp. Med. 213: 1–13. 11. Liu, J., C. Qian, and X. Cao. 2016. Post-translational modification control of AU- and U-rich sequences such as AUUUUA, AUUUUUA, and innate immunity. Immunity 45: 15–30. UUUUUUU (30, 31). The Plk2 39UTR contains four AU- and 12. Zhao, X., H. Zhu, J. Yu, H. Li, J. Ge, and W. Chen. 2016. c-Cbl-mediated U-rich consecutive sequences. Our analysis using a series of de- ubiquitination of IRF3 negatively regulates IFN-b production and cellular antiviral response. Cell. Signal. 28: 1683–1693. letion mutants of the Plk2 39UTR demonstrated that the sequence 13. Li, S., M. Zhu, R. Pan, T. Fang, Y. Y. Cao, S. Chen, X. Zhao, C. Q. Lei, L. Guo, from 2744 to 2760 in the Plk2 39UTR is involved in HuR- Y. Chen, et al. 2016. The tumor suppressor PTEN has a critical role in antiviral innate immunity. Nat. Immunol. 17: 241–249. mediated Plk2 mRNA stability. This sequence is also highly 14. Kim, J. H., T. H. Kim, H. C. Lee, C. Nikapitiya, M. B. Uddin, M. E. Park, conserved in the Homo sapiens PLK2 39UTR, suggesting that the P. Pathinayake, E. S. Lee, K. Chathuranga, T. U. B. Herath, et al. 2017. Rubicon sequence from 2744 to 2760 in the Plk2 39UTR plays an important modulates antiviral type I interferon (IFN) signaling by targeting IFN regulatory factor 3 dimerization. J. Virol. 91: e00248-17. role in controlling the stability of Plk2 mRNA. Although it re- 15. Meng, F., R. Zhou, S. Wu, Q. Zhang, Q. Jin, Y. Zhou, S. W. Plouffe, S. Liu, mains unclear how HuR increases the stability of Plk2 mRNA, it is H. Song, Z. Xia, et al. 2016. Mst1 shuts off cytosolic antiviral defense through possible that HuR prevents the binding of Plk2 mRNA by other IRF3 phosphorylation. Genes Dev. 30: 1086–1100. 16. Wang, S., F. Xie, F. Chu, Z. Zhang, B. Yang, T. Dai, L. Gao, L. Wang, L. Ling, RBPs and miRNA responsible for mRNA decay. For example, J. Jia, et al. 2017. YAP antagonizes innate antiviral immunity and is targeted for Downloaded from HuR has been shown to compete with TTP, KSRP, and AUF1, lysosomal degradation through IKK-mediated phosphorylation. Nat. Immunol. which promote mRNA degradation, for binding to mRNAs 18: 733–743. 17. James, S. J., H. Jiao, H. Y. Teh, H. Takahashi, C. W. Png, M. C. Phoon, encoding TNF, iNOS, COX-2, and p16 (27, 36–38). Notably, HuR Y. Suzuki, T. Sawasaki, H. Xiao, V. T. K. Chow, et al. 2015. MAPK phosphatase and TTP share more than 1000 genes as their targets (39). HuR 5 expression induced by influenza and other RNA virus infection negatively also protects target mRNAs from degradation by miRNA, and it regulates IRF3 activation and type I interferon response. Cell Rep. 10: 1722– 1734. competes with let-7, miR-16, miR-200b, and miR-331-3p for 18. Wang, S., X. Sun, C. Yi, D. Zhang, X. Lin, X. Sun, H. Chen, and M. Jin. 2017. antagonizing the function of each miRNA to degrade the mRNA AGO2 negatively regulates type I interferon signaling pathway by competition http://www.jimmunol.org/ binding IRF3 with CBP/p300. Front. Cell. Infect. Microbiol. 