The Drosophila Homologue of Vertebrate Myogenic-Determination

Proc. Natl. Acad. Sci. USA Vol. 88, pp. 3782-3786, May 1991 Developmental Biology The Drosophila homologue of vertebrate myogenic-determination genes encodes a transiently expressed nuclear protein marking primary myogenic cells (insect myogenesis/helix-loop-helix/invertebrate MyoD) BRUCE M. PATERSON*t, UWE WALLDORFt, JUANITA ELDRIDGE*, ANDREAS DUBENDORFERt, MANFRED FRASCH§, AND WALTER J. GEHRINGt *Laboratory of Biochemistry, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; tDepartment of Cell Biology, Biozentrum, University of Basel, Klingelbergstrasse 70, CH-4056 Basel, Switzerland; tZoology Institute, University of Zurich, Winterthurerstrasse 190, CH-8057 Zurich, Switzerland; and §Max Planck Institute for Developmental Biology, Abteilung III Genetik, D-7400 Tubingen, Federal Republic of Germany Contributed by Walter J. Gehring, January 22, 1991

10 30 50 ABSTRACT We have isolated a cDNA clone, called Dmyd GGAAAAATCCCGAAAGTGAAACTATAACAAATTAAACTAAATAGAAACCACAGCCTAAAA 70 90 110 that encodes a CTTGTGTGTAACCATAACTCATAAATTTGTGTTAATGACCTAGCATACCTAGAAAAGGAG for Drosophila myogenic-determination gene, 130 150 170 CTTAAACCACGTTAAAAATGGTAATAATCAACTGACTAAATTAACTGTGCCATCGTAATT protein with structural and functional characteristics similar to 190 210 230 AGTATCAGCAATTAAATTCAGCAACTTGTTGAACTACCAAAATTGTTTTGTAAAATATAA the members of the vertebrate MyoD family. Dmyd clone 250 270 290 CAAAATCGTAGTGAAGTGAAAAATGACCAAGTATAkATAGTGGCAGCAGTGAAATGCCTGC encodes a polypeptide of 332 amino acids with 82% identity to M TK Y N S G S S E M P A 310 330 350 MyoD in the 41 amino acids of the putative helix-loop-helix GGCTCAAACCATCAAGCAGGAGTACCACAATGGCTATGGTCAGCCGACACATCCTGGATA A Q T I K 0 E Y H N G YG Q P T H P G Y region and 100% identity in the 13 amino acids of the basic 37S0 390 4 10 CGGATTTAGCGCCTATAGCCAACAGAATCCGATAGCCCATCCCGGCCAGAATCCACACCA domain proposed to contain the essential recognition code for G FS A Y S QQ N P I A H P G Q N P H Q 430 450 470 muscle-specific gene activation. Low-stringency hybridizations GACACCTGCAGAATTTCTTTAGCCGCTTCAATGC CCGGGTGATGCGAGTGCGGGAAATGG T L Q N F F S R F N A V G D A S A GN G indicate that Dmyd is not a member of a multigene family 4 90 510 530 TGGAGCGGCTTCCATCTCAGCCAACGGATCGGGTTCGTC TTGCAACTACAGTCATGCGAA to in vertebrates. is a nuclear in G A A S I S A NG S G S S C N Y S H A N similar MyoD Dmyd protein 550 570 590 TCATCATCCGGCGGAGCGTGGACAAGCCGTTGGGCATGAATATGACAC CGTCGCCCATCTA Drosophila, consistent with its role as a nuclear-gene regulatory HH P A E L D K P L G M N M TPSP I Y 610 630 650 factor, and is proposed to be a transiently expressed marker for CACCACGCGACTAGATGACGAGAACAGCAGTCTCAGCTCCGAGGAGCACGTCCATGCGCC T TD Y DD E N S S L S S E E H V H A P muscle founder cells. We have used an 8-kilobase promoter 670 690 710 CCTCGTCTGCTCCTCCGCCCAATCCTCCAGACCATGCCTCACCTGGGCCTGCAAGGCGTG fragment from the gene, which contains the first 55 amino acids L V C SS A Q SS R P CL T W A C K A C 730 750 770 of the Dmyd protein, joined to lacZ, to follow myogenic CAAAAAGAAGAGCGTCACCGTGGACCGTCGAAA.AGCGGCCACTATGAGGGAACGCCGGAG JK K K ,IS V T V D 0A A T MRL EPR R R precursor cells into muscle fibers with antibodies to 13-galac- 1 BAS IC 2 3 790 910 830 tosidase and to Dmyd. Unlike the myogenic factors in verte- TGCCGAAAGGTTAACTGAGGCCTTCGAGATCTCTTCAAGCGACGCACTTCAATAATCOCCAA NLR K V NE A F E IOL K R0TR FS N P N brate muscle cells, Dmyd appears to be expressed at a much HELIX 1 850 870 890 lower level in differentiated Drosophila muscles, so Dmyd CCAGCGCCTGCCGAAGGTTGAGATATTGCGCAATGCCATCGAG TATATCGAGAGCCTGGA Q R L P K V 'E|I L R N A I