Washington University School of Medicine Digital Commons@Becker
Outlook Magazine Washington University Publications
2004 Outlook Magazine, Fall 2004
Follow this and additional works at: http://digitalcommons.wustl.edu/outlook Part of the Medicine and Health Sciences Commons
Recommended Citation Outlook Magazine, Fall 2004. Central Administration, Medical Public Affairs. Bernard Becker Medical Library Archives. Washington University School of Medicine, Saint Louis, Missouri. http://digitalcommons.wustl.edu/outlook/153
This Article is brought to you for free and open access by the Washington University Publications at Digital Commons@Becker. It has been accepted for inclusion in Outlook Magazine by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected].
Row, row, row ... Stephen Warner (front), a first-year MOl PhD student in the university's Division of Biology and Biomedical Sciences, guided his men 's lightweight-four boat during competition in the recent summer Olympic Games in Athens, Greece. The former University of Michigan rower deferred his acceptance to the School of Medicine for four years to continue training. He and his teammates finished ninth overall in the rowing event.
OUTLOOK Volume XLI, Number 3 EDITOR HOLLY EDMISTON CONTACTS Fall 2004 (ISSN 1042-2897) is Phone: 3141286-0100 ART DIRECTOR ERIC YOUNG published quarterly by the Office of FAX : 3141286-0101 Medical Public Affairs, Washington PHOTO GRAP HER ROBERT BOSTON e-mail: hollyedmiston @wustl.edu University School of Medicine, Campus Periodical postage paid at SI. Louis, MO. CIRCULATION Box 8508 , 4444 Forest Park Ave ., KATHI LAW POSTMASTER. Send address changes to: SI. Louis, M0 63108. © 2004 EXECUTIVE STEVE KOHLER Circulation, Outlook, Campus Box 8508, DIRECTOR 4444 Forest Park Ave., SI. Louis, MO 63108 outlook .wustl.edu O J [u]li~@@ Rea
Construction proceeds on the atrium that will connect the Farrell learning and Teaching Center with the North Building.
medicine.wustl.edulltc ------~~--
Farrell Learning and Teaching Center
located in the heart of the Washington University Medical Center, at the intersection of Euclid and Scott avenues, the Farrell Learning and Teaching Center will serve as the school's main venue for medical education. • The first classes are scheduled to be held there in fall 2005. • The latest technology throughout the building means, for example, that every seat in the lecture halls will be wired for personal network access. • New spaces emphasize small group learning. Giving opportunities • Prominent naming opportunities are available throughout the building, starting at $25,000. • Annual Fund support, at any level, will help enable this important addition to medical education.
Contact the Office of Medical Alumni and Development at (314) 286-0086. aWashington Universityin St.louis SCHOOL OF MEDICINE UIIOO Washington University School of Medicine 16 Gene matching VOLUME XLI' NUMBER 3· FALL 2004
COVER Susan K. Dutcher, PhD, professor of genetics and CTCAGTCGGCTCAAGCCCCTAAGAGAATG ~ of cell biology and physiology, among the flora at SI. Louis' Missouri Botanical Garden. Dutcher's research on cilia, hairlike structures on the surfaces of cells, led her on a computerized search through genetic information from algae, plants and humans. For more on this story, please turn to page 15. PHOTO BY ROBERT BO STON Immunity Bites BY MICHAEL PURDY
Understanding why tbe human immune system some times attacks its own host may lead to new therapies or even the prevention of autoimmune diseases.
Young Hip Joints BY JIM DRYDEN ...... Young adults w ith hip dysplasia - who often go undiagnosed - can benefit from a su rgical procedure that radically changes the structure of the hip joint.
Strands of Life BY MICHAEL PURDY
8 Immunity unleashed An innovative m ethod of culling specific genes for study helps researchers to determine which genes carry out important functions or contribute to human diseases . .DEPARTMENT
Seeking Closure BY KIMBERLY LEYDIG
Pulse Minimally invasive treatment for vari cose veins and ocher leg ve in problems is no t for looks alone - the procedure Historic Outlook can cure these often painful and debilitating conditions.
& Alumni Development 28 William T. Shearer, MD 70, PhD 26 Honorable Continuum 28 Profile
30 ~Iews 33 Class Notes Powell to head Radiation Oncology
SIMON POWELL, MBBS, PHD, a cancer physician scientist from MassachusettS General Hospital and Harvard University, has been appointed head of the Department of Radiation Oncology. "S imon is a talented research scientist who has done much to uncove r the molecular mechanisms that allow normal tissues and can cer ce lls to repair their DNA after exposure to ionizing radiation," says Larry]. Shapiro, MD, dean of the School of Medicine and executive vice chancellor for medical affairs. Simon Powell, MBBS, PhD "He possesses the leadership skills and vision to move our Department of Radiation Oncology forward in a continued effort to achieve excellence in a ll of its miss ions." Powell is a leader in research into BRCA I and WU STl awarded select distinction BRCA2, twO genes that can sharply increase a woman's THE ASSOCIAT ION FOR THE ACCREDITATION risk of developing breast cancer. Among other accom OF HUMAN RESEARCH PROTECTION PROGRAMS plishments, Powell developed new tests that let doctors (AAH RP p) recently awarded full accreditation to interpret formerly ambiguous results from tests for the Washington University, one of only a few organizations risk-enhancing forms of BRCAI and BRCA2. in the nation to gain this recognition. Originally from England, Powell was head of The AAHRPP, a non-profit organization, works to the Breast Cancer Service and Clinical Director of protect the rights and welfare of research participants the Gillette Women's Cancer Center Program at by fostering and advancing the ethical and professional Massachusetts General, whi.ch is affiliated with Harvard conduct of scientists and organiza tions that engage in M edical School. He earned both his MBBS (the British cI i n ical research. equivalent to the MD) and hi.s PhD in cel l and molecular "We are very proud that Washington University is radiation biology at the University of London. Powell one of only 14 organiza tions awarded accreditation by trained at the Royal Marsden Hospital and the Institute the AAHRPP," says Theodore of Cancer Research in England before coming to th e "The safety and protection ]. Cicero, PhD, vice chancellor United States in 1991 as a clinical oncology fellow for research. at H a rvard. of human participants has The AAH RPP was Powell also will become a professor of radiation always been at the fore- founded by seven prestigious oncology. As department head, he succeeds Carlos A. front of patient care at organiza tions, including the Perez, MO, who se rved as the department's head since Washington University:' Association of American it was founded in Septem ber 200l. Medical Colleges, the Powell is curren t1y principal investigator or co-principal THEOOORE J. CICERO, PHO Association ofAmerican investigator for six federal research grants, and he has Universities and the served on various committees for the NIH including site Federation of tbe America n Societies of Experimental visit committees that have reviewed major cancer-related Biology, "to fo ster a culture of science and res pon grants at other in sti tutions. He was associate ed itor for sibility within institutions seeking its services. " The the International Journal ofCancer for eight years and clinical research accreditation process was initiated by currently serves on the editorial boards of the journals AAHRPP in 2002. Radiation Research and Cancer Biology and Therapy.
2 Pulse Fall 2004 Outlook HIV care for uninsured, underserved patients to be funded by three-year grant
MISSOURI FOUNDATION FOR HEALTH (MFH ) MFH was crea ted in 2000 as part of an agree has awarded a th ree-year, $l.1 million granr ro the ment between Blue C ross/Bl ue Shield of Missouri, the Infectious Disease Clinic at Washingron Universiry Missouri Department of Insurance and the Missou ri School of Medicine and Barn es-Jewish Hospital. The Atrorney General. The largest health care fo undation in n ew granr will supporr care of low-income patienrs with the state, Misso uri Foundation for H ealth works ro HIV and conditions that complicate HIV treatmenr. support public and private health care services for the "The foundation's funds will be commirred ro serv uninsu red and the underserved. in g the growing needs of people with HIV disease who, The granr also will be used ro expand and improve due ro lack of insurance or other iss ues of access, would psychiatric counseling and ro berrer moniror HIV's otherwise receive li trle or no ca re for their complex ill effects on th e liver. Though 85 perce nt of the granr's nesses," says project direcror Victoria J. Fraser, MD, funds will be used direcrly for pati ent servi ce, the granr professor of medicine and co-direcror of the division of also is structured to help the clinic seek fu rure funding infectious diseases. from other agencies and plan for furure partnersh ips.
PSYCHIATRY Holidays, special events have no proven effect on timing of death
he idea that dying people hang on through force of will or hastened by loss For instance, one study claimed there to life in order to celebrate one more of the desire to live:' was a 19 percent dip in deaths among birthday or holiday has no firm sci Skala is the lead author of a review prominent Americans in the month before entific basis, according to behavioral article that appeared in the May issue of their birthdays and a 14 percent rise in medicine researchers. the journal Psychosomatic Medicine. With deaths in the month afterward. However, "I've worked in hospitals since I was Kenneth E. Freedland, PhD, professor of Skala and Freedland say, the original about 16 years old, and I've seen that people psychiatry, Skala reviewed a number of authors included the birth month itself in in medicine have a lot of very strongly held studies that have looked at whether death the "after" category. That meant some beliefs, like the idea that certain people rates increase or decrease before, during post-birthday deaths may have occurred hang on," says Judith A. Skala, PhD, or after symbolically important occasions before a person's actual birthday. research associate at the university's such as holidays or birthdays. Two other studies analyzed deaths Behavioral Medicine Center. "But none of They examined studies dating back among members of certain religious the studies have convincingly established to the early 1970s but found no convincing groups before and after major holidays. that the time of death can be postponed evidence that people can delay or hasten Astudy of Catholic priests found no their own deaths. variation in mortality around Christmas, If it were possible to learn how Easter, birthdays or anniversaries of people might tip the balance one way or their ordinations. the other, Freedland says, it could pro To truly learn whether people can vide some insight into the psychological "hang on" or "give up," it will be neces processes that can enhance or inhibit sary to pick a group of people with the survival. same disorder at the same stage - say, The available research analyzed by terminal cancer. Then, studying those Skala and Freedland is contradictory, people during the time they have left, shows only modest effects, and some is Freedland and Skala say it may be pos of poor quality. In many cases, the studies sible to identify psychological factors also fail to explain the mechanisms that that seem to lengthen the time that a might delay or advance death. person survives.
Pulse 3 I I p.!!Js~ Baum to lead national organization
M. CAROLYN BAUM, PHD, has been elec ted president of the American Occupational Therapy Association (AOTA), a professional society that represents the interests and concerns of occupational therapy professionals and works to improve the quality of occupational therapy services. Baum is the Elias Michael Director of the School of Medicine's Program in Occupational Therapy, which is ranked third among occupational therapy schools by us. News & WorLd Report. "My goals are to lead the asso ciation and its members as they form partnerships with consumers and policymakers," Baum says. "We hope to foster the participa tion, health and well-being of M. Carolyn Baum, PhD ...... people whose health condition or disability threatens or limits their performance." The AOTA is a national professional society estab lished in 1917 to represent the interests and concerns of occupational therapy professionals and to improve the Barrack named Knight Professor quality of occupational therapy services. Occupational therapists focus on enhancing the quality of life for indi ROBERT L. BARRACK, MD, has been named the viduals who may be recovering from illnesses or injuries, C harles F. and Joanne Knight Distinguished Professor of coping with developmental disabilities or experiencing Orthopaedic Surgery. He also will serve as chief of staff the normal sensory changes that res ult from aging. for orthopaedic surgery at Barnes-Jewish Hospital and Baum, who also is professot of occupational therapy chi ef of the Adult Reconstructive Surgery Service for and of neurology, has developed three measurement tools the Department of Orthopaedic Surgery at the School used worldwide by clinicians working with patients with of Medicine. neurological conditions. The instruments enable thera "We are very excited to wel pists to assess what a patient is ab le to do now versus come Dr. Barrack as the Knight before an illness or injury, how much support a patient Distinguished Professor," says may need to perform dail y tasks such as payi ng bills or Larry]' Shapiro, dean of the taking medications, and the level of care a patient may School of Medicine and executive need in the home or an assisted-living facility. vice chancellor for medical affairs. Much of her research focuses on helping older adults "The School of Medicine and live independently. "Rather than focusing on people's Barnes-Jewish Hospital owe a great Robert L. Barrack, MD deficits, I try to understand what a person with a chronic debt to Chuck and Joanne Knight, disease or disability can do," Baum says. and this distinguished professorship is emblematic of Her cu rrent research includes a project to identify their commitment to our institution." the rel ationship between a person's vision and the ability Richard H. Gelberman, MD, the Fred C. Reynolds to continue living at home. Baum also is principal Professor and head of the D epartment of Orthopaedic investigator of an interdisc iplinary team studying brain Surgery, says Barrack's appointment is another key injuries caused by stroke or trauma. She and her col step in building the depattment's reputation as one leagues hope this research will lead to more effective of the fin es t orthopaedic surgery departments in the rehabilitation strategies. United States.