7: 195. encoding CAT-1, COX-2, VEGF-A, and ERBB-2, both in vitro 19. Mino, T., Y. Murakawa, A. Fukao, A. Vandenbon, H. H. Wessels, D. Ori, and in vivo (24, 40–42). Therefore, Plk2 mRNA degradation in T. Uehata, S. Tartey, S. Akira, Y. Suzuki, et al. 2015. Regnase-1 and roquin HuR-deficient cells is induced by competing with other RBPs or regulate a common element in inflammatory mRNAs by spatiotemporally distinct mechanisms. Cell 161: 1058–1073. miRNAs that mediate Plk2 mRNA decay. 20. Matsushita, K., O. Takeuchi, D. M. Standley, Y. Kumagai, T. Kawagoe, Type I IFNs and RLRs play essential roles in protection against T. Miyake, T. Satoh, H. Kato, T. Tsujimura, H. Nakamura, and S. Akira. 2009. infectious viruses and are also involved in exacerbating autoim- Zc3h12a is an RNase essential for controlling immune responses by regulating mRNA decay. Nature 458: 1185–1190. munity and bacterial infection (43, 44). Control of type I IFN 21. Masuda, K., B. Ripley, R. Nishimura, T. Mino, O. Takeuchi, G. Shioi, production is crucial for achieving an appropriate host defensive H. Kiyonari, and T. Kishimoto. 2013. Arid5a controls IL-6 mRNA stability, by guest on October 1, 2021 response. Recently, small molecules that could inhibit an interaction which contributes to elevation of IL-6 level in vivo. Proc. Natl. Acad. Sci. USA 110: 9409–9414. between HuR and target mRNAs have been developed (45, 46). 22. Srikantan, S., and M. Gorospe. 2012. HuR function in disease. Front. Biosci. 17: Therefore, these molecules may be useful to prevent autoimmu- 189–205. 23. Buchan, J. R., and R. Parker. 2009. Eukaryotic stress granules: the ins and outs of nity in which type I IFNs and RLRs are involved. translation. Mol. Cell 36: 932–941. 24. Kundu, P., M. R. Fabian, N. Sonenberg, S. N. Bhattacharyya, and W. Filipowicz. 2012. HuR protein attenuates miRNA-mediated repression by promoting miR- Acknowledgments ISC dissociation from the target RNA. Nucleic Acids Res. 40: 5088–5100. We thank K. Abe and C. Suzuki for secretarial assistances and K. Oakley 25. Kurosu, T., N. Ohga, Y. Hida, N. Maishi, K. Akiyama, W. Kakuguchi, from Edanz Group (www.edanzediting.com/ac) for editing a draft of this T. Kuroshima, M. Kondo, T. Akino, Y. Totsuka, et al. 2011. HuR keeps an an- article. giogenic switch on by stabilising mRNA of VEGF and COX-2 in tumour en- dothelium. Br. J. Cancer 104: 819–829. 26. Fan, J., F. T. Ishmael, X. Fang, A. Myers, C. Cheadle, S. K. Huang, U. Atasoy, Disclosures M. Gorospe, and C. Stellato. 2011. Chemokine transcripts as targets of the RNA- binding protein HuR in human airway epithelium. J. Immunol. 186: 2482–2494. The authors have no financial conflicts of interest. 27. Young, L. E., S. Sanduja, K. Bemis-Standoli, E. A. Pena, R. L. Price, and D. A. Dixon. 