DOCSLIB.ORG

Characterization of Microsatellite Loci in Brighamia Insignis and Transferability to Other Genera in the Hawai‘Ian Lobelioid Group

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of Microsatellite Loci in Brighamia Insignis and Transferability to Other Genera in the Hawai‘Ian Lobelioid Group PRIMER NOTE Characterization of microsatellite loci in Brighamia insignis and transferability to other genera in the Hawai‘ian lobelioid group Jeremie B. Fant1,2,4 , Mereida Fluckes1,3, Evana James1,3, Hilary Noble1, and Jordan Wood1,2 Manuscript received 20 August 2019; revision accepted PREMISE: Microsatellite markers were developed to measure genetic diversity and relatedness 22 September 2019. of ex situ collections of Brighamia insignis (Campanulaceae). 1 Plant Science and Conservation, Chicago Botanic Garden, 1000 Lake Cook Road, Glencoe, Illinois 60022, USA METHODS AND RESULTS: Potential microsatellite markers were identified from two sources; 28 2 Plant Biology and Conservation, Northwestern University, O. T. were developed for B. insignis and an additional 12 markers from a previously published study Hogan Hall, 2205 Tech Drive, Evanston, Illinois 60208, USA of Lobelia villosa. Primer pairs were tested on 30 individuals of B. insignis and 24 individuals of 3 University of Illinois at Urbana-Champaign, Champaign, Illinois B. rockii to provide measures of genetic diversity and inbreeding. We assessed cross-species 61820, USA amplification in an additional 13 taxa that represented all six genera within the Hawai‘ian 4 Author for correspondence: [email protected] lobelioid group to determine the broader applicability of the markers. Citation: Fant, J. B., M. Fluckes, E. James, H. Noble, and J. Wood. CONCLUSIONS: Results indicate that these primers will provide useful estimates of genetic 2019. Characterization of microsatellite loci in Brighamia insignis and transferability to other genera in the Hawai‘ian lobelioid diversity and relatedness of ex situ collections of both Brighamia species. In addition, we group. Applications in Plant Sciences 7(11): e11303. have also demonstrated the widespread applicability of these markers for use in population doi:10.1002/aps3.11303 genetic studies of several species within the Hawai‘ian lobelioid group. KEY WORDS Brighamia; Campanulaceae; cross-amplification; Hawai‘ian lobelioids; Lobelia; microsatellites. With over 126 species, the Hawai‘ian lobelioids represent one of the best in collections; however, the majority of individuals have uncertain examples of adaptive radiation (Givnish et al., 2009). Unfortunately, parentage. Neutral molecular markers can be used to estimate re- for many species in this group, wild populations are so reduced that latedness of individuals with unknown parentage. Unfortunately, they are now of high conservation concern. For example, the genus previous genetic markers used for Brighamia studies have revealed Brighamia A. Gray is composed of two species, B. insignis A. Gray and only a limited amount of genetic diversity (Gemmill et al., 1998; B. rockii H. St. John, which were once found on multiple Hawai‘ian Walsh, 2015). Here we report 28 microsatellite markers developed islands (Gemmill et al., 1998) but are currently reduced to only one for B. insignis and 12 published primers from Lobelia villosa (Rock) individual of B. insignis and fewer than 100 individuals of B. rockii H. St. John & Hosaka (Tran et al., 2015) that were tested on B. in- (Walsh, 2016). Fortunately, the National Tropical Botanical Garden signis and B. rockii, as well as on an additional 13 taxa that repre- began making collections in the 1970s and has distributed germplasm sented all six genera in the Hawai‘ian lobelioid group. to