4 Pulse Fall 2004 Outlook Peck named to national committee on health insurance benefits and payments
TH E N ATIONAL AC AD E MY OF SCIEN C E S' Medicare program, but th e findi ngs lnstiwte of M ed icine has named W illiam A. Peck, M D, and recommendations may have a member of a natio nal com mittee that w ill address broad applicability to all publi c and ways [0 redesign health insurance benefits, payment pnvate l11 surance programs. and performance improvement programs. Peck is the T h e com m ittee, chaired Al an A. and Edith L. Wolff Distingui shed Professor of by Steve A. Schroeder, MD, M edicine and d irector of the C enter fo r H ealth Poli cy at D istinguished Professor of H ea lth W ashington University's O lin School of Business. and H ea lth Care at the University The committee's purpose is to identify optio ns for of California, San Francisco, William A. Peck, MD redes igning insurance benefits, provider payment poli includes 22 nati onal health care cies and perform ance improvement programs in ways execu tives , educators and policy makers. that w ill encourage and reward improvements in health Peck, the former dean of the School of M edicin e, is and hea lth ca re delivery. The primary focus is o n the a natio nall y recogn ized health care leader.
RADIATION ONCOLOGY PET scans aner therapy improve cervical cancer survival predictions
ost-treatment positron emission While X-rays and CAT scans reveal - tomography (PET) scans can be structural details of the body, PET scans used to predict cervical cancer can detect functional differences in I ?patients' chances of survival, tissues, allowing physicians to highlight according to radiologists at the School tumors. of Medicine. Grigsby and colleagues retrospec PET scans are used to diagnose tively examined post-treatment PET scans cervical cancer, but post-therapeutic PET from 152 cervical cancer patients taken scans are not covered by most insurance after their treatment at the Siteman plans and are rarely used to look for signs Cancer Center at Washington University of cancer recurrence. Current follow-up and Barnes-Jewish Hospital. They used practices include regular pelvic exams scan data to separate patients into groups and occasional X-rays or CAT scans. based on indications of recurrent or con The new study's results suggest that tinued tumor growth : those with no signs, making post-treatment PET scans standard those with moderate indications, and therapy practice could give doctors a poten those with strong signs. tially lifesaving headstart at prescribing After five years, 90 percent of the follow-up therapy. patients in the moderate indications group Their results appeared in the June 1, were still alive , compared to less than half 2004 issue of Journal of Clinical Oncology. in the group with strong signs of surviving "Right now, we're forced to wait tumor cells. I until a patient comes back with a lump "The hope is that we might be or with symptoms before we can begin able to catch patients in that second or follow-up treatments, and by then it's third group before their cancers get too often too late," says Perry W. Grigsby, M0, far ahead of us and try to do something professor of radiology and of radiation to make their survival rates better," oncology. says Grigsby.
Outlook Fa ll 2004 Pulse 5 Siteman Cancer Center receives donations
PLEDGES OF $1 MILLION EACH toward the Si teman Cancer C enter's Emerson-Busch challenge grant have been made by the May Department StOres Foundation and Edward Jones. The chaJJenge grant, a $ 10 million gift from Emerson's Charitable Trust and the Anheuser-Busch Foundation, will be used to expand research space at Siteman and to suppOrt and help ensure that patients have access ro the most advanced cancer treatments. "These gifts from May and Edward Jones will bene fit efforts to lesse n the burden of cancer on communities in the St. Louis area, the Midwest and beyond for years ro come," says Washingron University Chancellor Mark S. WrightOn. The challenge grant will further Sr. Louis' role as home to a nationally recognized cancer research and treatment program. First priority for funding through the Emerson Busch chalJ enge grant is expansion of cancer research space and programs in a new cancer research facility. Gordon to lead Genome Sciences Center The basic and applied research supported by this gift are crucial in finding new treatments and diagnostic THE NEW CENTER FOR GENOME SCIENCES, techniques for cancer patients. an interdepartmental, university-wide program, will be directed by Jeffrey 1. Gordon, MD, the Dr. Robert J. Second opinion service debuts Glaser Distinguished University Professor. The center is an interdisciplinary and university No MATTER HOW EXPERIENCED your physician, wide program strategically located adjacent to the the need for a major medical procedure can be daunting. School of Medicine's Genome Sequencing Cenrer (GSC), To address this issue, School of M ed icine cardi which played a major role in ologists and cardiothoracic surgeons at Barnes-Jewish The community of the success of the Human Hospital have introduced a second opinion service scientists will address Genome Project. for patienrs wi th a heart disease fundamental questions The new Center for diagnosis who have been Genome Sciences is the first 2 recommended for any heart NO in comparative genomics G t a of three major components procedure, including surgery. opi ion and systems biology. to be implemented as part The service also is available for of BioMed 21, the univer any lung or esophageal condition sity's visionary initiative dedicated to using the latest for which surgery is recommended. knowledge of the human genetic blueprint to develop For a fee of $50, physicians in the School of new ways to diagnose, treat and ultimately prevent a Medicine's divisions of cardiothoracic surgery and cardio variety of common human diseases. vascular diseases will review a patient's medical records The C enter for Genome Sciences will provide space within 48 hours of receipt. If a patient prefers to be seen for faculty and students and bind tOgether research and in person, the staff will arrange an office visit, for which educational programs. Center members also will provide the patient's insurance will be billed. new tOols to their GSC neighbors to help interpret the The se rvice is open to Missouri and Illinois residents. information generated from ongoing sequencing projects. To learn more, call roll-free (866) TOP-DOCS.
6 Pulse Fall 2004 Outlook MOLECULAR MICROBIOLOGY Strep bacteria spreads infection via wasplike "stinger"
he bacterium responsible for strep a Gram-positive bacteria. Gram-positive its infectious processes," he says. "Some throat, scarlet fever and other bacteria only have one outer membrane; are toxins, some interact with host cell disorders appears to use a single Gram-negative bacteria have two outer receptors and make the cells die or wasplike "stinger" to spread infec membranes separated by a small space. behave differently. We wanted to know tion, according to surprised microbiologists That space between the inner and how Strep A emits these agents: Is it at the School of Medicine. outer membranes serves as a prep room organized in any fashion, or does it just Researchers studying the surface of for proteins and other agents that Gram happen randomly?" Streptococcus pyogenes, also known as Strep negative bacteria secrete to infect host Most microbiological evidence had A, had expected to find a disordered jumble cell1s. Many proteins won 't function suggested the latter hypothesis might be a of several pumps for spraying compounds properly unless they have folded into a better bet. Bacteria seemed to have little onto cells targeted for structural organization infection. Instead, they beyond the shape of the found a single dedicated cells they came in, which stinger - a feature can vary from round Strep A may share with to cigar to corkscrew other bacteria that could shapes. But a few stud provide an easier target ies, including some from for new drugs designed Caparon's lab, recently to treat infections. hinted that Strep A "It's certainly a bacteria might be more long time down the organized than scientists road, but this gives suspected. us new ways to think For the study, about how strep and Caparon and graduate other bacteria might one student Jason Rosch day be stopped, " says used modified antibod Michael G. Caparon, ies to tag an infectious PhD, professor of agent secreted by Strep molecular microbiology A. They then took micro and the study's lead graphs of the bacteria . investigator. "With bet The antibodies consis ter understanding of how bacteria interact tently showed up at a single focal point with the cells they infect, we can start to where the cell was secreting the infec develop better approaches for intervening:' tious agent. Strep A is one of the most common After follow-up tests confirmed their human pathogens. Epidemiologists estimate particular configuration, and scientists findings, Caparon decided to name the that at any given time, 5 to 15 percent of believe the space between the two mem new structure that secretes infectious humans carry asymptomatic Strep A in branes provides Gram-negative bacteria agents. He calls it the "exportal, " a com their respiratory tracts. Strep bacteria has with a place to ensure the right folding bination of export and portal. become increasingly resistant to antibiotic and other preparatory steps take place. "We'd like to now look at how the drugs during the last decade, and serious Caparon was curious about how cell actually puts this together," Caparon infection by the bacteria can produce a Gram-positive bacteria like Strep A pre says. "If we can identify the factors that "flesh-eating" condition called necrotizing pare their infectious agents without this are involved in structurally putting the fasciitis. airlock-like space between membranes. exportal together, those may be the On the basis of the Strep A's outer "Strep A is known to secrete more most interesting points of intervention membrane, microbiologists classify it as than 30 different substances as a part of for devising new drug treatments:' rn utlook Fall 2004 Pulse 7 CIENTISTS ARE UNCOVERING new complexities in the innermost workings Stanford Peng, M0 , PhD , rev iews lab results wi th , from leh, of the human immune system that could graduate stud ents Ste ph anie Lathrop and Barba ra Schra ml S an d laborato ry tec hnician Lin g Lin. make big differences for patients with autoimmune diseases. Thousands of Americans are diagnosed with these disorders each year as cells in their bodies that normally attack invaders like bacte ria and viruses instead turn their fury on the body's own tissues. This about-face causes conditions such as lupus, myasthenia gravis, allergies, psoriasis, diabetes, Graves' disease, rheumatoid arthritis and multiple sclerosis.
Fall 2004 Ou tlook
~-L-.._---L.______BY MICHAEL PURDY
For decades, scientists assumed that these disorders One of the biggest new developments in autoimmune were caused mostly by bad lnstrucrions to the cells that theory focuses on what immune attack cells are like when serve as the immune system's attack dogs. These cells, they're not on the job battling invaders. Scientists previ which are collectively referred to as lymphocytes and ously assumed that mature, unused versions ofT and B include B cells and T cells, rely on a complex signaling cells were "sleeping" or dormant. But a new theory start and detection system that tells them when, where and ing to gain widespread acceptance suggests that the cells what to attack. If immune attack cells were assaulting are constantly spoiling for a fight, and healthy immune the wrong targets, researchers reasoned, something had sys tems have to constantly work to restrain them, in effect to be going awry in that signaling system. putting a "leash" on the attack dogs. T hanks to the work of researchers like Stanford In both T and B cells, Peng has identified the first-ever Peng, MD, PhD, assistant professor of medicine in examples of these leashes - proteins that ac tively work rheumatology and of pathology and immunology, a within the cells to keep them quiet when they're not needed. much more complicated picture of the causes of auto Peng, who sees patients at Barnes-Jewish H ospi tal, immune diseases is beginning to emerge. Expanded specializes in the study of lupus, an autoimmune co ndi insights into these causes may soon be offering scien tion that afAicts approximately 1. 5 million Americans ti sts new frontiers for developing drugs that can ease with symptoms including arthritis, prolonged fatigue, or prevent such disorders. skin rashes, kidney damage, anemia and brearhing pain.