2009. The mRNA binding proteins HuR and tristetraprolin regulate cyclooxygenase 2 expression during colon carcinogenesis. Gastroenterology References 136: 1669–1679. 28. Tsuchida, T., J. Zou, T. Saitoh, H. Kumar, T. Abe, Y. Matsuura, T. Kawai, and 1. Kawai, T., and S. Akira. 2010. The role of pattern-recognition receptors in innate S. Akira. 2010. The ubiquitin ligase TRIM56 regulates innate immune responses immunity: update on Toll-like receptors. Nat. Immunol. 11: 373–384. to intracellular double-stranded DNA. Immunity 33: 765–776. 2. Ori, D., M. Murase, and T. Kawai. 2017. Cytosolic nucleic acid sensors and 29. Mashiko, D., Y. Fujihara, Y. Satouh, H. Miyata, A. Isotani, and M. Ikawa. 2013. innate immune regulation. Int. Rev. Immunol. 36: 74–88. Generation of mutant mice by pronuclear injection of circular plasmid 3. Kawai, T., K. Takahashi, S. Sato, C. Coban, H. Kumar, H. Kato, K. J. Ishii, expressing Cas9 and single guided RNA. Sci. Rep. 3: 3355. O. Takeuchi, and S. Akira. 2005. IPS-1, an adaptor triggering RIG-I- and Mda5- 30. Ma, W. J., S. Cheng, C. Campbell, A. Wright, and H. Furneaux. 1996. Cloning mediated type I interferon induction. Nat. Immunol. 6: 981–988. and characterization of HuR, a ubiquitously expressed Elav-like protein. J. Biol. 4. Ishikawa, H., Z. Ma, and G. N. Barber. 2009. STING regulates intracellular Chem. 271: 8144–8151. DNA-mediated, type I interferon-dependent innate immunity. Nature 461: 788– 31. Uren, P. J., S. C. Burns, J. Ruan, K. K. Singh, A. D. Smith, and L. O. F. Penalva. 792. 2011. Genomic analyses of the RNA-binding protein Hu antigen R (HuR) 5. Hemmi, H., O. Takeuchi, S. Sato, M. Yamamoto, T. Kaisho, H. Sanjo, T. Kawai, identify a complex network of target genes and novel characteristics of its K. Hoshino, K. Takeda, and S. Akira. 2004. The roles of two IkappaB kinase- binding sites. J. Biol. Chem. 286: 37063–37066. related kinases in lipopolysaccharide and double stranded RNA signaling and 32. Herdy, B., T. Karonitsch, G. I. Vladimer, C. S. H. Tan, A. Stukalov, C. Trefzer, viral infection. J. Exp. Med. 199: 1641–1650. J. W. Bigenzahn, T. Theil, J. Holinka, H. P. Kiener, et al. 2015. The RNA-binding 6. Kawasaki, T., N. Takemura, D. M. Standley, S. Akira, and T. Kawai. 2013. The protein HuR/ELAVL1 regulates IFN-b mRNA abundance and the type I IFN second messenger phosphatidylinositol-5-phosphate facilitates antiviral innate response. Eur. J. Immunol. 45: 1500–1511. immune signaling. Cell Host Microbe 14: 148–158. 33. Song, S., J. J. Lee, H. J. Kim, J. Y. Lee, J. Chang, and K. J. Lee. 2016. Fas- 7. Shi, H. X., K. Yang, X. Liu, X. Y. Liu, B. Wei, Y. F. Shan, L. H. Zhu, and associated factor 1 negatively regulates the antiviral immune response by C. Wang. 2010. Positive regulation of interferon regulatory factor 3 activation by inhibiting translocation of interferon regulatory factor 3 to the nucleus. Mol. Herc5 via ISG15 modification. Mol. Cell. Biol. 30: 2424–2436. Cell. Biol. 36: 1136–1151. The Journal of Immunology 11

