Outlook Magazine, Fall 2004

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Washington University School of Medicine Digital Commons@Becker Outlook Magazine Washington University Publications 2004 Outlook Magazine, Fall 2004 Follow this and additional works at: http://digitalcommons.wustl.edu/outlook Part of the Medicine and Health Sciences Commons Recommended Citation Outlook Magazine, Fall 2004. Central Administration, Medical Public Affairs. Bernard Becker Medical Library Archives. Washington University School of Medicine, Saint Louis, Missouri. http://digitalcommons.wustl.edu/outlook/153 This Article is brought to you for free and open access by the Washington University Publications at Digital Commons@Becker. It has been accepted for inclusion in Outlook Magazine by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Row, row, row ... Stephen Warner (front), a first-year MOl PhD student in the university's Division of Biology and Biomedical Sciences, guided his men 's lightweight-four boat during competition in the recent summer Olympic Games in Athens, Greece. The former University of Michigan rower deferred his acceptance to the School of Medicine for four years to continue training. He and his teammates finished ninth overall in the rowing event. OUTLOOK Volume XLI, Number 3 EDITOR HOLLY EDMISTON CONTACTS Fall 2004 (ISSN 1042-2897) is Phone: 3141286-0100 ART DIRECTOR ERIC YOUNG published quarterly by the Office of FAX : 3141286-0101 Medical Public Affairs, Washington PHOTO GRAP HER ROBERT BOSTON e-mail: hollyedmiston @wustl.edu University School of Medicine, Campus Periodical postage paid at SI. Louis, MO. CIRCULATION Box 8508 , 4444 Forest Park Ave ., KATHI LAW POSTMASTER. Send address changes to: SI. Louis, M0 63108. © 2004 EXECUTIVE STEVE KOHLER Circulation, Outlook, Campus Box 8508, DIRECTOR 4444 Forest Park Ave., SI. Louis, MO 63108 outlook .wustl.edu O J [u]li~@@ Rea Construction proceeds on the atrium that will connect the Farrell learning and Teaching Center with the North Building. medicine.wustl.edulltc --------- - ------------------~~-- Farrell Learning and Teaching Center located in the heart of the Washington University Medical Center, at the intersection of Euclid and Scott avenues, the Farrell Learning and Teaching Center will serve as the school's main venue for medical education. • The first classes are scheduled to be held there in fall 2005. • The latest technology throughout the building means, for example, that every seat in the lecture halls will be wired for personal network access. • New spaces emphasize small group learning. Giving opportunities • Prominent naming opportunities are available throughout the building, starting at $25,000. • Annual Fund support, at any level, will help enable this important addition to medical education. Contact the Office of Medical Alumni and Development at (314) 286-0086. aWashington Universityin St.louis SCHOOL OF MEDICINE UIIOO Washington University School of Medicine 16 Gene matching VOLUME XLI' NUMBER 3· FALL 2004 COVER Susan K. Dutcher, PhD, professor of genetics and CTCAGTCGGCTCAAGCCCCTAAGAGAATG ~ of cell biology and physiology, among the flora at SI. Louis' Missouri Botanical Garden. Dutcher's research on cilia, hairlike structures on the surfaces of cells, led her on a computerized search through genetic information from algae, plants and humans. For more on this story, please turn to page 15. PHOTO BY ROBERT BO STON Immunity Bites BY MICHAEL PURDY Understanding why tbe human immune system some­ times attacks its own host may lead to new therapies or even the prevention of autoimmune diseases. Young Hip Joints BY JIM DRYDEN . .. .. ... Young adults w ith hip dysplasia - who often go undiagnosed - can benefit from a su rgical procedure that radically changes the structure of the hip joint. Strands of Life BY MICHAEL PURDY 8 Immunity unleashed An innovative m ethod of culling specific genes for study helps researchers to determine which genes carry out important functions or contribute to human diseases . .DEPARTMENT Seeking Closure BY KIMBERLY LEYDIG Pulse Minimally invasive treatment for vari cose veins and ocher leg ve in problems is no t for looks alone - the procedure Historic Outlook can cure these often painful and debilitating conditions. & Alumni Development 28 William T. Shearer, MD 70, PhD 26 Honorable Continuum 28 Profile 30 ~Iews 33 Class Notes Powell to head Radiation Oncology SIMON POWELL, MBBS, PHD, a cancer physician­ scientist from MassachusettS General Hospital and Harvard University, has been appointed head of the Department of Radiation Oncology. "S imon is a talented research scientist who has done much to uncove r the molecular mechanisms that allow normal tissues and can­ cer ce lls to repair their DNA after exposure to ionizing radiation," says Larry]. Shapiro, MD, dean of the School of Medicine and executive vice chancellor for medical affairs. Simon Powell, MBBS, PhD "He possesses the leadership skills and vision to move our Department of Radiation Oncology forward in a continued effort to achieve excellence in a ll of its miss ions." Powell is a leader in