botanic gardens around the world (Hannon and Perlman, 2002). According to the global plant collections database PlantSearch (https :// tools.bgci.org/plant_search.php), at least 56 other botanic gardens METHODS AND RESULTS maintain collections of this species. This conservation effort helped B. insignis escape extinction and could ultimately provide potential Genomic DNA was extracted using the modified 2× cetyltrimeth- in situ restoration material. However, recent genetic analysis of the ylammonium bromide (CTAB) method (Doyle and Doyle, 1987). ex situ populations suggests a loss of genetic diversity and fitness de- We tested all primers on 15 taxa that represented the six genera clines associated with inbreeding depression (Walsh, 2015). within the Hawai‘ian lobelioid group; for each taxon, one to two This loss of genetic diversity could be mitigated by developing a samples were tested. These included both species of Brighamia (B. in- robust breeding program that incorporates genetic data into breed- signis and B. rockii), two species of Clermontia Gaudich. (C. fau- ing decisions and ex situ management (Fant et al., 2016). An im- riei H. Lév. and C. samuelii C. N. Forbes subsp. hanaensis (H. St. portant first step in this process is to track the origins of all material John) Lammers), six species of Cyanea Gaudich. (C. fissa Hilldebr., Applications in Plant Sciences 2019 7(11): e11303; http://www.wileyonlinelibrary.com/journal/AppsPlantSci © 2019 Fant et al. Applications in Plant Sciences is published by Wiley Periodicals, Inc. on behalf of the Botanical Society of America. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made. 1 of 6 Applications in Plant Sciences 2019 7(11): e11303 Fant et al.—Brighamia microsatellites • 2 of 6 TABLE 1. Characteristics of 30 microsatellite loci used for screening in this study, including 18 newly developed markers for Brighamia insignis and 12 previously published markers for Lobelia villosa. Allele size GenBank accession Species and locus Primer sequences (5′–3′) Repeat motif range (bp) Fluorescent label no.a Brighamia insignis BRIN01 (GA) 202–222 Green [D3-PA] MK387344 F: CTTGTTGCAGGATGGGAGTT 17 R: GGGTATCCACCCTTTCCTTC BRIN05 (GT) 181–207 Blue [D4-PA] MK387346 F: GAATGGTTTTCACTTTCCCAAC 17 R: ATCTCTTACCCCGGAAGCAC BRIN07 (TG) (AG) 167 Green [D3-PA] MK387347 F: TTCAGCACAGATCCCTTTTG 16 7 R: TCCAGATTCAGCTCCTCCAG BRIN08 (TG) 146–154 Blue [D4-PA] MK387348 F: AGACGGCTCGGGGTATAACT 12 R: GTACCATTCTCGTATTTACCCA BRIN10 (CT) (CA) 148–186 Blue [D4-PA] MK387349 F: CAGCTGTTACCGTCTTCTGC 11 14 R: TTTCTAAAGTTACAAAATCAAGG BRIN41 (TG) 111–125 Black [D2-PA] MK387352 F: CAACGCTGATGATGATGATTG 14 R: ACCCTTCGTTCCAAAGATCC BRIN43 (CT) 174–248 Blue [D4-PA] MK387354 F: GGACCAACAATTGGAGAAACA 27 R: CTGATGCTGAACATCTGTAAACAA BRIN44 (AG) 142–162 Black [D2-PA] MK387355 F: ACTGGATTGAAAGCCTTACTTTG 14 R: CTAATGCACATTTTTGGATTGCT BRIN46 (TC) (AC) 232–254 Blue [D4-PA] MK387357 F: GGAAAACTGATGTGCGTTGA 13 10 R: TTGCTTCATGACTTGAGCTTG BRIN47 (GT) 152–188 Green [D3-PA] MK387358 F: CCCCTCCATTTCAAGGTTCT 12 R: CCTCAGCAGGGGAAAAGTAA BRIN51 (CT) (CA) 170–208 Green [D3-PA] MK387362 F: GACAAGGGACATGGCTGTTT 16 12 R: TGAGAGTTTGATCTGCACAAAA BRIN53 (AG) 165–177 Green [D3-PA] MK387363 F: GCTTGTTGCACAACATGAAA 12 R: TGATAGTCACAGTTTGGCTGA BRIN54 (GT) 168–176 Green [D3-PA] MK387364 F: TGTGAATGGCTGGTTGGTAA 9 R: GCCTAAAGGCAAAGAGTTTGAA BRIN56 (CA) 104 Black [D2-PA] MK387366 F: CGCGAAGTCCAGAAGAAAAC 11 R: TTTTGTTTCACTCTTCGTCCA BRIN57 (GT) (GA) 223–233 Blue [D4-PA] MK387367 F: TGGGAGAAAATTGAAAGCAAA 7 22 R: GTACAAAGAATCCACTCACTCGC BRIN59 (GA) — Green [D3-PA] MK387351 F: ACCAGGGATTGTTCGCTAAG 29 R: GGCTCTGTGGCATTCAAAGT BRIN61 (AG) 183–191 Green [D3-PA] MK387369 F: GTGAGCTGGGTGGTTGTTTT 14 R: AGGAGGACCCCTCAACAATC