34. Onomoto, K., M. Jogi, J. S. Yoo, R. Narita, S. Morimoto, A. Takemura, 40. Young, L. E., A. E. Moore, L. Sokol, N. Meisner-Kober, and D. A. Dixon. 2012. S. Sambhara, A. Kawaguchi, S. Osari, K. Nagata, et al. 2012. Critical role of an The mRNA stability factor HuR inhibits microRNA-16 targeting of COX-2. Mol. antiviral stress granule containing RIG-I and PKR in viral detection and innate Cancer Res. 10: 167–180. immunity. [Published errata appear in 2012 PLoS One 7 and 2013 PLoS One 8.] 41. Chang, S. H., Y. C. Lu, X. Li, W. Y. Hsieh, Y. Xiong, M. Ghosh, T. Evans, PLoS One 7: e43031. O. Elemento, and T. Hla. 2013. Antagonistic function of the RNA-binding 35. Yoo, J. S., K. Takahasi, C. S. Ng, R. Ouda, K. Onomoto, M. Yoneyama, J. C. Lai, protein HuR and miR-200b in post-transcriptional regulation of vascular endo- S. Lattmann, Y. Nagamine, T. Matsui, et al. 2014. DHX36 enhances RIG-I thelial growth factor-A expression and angiogenesis. J. Biol. Chem. 288: 4908– signaling by facilitating PKR-mediated antiviral stress granule formation. 4921. PLoS Pathog. 10: e1004012. 42. Epis, M. R., A. Barker, K. M. Giles, D. J. Beveridge, and P. J. Leedman. 2011. 36. Linker, K., A. Pautz, M. Fechir, T. Hubrich, J. Greeve, and H. Kleinert. 2005. The RNA-binding protein HuR opposes the repression of ERBB-2 gene ex- Involvement of KSRP in the post-transcriptional regulation of human iNOS pression by microRNA miR-331-3p in prostate cancer cells. J. Biol. Chem. 286: expression-complex interplay of KSRP with TTP and HuR. Nucleic Acids Res. 41442–41454. 33: 4813–4827. 43. Trinchieri, G. 2010. Type I interferon: friend or foe? J. Exp. Med. 207: 2053– 37. Tiedje, C., N. Ronkina, M. Tehrani, S. Dhamija, K. Laass, H. Holtmann, 2063. A. Kotlyarov, and M. Gaestel. 2012. The p38/MK2-driven exchange between 44. Ng, C. T., J. L. Mendoza, K. C. Garcia, and M. B. A. Oldstone. 2016. Alpha and tristetraprolin and HuR regulates AU-rich element-dependent translation. PLoS beta type 1 interferon signaling: passage for diverse biologic outcomes. Cell 164: Genet. 8: e1002977. 349–352. 38. Chang, N., J. Yi, G. Guo, X. Liu, Y. Shang, T. Tong, Q. Cui, M. Zhan, 45.Meisner,N.C.,M.Hintersteiner,K.Mueller,R.Bauer,J.M.Seifert,H.-U.Naegeli, M. Gorospe, and W. Wang. 2010. HuR uses AUF1 as a cofactor to promote J.Ottl,L.Oberer,C.Guenat,S.Moss,etal. 2007. Identification and mechanistic p16INK4 mRNA decay. Mol. Cell. Biol. 30: 3875–3886. characterization of low-molecular-weight inhibitors for HuR. Nat. Chem. Biol. 3: 39. Mukherjee, N., N. C. Jacobs, M. Hafner, E. A. Kennington, J. D. Nusbaum, 508–515. T. Tuschl, P. J. Blackshear, and U. Ohler. 2014. Global target mRNA specifi- 46. Wang, Z., A. Bhattacharya, and D. N. Ivanov. 2015. Identification of small- cation and regulation by the RNA-binding protein ZFP36. Genome Biol. 15: molecule inhibitors of the HuR/RNA interaction using a fluorescence polarization R12. screening assay followed by NMR validation. PLoS One 10: e0138780. Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021 Gene name Species Forward primer (5'-3') Reverse primer (5'-3') Ifnb1 Mouse ATGGTGGTCCGAGCAGAGAT CCACCACTCATTCTGAGGCA Cxcl10 Mouse CCATCAGCACCATGAACCCAAGT CACTCCAGTTAAGGAGCCCTTTTAAGACC Il10 Mouse TGGCCCAGAAATCAAGGAGC CAGCAGACTCAATACACACT Elavl1 Mouse ATGAAGACCACATGGCCGAAGACT AGTTCACAAAGCCATAGCCCAAGC Plk1 Mouse TTGTAGTTTTGGAGCTCTGTCG CAGTGCCTTCCTCCTCTTGT Plk2 Mouse GCAGACACAGTGGCAAGAGT CTGGTACCCAAAGCCGTATT Plk3 Mouse GGCTGGCAGCTCGATTAG GTTGGGAGTGCCACAGATG Plk4 Mouse GAAACCAAAAAGGCTGTGG CCTTCAGACGCACACTCTCTC Map3k7 Mouse AGAGGTTGTCGGAAGAGGAGCTT ACAACTGCCGGAGCTCCACAA Mapk14 Mouse ACATCGTGAAGTGCCAGAAG CTAGGTTGCTGGGCTTTAGG Traf2 Mouse CACCGGTACTGCTCCTTCTG TGAACACAGGCAGCACAGTT Traf6 Mouse AAAGCGAGAGATTCTTTCCCTG ACTGGGGACAATTCACTAGAGC Ticam1 Mouse ATGGATAACCCAGGGCCTT TTCTGGTCACTGCAGGGGAT Mavs Mouse GCAACTCCTCCAGACCAACTC GGAGACACAGGTCCATAGGTT Tmem173 Mouse CATTGGGTACTTGCGGTT CTGAGCATGTTGTTATGTAGC Tbk1 Mouse ACTGGTGATCTCTATGCTGTCA TTCTGGAAGTCCATACGCATTG Gapdh Mouse TGACGTGCCGCCTGGAGAAA AGTGTAGCCCAAGATGCCCTTCAG IFNB1 Human AAACTCATGAGCAGTCTGCA AGGAGATCTTCAGTTTCGGAGG CXCL10 Human AGGAACCTCCAGTCTCAGCA CAACACGTGGACAAAATTGG ELAVL1 Human GAGGCTCCAGTCAAAAACCA GAGGCTCCAGTCAAAAACCA PLK2 Human GAGCAGCTGAGCACATCATT CATGTGAGCACCATTGTTGA GAPDH Human AATCCCATCACCATCTTCCA TGGACTCCACGACGTACTCA

