DOCSLIB.ORG

Hu Antigen R Regulates Antiviral Innate Immune Responses Through the Stabilization of Mrna for Polo-Like Kinase 2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Hu Antigen R Regulates Antiviral Innate Immune Responses Through the Stabilization of Mrna for Polo-Like Kinase 2 Hu Antigen R Regulates Antiviral Innate Immune Responses through the Stabilization of mRNA for Polo-like Kinase 2 This information is current as Takuya Sueyoshi, Takumi Kawasaki, Yuichi Kitai, Daisuke of October 1, 2021. Ori, Shizuo Akira and Taro Kawai J Immunol published online 20 April 2018 http://www.jimmunol.org/content/early/2018/04/19/jimmun ol.1701282 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2018/04/19/jimmunol.170128 Material 2.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 1, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2018 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published April 20, 2018, doi:10.4049/jimmunol.1701282 The Journal of Immunology Hu Antigen R Regulates Antiviral Innate Immune Responses through the Stabilization of mRNA for Polo-like Kinase 2 Takuya Sueyoshi,* Takumi Kawasaki,* Yuichi Kitai,† Daisuke Ori,* Shizuo Akira,‡,x and Taro Kawai* Retinoic acid–inducible gene I (RIG-I)–like receptors (RLRs), RIG-I, and melanoma differentiation-associated gene 5 (MDA5) play a critical role in inducing antiviral innate immune responses by activating IFN regulatory factor 3 (IRF3) and NF-kB, which regulates the transcription of type I IFN and inflammatory cytokines. Antiviral innate immune responses are also regulated by posttranscriptional and translational mechanisms. In this study, we identified an RNA-binding protein HuR as a regulator for RLR signaling. Overexpression of HuR, but not of other Hu members, increased IFN-b promoter activity. HuR-deficient mac- rophage cells exhibited decreased Ifnb1 expression after RLR stimulation, whereas they showed normal induction after stimu- lation with bacterial LPS or immunostimulatory DNA. Moreover, HuR-deficient cells displayed impaired nuclear translocation of Downloaded from IRF3 after RLR stimulation. In HuR-deficient cells, the mRNA expression of Polo-like kinase (PLK) 2 was markedly reduced. We found that HuR bound to the 39 untranslated region of Plk2 mRNA and increased its stabilization. PLK2-deficient cells also showed reduced IRF3 nuclear translocation and Ifnb mRNA expression during RLR signaling. Together, these findings suggest that HuR bolsters RLR-mediated IRF3 nuclear translocation by controlling the stability of Plk2 mRNA. The Journal of Immu- nology, 2018, 200: 000–000. nnate immune responses to virus infection are initiated upon 3 (IRF3). RLRs and cGAS use the mitochondrial protein IFN-b http://www.jimmunol.org/ the sensing of viral nucleic acid species by host pattern- promoter stimulator 1 (IPS-1) (also called MAVS) and the ER protein I recognition receptors, such as membrane-bound TLR3, STING as an adapter, respectively, which likewise culminates in the TLR7, and TLR9 and cytosolic proteins retinoic acid–inducible gene activation of NF-kB and IRF3 (3, 4). NF-kB largely regulates the I (RIG-I)–like receptors (RLRs) and cyclic GMP-AMP synthase expression of inflammatory cytokine genes, whereas IRF3 and IRF7 (cGAS). TLR3 and TLR7 sense dsRNA and ssRNA, respectively, regulate the expression of type I IFNs. whereas TLR9 senses DNA. The RLRs RIG-I and melanoma In the unstimulated condition, IRF3 is expressed in the cytoplasm. differentiation-associated gene 5 (MDA5) are cytoplasmic RNA After viral infection or other simulation, IRF3 is phosphorylated by ε helicases that sense viral RNA, and cGAS is a cytoplasmic sensor for the kinase TBK1 and/or its related kinase IKKi (also known as IKK ) by guest on October 1, 2021 DNA (1, 2). Upon ligand ligation, they activate downstream sig- (5). This phosphorylation induces conformational changes in IRF3, naling pathways, culminating in the induction of inflammatory cy- which result in the formation of an IRF3 homodimer and its sub- tokinesandtypeIIFNs.TLR7andTLR9areknowntoplaycentral sequent