research into BRCA I and WU STl awarded select distinction BRCA2, twO genes that can sharply increase a woman's THE ASSOCIAT ION FOR THE ACCREDITATION risk of developing breast cancer. Among other accom­ OF HUMAN RESEARCH PROTECTION PROGRAMS plishments, Powell developed new tests that let doctors (AAH RP p) recently awarded full accreditation to interpret formerly ambiguous results from tests for the Washington University, one of only a few organizations risk-enhancing forms of BRCAI and BRCA2. in the nation to gain this recognition. Originally from England, Powell was head of The AAHRPP, a non-profit organization, works to the Breast Cancer Service and Clinical Director of protect the rights and welfare of research participants the Gillette Women's Cancer Center Program at by fostering and advancing the ethical and professional Massachusetts General, whi.ch is affiliated with Harvard conduct of scientists and organiza tions that engage in M edical School. He earned both his MBBS (the British cI i n ical research. equivalent to the MD) and hi.s PhD in cel l and molecular "We are very proud that Washington University is radiation biology at the University of London. Powell one of only 14 organiza tions awarded accreditation by trained at the Royal Marsden Hospital and the Institute the AAHRPP," says Theodore of Cancer Research in England before coming to th e "The safety and protection ]. Cicero, PhD, vice chancellor United States in 1991 as a clinical oncology fellow for research. at H a rvard. of human participants has The AAH RPP was Powell also will become a professor of radiation always been at the fore- founded by seven prestigious oncology. As department head, he succeeds Carlos A. front of patient care at organiza tions, including the Perez, MO, who se rved as the department's head since Washington University:' Association of American it was founded in Septem ber 200l. Medical Colleges, the Powell is curren t1y principal investigator or co-principal THEOOORE J. CICERO, PHO Association ofAmerican investigator for six federal research grants, and he has Universities and the served on various committees for the NIH including site Federation of tbe America n Societies of Experimental visit committees that have reviewed major cancer-related Biology, "to fo ster a culture of science and res pon­ grants at other in sti tutions. He was associate ed itor for sibility within institutions seeking its services. " The the International Journal ofCancer for eight years and clinical research accreditation process was initiated by currently serves on the editorial boards of the journals AAHRPP in 2002. Radiation Research and Cancer Biology and Therapy. 2 Pulse Fall 2004 Outlook HIV care for uninsured, underserved patients to be funded by three-year grant MISSOURI FOUNDATION FOR HEALTH (MFH ) MFH was crea ted in 2000 as part of an agree­ has awarded a th ree-year, $l.1 million granr ro the ment between Blue C ross/Bl ue Shield of Missouri, the Infectious Disease Clinic at Washingron Universiry Missouri Department of Insurance and the Missou ri School of Medicine and Barn es-Jewish Hospital. The Atrorney General. The largest health care fo undation in n ew granr will supporr care of low-income patienrs with the state, Misso uri Foundation for H ealth works ro HIV and conditions that complicate HIV treatmenr. support public and private health care services for the "The foundation's funds will be commirred ro serv­ uninsu red and the underserved. in g the growing needs of people with HIV disease who, The granr also will be used ro expand and improve due ro lack of insurance or other iss ues of access, would psychiatric counseling and ro berrer moniror HIV's otherwise receive li trle or no ca re for their complex ill­ effects on th e liver. Though 85 perce nt of the granr's nesses," says project direcror Victoria J. Fraser, MD, funds will be used direcrly for pati ent servi ce, the granr professor of medicine and co-direcror of the division of also is structured to help the clinic seek fu rure funding infectious diseases. from other agencies and plan for furure partnersh ips. PSYCHIATRY Holidays, special events have no proven effect on timing of death he idea that dying people hang on through force of will or hastened by loss For instance, one study claimed there to life in order to celebrate one more of the desire to live:' was a 19 percent dip in deaths among birthday or holiday has no firm sci­ Skala is the lead author of a review prominent Americans in the month before entific basis, according to behavioral article that appeared in the May issue of their birthdays and a 14 percent rise in medicine researchers. the journal Psychosomatic Medicine. With deaths in the month afterward. However, "I've worked in hospitals since I was Kenneth E. Freedland, PhD, professor of Skala and Freedland say, the original about 16 years old, and I've seen that people psychiatry, Skala reviewed a number of authors included the birth month itself in in medicine have a lot of very strongly held studies that have looked at whether death the "after" category.
Recommended publications
  • Anastasi 2032