Outlook Fall 2004 Immunity Bites 9 Through selective breeding, scientists havc developed several mouse models that exhibit one or morc lupus-likc symptoms. To identify the gene leashes, Peng's research I group compared levels of messenger RNA for various genes in normal mice and a lupus mouse model. Measuring messenger RNA, which acts like an order slip for building a copy of a gene's protein, gives scientists a feel for a gene's activity level in a cell. This in turn allowed he second leash reccntly idencificd Peng's group to highlight genes with distinct by Peng's group is known as microph differences in activity levels in the mice with thalmia-associated transcription factor lupus-like symptoms. (MITF). Microphthalmia is a genetic condi tion that causes abnormally small eyes and he first leash they found, a protein called impaired vision. Foxj I, had never previously been linked to Like the Foxj J protein, Peng's group immune system functions. Based on mes became interestcd in MITF when messenger senger RNA levels, though, the gene appeared RNA studies suggested the gene was unusu to be much less active in lupus mice than in ally inactive in a mouse lupus model. Peng normal mice. When Peng and colleagues dis and colleagues lowered activity levels of the abled the gene for the protein in normal mice, protein in normal mice, and dose examina the mice developed lupus-like symptoms. tion of those mice showed that B cells were "These symptoms included inAammation spontaneously turning themselves on and in multiple organs like their lungs, their sali making antibodies, clumps of proteins that vary glands, their kidneys, and othcr organs, which arc normally designed to attack invaders. The new anti is very characteristic of lupus," Peng explains. bodies in the mice were autoantibodies - antibodies Scientists had previously identified Foxj I as a targeted to the body's own tissues that are a characteristic transcription facror, a protein that can bind to DNA to symptom of lupus. increase or decrease the activity of other genes. Further "This is the first transcription factor we've found investigation by Peng's group showed that decreased that has to be active in the resting B cell to keep it that Foxj I activity led another transcription factor, NF-KB, way," Peng says. to increase its activity. MITF's sphere of inAuence is proving a little harder "This protein belongs to a family of transcription to define than that of Foxj 1. It appears to restrain inter factors heavily implicated in variolls types of inflamma feron regulatory factor 4 (IRF4), a transcription factor tion, including the inflammation caused by infections previously linked to the activation of B cells. But it and by allergies," Peng says. "So our thinking is that appears to have that effect by proxy through its inAuence without Foxj I, more NF-KB is activated, possibly trig on several othcr genes that in turn act to keep IRF4 gering the inappropriate activation ofT cells and leading in check. to organ inflammation and other lupus symptoms." "\Ve've been focusing our efforts to develop new Inappropriately activated T cells also are involved in treatments for autoimmune disease on pathological tar multiple sclerosis and in diabetes, suggesting that Foxj I gets - genes that are overused or are used inappropri also might be a contributing factor in these conditions, ately, leading to immune system anacks on self," Peng Peng notes. says. "Another concept we should keep in mind is
10 Immunity Bites fall 2004 Outlook To their surprise, researchers found that most immune system functions appeared to be working normally in mice lacking SAI~ "We have identified other immune system proteins that are potential that the loss of one of these targets for new autoim regulatory genes that keep mune disease treatments, the immune system in check hut they all affect large also may be a primary portions of the immune contributing factor." system, making weakened immune function a poten n addition to their work tial side effect of any new with immune cellieasbes, drug," Peng explains. "Our Peng and his colleagues early experi menrs suggest recently connected lupus targeting SAP for treat in nLice to a protein that is ment may avoid that risk." involved in immune system COmmUi1IG1tiOns. :ng cautions that errors The protein, SLAM-asso Il1 anyone gene are ciated protein (SAP) appears Punlikely to he the sole to be involved in exchanges between B cells and T cells. cause of an acute autoimmune disorder like lupus. "It's Scientists have long known that T cells "talk" to B cells very clear now that no single gene or even couple of to help them produce antibodies meticulously custom genes are sufficient to explain lupus," he notes. "You ized to destroy the last scattered remnants of a persistent probably need multiple malfunctions in different genes invader. But they've had a hard time determining the to cause such a severe autoimmune syndrome." details of how those interactions take place. The multiple causes of lupus are likely reAected in "SAP may give us an important first insight intO the multiple mouse models of the disorder, says Pengo how this occurs," Peng says. "But even more importantly, "Each of the animal models has slightly different it may provide us with a target for ne"v lupus treatments clinical aspects to it, probably because they represent a that don't widely suppress the immune system." slightly different facet of the human disease," he explains. Earlier research had shown that higher levels of SAP "It's therefore going to be very interesting to test if these were present in animals with autOi,mmune conditions are findings tbat can apply to lupus generally or if they're than in normal animals. limited to subsets of lupus." Peng affirmed the SAP-autoimmunity connection Peng's group recently identified another leash pro through work with a lupus model created by exposing tein from the same family of genes as Foxj 1. They are mice to a hydrocarbon oil. Such exposures cause normal currently working in the lab to further understand the mice to develop kidney disease, arthritis and other condi activity of all the proteins and also have begun studying tions similar to lupus. However, mice with genetically human lupus patients to see if they can detect signs of disabled SAP stayed healthy even after exposure. abnormal activity in these proteins. 0
Outlook Fall 2004 Immunity Bites 1 1 • • • • Christopher Mackey didn't realize he neededhip surgery. • • • 1: ...... '. . For several months, he didn't reaUy know what wa.<; wrong. All he knew was rhat when he pitched a baseball, a popping ound came from his left hip. At first, there wasn't really any pain involved, bue rhen his groin muscle started [0 hurt. It turned out the groin was being aggravated by a deformity • • • • • • • • • • • in his hip, the same deformity chat was causing it (0 pop. Later, when his right hip also popped Ollt of irs socket, People with hip dysplasia lack a normal nip's solid ball and socket structure Mackey experienced significant pain. In fact, he was unabl (left, top and middle). Rather than LO move. and his baseball coach had (0 lay him flat on the re(llace the hill joint, ortho(laedlc ground in order to help move the joint back into place. surgeon John C. Clohisy, MD, (below, "That time it hurd" he say ... . right) radically cuts and repositions the bones in young (latients such as Mackey was suffering from a congenital deformity of Christopher Mackey, returning them to the hip joint called hip dysplasia. The hip joint is commonly normal, pain-free motion. thought of as a "ball and socket" joint. The "ball" is the rap of the thighbone, called the femoral head. It rests within the hip's "socket," known as the acetabulum. When chose two structures are our of sync. problems can develop. rF·'------~------..~..
• • • • • • • • • • • •
f I f I t ami-inAammacory medicines and John C. Clohisy, MD, painkillers. Bur rhe pain usually gers examines Christopher II worse. Ar firsr , i r occurs during or Mackey's ran!le of jusr afrer physical acrivi ry, bu rover motion. The outcome? rime, as rhe pain becomes more Ask anyon e who's faced Mackey's frequenr, many people may have 92-mph fastball. hip pain even when ar resc. "One way to explain why pariems like Chriscopher don'r ger symptoms umil rhey are young adulrs is rhar although rhe canilage in rhe hip can funcrion in an adverse environmcnr for a long rime, evenru ally jusr as rhe rread on a ri re wi II go "Mosr of rhese parients have an medical problems or rhose who are bad, rhe canilage begins co wear ou r underlying deformiry, and many of obese are nor good candidares. over time," Clohisy says. rhem have some degree of os reo And while hip replacemenr A person wirh Mackey's condi arrhriris in rhe hip, " says John C. surgery can provide pain relief and rion could look forward to pain, Clohisy, MO, assisranr professor of improved funcrion for parienrs wirh difficulry wirh daily and recrearional orrhopaedic surgery. "As people Ii ke advanced hip disease, ir's nor a grear acriviries, and doeror's orders co stop Christopher ger older, rh ey can begin solu rion for people under age 50. doing rhings rhar pur srress on rhe co experience symptoms. Among "For parienrs in rhe 15 to 50 hip joinr. There al so are problems people in rheir 60s and 70s, rhose age group, a hip replacemem is sub involving failure to diagnose early sympcoms would make us rhink oprimal due co acriviry resrriuions hip disease. abour toral hip replacemem, but our Thar could easily have happened goal with younger pariems is to delay "Our goal with younger to Mackey. joint replacemem surgery and co pro "I live in Springfield, and a lor long rhe life of their rrue hip joinr. " patients is to delay joint of rhe doerors I saw around here To do rhar, Clohisy and his replacement surgery and didn'r really know whar was wrong colleague Perry L. Schoenecker, MO, wirh me, " he says. professor of onhopaedic surgery, to prolong the life of According co Clohisy, rhat's radically change rhe hip joinr's suuc nor uncommon. "Very frequenriy, rure. In an operarion rhar takes [Wo their true hip joinf' parienrs of rhis age have a deformiry co four hours, rh ey cur rhe bones JOHN C. ClOHISV, MD or hip joinr problem rhat is nor easily around rh e hip socker and reposirion recognized," he says. "Pariems don'r rhem. The pariems don'r need a casr, and rhe facr rhar rhe symheric hip ger a definire diagnosis, so some go bur rhey do need co sray in rhe hos joinr is going co wear our wirh for many yea rs wirhour rrearmenr. " piral for several days and mu sr walk rime," says Clohisy. "A parienr who Thar's why Clohisy developed with the help of crurches for several gets a hip replacemenr ar a very rhe Young Adulr Hip Program ar weeks afrerward. young age may require mulriple hip Washingcon Universiry and Barnes The surgical rechnique, call ed surgeries over rhe course of his or Jewish Hospiral. He rrears nor only the Bernese Peri-Acerabular Osreo her liferime. " parienrs who need major rebuilding comy, isn'r for everybody. Clohisy Tradirionally, rrearmem for hip of rhe hip joim, bur also young says ir's designed for relarively young, disorders in young adulrs involved people who are candidates for hip healrhy parients. Those wirh mulriple lirde more rhan resrricrion of acriviries, arrhroscopy or for a process called 14 Young Hip Joints Fall 2004 Outlook I • • • • • • • • •• • • • • • • • • • • • • • • • • • • •
hip joint debridement, a procedure Instead, many of those patients person with 20 years when the hip that involves a trimming of the bones are walking around withouc pain. wasn't causing them problems, giving around the joim ro correct subtle Even those who still experience some them th e opportunity ro do many abnormalities and relieve impinge pain in the hip joim due ro underl y things they couldn't do if they hadn't mem problems of the hip joinr. ing arthritis are markedly improved had the operation." Many of these surgical tech and usually can manage their pain Luckily, Mackey can look forward niques have only been used regularly with over-the-coU!Her anti-inflam ro doing many things he would not in the past few years at selected marory drugs. Most return ro fuJI have been able ro do without surgery. medical centers. As recen dy as 15 activities after surgery. Clohisy and Schoenecker surgica lly years ago, most of these patients Clohisy says some of these repaired his left hip on Val entine's would have been untreated. That young patients may eventually need Day of 2003. When baseball season would have contributed ro the devel hip replacement surgery, but even started in March of that year, Mackey opment of osteoarthritis at a yo ung that wouldn't mean the ea rlier sur had (0 watch the Fighting Irish of age, and most would have needed gery wasn't worth ir. Springfield Catholic from the dug a hip replacement by the time they "If we have a patient who gets our. But in spite of pain in hi s right reached their 30s or 40s. an osteoromy at age 30 and then ends hip, he came back for his senior sea up having a hip replacement at age son last spring and featured a fastball
50, (0 me that's a great success," in the 92-mile-per-hour range. He
he says. "The first surgery waited (0 have that hip operated will have provided that on in June of this year because he wanted ro make it through baseball season fi rst. Young athletes like Mackey make up a large part of C lohisy's sur gica l practice. After osteoromy sur gery, they can return to competition, although he discourages them from taking up di stance running or other repetitive-impact activities that can damage a diseased hip. Nonetheless,
his patients have returned (0 a vari ety of sportS, including basketball , gymnastics, cycling, swimming, hik ing and tennis. Following the rehabilitation of
his right hip, Mackey plans (0 pitch in college next season for Southwest Missouri State University. H e says his hip problems probably cost him a shot at being drafted by a major league baseball team, but even with
the injury, he was able (0 ea rn a col lege scholarship. And who kn ows, if his pitching improves as much as his hips have, he might go a long way. 0
Young Hip Joints 15
Match... eliminate... identify. / Cilia perform important functions in both multicellular Humans and algae share many genes for / organisms and single-celled organisms. basic functions and essential structures, CTCAGJCGGCTCAAGCCCCTAAGAGAATGCC including some genes that go into cilia and basal bodies. Scientists used acomputerized comparison to identify human-algal gene matches, then eliminated all matches found in a land plant that doesn't have cilia or basal bodies.
18 Strands of life Fall 2004 Outlook
------.------...:....--~------,,'. Strands of Lil'e.... y. ~...... ,......