translocation into the nucleus, where it binds to target DNA roles in plasmacytoid dendritic cells (DCs) via the recruitment of the and upregulates the transcription of type I IFN genes. The activation adapter MyD88, which eventually activates the transcription factors of IRF3 is tightly regulated by multiple mechanisms. IRF3 binding NF-kB and IRF7. TLR3 is expressed in various cell types, including to the lipid phosphatidylinositol 5-phosphate, which is increased conventional DCs, macrophages, and nonimmune cells, and it uses upon viral infection, causes IRF3 to be phosphorylated by TBK1/ another adapter, TRIF, to activate NF-kB and IFN regulatory factor IKKi (6). The conjugation of the ubiquitin-like protein ISG15 by *Laboratory of Molecular Immunobiology, Division of Biological Science, Graduate Address correspondence and reprint requests to Prof. Taro Kawai, Laboratory of School of Science and Technology, Nara Institute of Science and Technology, Ikoma, Molecular Immunobiology, Graduate School of Biological Sciences, Nara Institute Nara 630-0192, Japan; †Department of Immunology, Graduate School of Pharma- of Science and Technology, 8916-5 Takayama-cho, Ikoma, Nara 630-0192, Japan. ceutical Sciences, Hokkaido University, Sapporo, Hokkaido 060-0812, Japan; E-mail address: [email protected] ‡Laboratory of Host Defense, Immunology Frontier Research Center, Osaka University, x The online version of this article contains supplemental material. Suita, Osaka 565-0871, Japan; and Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 565-0871, Japan Abbreviations used in this article: avSG, antiviral SG; BMM, bone marrow–derived macrophage; CDS, coding sequence; cGAS, cyclic GMP-AMP synthase; DC, den- Received for publication September 6, 2017. Accepted for publication April 3, 2018. dritic cell; Elavl1, ELAV-like protein 1; G3BP, Ras-GAP SH3 domain binding pro- This work was supported by Japan Ministry of Education, Culture, Sports, Science tein; gRNA, guide RNA; HMW, high m.w.; IPS-1, IFN-b promoter stimulator 1; and Technology KAKENHI Grants-in-Aid for Research Activity (B) 26293107 and IRF3, IFN regulatory factor 3; ISD, IFN stimulatory DNA; KO, knockout; LMW, low 17H04066 (to T. Kawai) and Grants-in-Aid for Young Scientists (B) 17K15598 m.w.; MDA5, melanoma differentiation-associated gene 5; MEF, mouse embryonic (to T. Kawasaki) and 17K15726 (to D.O.). This work was also supported by the fibroblast; miRNA, microRNA; NDV, Newcastle disease virus; pGL3, pGL3- Uehara Memorial Foundation (to T. Kawai), the Takeda Science Foundation (to T. Kawai), Promoter Vector; pGL3-mPlk2 39UTR, pGL3-Promoter Vector harboring mouse the Joint Usage and Joint Research Programs, the Institute of Advanced Medical Plk2 39UTR; PLK, Polo-like kinase; poly(I:C), polyinosinic-polycytidylic acid; Sciences, Tokushima University (H27-28 to T. Kawai), and the Foundation for Nara RBP, RNA-binding protein; RIG-I, retinoic acid–inducible gene I; RLR, RIG-I–like Institute of Science and Technology (H28 to T. Kawai). receptor; RRM, RNA-recognition motif; RT-qPCR, real-time quantitative PCR; SG, stress granule; shRNA, short hairpin RNA; siRNA, small interfering RNA; UTR, T.S. performed the experiments. T.S., T. Kawasaki, Y.K., D.O., and T. Kawai untranslated region; W.B., Western blotting; WT, wild type. designed the experiments. S.A. contributed materials and tools. T.S., T. Kawasaki, and T. Kawai wrote the paper, and T. Kawai supervised the project. All authors Ó approved the final version of the manuscript. Copyright 2018 by The American Association of Immunologists, Inc. 0022-1767/18/$35.00 The microarray data presented in this article have been submitted to the Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo/) under accession number GSE103459. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1701282 2 HuR REGULATES ANTIVIRAL INNATE IMMUNITY HERC5 is involved in sustained IRF3 activation (7). Additionally, intracellular stimulation. The transcriptional inhibitor actinomycin D was Polo-like kinase (PLK) 2 is associated with IRF3 nuclear transloca- purchased from Sigma-Aldrich. Newcastle disease virus (NDV) was pre- tion (8). In contrast, multiple proteins, including PIN1, YAP, RBCK1, pared as described previously (3). RAUL, PTEN, PP2A, MAPK phosphatase 5, SENP2, TRIM21 Plasmid construction a (Ro52), TRIM26, FoxO1, c-cbl, Rubicon, ERR ,MST1,andAGO2, Full-length mouse HuR, HuB, HuC, HuD, and PLK2 coding sequence (CDS) have been reported to negatively regulate IRF3 activation via distinct were amplified from murine brain, lung, and bone marrow cDNAs and mechanisms such as proteasome-dependent degradation, dephos- inserted into a pFlag-CMV-2 expression vector (Sigma-Aldrich). A series of phorylation, de-SUMOylation, and/or prevention of protein–protein mutants for HuR and PLK2 expression plasmids were generated by PCR from interactions (9–18). the full-length HuR pFlag-CMV-2 expression vector. For constructing the pGL3-Promoter
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Use of the Polo-Like Kinase 4 (PLK4) Inhibitor Centrinone to Investigate Intracellular Signaling Networks Using SILAC-Based Phos
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110767; this version posted May 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Use of the Polo-like kinase 4 (PLK4) inhibitor centrinone to 2 investigate intracellular signaling networks using SILAC-based 3 phosphoproteomics 4 Dominic P Byrne1#, Christopher J Clarke1,2#, Philip J Brownridge2, Anton Kalyuzhnyy1, 5 3, Simon Perkins1, 3, Amy Campbell1,2, David Mason4, Andrew R Jones1, 3, Patrick A 6 Eyers1* and Claire E Eyers1,2* 7 1 Department of Biochemistry and Systems Biology, Institute of Systems, Molecular & 8 Integrative Biology, University of Liverpool, L69 7ZB, UK. 9 2 Centre for Proteome Research, Department of Biochemistry and Systems Biology, 10 Institute of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, 11 UK. 12 13 3 Computational Biology Facility, Department of Biochemistry and Systems Biology, 14 Institute of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, 15 UK. 16 17 4 Centre for Cell Imaging, Department of Biochemistry and Systems Biology, Institute 18 of Systems, Molecular & Integrative Biology, University of Liverpool, L69 7ZB, UK. 19 20 # Equal contribution 21 *Correspondence to CEE ([email protected]) and PAE 22 ([email protected]) 23 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110767; this version posted May 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • PLK4, Active (SRP5315)
    PLK4, active, GST-tagged, human Ò PRECISIO Kinase recombinant, expressed in Sf9 cells Catalog Number SRP5315 Storage Temperature –70 °C Synonyms: SAK, STK18 Figure 1. SDS-PAGE Gel of Typical Lot: Product Description ³70% (SDS-PAGE, densitometry) PLK4 or polo-like kinase 4 is a member of the polo family of serine/threonine protein kinases, which localizes to centrioles, the complex microtubule-based structures found in centrosomes, and regulates centriole duplication during the cell cycle. The overexpression of PLK4 triggered the simultaneous formation of multiple procentrioles around each preexisting centriole, which results in centriole amplification and thus, PLK4-induced centriole biogenesis in human cells.1 The reduced PLK4 gene dosage increases the probability of mitotic errors and cancer development.2 Figure 2. Specific Activity of Typical Lot: Recombinant human PLK4 (1-836) was expressed by 4.5–6.7 nmole/min/mg baculovirus in Sf9 insect cells using an N-terminal GST-tag. The PLK4 gene accession number is NM_014264. It is supplied in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM glutathione, 0.1 mM EDTA, 0.25 mM DTT, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ~140 kDa Precautions and Disclaimer This product is for R&D use only, not for drug, household, or other uses. Please consult the Material Safety Data Sheet for information regarding hazards Procedure and safe handling practices. Preparation Instructions Kinase Assay Buffer – 25 mM MOPS, pH 7. 2, 12.5 mM Storage/Stability glycerol 2-phosphate, 25 mM MgC12, 5 mM EGTA, and The product ships on dry ice and storage at –70 °C is 2 mM EDTA.