BRIN66 (GT) (GA) 157–181 Blue [D4-PA] MK387370 F: GTACTGCATGCCCTGTGTT 10 10 R: GATGCGCTCAAACGAGAGTT Lobelia villosa LOVI4 (AC) 248–268 M13F-green [D3-PA] F: ACGTCTAGGGGCACTGCCAAGCCAG 12 R: TCCAAATGGGAGACTACTGCAGAAAGG LOVI23 (AC) 401–437 M13F-blue [D4-PA] F: TCTTTTGTCCATGCCAGCGTG 11 R: AGGTACTCGGTCTGAGCGTTTCG LOVI33 (GT) (GA) 372–378 M13F-black [D2-PA] F: ACAGGGGGCAAAACTGGTCACC 8 9 R: TGCAAGGATGACGAAGGGGCTC LOVI34 (CA) 155 M13F-blue [D4-PA] F: ACAGGCGCTATGGCGTCCCT 10 R: GTTGTATGCATCATGAGACCGTC LOVI35 (CA) 230–256 M13F-black [D2-PA] F: GCTTACAACAAATTGCCTC 17 R: AGCCTCGAAATCATCCGGCCCA LOVI37 (GA) 470–478 M13F-green [D3-PA] F: GGATCACTCAAGGATGAACTCGCAAGG 14 R: TGTGTAATGGACCTTGGGCTGTCTC LOVI48 (AC) A(AC) 400–420 M13F-green [D3-PA] F: TCACCGAACGATTCATCGAACCA 7 5 R: ACGAGTGAGAGACTTTTGGGTGATCA LOVI52 (AC) — M13F-blue [D4-PA] F: CGAATGATCTATTATTCCAGCC 11 R: AGACACTTCCTCGAGTTGGTG LOVI56 (CT) (CA) 536–640 M13F-black [D2-PA] F: AGCATCAGCAAGACACTTGC 9 14 R: AGTAAGGGATAAAGCAGACCTGG LOVI73 (CA) 468–478 M13F-black [D2-PA] F: TCACAAATGCTCCATCGCGAG 9 R: TGTAGCGGAAAGTACCGGATCCA LOVI90 (CA) 200–206 M13F-blue [D4-PA] F: ACCGGCTGTAATCACGCGTTGG 12 R: CTACTGTGTGAAGTCGGAAAACC LOVI93 (GT) 287–397 M13F-green [D3-PA] F: TCTAGCAGAAGCCTCACCCCGGA 10 R: CACCAGAACTCAAGCAAGGCGAC Note: — = no amplified product. aAccession numbers are provided for loci developed for Brighamia insignis. Loci for Lobelia villosa were previously published in Tran et al. (2015). http://www.wileyonlinelibrary.com/journal/AppsPlantSci © 2019 Fant et al. Applications in Plant Sciences 20197(11):e11303 inPlant Applications h ttp://www.wileyonlinelibrary.com/journal/AppsPlantSci TABLE 2. Allele size ranges for the 18 newly developed markers for Brighamia insignis and 12 previously published markers for Lobelia villosa, tested on 15 taxa from the Hawai‘ian lobelioid complex.a Brighamia Brighamia Clermontia Clermontia Cyanea Cyanea Cyanea Cyanea Cyanea Cyanea Delissea Delissea Delissea Lobelia insignis rockii fauriei samuelii fissa hardyi leptostegia hirtella pseudofauriei salicina kauaiensis rhytidosperma waianaeensis niihauensis Trematolobelia Locus (n = 30) (n = 24) (n = 2) (n = 1) (n = 2) (n = 2) (n =
Load more

Recommended publications
  • Handbook Publication.Pub
    Table of Contents Maui County’s Landscape and Gardening Handbook Xeriscaping in Maui County ................................................................. 1 Planning and Design................................................................................................................. 1 Hydro-zones.............................................................................................................................. 1 Plant Selection and the Maui jkCounty Planting Zones............................................................ 2 Soil Preparation ........................................................................................................................ 4 Mulching.................................................................................................................................... 5 Irrigation .................................................................................................................................... 5 Maintenance ............................................................................................................................. 7 Other Interesting Techniques for the Ambitious ..................................... 8 Xeriscape Ponds....................................................................................................................... 8 Aquaponics in the Backyard ..................................................................................................... 9 Water Polymer Crystals ...........................................................................................................