E Y I ES L E cannot be followed as a muscle marker. This fact LOOP HELIX 2 continuously 910 930 950 RNA in 12- to 24-hr GGATCTGCTACAGGAATCCAGTACCACACGCGATGGCGACAACCTGGCGCCCAGTTTGAG is reflected in the loss of Dmyd expression JD L L Q E S S T T R D G D N L A P S L S as well as in the 9170 990 1010 embryos, a major period of early myogenesis, CGGCAAAAGCTGCCAGTCCGATTATCTGAGCTCCTATGCTGGCGCTTATCTAGAAGATAA G K S C Q S D YL SS Y A G A Y LED K undetectable level of the nuclear antigen in primary cultures of 1030 1050 1070 ACTTAGTTTTTACAACAAACATATGGAGAAlTATGGTCAGTTTACAGACTTTGATGGCAA embryonic and adult Drosophila muscle. L SF Y N K H M E K Y G Q FT D FD GN 1090 1110 1130 TGCCAATGGCTCCAGTTTGGACTGTCTAAATCTGATTGTTCAGAGCATCAATAAGAGCAC A N G S S L D C L N L I V Q S I N K S T The discovery of the four myogenic-determination genes 1150 1170 1190 CACGAGTCCCATTCAAAATAAGGCCACGCCCTCCGCTTCAGATACCCAATCGCCGCCCTC (1-4) in the vertebrates has helped to establish the idea that T S P I Q N K A T P S A S D T Q SP P S 1210 1230 1250 a small number of so-called "master regulatory genes" select ATCCGGAGCAACTGCACCCACTTCTCTGCACGTGAACTTCAAACGGAAGTGCAGCACTTA S G A T A P T S L H V N F K R K C S T* and commit embryonic cells to a particular developmental 1270 1290 1310 GCACTTAAGTATCAGCACCTTAGGCAATTGTAAAGCTATTTTTAAGAGGATACACGAGAT pathway. All members of this gene from to 1330 1350 1370 family, amphibia ACCCAGTGACCCGAATAGGCCTTAAATTATTTGTATAGCATTAGAACTTAATTAAATGGT man, share a common structural motif, a basic domainjoined 1390 1410 to a putative helix-loop-helix configuration, that is essential AATTCAAAACAGCAAAAAAAAA for function (5). FIG. 1. Nucleotide and predicted amino acid sequence of the To analyze early developmental events leading to muscle longest open reading frame in the Drosophila Dmyd cDNA clones. formation (6) we have used a probe from the conserved basic The encoded polypeptide has 332 amino acids and a molecular mass helix-loop-helix domain of the avian myogenic factor CMD1 of 36,208 Da. cDNA clone 1 includes nucleotides 1-1313, and clone (7) to isolate a Drosophila cDNA clone, Dmyd, encoding a 2 includes nucleotides 1314-1410. polypeptide very similar to the vertebrate myogenic- determination genes. Here we demonstrate that the Dmyd MATERIALS AND METHODS gene product is a transiently expressed nuclear protein that serves as a marker for myogenic precursor cells, or a subset General Methods. Preparation ofprobes, Drosophila DNA, thereof, in Drosophila development. Similar to the grasshop- RNA, the screening of libraries, Northern (RNA) and South- per (8), these cells may represent the muscle founder cells ern blot analysis, and dideoxynucleotide sequence determi- that are crucial in organizing and establishing the precise nation were done as described (9). muscle pattern in each segment of the Drosophila body plan. Preparation of Primary Cultures of Drosophila Embryo Cells. Single-drop cultures were prepared and treated with The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" Abbreviations: MHC, myosin heavy chain; EFla, elongation factor in accordance with 18 U.S.C. §1734 solely to indicate this fact. la. 3782 Downloaded by guest on September 29, 2021 Developmental Biology: Paterson et al. Proc. Natl. Acad. Sci. USA 88 (1991) 3783