    [Show full text]
  • Application of a MYC Degradation
    SCIENCE SIGNALING | RESEARCH ARTICLE CANCER Copyright © 2019 The Authors, some rights reserved; Application of a MYC degradation screen identifies exclusive licensee American Association sensitivity to CDK9 inhibitors in KRAS-mutant for the Advancement of Science. No claim pancreatic cancer to original U.S. Devon R. Blake1, Angelina V. Vaseva2, Richard G. Hodge2, McKenzie P. Kline3, Thomas S. K. Gilbert1,4, Government Works Vikas Tyagi5, Daowei Huang5, Gabrielle C. Whiten5, Jacob E. Larson5, Xiaodong Wang2,5, Kenneth H. Pearce5, Laura E. Herring1,4, Lee M. Graves1,2,4, Stephen V. Frye2,5, Michael J. Emanuele1,2, Adrienne D. Cox1,2,6, Channing J. Der1,2* Stabilization of the MYC oncoprotein by KRAS signaling critically promotes the growth of pancreatic ductal adeno- carcinoma (PDAC). Thus, understanding how MYC protein stability is regulated may lead to effective therapies. Here, we used a previously developed, flow cytometry–based assay that screened a library of >800 protein kinase inhibitors and identified compounds that promoted either the stability or degradation of MYC in a KRAS-mutant PDAC cell line. We validated compounds that stabilized or destabilized MYC and then focused on one compound, Downloaded from UNC10112785, that induced the substantial loss of MYC protein in both two-dimensional (2D) and 3D cell cultures. We determined that this compound is a potent CDK9 inhibitor with a previously uncharacterized scaffold, caused MYC loss through both transcriptional and posttranslational mechanisms, and suppresses PDAC anchorage- dependent and anchorage-independent growth. We discovered that CDK9 enhanced MYC protein stability 62 through a previously unknown, KRAS-independent mechanism involving direct phosphorylation of MYC at Ser .