    Anastasi 2032

    Shashwat Goel & Ankita Phulia ​Anastasi 2032 Table of Contents Section Page Number 0 Introduction 2 1 Basic Requirements 4 2 Structural Design 15 3 Operations 31 4 Human Factors 54 5 Business 65 6 Bibliography 80 Fletchel Constructors 1 Shashwat Goel & Ankita Phulia ​Anastasi 2032 0 Introduction What is an underwater base doing in a space settlement design competition? Today, large-scale space habitation, and the opportunity to take advantage of the vast resources and possibilities of outer space, remains more in the realm of speculation than reality. We have experienced fifteen years of continuous space habitation and construction, with another seven years scheduled. Yet we have still not been able to take major steps towards commercial and industrial space development, which is usually the most-cited reason for establishing orbital colonies. This is mainly due to the prohibitively high cost, even today. In this situation, we cannot easily afford the luxury of testing how such systems could eventually work in space. This leaves us looking for analogous situations. While some scientists have sought this in the mountains of Hawaii, this does not tell the full story. We are unable to properly fathom or test how a large-scale industrial and tourism operation, as it is expected will eventually exist on-orbit, on Earth. This led us to the idea of building an oceanic base. The ocean is, in many ways, similar to free space. Large swathes of it remain unexplored. There are unrealised commercial opportunities. There are hostile yet exciting environments. Creating basic life support and pressure-containing structures are challenging.
  • Concept Study of a Cislunar Outpost Architecture and Associated Elements That Enable a Path to Mars

    Concept Study of a Cislunar Outpost Architecture and Associated Elements That Enable a Path to Mars

    Concept Study of a Cislunar Outpost Architecture and Associated Elements that Enable a Path to Mars Presented by: Timothy Cichan Lockheed Martin Space [email protected] Mike Drever Lockheed Martin Space [email protected] Franco Fenoglio Thales Alenia Space Italy [email protected] Willian D. Pratt Lockheed Martin Space [email protected] Josh Hopkins Lockheed Martin Space [email protected] September 2016 © 2014 Lockheed Martin Corporation Abstract During the course of human space exploration, astronauts have travelled all the way to the Moon on short flights and have logged missions of a year or more of continuous time on board Mir and the International Space Station (ISS), close to Earth. However, if the long term goal of space exploration is to land humans on the surface of Mars, NASA needs precursor missions that combine operating for very long durations and great distances. This will allow astronauts to learn how to work in deep space for months at a time and address many of the risks associated with a Mars mission lasting over 1,000 days in deep space, such as the inability to abort home or resupply in an emergency. A facility placed in an orbit in the vicinity of the Moon, called a Deep Space Transit Habitat (DSTH), is an ideal place to gain experience operating in deep space. This next generation of in-space habitation will be evolvable, flexible, and modular. It will allow astronauts to demonstrate they can operate for months at a time beyond Low Earth Orbit (LEO). The DSTH can also be an international collaboration, with partnering nations contributing elements and major subsystems, based on their expertise.
  • Jenkins 2000 AIRLOCK & CONNECTIVE TUNNEL DESIGN