1 61 Omyf 6. Frg KRKSaptDRR KAATLRERRR LKKINEAFEA LKRrTvaNPN QRLPKVEILR SAIsYIERLQ d transformant lines were generated and balanced. The Dmyd- Mrf4.Frg KRKSaptDRR KAATLRERRR LKCINEAFEA LKRrTvaNPN QRLPKVEILR SAInYIERLQ d Herc. Frg KRKSaptDRR KAATLRERRR LKKINEAFEA LKRrTvaNPN QRLPKVEILR SAIsYIERLQ d lacZ transformant 14.1(11) used in these experiments mapped Hmyf 5. Frg KRKSttmDRR KAATMRERRR LKKVNqAFEt LKRcTttNPN QRLPKVEILR nAIRYIEsLQ e Hmgn. Frg KRKSvsVDRR rAATLkEkRR LKKVNEAFEI LKRsT11NPN QRLPKVEILR SAIqYIERLQ a to 47A. Mmgn.Frg KRKSvsVDRR rAATLREkRR LKKVNEAFEA LKRsTllNPN QRLPKVEILR SAIqYIERLQ a Chkmgn Frg KRICtvsIDRR rAATvREkRR LKKVNEAFEA LKRsTllNPN QRLPKVEILR SAIqYIERLQ s Preparation of Dmyd Antibody. A Rsa I fragment from the Mmd. Frg KRKttnaDRR KAATMRERRR LsKVNEAFEt LKRcTSsNPN QRLPKVEILR nAIRYIEgLQ a Cmd. Frg KRKttnaDRR KAATMRERRR LsKVNEAFEt LKRcTStNPN QRLPKVEILR nAIRYIEsLO a Dmyd cDNA (nucleotides 323-922) was inserted into the Xmd. Frg KRKttnaDRR KAATMRERRR LsKVNEAFEt LKRyTStNPN QRLPKVEILR nAIRYIEsLO a Sma I the transferase fusion vector, Dmd. Frg KkKSvtVDRR KAATMRERRR LrKVNEAFEi LKRrTSsNPN QRLPKVEILR nAleYIEsLe d site of glutathione Consensus EMS--VDA&5AT-REA LKKVNEAFEA LKR-TS-NPN QRLPKVEILR SAIRYIERLQ - 1 2 T-E9 1EF expressed in E. coli JM109, and purified as described (16). BASIC HELIX 1 LOOP HELIX 2 New Zealand White rabbits were injected s.c. with 200-300 ,ug of fusion protein in complete Freund's adjuvant and FIG. 2. Dmyd (Dmd) is closely related to the MyoD. The simi- boosted four times with the same amount of protein in larity of the helix-loop-helix sequences and the invariance in the amino acid sequence of the 13 amino acids that include the basic 2 incomplete adjuvant. Antibody was affinity purified (17). and 3 regions place Dmyd in the MyoD group. Sources for protein Cytochemical Methods. Antibody stainings ofwhole-mount sequences are as follows: Myf6 (Hmyf6) (21), Mrf4 (4), herculin embryos (11), ,B-galactosidase activity stainings (15, 18), and (Herc) (22), Myf5 (Hmyf5) (3), Myf4 (Hmgn) (23), myogenin (Mmgn) chromosomal mapping (19) were done as described. (2), chicken myogenin (Chkmgn) (B.M.P., unpublished work), mouse MyoD (Mmd) (1), chicken MyoD (Cmd) (7), and Xenopus MyoD (Xmd) (24, 25). RESULTS Isolation of Dmyd, a Drosophia Homologue to the Verte- ecdysone as described (10). Cultures were fixed and treated brate Myogenic Determination Genes. By using hybridization for antibody staining as done for the whole-mount embryos conditions of reduced stringency, two cDNA clones were (11). plaque-purified from -5 x 105 recombinant phages; clone 1 Isolation of the Dmyd cDNA and Genomic Clones. The from a A gtll random-primed library (0-16 hr) and clone 2 probe used to isolate the Drosophila Dmyd cDNA clones was from a A gtlO library (3-12 hr). The combined 1410-nucleotide prepared by PCR amplification (12) of the basic helix-loop- sequence of the two clones, called Dmyd for Drosophila helix domain in the avian CMD1 cDNA (7) (from nucleotides 413-637) by using the following primers: 5' primer, Poly Al RNA TGGGCGTGCAAGCATATGAAGAGGAAGACC, and 3' C\J primer, TGCATCCTCCTGGAATTCTTACAGGGCCTG- co 0xCe)) CAG. One nanogram of the CMD1 cDNA clone was ampli- CD co UO c aD- fied through 40 PCR cycles (94°C for 1 min, 37°C for 1 min, and 72°C for 1 min), and the fragment was isolated by electroelution from a preparative 1.5% agarose gel. Dro- Dmyd _3" sophila embryonic A gtlO (13) and A gt11 cDNA libraries were (1 .5kb) screened under reduced stringency (14). The EMBL3 genomic library was screened under standard conditions (9). Construction and Injection ofpC.20 Dmyd-acZ. A genomic fragment containing 8 kilobases (kb) of5' flanking sequences EF1 ax and the first 55 codons of the Dmyd protein was fused in (2.1 kb) frame with the lacZ gene ofEscherichia coli, cloned into the polylinker of the transformation vector Carnegie 20.1, and injected into Drosophila embryos (15). Five independent Total RNA Origin B E H P X 6 C) 6 Li L2 L3 Pl P2 A