The new approach has been spectacularly successful, "Ifyou look at any flowering land plant, it doesn't quickly leading to benefits for both Dutcher's research make any cilia, and it doesn't make basal bodies," Dutcher program and for other researchers, incl uding a group at explains. "Once the idea hit me, it seemed fairly obvious: Johns Hopkins University that used her data to identify Why not have the computer look for gene matches between a hu man disease gene. humans and Chlamydomonas, and then compare those l Dutcher's new method centers on a computerized resul ts to a land pl ant and remove all the genes from the ,I comparison of the genomes of three species: humans; a first comparison that also had matches in the land plant?" weed, Arabidopsis; and CMamydomonas, a green alga. The human-to-ChLamydomonas comparison would Dutcher works with Chlamydomonas to Jearn more locate many of the genes for basi c functions and structures about cilia, hair-like structures on th e surfaces of cell s. those two organisms share, Dutcher reasoned, but any ~ cc "Almost every cell in the human body has cilia," matching genes also found in the flowering land plant Dutcher says. "Cilia that are active early in development likely would have nothing to do with cilia or basal bodies. ensure that organs like the heart and stomach end up "We thought the final result might be incredibly en where they're su pposed to be. Cilia clear away dirt and riched with ci lia and basal body genes," she explains. bacteria in the respiratory traer, help sperm swim and r o,) r..'N~1>A> fl,)r..,fI,)N'v r·.> 1'\)1\)1\)~"'~l'\)rvl\)"') r~~NNI\) ~ I'I.1VNNOJf\)l\.'JI\)f'I) /\)1\)
help keep fluid flowing into and out of the brain." ~~~~~~••• • II (..,) ~~'....:... ~fJ~~• • • II ~• ~~i~~=~~~~~::~;• ••••• ,... • • • • ...... • • • ~...' =~=~~~~E., ...... 1'1,)...... •• . ~~.. <-" r,.' ''' W,..,... ~ ~ ... ~ (..)1\) - (...1\) .... (..)I\) .... (~ - (..,)N .... (..)~ I\)...... !\.' ...... x.,...... U'l...... x.'l ... '""I'\) (..,) ...... l(;)~(.) 1\)(..) Problems in the cilia and basal bodies, the structures (".r.'II'.r1'I' l'ir 'I'm .1'l' lr ~ 'I"'I'1 1 'J that anchor cilia to the surfaces of cells, are linked to a variety of disorders, including polycystic kidney disease ...... 230 genes . Researchers knew a human disease gene and genetic disorders that affect the ea r, nose, sperm, was found so mewhere in a regio n of DNA that placement of internal organs, number of fingers and toes, contained 230 genes. AWashington Universi ty and length of the limb bones. analysis high li ghted two genes in the same region , Studying Chlamydomonas allows Dutcher's group to and Johns Hopkins scientists were Qui ckly able to more eas ily isolate and manipulate cilia and basal bodies. find the gene they'd been searching for. Although the alga is more easily subject to experiments, 2 genes rl its genetic material has 20,000 genes, which still left researchers like Dutcher with quite a bit ofsearching to Dutcher approached Gary D. Stormo, PhD, professor of genetics, do. Amid those thousands of genes, Dutcher and other with her idea. "My first reaction was, that's an interesting scientists were seeking only an es timated 250 to 400 idea, but that's a lot of genes!" Stormo recalls. genes - potentially a very long and repetitive hunt. A specialist in computational analyses of genetic "It had been prerty slow going," Dutcher says . 'I\Ithough code, Srormo is particularly interested in finding signals there are a lot of people interested in Chlamydomonas contained in DNA that interact with proteins to turn and in these ge nes, we had only identified a few of them genes on and off. at the time we began this genome comparison. " Stormo and Dutcher, who are married, were jointly mentoring a graduate student, Jin Billy Li, who Dutcher's analysis derives its power to identify interesting rook the lead in carrying out the comparisons. For genes from the evolutionary history written into the the land plant, researchers chose to use the genome of organisms' genomes. Evolution tends to retain genes that Arabidopsis, a weed. (Scientists at Washington University's make proteins for essential cell structures and processes. Genome Sequencing Center and at Cold Spring Harbor Scien ti sts call genes kept intact through the develop Laboratory completed mapping of the Arabidopsis ment of many different species "highly conserved," and genome in 2002.) Dutcher and others have shown that genes for cilia and The human-to-alga comparison produced 4,348 gene basal bodies fit this description. matches. Comparing those results to Arabidopsis yielded Significant exceptions to this principal of conserva approximately 3,600 matches, allowing researchers to tion can OCCLlr when life has to make major adjustments narrow down the pool of prospective cilia and basal body to its environment. In one such instance, most plants genes to 688. Further comparison with the genomes of evolving to adapt from life in the sea to life on land the fruit fly and the sea squirt, a small ocean-going animal, discarded their cilia. reduced the list of genes to approximately 300.
Outlook Fall 2004 Strands of Life I 9 Strands of ~ . ife ......
To determine how effecrive the screening process had "We contacred Nicholas Katsanis, PhD, a BBS been, Dutcher and colleagues first looked to see if their researcher at johns Hopkins, and he told us they had res ults had highlighted any of the cilia and basal body no idea where the BBS gene on chromosome 2 was," genes scientists had already identified in Chlamydomonas. Dut:cher recalls. "We explained that our comparison They were delighted to find the comparison caught 90 had highlighted two genes in that area and sllggested percent of the genes they already knew about. they might be worth checking into." "This absolu tely Aabbergasted us," When Katsanis, assistant professor at Hopkins' says Dutcher. "We thought we'd McKusick-Nathans Institute of Genetic M edicine, be less successful. " analyzed the twO genes in families afflicted by BBS, he Other tests produced found several sufferers had abnormalities in one of the similarly encouraging res ults. genes and named it BBS5. Li and research assi stan t To confirm that the BBS5 gene was important to Lin Ya Ll cut the cilia off cilia or basal bodies, Dutcher reduced the gene's activity Chlamydomonas and watched in the alga. to see if 103 of the genes iden "We see different effects depending upon how much tified by the comparison became we knock the acrivity of the gene down, but it looks like more active as the algae rebuilt the it actually is a basal body protein," Dutcher says. "Our cilia. More than a third increased hope is that we can now take our data set and accelerate
To test genes hi ghl ighted their activity. A follow-up experi the search for genes that contribute [0 some of the many in computeriz ed co mpari ment suggested that several genes human disorders that involve cilia and basal bodies." so ns, researchers tagged that didn't increase their acrivity In addition to probing those potential connections, the proteins made by when the cilia were cut off were Dutcher already has started brainstorming new genetic some of the genes with instead involved in the construc comparisons d es igned [0 identify genes of interest. fluorescent antibodies. tion of basal bodies. "Humans have twO kinds of cilia motile cilia, Results from a mouse lung "We don't yet know how which create motion, and non-motile cilia, which respond (above) and from the sea many of the genes we identified to motion," she says. "The microscopic worm C. elegans algae Chlamydomonas (below) con fi rm the pro are completely unrelated to cilia only has non-motile cilia, so if teins' presence in cilia. and basal bodies, but: so far the we were to take Ollr results results have been very encourag from this study and elim ing," says Stormo. "The technique seems to have been not inate all the genes that just a moderately good filter, but in fact a very good filter have a match in the for the genes Susan is interested in." genetic code of C. elegans, that might Dutcher then searched for matches between the genes let us highlight genes found by the comparison and known human genes for for proteins that create cilia and basal bodies. She found that the research team's and control the move results had highlighted both of the genes associated with ments of cilia." juvenile polycystic kidney disease and five of six genes Mark johnston, PhD, pro linked to Bardet-Biedl Syndrome (BBS), a rare genetic fessor and head of the departmen t condition that causes blindness, menral retardation, of genetics, says Dutcher's results have other geneticists severe obesity and other problems. excited about the possibility of using similar comparisons
Dutcher became intrigued by the possibility that the [0 idenrify genes that carry out important functions or comparison's results might help scientists identify new contribute to human diseases. disease genes. She learned that scientists had narrowed "What's so heartwarming about this result is how the hunt for a seventh BBS gene down to a large region vividly it illustrates the value of basic genetic research in on human chromosome 2. However, that region had these model organisms," says johnston. "There are quite
approximately 230 genes, far [00 many for scientists to a few scientists now thinking about how we can use this examine on a one-by-one basis. approach in other contexts." 0
20 Strands of life Fall 2004 Outlook
__ INCE HER EARLY 20s, Donna Kurowski The innovative procedure is a m.inimally invasive treatmelH for a has barried pain, swelling and pressure in her legs condition called superficial venous from varicose veins - (Or(uous, rwisred and painful reflux, which causes pain, swelling veins wirh poorly funcrioning valves. and varicose veins. As a staff nurse ar the university's Pain The condition can be precipitated Management Center, Kurowski actively works wirh by genetics, age, pregnancy, traumatic injury and can occur in people with chronic pain patients. She also has a lO-year-old son professions - nurses, chefs, waitresses, who keeps her busy. Although prolonged standing hair stylists - that reg uire prolonged would trigger intense pressure and pain, Kurowski standing. never let the condition interfere with life. The NIH estimates that nearly "I didn't let it limit my acrivities," she says. 25 million people in the United States suffer from complications of pro "I learned (0 make adjusrments and find ways (0 longed venous reflux. Studies reveal elevate or reposition my legs. Or, I'd just deal that 41 percent of American women with the pain." may have varicose vein disease by the Jeffrey Petersen, MD, assistant professor of time they reach their 40s and 50s. Symptoms include pain, fullness, medicine, wanted (0 help Kurowski improve her heaviness, aching, visibly enlarged quality of life and suggested that she undergo the veins, swelling, skin discoloration VNUS closure procedure (0 creat her varicose veins. and ulcers around the ankles. Normally, veins carry blood from Afan-shaped catheter delivers radiofrequency the extremities toward the heart. In energy to the vein wall in a minimally invasive varicose veins, the blood flows back treatment offered by Jeffrey Petersen, MD. ward, resulting in pooling of impure and acidic blood that contributes to multiple medical pathologies. "People mistakenly think the pro cedure is cosmetic, but many patients arc very unhappy due to the pain and discomfort," says Petersen, who now performs about 20 closure procedures monthly. "Patients often don't realize it's a medical condition that's usually covered by insurance." The VNUS procedure uses radiofrcquency or laser heat placed directly into (he wall of the saphenous vein, which runs from the ankle to the groin. Over time, faulry valves in the saphenous vein can result in unattract ive, bulging and painful varicose veins. The radiofreguency or heat causes the vein wall to collaps , cutting off the source of blood. The VNUS procedure became epinephrine (a drug that contracts available in the United States in blood vessels) helps reduce blood 1999 as an alternative to traditional loss and postoperative bruising while vein stripping, the surgical removal providing anesthesia. I~irst, Petersen of veins frol11 the leg. Vein stripping patients who underwent the closure inserts a thin catheter in the dam usually requires general anesthesia, procedure had bener outcomes. aged vein through a sma.ll incision.