    Jenkins 2000 AIRLOCK & CONNECTIVE TUNNEL DESIGN

    Jenkins_2000 AIRLOCK & CONNECTIVE TUNNEL DESIGN AND AIR MAINTENANCE STRATEGIES FOR MARS HABITAT AND EARTH ANALOG SITES Jessica Jenkins* ABSTRACT For a manned mission to Mars, there are numerous systems that must be designed for humans to live safely with all of their basic needs met at all times. Among the most important aspects will be the retention of suitable pressure and breathable air to sustain life. Also, due to the corrosive nature of the Martian dust, highly advanced airlock systems including airshowers and HEPA filters must be in place so that the interior of the habitat and necessary equipment is protected from any significant damage. There are multiple current airlocks that are used in different situations, which could be modified for use on Mars. The same is true of connecting tunnels to link different habitat modules. In our proposed Mars Analog Challenge, many of the airlock designs and procedures could be tested under simulated conditions to obtain further information without actually putting people at risk. Other benefits of a long-term study would be to test how the procedures affect air maintenance and whether they need to be modified prior to their implementation on Mars. INTRODUCTION One of the most important factors in the Mars Habitat design involves maintaining the air pressure within the habitat. Preservation of breathable air will be an extremely vital part of the mission, as very little can be found in situ. Since Mars surface expeditions will be of such long duration, it is imperative that the airlock designs incorporate innovative air maintenance strategies. For our proposed Earth Analog Site competition, many of the components of these designs can be tested, as can the procedures required for long-duration habitation on Mars.
  • Crucible of Science: the Story of the Cori Laboratory

    Crucible of Science: the Story of the Cori Laboratory

    Crucible of Science This page intentionally left blank Crucible of Science THE STORY OF THE CORI LABORATORY JOHN H. EXTON 3 3 Oxford University Press is a department of the University of Oxford. It furthers the University’s objective of excellence in research, scholarship, and education by publishing worldwide. Oxford New York Auckland Cape Town Dar es Salaam Hong Kong Karachi Kuala Lumpur Madrid Melbourne Mexico City Nairobi New Delhi Shanghai Taipei Toronto With offi ces in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland Th ailand Turkey Ukraine Vietnam Oxford is a registered trademark of Oxford University Press in the UK and certain other countries. Published in the United States of America by Oxford University Press 198 Madison Avenue, New York, NY 10016 © Oxford University Press 2013 All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitt ed, in any form or by any means, without the prior permission in writing of Oxford University Press, or as expressly permitt ed by law, by license, or under terms agreed with the appropriate reproduction rights organization. Inquiries concerning reproduction outside the scope of the above should be sent to the Rights Department, Oxford University Press, at the address above. You must not circulate this work in any other form and you must impose this same condition on any acquirer. CIP data is on fi le at the Library of Congress ISBN 978–0–19–986107–1 9 8 7 6 5 4 3 2 1 Printed in the United States of America on acid-free paper Dedicated to Charles Rawlinson (Rollo) Park This page intentionally left blank Contents Acknowledgments ix I n t r o d u c t i o n xi 1.
  • Edwin G. Krebs 73 Ed in Skeletal Muscle in Two Different Forms That They Designated a S Phos- Phorylase B and Phosphorylase a (2,3)

    Edwin G. Krebs 73 Ed in Skeletal Muscle in Two Different Forms That They Designated a S Phos- Phorylase B and Phosphorylase a (2,3)

    72 PROTEIN PHOSPHORYLATION AND CELLULAR REGULATION, I Nobel Lecture, December 8, 1992 by E DWIN G. K R E B S Departments of Pharmacology and Biochemistry, School of Medicine, SL-15, University of Washington, Seattle, WA 98195, USA. INTRODUCTION This presentation and the one to be given immediately thereafter will be concerned with the reversible phosphorylation of proteins and the role of this process in biological regulation. In addition to discussing our own early contributions to this field, Ed Fischer and I will describe some of the developments that have occurred subsequently. These developments have led to the realization that protein phosphorylation constitutes a major mechanism by which cellular processes are controlled. My own remarks will review the historical background that provided the setting in which our joint work was carried out in the 1950s and early 1960s. Then I’ll turn to a discussion of this work itself, to be followed by comments on the cyclic AMP-dependent protein kinase. Finally I will talk about the intracellular transmission of hormone and growth factor signals through protein kinase cascades. BACKGROUND By 1940, which is the year in which I entered medical school at Washington University in St Louis, it was well established that the breakdown of glyco- gen in skeletal muscle and other types of cells occurs by the process of phosphorolysis, catalyzed by the enzyme phosphorylase (for review, see ref. 1). Carl Cori was Professor and Chairman of the Department of Pharmacol- ogy at Washington University, when I started my training there, but he was soon to take over the Department of Biological Chemistry.
  • Multi Duty (MD) Airlock