Virus Forward primer (5'-3') Reverse primer (5'-3') NDV AGTGATGTGCTCGGACCTTC CCTGAGGAGAGGCATTTGCTA

Supplemental Table I. Primers used in this study for RT-qPCR.

Supplemental Table I A HuR-WT GTGTCATATGCTCGCCCAAGCTCAGAGGTCATCAA B D23 HuR-KO1-Allele 1 GTGTCATATGCTCGCCCAAGCTCAGAGGTCATCAA D123 HuR-KO1-Allele 2 GTGTCATATGCTCGCCCAAGCTCAGAGGTCATCA- HuR-WT AGATGCCAACTTATACATCAGTGGGCTCCCAAGGA HuR-KO1-Allele 1 AGATGCCAACTTATACATCAGTGGGCTCCCAAGGA HuR HuR-KO1-Allele 2 ------HuR-WT CCATGACACAGAAGGATGTG GAAGACATGTTTTCT Actin HuR-KO1-Allele 1 CCATGACACAGAAGGATGTGG------HuR-KO1-Allele 2 ------HuR-WT CGGTT TGGGCGAATCATCAACTCCAGGGTCCTTGT HuR-KO1-Allele 1 ------CGAATCATCAACTCCAGGGTCCTTGT Ifnb1 Cxcl10 Il10 Control

HuR-KO1-Allele 2 ------5000 * 1000 16 poly(I:C) * HuR-WT GGATCAGACCACAG GTACACACAGGAGCTAAGATA 4000 800 HuR-KO1-Allele 1 GGATCAGACCACAG GTACACACAGGAGCTAAGATA 12 3000 600 HuR-KO1-Allele 2 ------8 2000 400 HuR-WT GGTCTCTCTGAGCCCTAGACTAGGTGTTCTAGGGA 1000 4

HuR-KO1-Allele 1 GGTCTCTCTGAGCCCTAGACTAGGTGTTCTAGGGA 200

Relative expression Relative Relative expression Relative HuR-KO1-Allele 2 ------GAGCCCTAGACTAGGTGTTCTAGGGA 0 expression Relative 0 0 WT KO WT KO WT KO