    [Show full text]
  • The Bulletin, 2019 Fall/Winter Issue
    keep cool, Major seed storage findings stay dry, published and you may live long BY DUSTIN WOLKIS, SEED BANK AND LABORATORY MANAGER AND MARIAN CHAU, KALEHUA SEED CONSERVATION CONSULTING n the summer of 1989 NTBG’s future Breadfruit Institute Director Dr. Diane Ragone collected seeds from the critically endangered papala (Charpentiera densiflora), at Kahanu Garden on Maui, marking this as the oldest known collection in Hawai‘i. IAt that time, the Kew Millennium Seed Bank was still seven years from establishment, and the Svalbard Global Seed Vault wouldn’t be constructed until 2008, the same year NTBG’s Juliet Rice Wichman Botanical Research Center and future site of the NTBG Seed Bank and Laboratory was completed. NTBG has banked seeds every year since, and conserving these early collections for future use showed incredible forethought by NTBG staff. Seed banking, especially at botanical institutions, would not hit the mainstream for at least another decade. But what would the shelf life of these collections be, and at what intervals should they be re-collected? The term “seed storage behavior” describes the physiological response to storage methods. If seeds tolerate desiccation and freezing, they are considered to have “orthodox behavior.” Until the early 2000s, it was assumed that because of Hawai‘i’s tropical location, the conventional storage methods of desiccating and freezing seeds would prove lethal to the majority of the Hawaiian flora, and therefore seeds from MARIAN CHAU COLLECTING SEEDS FROM METROSIDEROS POLYMORPHA ON OʻAHU.
    [Show full text]
  • *Wagner Et Al. --Intro
    NUMBER 60, 58 pages 15 September 1999 BISHOP MUSEUM OCCASIONAL PAPERS HAWAIIAN VASCULAR PLANTS AT RISK: 1999 WARREN L. WAGNER, MARIE M. BRUEGMANN, DERRAL M. HERBST, AND JOEL Q.C. LAU BISHOP MUSEUM PRESS HONOLULU Printed on recycled paper Cover illustration: Lobelia gloria-montis Rock, an endemic lobeliad from Maui. [From Wagner et al., 1990, Manual of flowering plants of Hawai‘i, pl. 57.] A SPECIAL PUBLICATION OF THE RECORDS OF THE HAWAII BIOLOGICAL SURVEY FOR 1998 Research publications of Bishop Museum are issued irregularly in the RESEARCH following active series: • Bishop Museum Occasional Papers. A series of short papers PUBLICATIONS OF describing original research in the natural and cultural sciences. Publications containing larger, monographic works are issued in BISHOP MUSEUM four areas: • Bishop Museum Bulletins in Anthropology • Bishop Museum Bulletins in Botany • Bishop Museum Bulletins in Entomology • Bishop Museum Bulletins in Zoology Numbering by volume of Occasional Papers ceased with volume 31. Each Occasional Paper now has its own individual number starting with Number 32. Each paper is separately paginated. The Museum also publishes Bishop Museum Technical Reports, a series containing information relative to scholarly research and collections activities. Issue is authorized by the Museum’s Scientific Publications Committee, but manuscripts do not necessarily receive peer review and are not intended as formal publications. Institutions and individuals may subscribe to any of the above or pur- chase separate publications from Bishop Museum Press, 1525 Bernice Street, Honolulu, Hawai‘i 96817-0916, USA. Phone: (808) 848-4135; fax: (808) 841-8968; email: [email protected]. Institutional libraries interested in exchanging publications should write to: Library Exchange Program, Bishop Museum Library, 1525 Bernice Street, Honolulu, Hawai‘i 96817-0916, USA; fax: (808) 848-4133; email: [email protected].