    Multi Duty (MD) Airlock

    Multi Duty (MD) Airlock ■ Versatile airlock can be connected to many different types of storage and conveying devices ■ Square flanged inlet and outlet ■ Highly reliable, rugged design delivers low maintenance service ■ Sealed bearings require no lubrication and provide years of service ■ Available in a wide range of sizes ■ Special options extend service life in challenging applications Application Outboard press fit bearings provide better protection, resulting With tens of thousands of installations throughout the world, the in longer service life. Special wear resistant MD designs are Schenck Process MD airlock is a highly universal airlock used designed to be placed in abrasive environments. Field tests of to meter dry bulk materials under feeding devices, such as bins, these designs show a lifespan up to eight times longer than a hoppers, mixers, screw conveyors and sifters. standard MD airlock. Providing rugged service, the MD is suitable for use in dilute Operating Principle phase vacuum, pressure or combination vacuum/pressure The airlock reliably meters products into conveying lines or pneumatic conveying systems. Low mounting height is ideal storage areas. With open end rotors, the product comes in for space restricted applications. With a low profile and a wide contact with the endplates of the housing. With closed end flange width, the MD airlock is able to match drill hole patterns rotors, the product is confined within the pockets of the rotor. of many competitor’s valves for easy replacement. Features Equipment Rated up to 15 psi pressure differential The MD has a cast housing and endplates with a square flange. Standard temperature rating is 200 ºF (93 °C) The rotor and housing are precision machined to obtain a high Optional high-temperature rated to 450 ºF (232 °C) degree of accuracy and close tolerances.
  • Next Term's Project ENAE 483/788D

    Next Term's Project ENAE 483/788D

    Discussion of Next Term • Final design project information • Discussion of final exam • Discussion of grading for group projects • Other useful information © 2013 David L. Akin - All rights reserved http://spacecraft.ssl.umd.edu U N I V E R S I T Y O F Next Term’s Project ENAE 483/788D - Principles of Space Systems Design MARYLAND 1 Notes • Due date for project 5 postponed to time of final exam Monday 12/16 • Slides for Tuesday’s class (Sensors and Actuators) posted to Piazza site • Reminders: – Final exam limited single 8.5”x11” sheet of notes – Bring a calculator – Given honest attempt, final will only be counted if it improves overall grade U N I V E R S I T Y O F Next Term’s Project ENAE 483/788D - Principles of Space Systems Design MARYLAND 2 ENAE 483/788D Final Exam Questions • Orbital mechanics • Rocket performance • Reliability • Life support • Power systems • Structural design • Thermal analysis • Cost analysis • Propulsion systems • Systems engineering U N I V E R S I T Y O F Next Term’s Project ENAE 483/788D - Principles of Space Systems Design MARYLAND 3 Grading Rubrik for Group Projects • 10 - essentially perfect • 9 - excellent • 8 - very good • 7 - good • 6 - okay • 5 - minor deficiencies • 4 - significant deficiencies • 3 or below - major deficiencies U N I V E R S I T Y O F Next Term’s Project ENAE 483/788D - Principles of Space Systems Design MARYLAND 4 Fall Term Project Organization Systems Crew Systems Power, Propulsion, and Loads, Structures, and Avionics and Engineering Thermal Mechanisms Software A1 B1 C1 D1 E1 A2
  • 13.012 Marine Hydrodynamics for Ocean Engineers Fall 2004 Quiz #1 Student Name: ˆ4 10

    13.012 Marine Hydrodynamics for Ocean Engineers Fall 2004 Quiz #1 Student Name: ˆ4 10

    13.012 Marine Hydrodynamics for Ocean Engineers Fall 2004 Quiz #1 Student name: _____________________________________ This is a closed book examination. You are allowed 1 sheet of 8.5” x 11” paper with notes. For the problems in Section A, fill in the answers where indicated by ____________, or in the provided space. When a list of options is presented ([…],[…],[….] etc), circle all the options (all, none, one or more) that apply. Use the following constants unless otherwise specified: 2 3 -6 2 Gravity: g = 10 m/s water density: ρw = 1000 kg/m kinematic viscosity: νw = 1x10 m /s 3 -6 2 Seawater density: ρw = 1025 kg/m kinematic viscosity: νsw = 1x10 m /s 3 -5 2 Air density: ρa = 1 kg/m kinematic viscosity: νa = 1x10 m /s Assume the fluid is incompressible unless otherwise defined. Give all answers in SI units (kg, m, s). All numerical answers MUST have the proper units attached. Part A (30%): 1) A 1 m3 block of aluminum, specific gravity 2.7, is tethered to a piece of cork, specific gravity 0.24. The volume of cork required to keep the block neutrally buoyant in seawater is _______________ and the volume required in fresh water is _______________. Assume both the aluminum and cork are fully submerged and that the weight of the tether is negligible. h 2) The velocity field V= 4 xyiˆ + 10 y2 ˆj+ C zykˆ is valid for C = _____________. The vorticity in this flow field is ω = ______________. This flow field is [irrotational][rotational]. 3) The two linearized boundary conditions at the free surface for linear progressive free-surface gravity waves are _________________ and __________________.
  • Gerty Theresa Cori