~ an extended hospital stay and a long "There's a dramatic difference," Using an ultrasonic guide, the cath recovery, and it causes significant Kurowski says. "A week after the clo eter is manipulated up the vein, and swelling, bruising and pain. sure procedure most of my bruising radiofrequency energy is delivered Kurowski had vein-stripping was gone, and the pain and pressure to the vein wall, causing it to heat, surgery in 2001 . "Recovery from the in my leg was considerably better." collapse and seal shut. procedure was really painful, and Petersen says that European Once the diseased vein is closed, studies have shown that more than healthy veins take over, and normal Nearly 25 million people in 91 percent of legs treated with blood flow returns to the leg, allow the United States suffer the VNUS procedure were frec of ing the swelling, pain and discolor venous reHux, the underlying cause ation to noticeably improve. complications of prolonged of varicose veins, two years later. After the procedure, a compres venous reflux "There is little, if any, pain sion garmenr is worn for several with the closure procedure - most weeks to aid healing. Patients can I was very bruised," she says. "By patients don't require oral sedation resume normal activities in one to nighttime I was exhausted from the for relaxation," he says. "They can twO days but must refrain from pain and pressure, and I couldn't go get up and walk out of the office strenuous activities, prolonged stand back to work for two weeks." after the procedure." ing and heavy lifting for a few weeks. Last year, a study in the Journal Petersen performs the closure JUSt days after her procedure, o/Vascular Surg;er)1compared vein procedure at Washington University's Kurowski felt considerably less pres stripping and the VNUS closure Center for Dermarologic and sure and pain in he.r leg. And while procedure by evaluating procedure Cosmetic Surgery in West County. she didn't undergo the closure pro related complications, overall patient During the procedure, a mix cedure for cosmetic reasons, she was
recuperation and quality-of-life ture of intravenous saline solution, certainly happy (0 see bulgy veins and issues. In every measurable category, lidocaine (a local anesthetic) and pigment discoloration disappear. 0
The solution has legs: VN US procedure works for varicose veins and ulcers In addition to eliminating unsightly up undergoing multiple costly therapies in Before and during the procedure, and painful varicose veins, the VNUS an attempt to alleviate symptoms. ulcer patients wear a device called an procedure provides relief for venous leg Petersen is researching the use of Unna boot which presses on the skin ulcers, painful lesions that result from the VN US procedure to treat both ulcers and helps keep the wound closed. varicose veins and can cause eczema, around the ankles and venous changes "Many of these patients have other inflamed skin conditions and to the leg. The study aims to stop those dealt with chronic leg ulcers for five permanent scarring . changes from occurring and to decrease to 10 years and are very unhappy," Standard treatment for leg ulcers the frequency of ulceration. Petersen says. "We can resolve this is compression bandaging combined Petersen's research reveals that condition with VN US closure, and with anti-bacterial dressings over a patients who receive the closure proce many times patients will not need to period of 12 to 24 weeks. However, dure for ulcers experience an 80 to 90 see a physician for further treatment, many patients fail to respond and end percent reduction in ulcerations. which makes it very rewarding:' Complementary woman, had trouble finding an aca in marriage demic position, the Coris decided to emigrate to the United States. and medicine: Carl accepted a position as a The legacy of biochemist at the State Institute for Carl and the Study of Malignant Disease in Gerty Cori Buffalo NY in 1. 922. Gerty joined him six months later, taking a posi tion as an assistant pathologist. The two were never apart again profes sionally. At the beginning of their tenure there, the Coris encountered
opposition (0 their working (Ogether. Gerry was told she would lose her - job if she strayed from her labora tory in the pathology department. Soon, however, their colleagues came
(0 understand and respect the Coris'
wish (0 work together.
In 1931, Carl was offered the chair manship of the pharmacology department at Washington University School of Medicine. In 1946, he switched departments, becoming chairman of biological chemistry. Carl Cori and Gerty Radnitz shared much in common. The years in St. Louis were produc Both were born in 1896; both came from families that were Austrian tive and rewarding for the Coris. in origin but had lived in Prague for generations. When they met in They were able to collaborate on research, doing seminal work in the their first year of medical school, they found other things they had in mechanism of glycogen utilization. common: a love of research and an enthusiasm for mountain climbing. And they liked St. Louis, so much The two first met in 1914 - at At the end of the war, Carl and so that they turned down prestigious the beginning of World War I - when · Gerry were reunited. They received offers from Harvard, Berkeley and they entered Carl Ferdinand University . their medical degrees in 1920. That the Rockefeller Institute. The Coris in Prague to study medicine. In 1916, same year the young couple was were supportive of the many scien Carl was drafted into the Austrian married in Vienna, where they were tists who flocked to their laboratory army. His experiences in a barracks pursuing postdoctoral studies. Carl in St. Louis to study and work with that served as a hospital for infectious . wrote many years later that "life in them. All were invited to take parr diseases left him gloomy about the Vienna had its compensations," but in the daily brown bag lunches in ability of docrors to control disease. in fact it also had its deprivations, the library, where the conversation He wrote, "the influenza epidemic, and Gerty developed symproms of included current research interests with its high mortality rate among xerophthalmia, a condition caused but also might touch on a raft of the poorly nourished SO'liders and by vitamin A deficiency. Because non-scientific subjects. civilians and the inability co be of any . of the difficulty of life in Europe Most visitors were impressed help, came as a great shock to me." and because Gerty, as a Jew and a by the depth of their interests and
24 Historic Outlook Fall 2004 Outlook knowledge. The Coris had many friends in St. Louis, a modern house Cori research illuminated metabolism and a garden in which (h ey divided (he labor (she grew (he Bowers; he arl and Gerty Cori spent more tion of glucose and its conversion to gly rai sed (he vege(ables). T he Co ri s also than three decades exploring cogen in m!Jscle, as well as in the liver. read widely. Gerry was imeres (ed in C how the human body metabolizes Epinephrine, or adrenaline, worked in his(Ory, biography and modern fic(ion, glucose. It was known in the 1920s that reverse, decreasing muscle glycogen and while her husband was knowledge faulty sugar metabolism could lead to liver glycogen. Since other researchers able in archaeology, poeny, and an . diabetes, and it was also known that had established that muscle glycogen Carl was also a poe( and Bu em in insulin kept the disease in check. The does not contribute significantly to blood German, French, Iralian, and English. effect of insulin on blood sugar levels glucose, the Coris concluded that muscle had been observed, but scientists did glycogen must form an intermediate It was a truly collaborative relationship, not understand the biochemical mecha substance that then circulates through as rela(ives and fo rmer colleagues nism behind insulin's effect or how the blood to the liver. The Coris theorized (es(ify. David M. Kip nis, MD, carbohydrates were metabolized. - and eventually demonstrated - that Dis(inguished Universiry Professor of Sugar metabolism supplies energy this intermediate was lactic acid and was medicine and of molecular biology for life's activities. The human body is integral to the "cycle of carbohydrates," and pharmacology, says: "They were unable to make the slightest muscular or the "Cori cycle:' a remarkable pair. Gerry would have movement without burning sugar. In the In the 1930s, the Coris found a new Aigh(s of fan cy. She'd come up wi(h 19th century, the great French physi intermediate of glycogen breakdown, ex (r
abili(y (0 pur (h em imo concre(e cogen, the starch-like substance found 1-phosphate, known as the "Cori ester:'
ques(ions (0 answe r. And (herefore, in muscles and the liver. Glycogen is Working with Sidney Colowick, the Coris as a (earn , (hey were exuaordinary." the polymeric storage form of glucose, established the compound's structure Their so n Tom says his mo(her and when energy is needed, glycogen and discovered the enzyme that cata had (h e ideas; (h en (hey borh would is converted by the body into glucose. lyzed its formation, which they named
go in(O (he labora(Ory (0 execu(e (he This mechanism keeps the glucose level phosphorylase. In addition, the Coris idea or disprove it. in the blood constant even though the demonstrated that the reversal of the Carl summed up (h e narure of supply is uneven. phosphorylase-catalyzed reaction pro (heir parmership in his remarks a( The interplay between glucose and duced glycogen, the first time a biologi (h e 1947 Nobel banquer: "Our col glycogen is at the heart of what is cal macromolecule hadl been syn thesized labora(ion began 30 years ago when known as the "Cori cycle:' The Coris in a test tube. The Coris, in collaboration we were s(ill medical srudems a( (h e found that insulin increased the oxida with Arda Green , crystallized the enzyme Universiry of Prague and has con glycogen phosphorylase from muscle I (inued ever since. Our efforts have and investigated its chemical properties. Ii been largely complememary, and one The Coris' path-breaking research ~ &; ;. wi(hou( (he o(her would nor have resulted in their sharing the Nobel Prize i ;;;... gone as far as in combina(ion." in Physiology or Medicine in 1947 with .ll Bernardo Houssay of Argentina . The 1B Nobel committee cited the Coris "for Celebrating the Cori legacy: Washington their discovery of the course of the University in St. louis Chancellor Mark S. i.s Wrighton accepts a plaque designating the catal,ytic conversion of glycogen" and ~ former Cori laboratory as a National Historic Houssay "for the discovery of the impor- I tance of the anterior pituitary hormone 1; Chemical landmark. The official recognition, ~ 2:' which took place on Sept. 21, 2004, was for the metabolism of sugar:' ~ ~ ~ bestowed by the American Chemical Society. ------~. £
Outlook Fall 2004 Historic Outlook 25 ... BY RUTH BEBERMEYER
H ghlighting the accomplishments ofstudents, medical graduates, current andformer house staff, andfaculty who embody the School ofMedicine's unbrolun tradition ofexcellence.
He describes the experience as "tremendously rewarding .. . Man of many passions life changing." He is passionate about his woodworking hobby: John Crane, MD 64, and his wife, Carol, have lived "I've done carvings of smaJl birds, larger Jbstracts of in a pre-Civil War stone house on a small farm near wildlife, built model boats, etc. For the sculptures, I use Washington MO (population 14,000) since he opened 'found wood' from the farm ... walnut, oak, wild cherry, his practi ce there in 1975. After psychiatry resid ency apricot. They're fun, but I fel t like I was 'coming home' at the University ofIowa and Washington University, when I went to the Wooden Boat School in Maine last Crane served fWO years as a captain in the U.S. Air yea r... I'm currently building a l2-foot sailboat of Force, then spent five years on the staff of a large western red cedar strips over oak ribs, keel and stem. mul tispecialty clinic. Living in a semi-rural area had It's my first m ajor project, thus a learning experience, more appeal to the Cranes; Carol had grown up nea r and a whole lot of fun. I think it will Boat, and maybe Washington, and they decided to move there. even sail, when done!" A Distinguished Fellow of the American Psychiatric The Cranes met and married while he was in Association, Crane has a solo practice in Washington, medical school and she was a nurse at Barnes Hospital. is medical directOr of Family Well ness Clinics in Union They have three sons: John II, an optometrist and faculty and St. Peters, and consul ts monthly at the nearby member at the University of Missouri-St. Louis; David, Emmaus Home for the developmentally disa bled. an emergency room physician; and Christopher, a ''I'm one of very few shrinks in this area," Crane says, computer englIleer. "so by need I see almost anyone who comes through the door. . . this kind of practice has been very gratifying. An outstanding student I love to hear the stories people have to tell , and you never know what's comi ng nex t. " Crane participates in medi In 2002, the year he started medical school, Kyle Eash cal missions with the was one of only 20 students in the country named to WashingtOn Medical-Dental the USA Today All-USA Academic Team. That led to Construction Brigade and h is selection as one of 200 outstanding students from has made three trips to 40 countries to participate in the American Academy of Honduras, serving the Achievement's 2003 International Achievement Summit vcry poor. The first in Was hington DC. The four-day annual gathering time he was "on the brings together the brightest youth with leaders in poli constructIOn crew, tics, science, history and art (the likes of Colin Powell, mainly carrying heavy Sandra D ay O 'Connor, Desmond Tutu, HermanWouk). Stuff. The next twO Eash says it felt "surreal to be interacting on a personal trips I was a general level at meals and social events with people I usually medical doc. .. we only saw on TV." He was especially impressed by generally saw more Dr. Francis Collins, director of the National Human than 1,000 patients Genome Research Institute. on a 10-day trip." Eash is spending this year as a Howard Hughes Research Fellow, learning whether he prefers the "accom John Crane, IVID 64, plishment of discovering so meth ing new that could with his wife, Carol. eventually lead to better patient care for many patients,
Fall 2004 Outlook or the accomplishment of using and Health Committee ofWashington Physicians for already discovered knowledge I Social Responsibility and was a lead organizer for the have learned to improve the health Transportation and Global Warming Conference held in of individual patients I come in Seattle in May 2004, which drew nearly 300 attendees. contact with." In 2003, he was Her interest in environmental issues was kindled at a summer research student at Reed College in Portland OR, where she earned a BA the Siteman Cancer Center, sup in philosophy. As a medical student at Washington ported by grants from the Center University, she participated in the St. Louis Medical and the American Cancer Sociery. Committee for Human Rights activities concerned with Kyle Eash, WUMS III Before medical school he held a lead poisoning and Vietnam \X/ar isslles. resea rch inrernship at Praecis Pharmaceuticals, Inc., in Kitchell specialized in psychiatry because she Massachusetts. He first experienced the "satisfaction of a "liked getting to know people's stories with the longer successful experimenr, the frustration of a difficult one, visits that psychiatry allowed." While completing her and the rewards of seeing my work published," in the psychiatry residency and fellowship in geriatric psychiatry organic chemistry lab at Illinois Wesleyan University, at the University ofWashington, she lived in a collective where he majored in business and biology. house, also the home of a business in solar and alterna He was also a three-year football letterman, quar tive energy. Later, het concerns that the United States' terback and co-captain of the 2001 College Conference dependency on oil embroiled us in the first Gulf War of Illinois and Wisconsin co-championship team and led to her increasi ng involvement in transportation member of the track team, and he received the 2002 issues, "hoping to encourage walking, bicycling and Walter Byers Postgraduate Scholarship from the National transit as cleaner, sustainable and more efficienr modes. " Collegiate Athletic Association. T he $25,000 award is Such lifes tyl e changes, she says, help reduce health given annually to one male and one female studenr threats that range from global warming to the currenr "who has combined the best elemenrs of mind and body epidemic of obesity. to achieve national distinction ...and ptomises to be a Kitchell takes the bus to work (her clinic is in future leader in his chosen field." Lynnwood), often rides her bike for transportation, and A leader in studenr community service groups, usually walks at least one or tWO miles a da y. She and her Eash has coordinated the Saturday Neighborhood Health husband, Jack Buchans, a video producer and part-time Clinic and the Community CPR group and taught transit operator, own a hybrid Toyota Prius and have public school srudenrs in the Drug Education Project, days when they don't d rive at all. the Reproductive Health Education Project, and STATS Their daughter graduated recendy from Fairhaven (Students Teaching AIDS to Students). College of Western Washington University and has a position with Americorps, working with you th. Their Advocating for health son is a senior at the University of Oregon, majoring in geography.