    [Show full text]
  • The Bulletin, 2020 Summer-Fall Issue
    Vol. XXXVI No. 2 SUMMER-FALL 2020 the bulletinof the National Tropical Botanical Garden THE BULLETIN OF NTBG | SUMMER-FALL 2020 1 contents 3 MESSAGE FROM THE CEO/DIRECTOR ON THE COVER Planting hope The endemic Dubautia-Sadleria shrubland- fernland below the summit of Kawaikini, Kaua‘i’s highest peak (5,243 ft.), is a prime features example of healthy native Hawaiian habitat free of disease and invasive species. Photo for the future… by Ken Wood 6 HOW NTBG CONTRIBUTES TO PLANT HEALTH The Bulletin is a publication for supporters by NTBG staff of the National Tropical Botanical Garden, a not-for-profit institution dedicated to tropical plant conservation, scientific During this unprecedented pause, scientists, policy makers, and 14 TWO DECADES AFTER RESTORATION, research, and education. global leaders are highlighting the opportunity to safeguard our REFLECTIONS ON PI‘ILANIHALE environment in new ways as the world reopens. In the midst of We encourage you to share this HEIAU RISING publication with your family and friends. uncertainty, our core mission of saving plants is relevant, timely, by Chipper Wichman with Mike Opgenorth If your household is receiving more than and vital to a brighter future. Please consider joining us at this one copy and you wish to receive only critical juncture by using the enclosed envelope to make your one, please inform our Development 22 NTBG AUDITS THE SEED BANK Office at our national headquarters at: contribution today. To donate online, go to ntbg.org/donate. TAKING STOCK [email protected]. by Kelli Jones National Tropical Botanical Garden 3530 Papalina Road, Kalāheo 24 GOING NATIVE IN SOUTH FLORIDA Hawai‘i 96741 USA by Craig Morell Tel.
    [Show full text]
  • 9:00 Am PLACE
    CARTY S. CHANG INTERIM CHAIRPERSON DAVID Y. IGE BOARD OF LAND AND NATURAL RESOURCES GOVERNOR OF HAWAII COMMISSION ON WATER RESOURCE MANAGEMENT KEKOA KALUHIWA FIRST DEPUTY W. ROY HARDY ACTING DEPUTY DIRECTOR – WATER AQUATIC RESOURCES BOATING AND OCEAN RECREATION BUREAU OF CONVEYANCES COMMISSION ON WATER RESOURCE MANAGEMENT STATE OF HAWAII CONSERVATION AND COASTAL LANDS CONSERVATION AND RESOURCES ENFORCEMENT DEPARTMENT OF LAND AND NATURAL RESOURCES ENGINEERING FORESTRY AND WILDLIFE HISTORIC PRESERVATION POST OFFICE BOX 621 KAHOOLAWE ISLAND RESERVE COMMISSION LAND HONOLULU, HAWAII 96809 STATE PARKS NATURAL AREA RESERVES SYSTEM COMMISSION MEETING DATE: April 27, 2015 TIME: 9:00 a.m. PLACE: Department of Land and Natural Resources Boardroom, Kalanimoku Building, 1151 Punchbowl Street, Room 132, Honolulu. AGENDA ITEM 1. Call to order, introductions, move-ups. ITEM 2. Approval of the Minutes of the June 9, 2014 N atural Area Reserves System Commission Meeting. ITEM 3. Natural Area Partnership Program (NAPP). ITEM 3.a. Recommendation to the Board of Land and Natural Resources approval for authorization of funding for The Nature Conservancy of Hawaii for $663,600 during FY 16-21 for continued enrollment in the natural area partnership program and acceptance and approval of the Kapunakea Preserve Long Range Management Plan, TMK 4-4-7:01, 4-4-7:03, Lahaina, Maui. ITEM 3.b. Recommendation to the Board of Land and Natural Resources approval for authorization of funding for The Nature Conservancy of Hawaii for $470,802 during FY 16-21 for continued enrollment in the natural area partnership program and acceptance and approval of the Pelekunu Long Range Management Plan, TMK 5-4- 3:32, 5-9-6:11, Molokai.