    [Show full text]
  • Comparative Analysis of Protein Expression Concomitant with DNA Methyltransferase 3A Depletion in a Melanoma Cell Line
    American Journal of Analytical Chemistry, 2011, 2, 539-572 doi:10.4236/ajac.2011.25064 Published Online September 2011 (http://www.SciRP.org/journal/ajac) Comparative Analysis of Protein Expression Concomitant with DNA Methyltransferase 3A Depletion in a Melanoma Cell Line Shengnan Tang1,#, Xiaoyan Liu1,#, Tonghua Li1*, Haoyue Wang2, Jiangming Sun1, Qian Qiao1, Jun Yao3, Jian Fei2 1Department of Chemistry, Tongji University, Shanghai, China 2School of Life Science & Technology, Tongji University, Shanghai, China 3School of Medicine, Fudan University, Shanghai, China E-mail: *[email protected] Received March 17, 2011; revised May 3, 2011; accepted June 1, 2011 Abstract DNA methyltransferase 3A (Dnmt3a), a de novo methyltransferase, has attracted a great deal of attention for its important role played in tumorigenesis. We have previously demonstrated that melanoma is unable to grow in-vivo in conditions of Dnmt3a depletion in a mouse model. In this study, we cultured the Dnmt3a depletion B16 melanoma (Dnmt3a-D) cell line to conduct a comparative analysis of protein expression con-comitant with Dnmt3a depletion in a melanoma cell line. After two-dimensional separation, by gel elec- tro-phoresis and liquid chromatography, combined with mass spectrometry analysis (1DE-LC-MS/MS), the re-sults demonstrated that 467 proteins were up-regulated and 535 proteins were down-regulated in the Dnmt3a-D cell line compared to the negative control (NC) cell line. The Genome Ontology (GO) and KEGG pathway were used to further analyze the altered proteins. KEGG pathway analysis indicated that the MAPK signaling pathway exhibited a greater alteration in proteins, an interesting finding due to the close rela- tion-ship with tumorigenesis.
    [Show full text]
  • Synthesis, Biological Evaluation and in Silico Studies of Certain Oxindole–Indole Conjugates As Anticancer CDK Inhibitors
    molecules Article Synthesis, Biological Evaluation and In Silico Studies of Certain Oxindole–Indole Conjugates as Anticancer CDK Inhibitors Tarfah Al-Warhi 1, Ahmed M. El Kerdawy 2,3 , Nada Aljaeed 1, Omnia E. Ismael 4, Rezk R. Ayyad 5, Wagdy M. Eldehna 6,* , Hatem A. Abdel-Aziz 7 and Ghada H. Al-Ansary 8,9,* 1 Department of Chemistry, College of Science, Princess Nourah bint Abdulrahman University, Riyadh 12271, Saudi Arabia; [email protected] (T.A.-W.); [email protected] (N.A.) 2 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Cairo University, Kasr El-Aini Street, Cairo 11562, Egypt; [email protected] 3 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, New Giza University, Newgiza, km 22 Cairo–Alexandria Desert Road, Cairo 12577, Egypt 4 Department of Biochemistry, Faculty of Pharmacy, Egyptian Russian University, Badr City, Cairo 11829, Egypt; [email protected] 5 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Al-Azhar University, Cairo 11651, Egypt; [email protected] 6 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Kafrelsheikh University, Kafrelsheikh 33516, Egypt 7 Department of Applied Organic Chemistry, National Research Center, Dokki, Giza 12622, Egypt; [email protected] 8 Department of Pharmaceutical Chemistry, Pharmacy Program, Batterejee Medical College, Jeddah 6231, Saudi Arabia 9 Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Ain Shams University, Abbassia, Cairo 11566, Egypt * Correspondence: [email protected] (W.M.E.); [email protected] (G.H.A.) Academic Editor: Sandra Gemma Received: 3 April 2020; Accepted: 23 April 2020; Published: 27 April 2020 Abstract: On account of their overexpression in a wide range of human malignancies, cyclin-dependent kinases (CDKs) are among the most validated cancer targets, and their inhibition has been featured as a valuable strategy for anticancer drug discovery.