Margaret Kitchell, MD 74 It might be said that, as a psychiatrist, Margaret Kitchell, _ ...... MD 74, focuses on heads and, as an environmenralist, focuses on feet. Either way, she expresses her dedication to improving health. A specialist in geriatric psychiatry and a Distin guished Fellow of the American Psychiatric Association, Kitchell is a staff psychiatrist with Compass H ea lth, a ne(\'Vork of menral health service clinics north of Seattle. She is a Iso secretary of the board of Feet First, a mem ber organization of America Walks, a coalition of local pedes trian advocacy groups. She co-chairs thei-nvironment
Outlook Fall 2004 Alumni & Development 27 BY DIAIE DUKE WILLIAMS Faithful stewardship Pediatric immunologist devotes self to children, university
illiam T. Shearer, MD 70, PhD, that were involved in the discovery of speaks with admiration as he the gene defect David had. recalls the valiant struggle of his "It was a unique experience, and I patient David Vetter, the well- was fortunate to be involved," Shearer known boy who was born without says, adding that watching the field of an immune system. David spent 12 years immunology explode has been extraordi in a plastic bubble and never knew human nary. "Scientists now have identified 100 contact. gene defects." But in his world of isolation, David's David was a special patient, but only spirit touched many. one of thousands who have benefited "He was a wonderful, cheerful child from Shearer's skill as a doctor. He has who had a 'go get 'em' attitude," Shearer been professor of pediatrics and immu recalls. "And the whole world learned nology at Baylor College of Medicine in immunology from this boy." Houston and chief of the Allergy and Shearer provided National Institutes Immunology Service at Texas Children's of Health scientists with transformed cells Hospital since 1978.
William T. Shearer, MD 70, PhD
28 Alumni & Development Fall 2004 Outlook Shearer also directs the HIVIAlDS Researcb Center When Shearer told then-registrar William Parker of at Baylor and has made enormous contributions to the his interest in immunochemistry, Parker introduced field of immunoglobulin gene activation in HIV in~ection. Shearer to his son, Charles W Parker, MD 53, PhD, an Nationally, he is a member of the Leadership Group of assistant professor of medicine at the timc and allergist and the Pediatric AIDS Clinical Trials Group, an I8-center immunologist. The meeting produced serendipitous research group devoted to the study of amiretroviral and results - Shearer then worked for Charles Parker during immune-based therapies in children with HIV hi s fourth year of medical school and during a postdoc "Bill wrote more published papers as a pediatric resi toral fellowship in pediatric allergy and immunology. dem than many good doctors produce in their careers," Shearer specialized in pediatrics for a number of reasons, says James P. Keating, MD, the W McKim O. Marriott one of which was the honesty of children. "Pediatrics is Professor of Pediatrics, who trained Shearer at St. Louis fun," he says. "You're treating people who have no pretense." Children's H ospital. "His imellectual and expository He also jokes that he chose the specialty because ski lis have allowed him to rise to posi tions locally and he has six children - a biological daughter and five nationally where hi s inAuence has been of great value to adopted sons - between the ages of 34 and 46. younger physicians and colleagues. " At the School of Medicine, Shearer says he learned "The way Washington University to look beyond the immediate facts to get to the hea rt of the matter. "I also learned to push myself to the extent of has risen to the top is astonishing, my knowledge," h e says. In gratitude to the School of Medici ne, Shearer and and the world has recognized if' his wife, Lynn D es Prez, have made a beques t to endow WILLIAM T. SHEARER, MD 70, PHD the William T Shearer and Lynn Des Prez Professorship in Pediatrics. They also have established the William T...... Shearer and Lynn Des Prez Underrep resemed Minorities After clinical training at Sr. Louis Children's Hospi tal Scholarship. and Barnes Hospital, Shearer joined the Washington Lynn Des Prez, who resides in Philadelphia, is the University faculty in 1974. H e was promoted to profes administrative director of the American Board of Allergy sor of pediatrics in 1978 before leaving for Baylor. and Immunology. Not long after Shea rer moved to H ouston, the "The way Washington University has risen to the AIDS epidemic hit. Under his guidance, Baylor was top is astonishing, and the world has recognized it," one of the leading hospi tals in decreasing mother-to says Shearer. "To be parr of Washington University is infant disease transmission by giving babies the drug ve ry important to us." AZT Shearer also conducted trials to prove that Shearer grew up with a brother and two sisters in protease inhibitors could help children with HIV a middle-class family in Dw·oi t. Later, his parents sem Shearer serves as a member of the \'<1ashington him to Passionist Preparatory Seminary in Sr. Louis, University Medical Center Alumni Association and a large Catholic high school that stood where the received a Washington University Distinguished Alumni University of Misso uri- Sr. Louis is located today. Award at Founder's Day in October. H e has been "Sometime in high school, I decided I wanted to active through the years in alumni leadership roles in be a doctor," Shearer says. "It was very appealing to me Houston. because the profession seemed to have few boundaries." Philanthropist Robert S. Brookings and others, After majoring in chemistry and biology at the Shearer says, inspire him in hi s commitment to University of Detroit, Shearer decided to pursue an MOl Washington University. "Brookings gave most of his for PhD at Wayne State University. He went to med ical school rune to the university, and look at how many times that there for one year and then pursued a PhD in immuno has multiplied in helping people who want ro do good chemistry, which he earned in 1966. He chose to finish in the world," he says. "I know that whatever I can medical school at Washington University School ofMedicine. leave to the university is going to live on forever."
Outlook Fall 2004 Alumni & Development 29 Alumni Association hears from students
thOUgh alumni activities, by definition, imply a WUMCAA Officers and Members 2004-2005 graduation date, this yea r's alumni association 4meetings more often than not featured input from PRESIDENT Edward P. Rose, MO 71 those whose degrees are still a work in progress. James W. Fleshman Jr., MD 80 Medical stUdents made pitches to the Washington Marlys E. Schuh, MO 79 University Medical Center Alumni Association to garner PRESIDENT-ELECT Donald A. Skor, MO, HS 84 funding for their favorite community service programs. Janet M. Ruzycki, MO 81* Garry S. Tobin, MO 85, HS 90 Months later, they reponed on these and other activities, Alice W. Trotter, M0 69 painting a pi cture for the Executive Council of the VICE PRESIDENT myriad outside interests juggled by this year's students. Jeffrey L. Thomasson, MO 82* oUT-oF-ToWN MEMBERS Throughout the dis Susan Bennett, MO, HS 91, cussions, fourth-year class TREASURER WUMCAA Fund Washington OC* presid em Jason Stephenson, Allocation 2003-2004 Marlys E. Schuh, MO 79* an ex-officio member of the Mark J. Lucarelli, M0 91, Total: $295,982 Executive Counci l, voiced PAST PRESIDENTS Madison WI* the student perspective. J. William Campbell, MO 71 Colin McDonald, M0 93, By the end of its term, Boston MA* the 2003-2004 Executive Carlton S. Pearse, MO 78 Jon Morris, MO 92, Council had allocated more Brent T. Allen, M0 79 San Diego CA* than $295,000, all of it addressing students' needs LOCAL COUNCIL William T. Shearer, MO 70, in some way. A longstanding MEMBERS Houston TX* commitment to scholarship Elliot E. Abbey, MO, HS 80* EX-OFFICIO MEMBERS support cominued, some Edward F. Berg, M0 64 $160,000 this year. Ian Dorward, Fourth-Year Kim O. Colter, MO 78* Class President Distinguished Alumni A payment of $70,000 Scholarships brought the Executive Mark E. Frisse, M0 78 W. Edward Lansche, M0 52 Council closer to fulfilling • Farrell Learning and James W. Forsen Jr., MO 88* Larry J. Shapiro, M0 71, Dean Teaching Center its 10-year, $750,000 Eleven student organizations commitment to the Farrell James M. Goldring, M0 86 Emily L. Smith, MO 68 and community service projects Learning and Teaching J. Michael Hatlelid, MO 71* Morton E. Smith, MO, HS 64 Other student-related Cen ter, which will upgrade Katherine L. Kreusser, M0, Alison J. Whelan, MO 86, activities the spaces for students to HS 82 HS 89 Primary care pre ce ptorships learn, study and gather. Primary ca re preceptor Amy Sullivan Nordmann, M0 99 * Newly elected ships received funding, as Timothy C. Philpott, MO 94* did a graduation reception and other efforts designed to round out the medical school experi ence. Led by President Brent T. Allen, MD 79, the Distinguished Alumni Scholarship Honorees Executive Council set its sights on outstanding alumni, selecting candidates to receive alumni achievement awards Sidney Goldring, MO 47 Donald Sessions, MO 62 and identifying others after whom to name scholarships. Maurice Lonsway, MO 50 Larry J. Shapiro, MO 71
30 Alumni & Development Fall 2004 Outlook BY ANNE ENRIGHT SHEPHERD
A legacy of learning New WUMCAA president
the new president of the Flesh man special izes in treat Washington U niversity ments for colon and rectal cancer, ~ Medical Center Alumni inflam matory bowel di sease and Association, James W. Fleshman Crohn's disease and has published J L , MD 80, notes that payi ng for more than 90 articles on topics medical school gets more chall enging including minimally invasive colon with each passing year. and rectal surgery. When he travels "To date myself, the tuition dur for committee meetings, he notices ing my first year of medical school that representing Washington was $5,000, and I thought that was University brings instant recognition. going to break the bank," Fleshman "I rea ll y enjoy seeing the value says. "I could mow yards or work in of my d iploma go up every year, and a lab and come up with in co me to I think the al umni association has get my education covered ." helped that, " he says. "We attract Today's studen ts rely on scholar the best medical students, no ques ships and financial aid, provided in ti on. Our scholarship programs have large parr by alumni. James W. Fleshman Jr., MD 80 made a difference." "In the best of al l worlds, I think To Fleshman, teaching and men tuition to medical school would be A New Orleans native, Fleshman toring m edical students and residents free, and we would all owe some earned a bachelor's degree in biology are valuable pursuits.
thi ng back to society to pay for that from Washington University, gradu "The only way [0 really see that education," Fleshman says. "Bur it ating summa cum laude. After medical you have succeeded in your profes may not happen in my lifetime." school, he completed an internship, sion and your career is to actually Leav in g nothing to chance, residency and fellowship in surgery duplicate yourself- to leave a legacy Fleshman, professor of surgery at the at what was then Jewish H ospital, of people you have trained or helped School of Medicine and chief of the serving as chief resident in 1985- 86. through their education," says Section of Colon and Rectal Surgery, A fellowship in colon and rectal Fleshman. "That's the motivation leads al umni activities, supports surgery at the University ofToron[O behind the academic side of my life Scholars in M edicine, and encour followed. H e joined the School of and why I volunteer for the Eliot ages other graduates to get involved. Medicine faculty in 1987. Society and alumni association."