    [Show full text]
  • The Bulletin, 2019 Fall/Winter Issue
    Vol XXXV No. 3 FALL-WINTER 2019 the bulletinof the National Tropical Botanical Garden contents From all of us at NTBG, 3 MESSAGE FROM THE CEO/DIRECTOR ON THE COVER The green, red, and white in this American here's wishing you and your family the very best holly (Ilex opaca) illustration captures features the spirit of the season. This issue of The Bulletin features works by members of holiday season and a happy new year. 4 KEEP COOL, STAY DRY, AND YOU MAY NTBG’s Florilegium Society including LIVE LONG botanical artist and instructor Wendy Hollender (cover image). by Dustin Wolkis and Marian Chau The Bulletin is a publication for supporters of the National Tropical Botanical Garden, 8 SPLITTING HAIRS (EVEN WHEN THERE a not-for-profit institution dedicated to ARE NONE) tropical plant conservation, scientific by Dr. David H. Lorence research, and education. We encourage you to share this 18 INTERVIEW: DR. NINA RØNSTED, publication with your family and friends. NTBG’S NEW DIRECTOR OF SCIENCE If your household is receiving more than one copy and you wish to receive only AND CONSERVATION one, please inform our Development Office at our national headquarters at: [email protected]. in every issue National Tropical Botanical Garden 3530 Papalina Road, Kalāheo RED LISTED Hawai‘i 96741 USA 12 Tel. (808) 332-7324 Fax (808) 332-9765 THE GREEN THUMB [email protected] 13 www. ntbg.org 16 GARDEN SPROUTS ©2019 National Tropical Botanical Garden News from around the Garden ISSN 1057-3968 All rights reserved. Photographs are the property of NTBG unless otherwise noted.
    [Show full text]
  • 5-YEAR REVIEW Short Form Summary Species Reviewed: Bidens Wiebkei (Kookoolau) Current Classification: Endangered Federal Regis
    5-YEAR REVIEW Short Form Summary Species Reviewed: Bidens wiebkei (kookoolau) Current Classification: Endangered Federal Register Notice announcing initiation of this review: [USFWS] U.S. Fish and Wildlife Service. 2009. Endangered and threatened wildlife and plants; initiation of 5-year reviews of 103 species in Hawaii. Federal Register 74(49):11130-11133. Lead Region/Field Office: Region 1/Pacific Islands Fish and Wildlife Office (PIFWO), Honolulu, Hawaii Name of Reviewer(s): Marie Bruegmann, Plant Recovery Coordinator, PIFWO Jess Newton, Recovery Program Lead, PIFWO Assistant Field Supervisor for Endangered Species, PIFWO Methodology used to complete this 5-year review: This review was conducted by staff of the Pacific Islands Fish and Wildlife Office of the U.S. Fish and Wildlife Service (USFWS), beginning on March 16, 2009. The review was based on final critical habitat designations for Bidens wiebkei and other species from the island of Molokai (USFWS 2003) as well as a review of current, available information. The National Tropical Botanical Garden provided an initial draft of portions of the review and recommendations for conservation actions needed prior to the next five-year review. The evaluation of Samuel Aruch, biological consultant, was reviewed by the Plant Recovery Coordinator. The document was then reviewed by the Recovery Program Lead and the Assistant Field Supervisor for Endangered Species before submission to the Field Supervisor for approval. Background: For information regarding the species listing history and other facts, please refer to the Fish and Wildlife Service’s Environmental Conservation On-line System (ECOS) database for threatened and endangered species (http://ecos.fws.gov/tess_public).