    Gerty Theresa Cori

    NATIONAL ACADEMY OF SCIENCES G ERTY THERESA C ORI 1896—1957 A Biographical Memoir by J OSEPH LARNER Any opinions expressed in this memoir are those of the author(s) and do not necessarily reflect the views of the National Academy of Sciences. Biographical Memoir COPYRIGHT 1992 NATIONAL ACADEMY OF SCIENCES WASHINGTON D.C. GERTY THERESA CORI August 8, 1896-October 26, 1957 BY JOSEPH LARNER ERTY AND CARL CORI'S most significant contributions Gwere the establishment of the cycle of carbohydrates known as "the Cori Cycle," the isolation of glucose 1-phos- phate, and the discovery of phosphorylase and phospho- glucomutase. These discoveries established the enzymatic pathways of glycogenolysis and glycolysis. In glycogen metabolism, Gerty Cori pioneered in the discovery of the debranching enzyme amylo-l,6-glucosidase and its use in the elucidation of glycogen structure by se- rial enzymatic degradation. This pioneering work led to the elucidation of the enzymatic defects in the glycogen storage diseases. Her studies, therefore, extended funda- mental scientific discoveries into the clinical arena, most particularly in the field of pediatrics, her original area of clinical interest and specialization. Gerty Theresa Radnitz was born on August 8, 1896, in Prague, at that time part of the Austro-Hungarian empire. Otto Radnitz, her father, was director general of a sugar refinery in Bohemia. Her mother's brother was professor of pediatrics at the University of Prague. Gerty studied at home until the age of ten, when she went to a girls' prepa- ratory school, from which she graduated in 1912. In 1914, after passing her final examination (matura) at the Tetschen 111 112 BIOGRAPHICAL MEMOIRS Real Gymnasium, she enrolled as a medical student at the Carl Ferdinand University, the German university of Prague.
  • Title Description Filename Keywords Media Code Time CD Track Index AIR PRESSURIZED AIR BLAST, SCI FI Air 8005 01 1 Air, Ga

    Title Description Filename Keywords Media Code Time CD Track Index AIR PRESSURIZED AIR BLAST, SCI FI Air 8005 01 1 Air, Ga

    Media Title Description FileName Keywords Time CD Track Index Code Air, Gases & Steam;Space 8005- AIR PRESSURIZED AIR BLAST, SCI FI Air 8005_01_1 :01 8005 1 1 Doors, Hatches & Airlocks 01-01 Air, Gases & Steam;Space 8005- AIR PRESSURIZED AIR BLAST, SCI FI Air 8005_01_2 :01 8005 1 2 Doors, Hatches & Airlocks 01-02 Air, Gases & Steam;Space 8005- AIR PRESSURIZED AIR BLAST, SCI FI Air 8005_02_1 :02 8005 2 1 Doors, Hatches & Airlocks 02-01 Air, Gases & Steam;Space 8005- AIR PRESSURIZED AIR BLAST, SCI FI Air 8005_02_2 :01 8005 2 2 Doors, Hatches & Airlocks 02-02 Air, Gases & Steam;Space 8005- AIR PRESSURIZED AIR BLAST, SCI FI Air 8005_03_1 :01 8005 3 1 Doors, Hatches & Airlocks 03-01 Air, Gases & Steam;Space 8005- AIR PRESSURIZED AIR BLAST, SCI FI Air 8005_03_2 :01 8005 3 2 Doors, Hatches & Airlocks 03-02 Air, Gases & Steam;Space 8005- AIR PRESSURIZED AIR BLAST, SCI FI Air 8005_04_1 :01 8005 4 1 Doors, Hatches & Airlocks 04-01 Air, Gases & Steam;Space 8005- AIR PRESSURIZED AIR BLAST, SCI FI Air 8005_04_2 :01 8005 4 2 Doors, Hatches & Airlocks 04-02 Air, Gases & Steam;Space 8005- AIR PRESSURIZED AIR BLAST, SCI FI Air 8005_05_1 :01 8005 5 1 Doors, Hatches & Airlocks 05-01 Air, Gases & Steam;Space 8005- AIR PRESSURIZED AIR BLAST, SCI FI Air 8005_05_2 :01 8005 5 2 Doors, Hatches & Airlocks 05-02 Air, Gases & Steam;Space 8005- AIR PRESSURIZED AIR BLAST, SCI FI Air 8005_05_3 :04 8005 5 3 Doors, Hatches & Airlocks 05-03 Air, Gases & Steam;Space 8005- AIR PRESSURIZED REVERSE AIR POP, SCI FI Air 8005_06_1 :01 8005 6 1 Doors, Hatches & Airlocks 06-01
  • Human Systems Integration of an Extravehicular Activity Space Suit Augmented Reality Display System