    [Show full text]
  • Modulation of NF-Κb Signalling by Microbial Pathogens
    REVIEWS Modulation of NF‑κB signalling by microbial pathogens Masmudur M. Rahman and Grant McFadden Abstract | The nuclear factor-κB (NF‑κB) family of transcription factors plays a central part in the host response to infection by microbial pathogens, by orchestrating the innate and acquired host immune responses. The NF‑κB proteins are activated by diverse signalling pathways that originate from many different cellular receptors and sensors. Many successful pathogens have acquired sophisticated mechanisms to regulate the NF‑κB signalling pathways by deploying subversive proteins or hijacking the host signalling molecules. Here, we describe the mechanisms by which viruses and bacteria micromanage the host NF‑κB signalling circuitry to favour the continued survival of the pathogen. The nuclear factor-κB (NF-κB) family of transcription Signalling targets upstream of NF‑κB factors regulates the expression of hundreds of genes that NF-κB proteins are tightly regulated in both the cyto- are associated with diverse cellular processes, such as pro- plasm and the nucleus6. Under normal physiological liferation, differentiation and death, as well as innate and conditions, NF‑κB complexes remain inactive in the adaptive immune responses. The mammalian NF‑κB cytoplasm through a direct interaction with proteins proteins are members of the Rel domain-containing pro- of the inhibitor of NF-κB (IκB) family, including IκBα, tein family: RELA (also known as p65), RELB, c‑REL, IκBβ and IκBε (also known as NF-κBIα, NF-κBIβ and the NF-κB p105 subunit (also known as NF‑κB1; which NF-κBIε, respectively); IκB proteins mask the nuclear is cleaved into the p50 subunit) and the NF-κB p100 localization domains in the NF‑κB complex, thus subunit (also known as NF‑κB2; which is cleaved into retaining the transcription complex in the cytoplasm.
    [Show full text]
  • Centrosome Impairment Causes DNA Replication Stress Through MLK3
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.898684; this version posted January 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Centrosome impairment causes DNA replication stress through MLK3/MK2 signaling and R-loop formation Zainab Tayeh 1, Kim Stegmann 1, Antonia Kleeberg 1, Mascha Friedrich 1, Josephine Ann Mun Yee Choo 1, Bernd Wollnik 2, and Matthias Dobbelstein 1* 1) Institute of Molecular Oncology, Göttingen Center of Molecular Biosciences (GZMB), University Medical Center Göttingen, Göttingen, Germany 2) Institute of Human Genetics, University Medical Center Göttingen, Göttingen, Germany *Lead Contact. Correspondence and requests for materials should be addressed to M. D. (e-mail: [email protected]; ORCID 0000-0001-5052-3967) Running title: Centrosome integrity supports DNA replication Key words: Centrosome, CEP152, CCP110, SASS6, CEP152, Polo-like kinase 4 (PLK4), DNA replication, DNA fiber assays, R-loops, MLK3, MK2 alias MAPKAPK2, Seckel syndrome, microcephaly. Highlights: • Centrosome defects cause replication stress independent of mitosis. • MLK3, p38 and MK2 (alias MAPKAPK2) are signalling between centrosome defects and DNA replication stress through R-loop formation. • Patient-derived cells with defective centrosomes display replication stress, whereas inhibition of MK2 restores their DNA replication fork progression and proliferation. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.09.898684; this version posted January 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Subtype and Pathway Specific Responses to Anticancer Compounds in Breast Cancer
    Subtype and pathway specific responses to anticancer SPECIAL FEATURE compounds in breast cancer Laura M. Heisera,1, Anguraj Sadanandama,1,2, Wen-Lin Kuoa, Stephen C. Benzb, Theodore C. Goldsteinb, Sam Ngb, William J. Gibba, Nicholas J. Wanga,Safiyyah Ziyada, Frances Tongc, Nora Bayania, Zhi Hua, Jessica I. Billiga, Andrea Duereggera, Sophia Lewisa, Lakshmi Jakkulaa, James E. Korkolaa, Steffen Durincka, François Pepina, Yinghui Guana, Elizabeth Purdomc, Pierre Neuvialc,3, Henrik Bengtssonc,4, Kenneth W. Woodd, Peter G. Smithe, FEATURE Lyubomir T. Vassilevf, Bryan T. Hennessyg, Joel Greshockh, Kurtis E. Bachmanh, Mary Ann Hardwickeh, John W. Parki, Laurence J. Martonj, Denise