If you receive mail from the School of Drost also works closely with each year's Drost Medicine, odds are Scott Drost now has reunion gift chairs as well as supporting something to do with it. As the school's new the efforts of the School of Medicine Eliot named director of annual giving, Drost works with Society'S membership committee. annual volunteers like the Annual Fund chair to "get Aresident of University City for the word out" to thousands of alumni and more than 15 years (his wife, JoAnne, is . . Washington University School of Medicine an alumna of the School of Art), Drost Scott Drost giving supporters - often through the mail. joined the Office of Medical Alumni and director "Connecting the dedication of our volun Development Programs in 2003. He holds teers and the enthusiasm of the WUSM com a bachelor's degree in English and a cer munity is a recipe for success," says Drost. tificate in writing from the University of "I feel fortunate to be part of the equation:' Missouri - St. Louis.
Outlook Fall 2004 Alumni & Development 31 ,I~ ==~~~~~------~------~~- r
I' I ! i I I i r f Abanner year! nnua I I I· i ! unks [Q the generous support from al umni, former house staff, and friends, the School of un T;Medicine's annual fund drive ended as one of the most successfu I years on record! F[Qm July I , 2003 to Alumni Results by Program June 30, 2004, more than $2.7 million was raised from PERCENT PARTICIPATION JULY 1, 2003-JUNE 30,2004 7,159 donors, supporring imporrant programs through out the School of Medicine, MD Alumni 42% The yea r would not have been such a success with Physical Therapy 32(Yc) out rwo special annual fund challenges: In February, an anonymous Health Administration 31% donor offered the Fives Challenge Nursing 29% - matching all gifts that came in during the last five months Occupational Therapy 24% of the academic year with $500 Former House Staff 21 % (or $1000 for Eliots), up [Q $500,000. More than 1,900 individuals participated in this Records and highlights challenge (with gifts ranging • The Eliot Society (gifts of $1 ,000 or more) set a record from $5 - $10,500), surpass ing the goal of the $500,000 in new and renewed members: 216 and 602 res pec match. In the end, $500,000 in matching funds were tively. The previ ous records were 182 new members directed [Q the Farrell Learning and Teachi ng Cenrer. in 1998 and 573 renewed members in 2003. In honor of his 45[11 medical • MD alumni annual giving su rpassed $1 million for reunion, Chuck Norland, MD 59. the second consecutive year. issued a special challenge [Q his • Former house staff participation and doJl ars were at class, matching each percenr of a four-year high: 20.9 percent and $243,933. participation with $100 of his • Health Administration Program alumni se t a new own. The Class of 1959 ended record for generosity to their Annual Fund, making the year with a 75 percenr partic nearly $46,000 in gifts! ipation rate - the highest • Three hundred forty-three nursing al umnae made Charles C. Norland, MD 59 among this year's reu nion cl asses. gifts this year - a record participation rate. • The Program in Occupational Therapy increased its Reunion 2004 participation ra te from last year. More than $2.6 million was raised from classes celebrat ing reunion in 2004 (including both restricted and Newest alums make a difference unrestricted gifts). The classes of 1954, 1964, 1969, and • T he MD Class of 2004 es tablished a gift [Q accom 1974 conrinued their efforts [Q raise additional funds pany each year's Residenr/Fellow of the Year Awards for their endowed class scholarships. The Class of 1979 for the next five years. Nearly 50 percent of the class launched an effort [Q es tablish an endowed scholarship participated. in honor of its 25,h re union. Under the leadership of • The Program in Physical Therapy's Class of 2004 Brenr Allen, MD 79 and Jeffrey Cichon, MD 79, the continued the you ng alumni gift effort begun by the Class of 1979 raised nearly $18,000 in gifts and $49,000 prev ious cl ass - perhaps launchin g a new tradition . in pledges [Qward the project.
32 Alumni & Development Fall 2004 Outlook Carl Rosenbaum, MD 27, health. He still se rves on the Health advises patients on the workings of was featured in an Department's Food Advisory Council , medical facilities and how to navigate 20Sarricle in th e Arkansas which oversees restaurant and food today's medical maze to receive the Democrat-Gazette, noting that he cele processing li censes. An advocate for best medical care. Gallin practices brated his 105th birthday on May 18, older peopl e, Prothro was the first and teaches at Columbia Presbyterian 2004, at Presbyterian Village in Little chairman of the Tulsa County Medical Medical Center and Columbia Rock. Members of Grace Presbyterian Society's Concerns of Older Tulsans University College of Physician s and Church there honored him at a lun Committee, which started a drug recy Surgeons, where she is director and cheon and his family hosted a party in cling program through which unused associate professor of ped iatric oph his honor. Rosenbaum retired from his prescription drugs from nursing homes thalmology at the Edward S. Harkness private surgery practice in Little Rock are made available to the poor. Eye Institute and also associate profes at age 70. He commented that his Frank B. Norbury, M0 48, represented sor of pediatrics at Children's Hospital family is blessed with longevity and Washington University at the inau of New York. Gallin's earlier book that he has a cousin who is now 107. guration of Axel D. Steuer, PhD, as was titled The Savvy Moms Guide to the 13th president of Illinois College, Health Care. Benjamin Milder, MD 39, Jacksonville IL, on April 17, 2004. has a new book of Raymond J. Tesi II, IVID 82, 30Sverse, The Zoo You Muriel Kreyling MacKallor, has joined Cellerant Never Gnu, a Mad Menagerie of OT 53, of Mililani HI 80STherapeutics, Inc. , in Bizarre Beasts and Birds, published 50 Swrites that she is Palo Alto CA as executive vice president by Time Being Books. Milder's zoo "retired and enjoying Oahu. The local of clinical development and medical includes xiphias, hackee, zebu and alumni group recently had a terrific affairs. Tesi will lead the development urubu, animals presented in the form program." of cell-based therapies for autoimmune of a poetic palindrome with names diseases and cancer. He is known for ranging from A to Z and back. Joshua Grossman, MD 65 , his work in solid organ trans plan tation wri tes tha t he "served and has been active clinically in kid Stanley S. Kahn, MD 43 60Sas visiting professor in ney, pancreas, liver and small bowel (March) , is the author the Department of Surgery on April transplantation. His earlier positions 40Sof a paper on the late 15, 2004, at the University of have included se nior vice president of Dr. Ralph Major, a prominent medical 'lcnnessee Knoxville - Surgery Gra nd clinical development and medical historian, published in the Winter Rounds - Surgery Tall Tales. " affairs at SangStat Medical Corporation 2004 issue of Pharos, the journal of Grossman is a member of the clinical and associate professor of surgery and Alpha Omega Alpha. Kahn practiced faculty of East Tennessee State director of the extra-renal transplanta internal medicine and endocrinology University in Johnson City. tion program at Tulane Medical in Birmingham AL for many years Robert J. langlais, MHA 75, School in New Orleans. before he and his wife moved to Jeffrey l. Thomasson, Mil 82, and president and CEO of California to be near their children. Ronald R, Townsend, MD 82, were the Cheshire Medical Both are active in volunteer work, ~oS inducted as Fellows in the American Center in Keene NH, has been and he is servi ng his third year on th e CoJJege of Radiology (ACR) at the awarded Life Fellow Status by the Berkeley City Health Commission. formal convocation ceremony dur American College of Hea lthcare George Prothro, MI] 45, was ing the ACR's annual meeting in Executives. He has been a member for honored with the Leadership Award Washington DC in May. Thomasson more than 30 years. This is a special from the Retired Senior Volunteer is affiliated with St. Johns Mercy Program of Tulsa OK at a dinner on recognition for exemplary lead ership in health care, advancing the profes Medical Center and St. Louis May 14,2004. Prothro, who retired University School of Medicine, and sion through published articles and from his position as medical direc has served as pres ident of the St. lectures, and public service. Langlais tor of the Tulsa City-County Health Louis Metropolitan Medical Society. pl ans to retire in November 2004 and Department in 1978, recently retired Townsend has affiliations with the from teaching at the University of reloca te to Arizona. Pamela F. Gallin, MD 78 , has Denver Hea lth Medical Center and Oklahoma College of Medicine, the University of Colorado Health authored her second book, How to where he developed a system for Sciences Cen tel' in Den ver, where Survive Your Doctors Care, publ ished training medical students in public he received the 2003 John C. Stears in 2003 by LifeLine Press. The book
Outlook Fall 2004 Alumni & Development 33 a tes
Outstanding Faculey Teaching Award. and assis tanr professor of medicine at He has served as presidell( of the the Universiey of Minnesota, where he IN MEMORY Rocky Mounrain Radiological Socieey. did his residency in internal medicine Richard Y. Sakimoto, MD 33, HS , of Only about 10 percell( of the ACR and where he won the Departmen t of Honolulu HI died April 26, 2004, at members are selected for Fellowships, Medicine's "Teacher of the Year" award the age of98. He was Hawaii's first based on service co organized medi in 1997. Since starting the HPMG&C board-qualified obstetrician/gynecologist cine, accomplishments in radiology, hospitalist program in 1997, Holman and had delivered more than 12,000 radiation oncology or medical physics, has expanded it to 30 physicians across babies. A native of Japan, he completed ourstanding teaching and reputation four hospital sites. He also founded his residency at Barnes Hospital before among colleagues. and directs the HealthPartners open ing his practice in Honolulu in Michael P. Joyce, HA 87, assumed his Fellowship Program in hospital medi 1938. During his career he served on duries as president of HCA's Southeast cine. In 2002, he was the recipient the faculey of the John Burns School of Division in Atlanta GA on July 1. He of th e SHM awa rd for "Outstanding Medicine at the Universiey of Hawaii has operational responsibiliey for 19 Service in Hospital Medicine." and was chief of obstetrics and gynecol hospitals and 12 outpatient surgery Julie Lundberg Freiner, DT 94, ogy at The Queen's Medical Center. centers in Georgia, South Carolina writes that she and her husband, In 1983, he received a Distinguished and North Carolina. A Fellow of Tim, welcomed their second so n, Service Award from Washington the American College of Healthcare Tyler Jack. born April 15, 2004. He University's Medical Center Alumni Execurives, Joyce has been with HCA joins big brother Troy, who was born Association. Survivors include his for 17 years. June 19.2001. Freiner is a certified wife, Edna, a daughter, Eda, and a hand therapist who is co-owner of son , Richard. Stanley L. Hazen, MD, Rehab 1- Hand Therapy Network of William S. "Bill" Curtis, MD 40, HS 48, PhD 92, HS 94, has St. Charles Couney. The family lives of Boulder CO died April!' 2004, at been appoin ted head 90 S in Lake St. Louis MO. the age of 88. He was a radiologist of the Section for Preventive Cardiology Karen Good, PT 98, recen tly earned who had ,"vorked at Boulder Medical and Rehabilitation at The Cleveland her orthopaedic clinical specialist cer Center and the Universiey of Colorado Clinic, where he has been on staff tification from the American Physical Student Health Center. During World since 1997 in the Departments of Cell Therapy Association. She works at War II he served in the U.S. Army. Biology and Cardiovascular Medicine. the Kennedy Krieger Institure in A member of the American College of His research has helped co idenrify Baltimore MD. Radiology, Curtis was a past-president new markers for inflammation in Amy Malecki Rogers, MD, PhD 99 , of bo th state and local medical societies. patiell(s with heart disease and mecha writes "Finally, I have returned to His wife, Frances Elmer Curtis, died nisms of inflammation in airways work at least part-time. In the spring on April 8. 