    Human Systems Integration of an Extravehicular Activity Space Suit Augmented Reality Display System

    Mississippi State University Scholars Junction Theses and Dissertations Theses and Dissertations 1-1-2018 Human Systems Integration of an Extravehicular Activity Space Suit Augmented Reality Display System Paromita Mitra Follow this and additional works at: https://scholarsjunction.msstate.edu/td Recommended Citation Mitra, Paromita, "Human Systems Integration of an Extravehicular Activity Space Suit Augmented Reality Display System" (2018). Theses and Dissertations. 2517. https://scholarsjunction.msstate.edu/td/2517 This Graduate Thesis - Open Access is brought to you for free and open access by the Theses and Dissertations at Scholars Junction. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of Scholars Junction. For more information, please contact [email protected]. Template C v3.0 (beta): Created by J. Nail 06/2015 Human systems integration of an extravehicular activity space suit augmented reality display system By TITLE PAGE Paromita Mitra A Thesis Submitted to the Faculty of Mississippi State University in Partial Fulfillment of the Requirements for the Degree of Master of Science in Aerospace Engineering. in the Department of Aerospace Engineering. Mississippi State, Mississippi August 2018 Copyright by COPYRIGHT PAGE Paromita Mitra 2018 Human systems integration of an extravehicular activity space suit augmented reality display system By APPROVAL PAGE Paromita Mitra Approved: ____________________________________ Keith Koenig (Major Professor) ____________________________________
  • GNM Silent Killers.Qxd:Layout 1

    GNM Silent Killers.Qxd:Layout 1

    “A truly engrossing chronicle.” Clive Cussler JAMES P. DELGADO SILENT KILLERS SUBMARINES AND UNDERWATER WARFARE FOREWORD BY CLIVE CUSSLER © Osprey Publishing • www.ospreypublishing.com © Osprey Publishing • www.ospreypublishing.com SUBMARINES AND UNDERWATER WARFARE JAMES P. DELGADO With a foreword by Clive Cussler © Osprey Publishing • www.ospreypublishing.com CONTENTS Foreword 6 Author’s Note 7 Introduction: Into the Deep 11 Chapter 1 Beginnings 19 Chapter 2 “Sub Marine Explorers”: Would-be Warriors 31 Chapter 3 Uncivil Warriors 45 Chapter 4 Missing Links 61 Chapter 5 Later 19th Century Submarines 73 Chapter 6 Transition to a New Century 91 Chapter 7 Early 20th Century Submariness 107 Chapter 8 World War I 123 Chapter 9 Submarines Between the Wars 143 Chapter 10 World War II: the Success of the Submarine 161 Chapter 11 Postwar Innovations: the Rise of Atomic Power 189 Chapter 12 The Ultimate Deterrent: the Role of the 207 Submarine in the Modern Era Chapter 13 Memorializing the Submarine 219 Notes 239 Sources & Select Bibliography 248 Index 260 © Osprey Publishing • www.ospreypublishing.com FOREWORD rom the beginning of recorded history the inhabitants of the earth have had a Fgreat fascination with what exists under the waters of lakes, rivers, and the vast seas. They also have maintained a great fear of the unknown and very few wished to actually go under the surface. In the not too distant past, they had a morbid fear and were deeply frightened of what they might find. Only three out of one hundred old-time sailors could swim because they had no love of water.