M. Wolfa, Eric A. Collissoni, Richard M. Nevea, Gordon B. Millsg, Terence P. Speedc,k, BREAST CANCER SPECIAL Heidi S. Feilera, Richard F. Woosterh, David Hausslerb,l, Joshua M. Stuartb, Joe W. Graya,5,6, and Paul T. Spellmana,6,7 aLife Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720; bDepartment of Biomolecular Engineering and Center for Biomolecular Science and Engineering, University of California, Santa Cruz, CA 94720; cDepartment of Statistics, University of California, Berkeley, CA 94720; dCytokinetics, Inc., South San Francisco, CA 94080; eOncology, Millenium Pharmaceuticals, Cambridge, MA 02139; fHoffman-La Roche, Nutley, NJ 07110; gDepartment of Sytems Biology, MD Anderson Cancer Center, Houston, TX 77054; hGlaxoSmithKline, Collegeville, PA 19426; iDivision of Hematology-Oncology, University of California, San Francisco, CA 94143;
    [Show full text]
  • ERCC6L Promotes Cell Growth and Invasion in Human Colorectal Cancer
    ONCOLOGY LETTERS 18: 237-246, 2019 ERCC6L promotes cell growth and invasion in human colorectal cancer YANG XIE1,2, JUN YU1,2, FENG WANG1,2, MENGYING LI1,2, XIAO QIU1,2, YUTING LIU1,2 and JIAN QI1,2 1Department of Gastroenterology, Zhongnan Hospital of Wuhan University; 2Hubei Clinical Center and Key Laboratory of Intestinal and Colorectal Diseases, Zhongnan Hospital of Wuhan University, Wuhan, Hubei 430071, P.R. China Received March 19, 2018; Accepted April 4, 2019 DOI: 10.3892/ol.2019.10297 Abstract. Excision repair cross-complementation group 6 Introduction like (ERCC6L), a recently discovered DNA helicase, has been demonstrated to be highly expressed in a variety of Tumors are the second leading cause of mortality worldwide, human cancer types. However, the precise role of ERCC6L behind cardiovascular disease (1,2). In the USA, the incidence in colorectal cancer (CRC) remains unclear. The current and mortality rates of colorectal cancer (CRC) are the third study aimed to investigate the potential role of ERCC6L in highest among all cancer types in both males and females the development and progression of CRC. Reverse transcrip- in 2018 (2). In China, CRC ranks as the fifth most common tion-quantitative polymerase chain reaction, western blot malignancy in males and the fourth most common malig- analysis and immunohistochemistry were used to detect the nancy in females, with 12,000 new cases being diagnosed expression level of ERCC6L in 30 matched pairs of CRC and each year (3). Early prevention, detection and treatment are adjacent noncancerous tissues. The function of ERCC6L in cell crucial for cancer control and management.
    [Show full text]
  • Characterization of the Small Molecule Kinase Inhibitor SU11248 (Sunitinib/ SUTENT in Vitro and in Vivo
    TECHNISCHE UNIVERSITÄT MÜNCHEN Lehrstuhl für Genetik Characterization of the Small Molecule Kinase Inhibitor SU11248 (Sunitinib/ SUTENT in vitro and in vivo - Towards Response Prediction in Cancer Therapy with Kinase Inhibitors Michaela Bairlein Vollständiger Abdruck der von der Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt der Technischen Universität München zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften genehmigten Dissertation. Vorsitzender: Univ. -Prof. Dr. K. Schneitz Prüfer der Dissertation: 1. Univ.-Prof. Dr. A. Gierl 2. Hon.-Prof. Dr. h.c. A. Ullrich (Eberhard-Karls-Universität Tübingen) 3. Univ.-Prof. A. Schnieke, Ph.D. Die Dissertation wurde am 07.01.2010 bei der Technischen Universität München eingereicht und durch die Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt am 19.04.2010 angenommen. FOR MY PARENTS 1 Contents 2 Summary ................................................................................................................................................................... 5 3 Zusammenfassung .................................................................................................................................................... 6 4 Introduction .............................................................................................................................................................. 8 4.1 Cancer ..............................................................................................................................................................
    [Show full text]