HuR-WT GTGTCATATGCTCGCCCAAGCTCAGAGGTCATCAA Ifnb1 Cxcl10 Il10 Control

D13 HuR-KO2-Allele 1 D GTGTCATATGCTCGCCCAAGCTCAGAGGTCATCAA 400 250 24 ISD D13 HuR-KO2-Allele 2 GTGTCATATGCTCGCCCAAGCTCAGAGGTCATCAA 20 300 200 HuR-WT 16 AGATGCCAACTTATACATCAGTGGGCTCCCAAGGA 150 HuR-KO2-Allele 1 AGATGCCAACTTATACATCAGTGGGCTCCCAAGGA 200 12 100 HuR-KO2-Allele 2 AGATGCCAACTTATACATCAGTGGGCTCCCAAGGA 8 100 50

HuR-WT CCATGACACAGAAGGATGTG GAAGACATGTTTTCT 4

Relative expression Relative Relative expression Relative HuR-KO2-Allele 1 CCATGACACAGAAGGATGTGGAAGACATG------0 expression Relative 0 0 WT KO WT KO WT KO HuR-KO2-Allele 2 CCATGACACAGAAGGATGTGGAAGACA------HuR-WT CGGTT TGGGCGAATCATCAACTCCAGGGTCCTTGT Ifnb1 Cxcl10 Il10 HuR-KO2-Allele 1 ------GGCGAATCATCAACTCCAGGGTCCTTGT E Control

HuR-KO2-Allele 2 100 20 200 -----TGGGCGAATCATCAACTCCAGGGTCCTTGT LPS 80 HuR-WT GGATCAGACCACAG GTACACACAGGAGCTAAGATA 15 150 HuR-KO2-Allele 1 60 GGATCAGACCACAGGTACACACAGGAGCTAAGATA 10 100 HuR-KO2-Allele 2 GGATCAGACCACAGGTACACACAGGAGCTAAGATA 40 5 50 HuR-WT GGTCTCTCTGAGCCCTAGACTAGGTGTTCTAGGGA 20

HuR-KO2-Allele 1 expression Relative GGTCTCTCTGAGCCCTAGACTAGGTGTTCTAGGGA expression Relative 0 0 expression Relative 0 HuR-KO2-Allele 2 GGTCTCTCTGAGCCCTAGACTAGGTGTTCTAGGGA WT KO WT KO WT KO

Supplemental Figure 1. Sequence of HuR-KO1 and -KO2 cells and generation and analysis of HuR KO cells derived from another gRNA. (A) Genomic sequences of the WT Elavl1 locus and of the two generated HuR-knockout RAW264.7 cells (KO1 and KO2). Bold characters show the Elavl1 exon 4 sequence, and the targeted sequence is underlined. (B) The cell lysates from HuR KO RAW264.7 cells generated by gRNA no. 2 (HuR KO gRNA no. 2) were subjected to W.B. to confirm the depletion of HuR. (C-E) WT and HuR KO gRNA no. 2 RAW264.7 cells were stimulated with HMW poly(I:C) (C), ISD (D) and LPS (E). Following stimulation, mRNA levels of Ifnb1, Cxcl10 and Il10 were quantified by RT-qPCR. Data are representative of three independent experiments and mean values and SEs are depicted. *p < 0.05, Student’s t test.

Supplemental Figure 1 A WT HuR KO Hoechst G3BP Merge Hoechst G3BP Merge

Control

HMW poly(I:C) 10 μm

B 16 C D 25 Plk2 Ccl2

12 20 WT 1.2 *

Plk2 HuR KO 15

8 0.8 WT 10

4 0.4

Relative expressionRelative Relative expression Relative

0 0 0 0 4 8 12 16 WT HuRKO KO KO gRNA #2

Supplemental Figure 2. Microscopy and expression analysis of WT and HuR KO RAW264.7 cells (A) Fluorescence confocal microscopy of G3BP in WT and HuR KO1 RAW264.7 cells stimulated with HMW poly(I:C). Cells were stained with Ab against Ab against G3BP (red) and Hoechst 33342 (blue). (B) WT and HuR KO1 RAW264.7 cells were stimulated with HMW poly(I:C) followed by RNA extraction and cDNA synthesis. The resulting cDNA was subjected to a microarray analysis, and the result is shown as a scatter plot. (C) The expression levels of selected genes are plotted by their relative levels of fold induction. (D) Expression of Plk2 mRNA in WT and HuR KO gRNA no. 2 RAW264.7 cells were measured by RT-qPCR. Data are representative of three independent experiments and mean values and SEs are depicted. *p < 0.05, Student’s t test.