23.1 - 9.4 - 6.5 4.3 - WO MHC (6.1kb) 2.3 2.0 Dmyd (1 .5kb)

FIG. 4. Developmental expression pattern of Dmyd RNA. Either 0.56- 20 1Lg of total RNA or 3 ,ug of poly(A)+ RNA from 0-3 hr, 3-6 hr, 6-9 hr, 9-12 hr, 12-18 hr. 12-22 hr, 18-24 hr, from first (Li), second (L2), and third (L3) instar larvae, early pupae (P1), late pupae (P2) and adult male and females (lane A, 1:1 ratio) was run on formal- dehyde gels and transferred to nitrocellulose for hybridization with the indicated probes. The poly(A)+ RNA blot was initially hybridized FIG. 3. Dmyd is not a member of a multigene family in Drosoph- with Dmyd random-primed cDNA clone 1 and then stripped and ila. Five micrograms of Drosophila DNA was digested with the rehybridized with EFla cDNA (27). The stripping process may indicated enzymes: B, BamHI; E, EcoRI; H, HindIII; P, Pst I; X, account for the uneven levels of EFla RNA on the blot. The total Xho I. The entire 1.3-kb insert from the Dmyd cDNA clone 1 was RNA blot was hybridized with Dmyd cDNA and a PCR-amplified labeled and hybridized under high and low stringency to a Southern and cloned DNA fragment representing exon 17 of the Drosophila blot of the gel. HindIII-digested A DNA was used as a size marker, MHC gene (28). Equal amounts of total RNA were loaded in each and the fragment molecular sizes in kb are listed at left. lane, as judged by ethidium bromide staining of the gel. Downloaded by guest on September 29, 2021 3784 Developmental Biology: Paterson et al. Proc. Natl. Acad Sci. USA 88 (1991)

I Pacific I I p

T U

FIG. 5. Expression pattern of the Dmyd protein and the Dmyd-p-galactosidase fusion protein in Drosophila embryos and cultured muscle. (A-C) Expression ofthe Dmyd nuclear antigen in stage 11-16 embryos. (A-C) Stage 11. (D-F) Stage 12. (G and H) Stage 13. (J-O) Stages 13-16. The muscle-numbering nomenclature was taken from Crossley (30) and Hooper (31). (P and R-Z) Expression of the Dmyd-acZ fusion gene in early and late embryos: (P) Stage 11 expression pattern ofthe Dmyd-f3-galactosidase fusion protein as determined with monoclonal antibody to f-galactosidase. Note the staining is now cytoplasmic rather than nuclear but is very similar to the nuclear-staining pattern shown in A. Both lateral and midline cells are now seen with the cytoplasmic staining. (Q) Late embryo stained with anti-MHC antibody (from D. Kiehart, Harvard University). (R) Late embryo stained with antiDmyd. Note the similarity between Q and R. (R-Z) Late embryos stained with antiDmyd. Downloaded by guest on September 29, 2021 Developmental Biology: Paterson et al. Proc. Natl. Acad. Sci. USA 88 (1991) 3785 myogenic-determination gene, is shown in Fig. 1. The AUG the number of mesodermal nuclei containing Dmyd increases at position 263 fits the Drosophila translation initiation con- -2- to 3-fold to a total of 30-40 per hemisegment, resulting sensus sequence, MAAM AUG (where M is A or C) (20) and in an additional ventral cluster and in a continuous band of is followed by the longest open reading frame of 332 amino nuclei in the dorsolateral region of thoracic segments 1 acids, encoding a polypeptide of 36,208 Da. Two AUG through abdominal segment 7 (Fig. S D-F). This pattern, as codons at positions 95 and 138 are immediately followed by well as the number of Dmyd-positive nuclei, is basically stop codons and do not conform to the consensus sequence. maintained until completion of germ-band retraction (stage The Amino Acid Sequences of the Basic and Helix-Loop- 13, 10-11 hr of development) (Fig. 5 G and H). However, Helix Domains Are Conserved Between Dmyd Protein and the differences in the number and pattern of stained