2004, at the age of 85. of subjects with as thma. Hazen is semester I taught at California State Their survivors include twO sons and professor of molecular medicine in Universiey (Sacramento), picking up a a daugh ter. the Department of Medicine of The microbiology and a molecular biology Robert B. Dickerson, MD 41, died Cleveland Clinic Lerner College of lab class. Yes, I can still do a miniprep! Ap ril 20, 2004, in Lompoc CA at the Medicine of Case Western Reserve Our move to CA last summer was a age of 92. He retired as a colonel in Universiey and adjunct professor in success, and we are happy here." the U.S. Army Medical Corps, having the Departments of Chemistry and served as chief of cardiology at Walter Biology at Cleveland State University. Rieke Baize, HA 00, has Reed Medical Cell(er and Consultanr to He lives in Pepper Pike OH with his been asked to serve the Surgeon General in Cardiovascular wife, Jackie Hazen, MD 89, a pediatri on the Healthcare 00S Diseases. During his military career he cian, and twO daughters. Executive ed itorial board for a term invell(ed the "Dickerson needle" which Russell Holman, MD 92, was ending March 2007. In April, she is still used in performing catheteriza installed as rreasurer of the Socieey received the Certified Healthcare tions. Among his survivors are his wife of Hospital Medicine (SHM) at the Executive credential from the American of 63 years. three so ns and a daughter. annual meeting held last April in College of Healthcare Executives, and Samuel E. Schechter, MD 41, died May New Orleans. Holman is associate in May she was the recipient of the 24, 2004, at the age of 87 after a long medical director for hospital services 2004 Early Career Healthcare Executive illness. He practiced in Clayton MO at HealthPartners Medical Group & Award presented at the annual meeting for many years and was an associate Clinics (HPMG&C) in Minnesota of the New Jersey Hospital Association. Baize lives in Maple Shade Nj. 34 Alumni & Development Fall 2004 Outlook professor of clinical medicine at Society, the Gerontological Sociery from 1982 until his death, he was also Washington University. He interned in of America and the International a professor of medi cine and pathology. internal medicine at Jewish Hospital, Association of Geronrology. He is As director of the Adult Hemophilia then served in the Army Air Force dur survived by his wife, Onrude "Ort" Treatment Center in St. Louis, he ing World War II, following which he Busse, and four children. initiated a program linking the center completed a fellowship in gastroen terol Frederick W. Klinge III, MD 42, died with a hospital in India, improving ogy at Michael Reese Hospital in June 23, 2004, in St. Louis at the diagnosis and trea tment there. The Chicago. In 2001, Schechter endowed age of 87. He was a general surgeon World Federation of Hemophilia the Samuel E. Schechter Professorship in Collinsville IL for many years and honored him with an award in 2001. in Medicine at Washington University. also had a strong interest in preven [n 2004, he received the St. Louis He also endowed the Rena Schechter tive medicine and physiology. Survivors University Hospital Caring Physician Memorial Lectureship in Cancer include four sons and five grandchildren. Award. Joist was married to Nancy Lee Research in honor of his first wife, who James C. lowe II, MD 56, died May Maxeiner, who survives, along with died in 1995, and the David Joel 4, 2004, at age 72. He had been a three daughters. Schechter and Leslie Schechter physician at Henry Ford Hospital in James 1. Shaw, MD 71, was killed Memorial Fund for Research in Detroit and West Bloomfield MI for in a hunting accident as he was tur
Depression in memory of [wo of their 38 years, had headed the divisions of key hunting in Gasconade County children, as well as [wo scholarships in preventive medicine, internal medicine MO on April 22, 2004. He was 58. Arts and Sciences in honor of his and executive medicine and served H e had been a family physician in daughters Miriam and Kay, who survive. as president of the hospital's medical H ermann MO for nearly 28 years, Also surviving is his wife, Norma board. As the hospital's representative, sharing an office with his uncle, Dr. Bonham, whom he married in 2002. he had a 36-year association with the George Workman, and was on the Memorials may be designated to provide Detroit Tigers. After residency, Lowe staff at the Hermann Area District scholarships for students at Washington served in the U.S. Army Medical Hospital. He was a lifetime member University School of Medicine. Corps in Frankfort, Germany. He was of the American Medical Association Ewald W. "Bud" Busse, MD 42, a a Fellow of the American College of and the American Academy of Family pioneer in understanding the human Physicians. A world traveler who had Physicians. Shaw is survived by his aging process, died March 8, 2004, at visited all 50 states and more than 50 wife, Kristen, [wo sons and a daughter. his home in Durham NC at the age countries on six continents, he was Tragically, Shaw's death mirrored that of 86. After completing a psychiatry also active in his home community. of his father, Dr. Carvel T. Shaw, who residency at the University of Colorado He was a talented musician and played was shot and killed in a hunting acci in 1948, he served on the faculty there clarinet in Washingron University's dent on Thanksgiving Day in 1967. before moving ro Duke University. At concert band as an undergraduate Craig Roberts, MD 83, an emer Duke he was the]. P. Gibbons Professor student. Survivors include his wife, gency physician at Tillamook County of Psychiatry and also served as dean Margaret, an alumna of Washington General Hospital in Tillamook OR, of the School of Medicine. He chaired University's School of ArtS and died December 27,2003, at age 46
the Departmen t of Psychiatry there Sciences, two daughters and [wo sons. when his van was struck head-on by from 1953 to 1974, establishing the Johann Heinrich Joist, MD, PhD, HS a drunk driver. His family survived. nation's first Center for the Study of 66, died February 13,2004, at his RobertS was a nationaHy recognized Aging and Human Development, home in St. Louis after a yearlong bat birder, having identified more than which he directed for 13 years. He was tle with mesothelioma. He was 69. A 800 North American birds. He taught the author of more than 200 scientific native of Germany, Joist came to this bird ing at several Oregon colleges papers and the editor of a number country in 1964 as a research fellow and universities, often organized and of books on gerontology. In 1985, at Washington University, served as an led birding trips, and had organized Duke University named the gerontol assistant professor of medicine at the the field trips for the 2003 meeting ogy building the E.W. Busse Building School of Medicine and later directed of the American Birding Association. in his honor. Busse was a member of the hemostasis and throm bosis labora Survivors include his wife, Crisanne, the Institute of Medicine and a past tory at Barnes-Jewish Hospital. He and three children. president of the American Psychiatric then became director of the division of Society, the American Geriatrics hematology and oncology at St. Louis University School of Medicine, where,
Outlook Fall 2004 Alumni & Development 35 il ------.------~~ I' i r
:1 A winning strategyfor your I· i ] II i" year-end tax and gift planning Find out how you can help yourselfand the University through a Life Income Plan
Consider a gift of appreciated securities or real estate - begin planning to: • Make a life income gift. • Receive a valuable charitable income tax deduction for 2004. • Transfer appreciated property to a life income plan and receive significant capital gains tax savings. • Turn low-yielding assets into attractive income through a gift annuity or charitable trust.
: . ' Gift Annuity Single life Double life age rate rJte Sample Rates age 60 5.7'Yc , 60 & 60 5.4(H, of Return 65 6.0')'<, 65 & 65 5.6'vo 70 6.5% 70 & 70 5.9% 75 7.1' Yc1 75 & 75 6.3% 80 8.0% 80 & 80 6.9%1 90 11.3% 85 & 85 7.9')1 , Looking for fixed payments? Consider the gift annuity. If you are age 72 and create a $10,000 gift annuity with cash, you will receive the following benefits:
Fixed rate of return 6.7% Fixed annual income for life $ 670 Tax-free income portion $ 403 «Charitable giJt m1f1l1ities Taxable income portion $ 267 Immediate federal income tax deduction $4,159 represent em il11poHc71ll part of (Yo ur deduction may vary,) l11y personal program ojgivil1g bnck You may also fund a gift annuity with appreciated securities. 10 Washington UIl;versity."
Do you own appreciated real estate? says Sally Bllrtram, PhD, HA 72. Consider gifting the real estate to a Washington University uni ''It'~ a will-win." trust and receive a lifetime income, receive a charitable income tax deduction, and avoid the capital gains tax on the sale.
For further information or to request a personalized example, g Washington please call 314-935-5848 or 800-835-3503, complete the attached University inSt.lDuis reply card, or e-mail us at [email protected].
Visit LIS at our Web site at http://plannedgiving.wustl.edu SCHOOL OF MEDICINE Seck advice fwm yo ur lax or legal advi sor when co nsidering a charilable gift annuily and/or charilable trust. ~Washington University inStlDuis SCHOOL OF MEDICINE
D I am age 60 or over. Please send me a personalized, D I would like information on planning my year-end giving. confidential calculation using the following information D I wish to become a Robert S. Brookings Partner. to illu strate th e very attractive be nefits that I will receive I have included Washington University in my estate plan from a Washington University Charitable Gift Annuity through my: __ will or trust other or Charitable Remainder Unitrust. D I have a question. Please contact me. Vruue$'______In the form of: Name ______D Cash D Real Estate ($ ) ( ) COST BASIS ACQUISITION DATE
D Securities ($ ) (----,-::-:-:-c==.,..,--:c-=-I Address COST BASIS ACQUI SITIO NDATE First Benefid uy Second Beneficiary Binhdate ______Binhdatt ______C ity/State/Zip ______Rel ationship ______Relationship ______Daytime Phone ______••• ••• 1II!!l!!1II E- mail ______~ IllHitmil1 ~ BROOKINGSlIInlil PART NERS This information is strictly confidentiaL. Recognizing the Importance of Planned Gifts
Fold this form and seal edges with tape to mail.
~ Washington Let us know what's new with you. University inStlDuis honors • Use this postage-paid card ...or: SCHOOL OF MEDICINE awards • Contact Kim Donermeyer at (314) 286-0031 activities • E-mail Ruth:[email protected] Office of Medical Alumni promotions & Development & more! • Update online: medicine.wustl.edu/alumni '''; E B Name ______Q) a. $ :5 Address______. ~ Signature.______The Un iversity reserves the right to Daytime phone______contact contributors to verify entries. -- ,,------'-- ,~- ;' - ••_'---"" - •• ' , . J • • - - . ..'. _ . - . _- _._",, _ _ -:-- . ---• •-.'~-' T . _ _,_ -,-,,--. ~ Washington ~ Washington University inSt.lDuis NO POSTAGE University inSt.louis NO POSTAGE NECESSARY NECESSARY SCHOOL OF MEDICINE IF MAILED SCHOOL OF MEDICINE IF MAILED IN THE IN THE UNITED STATES UNITED STATES BUSINESS REPLY MAIL BUSINESS REPLY MAIL FIRST-CLASS MAIL PERMIT NO. 685 ST. LOUIS , MISSOURI FIRST-CLASS MAIL PERMIT NO . 685 ST LOUIS, MISSOURI POSTAGE WILL BE PAID BY ADDRESSEE POSTAGE Wl LL BE PAID BY ADDRESS EE MEDICAL CENTER ALUMNI ASSOCIATION WASHINGTON UNIVERSITY CAMPUS BOX 8509 OFFICE OF PLANNED GIVING 660 S EUCLID CAMPUS BOX 1193-MV SAINT LOUIS MO 63110-9867 ONE BROOKINGS DRIVE SAINT LOUIS MO 63130-9989 1,11 .... 11""11 .. 11,1111,1,1,,1,1,, I" 1,1,1",,1,11 1,11""11",, 11"11,11,, ,1,1 " 1,1 " I" 1,1,1""I,ll Ghostly glow David Goodwin, a seven-year veteran of the School of Medicine Protective Services Department and now a commissioned police officer on the university's Hilltop campus, relaxes in Jefferson Barracks cemetery. He is at the grave of one of the ghosts featured in Ghosts of Jefferson Barracks, a history of the super natural at the military post. Goodwin, a National Guard reservist, is now deployed to Iraq. C MS LJ LLA VEKERDY B132 Facing America On October 8, 2004, apresidential debate on the hilltop campus put the candidates - and the university in the national spotlight. The School of Medicine chapter of the American Medical Student Association hosted aremote telecast in Moore Auditorium, with featured speaker Larry J. Shapiro, MD, executive vice chancellor for medical affairs and WUSM dean. aWashingtonUniversity in St.louis SCHOOL OF MEDICINE outlook.wustl.edu