Supplemental Figure 2 A C Plk2 GCTCCTGCGGACTATCACCTACCAGCCGGCCGCCGG 1.2 * 1

Exon1 Exon9 0.8 0.6

0.4

B expression Relative 0.2 0 PLK2-WT CCCAGCCAGCCGGCGCGTATTTAAAGCTTCGCTGCTCGCTCTTG WT PLK2-KO Δ2 PLK2-KO-Allele 1 CCCAGCCAGCCGGCGCGTATTTAAAGCTTCGCTGCTCGCTCTTG Δ1 PLK2-KO-Allele 2 CCCAGCCAGCCGGCGCGTATTTAAAGCTTCGCTGCTCGCTCTTG

PLK2-WT C TCGCACAAGCGAAGCAGGACGTCAGACTAGAGAGTAGGGAGAG PLK2-KO-Allele 1 CTCGCACAAGCGAAGCAGGACGTCAGACTAGAGAGTAGGGAGAG PLK2-KO-Allele 2 CTCGCACAAGCGAAGCAGGACGTCAGACTAGAGAGTAGGGAGAG

PLK2-WT AGACTGGTGCTCGAGGGACAGGGCTAGCCCGGACGCTTGTCCGC PLK2-KO-Allele 1 AGACTGGTGCTCGAGGGACAGGGCTAGCCCGGACGCTTGTCCGC PLK2-KO-Allele 2 AGACTGGTGCTCGAGGGACAGGGCTAGCCCGGACGCTTGTCCGC

PLK2-WT GCCTCGGAGGTGGCAAGTAGGCAGTGTCGGGTGGCGAGGCAACG PLK2-KO-Allele 1 GCCTCGGAGGTGGCAAGTAGGCAGTGTCGGGTGGCGAGGCAACG PLK2-KO-Allele 2 GCCTCGGAGGTGGCAAGTAGGCAGTGTCGGGTGGCGAGGCAACG

PLK2-WT ATGGAGCTCCTG CGGACTATCACCTACCAGCCGGCCGCCGGCAC PLK2-KO-Allele 1 ATGGAGCTCCTGCGGACTATCACCTA--AGCCGGCCGCCGGCAC PLK2-KO-Allele 2 ATGGAGCTCCTGCGGACTATCACCTA-CAGCCGGCCGCCGGCAC

PLK2-WT CAAGATGTGCGAGCAGGCTCTGGGCAAAGCTTGCGGCGGGGACT PLK2-KO-Allele 1 CAAGATGTGCGAGCAGGCTCTGGGCAAAGCTTGCGGCGGGGACT PLK2-KO-Allele 2 CAAGATGTGCGAGCAGGCTCTGGGCAAAGCTTGCGGCGGGGACT

Supplemental Figure 3. Generating of PLK2-deficient RAW264.7 cells (A) A partial sequence of the Plk2 exon 1 and the sequence targeted by gRNA are shown (upper). A schematic drawing of the Plk2 exon map is shown, and the mutation site is depicted by a white line (lower). (B) Genomic sequences of the WT Plk2 locus and of the generated PLK2-knockout RAW264.7 cells. Bold characters show the Plk2 exon 1 sequence, and the targeted sequence is underlined. (C) The expression of Plk2 in WT and PLK2 KO cells was measured by RT-qPCR. Data are representative of three independent experiments and mean values and SEs are depicted. *p < 0.05, Student’s t test. Supplemental Figure 3