nuclei Vertebrate Myogenic Factors. Direct comparison ofthe amino between the abdominal and more anterior segments become acid sequences of the conserved basic and helix-loop-helix increasingly apparent during this period. For example, the regions of the vertebrate myogenic factors (1-4, 7, 21-25) ventral clusters are reduced in the labium through thoracic with the same region in Dmyd is given in Fig. 2. The amino segment 3 compared with abdominal segments 1-7 (Fig. 5 G acid sequence that includes basic clusters 2 and 3, the and H), and the dorsolateral bands of labium and thoracic proposed myogenic activation domain (26), has been con- segment 1 appear to fuse to form a ring-shaped structure (Fig. served exactly from Drosophila to mouse and human in the SG). As dorsal closure begins, the level of nuclear staining MyoD and Myf5 groups (DRRKAATMRERR, in one-letter decreases rapidly. Only the nuclei of ventrally located syn- code). The helix-loop-helix region is 82% identical to MyoD, cytia in abdominal segments 1-7, representing the precursors but outside the conserved domain Dmyd is highly divergent. of muscles 26 and 27 [Fig. 51(30, 31)], and also some clusters Dmyd Is a Distinctive Gene and Is Not a Member of a in the head (Fig. SI-K), continue to show high levels ofDmyd Multigene Family. Hybridization of the Dmyd cDNA insert for an extended period. After dorsal closure, when the (clone 1) to various restriction enzyme digests of Drosophila somatic muscles have differentiated, weak nuclear staining is DNA indicates that Dmyd is not a member of a multigene still seen in several of these muscles: in the ventral external family because the same pattern of hybridization is seen oblique muscles (muscles 15, 16, and 17), the ventrolateral under low (Fig. 3) and high stringency (data not shown). The external oblique muscles (muscles 26 and 27), and the pleural gene maps to position 95A/B (data not shown). external longitudinal muscle (muscle 12) (Fig. 5 L-O). Stron- Steady-State Levels of Dmyd RNA Decrease During the ger staining persists in the pharyngeal muscles and in muscles Period of Larval Myogenesis. Northern analysis of total and of the anterior spiracles and telson (Fig. 5 J and K). poly(A)+ RNA shows a single transcript of -1.5 kb (Fig. 4). In our attempts to localize Dmyd antigen to mature muscle A weak signal is first seen at 3-6 hr of embryonic develop- nuclei, we cultured cells from Drosophila 4- to 6-hr embryos. ment with poly(A)+ RNA and reaches a maximum level of These cultures give rise to a variety of tissue types including expression around 9-12 hr. Thereafter, from =12 to 24 hr of larval muscle, nervous tissue, fat-body cells, hemocytes, and development, the signal is substantially reduced. By com- larval epidermal cells. Cultures can be treated with ecdysone parison, the 2-kb transcript for the constitutively expressed and will undergo metamorphosis, losing embryonic muscles gene, elongation factor la (EFla) (27), is seen in various (Fig. 5AA), to give rise to adult tubular (Fig. SBB) and fibrillar amounts at all early stages. Analysis of total RNA (Fig. 4) (Fig. 5CC) muscles. In no instance was Dmyd detected in the with both myosin heavy chain (MHC) and Dmyd probes, nuclei of these muscle types grown in culture; yet antibody indicates Dmyd transcription precedes that of MHC RNA. to horseradish peroxidase specifically stained all the neuronal Expression is not detected for either transcript in early pupae cells (32) (data not shown). We have not done a detailed study or in adult flys. Larval muscle formation occurs between on the kinetics of in vitro myogenesis versus the pattern of stages 13 (11.5 hr) and 16 (16-24 hr) (29-31), just as Dmyd Dmyd expression, so we could have missed any early tran- RNA levels are decreasing. Total RNA does not show the sient expression of Dmyd; however, Dmyd is clearly not decrease because the 12- to 22-hr time window is too broad. detectable in mature cultured Drosophila muscle. The Expression Pattern of Dmyd During Early Embryogen- Three observations should be noted at this stage: (i) Dmyd esis. To determine the expression pattern ofthe Dmyd protein antigen levels decrease at the onset of dorsal closure, coin- during development, affinity-purified polyclonal antibodies cident with the decrease in the steady-state levels of Dmyd were produced against a glutathione transferase-Dmyd fu- RNA and the onset oflarval myogenesis; (ii) the total number sion protein. Antibodies were specific for the fusion protein of Dmyd-positive cells does not increase substantially in total E. coli extracts and for Dmyd in extracts from enough to account-for all myoblasts in the larval muscle; and transgenic flies expressing the protein under the hsp70 pro- (iii) Dmyd-positive cells are highly organized into specific moter (data not shown). Dmyd could not be detected by abdominal and thoracic segment patterns, similar to cells that immunoblot analysis in any developmental stage in the ab- will give rise to the peripheral nervous system (18). sence of heat shock induction. This result is likely due to the The Developmental Expression ofa Dmyd-lacZ Fusion Gene small number of cells expressing the antigen (see below). Under the Control of the Dmyd Promoter. Because we could The earliest detection of Dmyd antigen is at stage 11, 6-7 not follow Dmyd expression as a stable marker for the hr after fertilization (Fig. 5 A-C). This period is when the terminal cell phenotype, we used 8 kb of5' genomic fragment germ band is fully elongated, the tracheal pits have invagi- that included the first 55 amino acid codons of Dmyd and nated, and the proliferation of mesodermal cells has almost fused it to lacZ protein in aP element vector with the idea that finished. Each of 14 segments, with the labium being the most cytoplasmic enzyme activity and antigen expressed under anterior one, shows a cluster of stained nuclei on either side control of the Dmyd promoter could be followed into later of the ventral midline and a smaller cluster laterally. A third, developmental stages. With antibodies to 8-galactosidase, small cluster of Dmyd-positive nuclei appears slightly later in the fusion protein is first seen at full germ-band extension in a dorsal position in the segments from the labium through a pattern of expression similar to the Dmyd nuclear staining abdominal segment 7 (A7) (Fig. 5 B and F). During stage 11, described above (Fig. 5P). This expression continues to

(AA-CC) Primary cultures of Drosophila muscle prepared from 4- to 6-hr embryos. (AA) Typical larval muscle. (BB) Tubular muscle formed in cultures treated with ecdysone. (CC) Fibrillar muscle formed in cultures treated with ecdysone. Tubular and fibrillar muscles are adult muscle types. 1, lateral; d, dorsal; v, ventral regions; sm, somatic musculature; a, muscle attachment site; phm, pharyngeal muscles; asp, anterior spiracles; te, telson; Lb, labial segment; Ti, thoracic segment 1; Al and A7, abdominal segments 1 and 7, respectively. Downloaded by guest on September 29, 2021 3786 Developmental Biology: Paterson et al. Proc. Natl. Acad. Sci. USA 88 (1991) mimic the overall Dmyd nuclear pattern through full germ- Dmyd is in accordance with the observed absence or low band retraction (data not shown). level ofthis factor in differentiated muscle in vivo and in vitro, When nuclear staining with Dmyd antibody is no longer but this assumption has not been formally demonstrated. detectable, cytoplasmic Dmyd staining now persists into later Note: While this manuscript was in preparation and under review, the stages due to the stability of the fusion protein (Fig. 5 R-Z). isolation of the same gene was reported by Michelson et al. (35). Numerous muscle groups are clearly stained, including the This work was supported in part by the Laboratory of Biochem- pharyngeal muscles and muscles near the anterior spiracles, istry ofthe National Cancer Institute while B.M.P. was on sabbatical suggesting each muscle includes at least one Dmyd-positive leave and by the Roche Research Foundation, the Kantons Basel, precursor cell. Note the identical pattern in the horizontal and the Swiss National Science Foundation. views stained either with antibodies to myosin (Fig. 5Q) or Dmyd (Fig. 5R). The pattern is reminscient of P3-tubulin 1. Davis, R. L., Weintraub, H. & Lassar, A. B. (1987) Cell 51, expression seen in somatic musculature and the pharynx (29). 987-1000. 2. Wright, E. W., Sassoon, D. A. & Lin, V. K. (1989) Cell 56, 607-617. DISCUSSION 3. Braun, T., Buschhausen-Denker, G., Bober, E. & Arnold, Unlike the vertebrate myogenic factor genes, which are H. H. (1989) EMBO J. 8, 701-709. expressed in practically all the nuclei of dividing myoblasts 4. Rhodes, S. J. & Konieczny, S. F. (1989) Genes Dev. 3, 2050- and newly differentiated muscle fibers (1-4, 7), Dmyd 2061. expression is transient and restricted to a 5. Tapscott, S. J., Davis, R. L., Thayer, M. J., Cheng, P.-F., subset of muscle Weintraub, H. & Lassar, A. B. (1988) Science 242, 405-411. precursor cells arranged with distinct thoracic and abdominal 6. Ingham, P. W. (1988) Nature (London) 335, 25-34. patterns. These Dmyd-expressing cells cannot account for all 7. Lin, Z.-Y., Dechesne, C. A., Eldridge, J. & Paterson, B. M. the myoblasts required to produce the 25-30 different mus- (1989) Genes Dev. 3, 986-996. cles in each hemisegment of the developing embryo (30, 31). 8. Jellies, J. (1990) Trends Neurosci. 13, 126-131. Furthermore, Dmyd expression appears absent in the nuclei 9. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1989) Molecular of larval, tubular, and fibrillar muscles differentiated in vitro Cloning:A Laboratory Manual (Cold Spring Harbor Lab., Cold and is only weakly seen in some nascent myofibers in vivo. Spring Harbor, NY), 2nd Ed. These observations are better understood when taken in 10. Dubendorfer, A., Blumer, A. & Deak, I. I. (1978) Roux's Arch. Dev. Biol. 184, 233-249. the context of what is known about muscle formation in 11. Frasch, M., Hoey, T., Rushlow, C., Doyle, H. & Levine, M. insects. The concept of the muscle pioneer or founder cell (1987) EMBO J. 6, 749-759. was described in the developing grasshopper (for review, see 12. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, ref. 8), where one could identify large single cells of meso- R., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988) Science dermal origin attached to the ectoderm at sites that marked 239, 487-491. the insertion points of the future muscle fascicles. These 13. Poole, S., Kauvar, L. M., Drees, B. & Kornberg, T. (1985) Cell pioneer cells serve as organizing centers for smaller meso- 40, 37-43. dermal cells that collect nearby and subsequently fuse with 14. McGinnis, W., Levine, M., Hafen, E., Kuroiwa, A. & Gehring, the pioneer cell to form a particular muscle. Muscles cannot W. J. (1984) Nature (London) 308, 428-433. 15. Hiromi, Y., Kuroiwa, A. & Gehring, W. J. (1985) Cell 43, form from mesodermal cells alone when the pioneer cell is 603-613. ablated (8). 16. Smith, D. B. & Johnson, K. S. (1988) Gene 67, 31-40. More recent studies suggested that founder cells for indi- 17. Lasko, P. F. & Ashburner, M. (1990) Genes Dev. 4, 905-921. vidual muscles, equivalent to the pioneer cells in the grass- 18. Ghysen, A. & O'Kane, C. J. (1989) Development 105, 35-52. hopper, also play a role during embryonic development of 19. Pardue, M. L. (1986) in Drosophila: A Practical Approach, ed. larval muscles in Drosophila. In a morphological study, Bate Roberts, D. B. (IRL, Oxford), pp. 111-138. (33) has concluded that each of the future larval muscles is 20. Cavener, D. R. (1987) Nucleic Acids Res. 15, 1353-1361. prefigured by an appropriately located, syncytial precursor 21. Braun, T., Bober, E., Winter, B., Rosenthal, N. & Arnold, by the end of germ-band shortening. These precursors seem H. H. (1990) EMBO J. 9, 821-831. 22. Miner, J. H. & Wold, B. (1990) Proc. Natl. Acad. Sci. USA 87, to originate from doublets or triplets of fused mesodermal 1089-1093. cells seen at even earlier stages, which, in turn, are thought 23. Braun, T., Bober, E., Buschhausen-Denker, G., Kotz, S., to be derived from individual founder cells. Although, in Grzeschik, K.-H. & Arnold, H. H. (1989) EMBO J. 8, 3617- contrast to the grasshopper system, these putative founder 3625. cells cannot be recognized morphologically in Drosophila, 24. Hopwood, N. D., Pluck, A. & Gurdon, J. B. (1989) EMBO J. the expression of Dmyd in a segment-specific pattern in a 8, 3409-3417. subset of defined mesodermal cells at a stage shortly before 25. Harvey, R. P. (1990) Development 108, 669-680. the occurrence of syncytial muscle precursors, as well as the 26. Davis, R. L., Cheng, P.-F., Lassar, A. B. & Weintraub, H. observation that cells expressing the Dmyd-3-galactosidase (1990) Cell 60, 733-746. 27. Walldorf, U., Hovemann, B. & Bautz, E. K. F. (1985) Proc. fusion protein are incorporated into most larval muscles, Natd. Acad. Sci. USA 82, 5795-5799. strongly suggests that these cells correspond to founder 28. Collier, V. L., Kronert, W. A., O'Donnell, P. T., Edwards, myoblasts. This idea is further supported by the fact that K. A. & Bernstein, S. I. (1990) Genes Dev. 4, 885-895. Dmyd expression starts at about the same time as that of the 29. Leiss, D., Hinz, U., Gasch, A., Mertz, R. & Renkawitz-Pohl, homeobox gene S59 (34), a marker for cells to be incorpo- R. (1988) Development 104, 525-531. rated into particular larval muscles, including muscles 26 and 30. Crossley, A. C. (1978) in The Genetics and Biology ofDroso- 27, similar to Dmyd (Fig. 5). phila, eds. Ashburner, M. & Wright, T. R. F. (Academic, New We suggest that the organization of the founder cells, York), pp. 499-560. 25-40 per hemisegment, establishes the future muscle pat- 31. Hooper, J. E. (1986) EMBO J. 5, 2321-2329. 32. Jan, L. Y. & Jan, N. J. (1982) Proc. Natl. Acad. Sci. USA 79, tern in each segment. The founder cells recruit uncommitted 2700-2704. mesodermal cells into a syncytium that then matures to 33. Bate, M. (1990) Development 110, 791-804. establish the muscle in question. In most cases Dmyd expres- 34. Dohrmann, C., Azpiazu, N. & Frasch, M. (1990) Genes Dev. 4, sion would cease or be reduced to very low levels just before 2098-2111. or during syncytium formation. Our assumption that the 35. Michelson, A. M., Abmayr, S. M., Bate, M., Arias, A. M. & recruited nascent myoblasts do not necessarily express Maniatis, T. (1990) Gene Dev. 4, 2086-2097. Downloaded by guest on September 29, 2021