    [Show full text]
  • Department of the Interior Fish and Wildlife Service
    Friday, April 5, 2002 Part II Department of the Interior Fish and Wildlife Service 50 CFR Part 17 Endangered and Threatened Wildlife and Plants; Revised Determinations of Prudency and Proposed Designations of Critical Habitat for Plant Species From the Island of Molokai, Hawaii; Proposed Rule VerDate Mar<13>2002 12:44 Apr 04, 2002 Jkt 197001 PO 00000 Frm 00001 Fmt 4717 Sfmt 4717 E:\FR\FM\05APP2.SGM pfrm03 PsN: 05APP2 16492 Federal Register / Vol. 67, No. 66 / Friday, April 5, 2002 / Proposed Rules DEPARTMENT OF THE INTERIOR the threats from vandalism or collection materials concerning this proposal by of this species on Molokai. any one of several methods: Fish and Wildlife Service We propose critical habitat You may submit written comments designations for 46 species within 10 and information to the Field Supervisor, 50 CFR Part 17 critical habitat units totaling U.S. Fish and Wildlife Service, Pacific RIN 1018–AH08 approximately 17,614 hectares (ha) Islands Office, 300 Ala Moana Blvd., (43,532 acres (ac)) on the island of Room 3–122, P.O. Box 50088, Honolulu, Endangered and Threatened Wildlife Molokai. HI 96850–0001. and Plants; Revised Determinations of If this proposal is made final, section Prudency and Proposed Designations 7 of the Act requires Federal agencies to You may hand-deliver written of Critical Habitat for Plant Species ensure that actions they carry out, fund, comments to our Pacific Islands Office From the Island of Molokai, Hawaii or authorize do not destroy or adversely at the address given above. modify critical habitat to the extent that You may view comments and AGENCY: Fish and Wildlife Service, the action appreciably diminishes the materials received, as well as supporting Interior.
    [Show full text]
  • Comparing the IUCN's EICAT and Red List to Improve
    A peer-reviewed open-access journal NeoBiota 62: 509–523Comparing (2020) the IUCN’s EICAT and Red List to improve impact assessments 509 doi: 10.3897/neobiota.62.52623 RESEARCH ARTICLE NeoBiota http://neobiota.pensoft.net Advancing research on alien species and biological invasions Comparing the IUCN’s EICAT and Red List to improve assessments of the impact of biological invasions Dewidine Van der Colff1,2, Sabrina Kumschick1,2, Wendy Foden3,4, John R. U. Wilson1,2 1 South African National Biodiversity Institute, Kirstenbosch Research Centre, Cape Town, South Africa 2 Centre for Invasion Biology, Department of Botany and Zoology, Stellenbosch University, Stellenbosch, South Africa 3 Cape Research Centre, South African National Parks, Tokai, 7947, Cape Town, South Africa 4 Global Change Biology Group, Department of Botany and Zoology, Stellenbosch University, South Africa Corresponding author: Dewidine Van der Colff ([email protected]) Academic editor: S. Bacher | Received 27 March 2020 | Accepted 13 August 2020 | Published 15 October 2020 Citation: Van der Colff D, Kumschick S, Foden W, Wilson JRU (2020) Comparing the IUCN’s EICAT and Red List to improve assessments of the impact of biological invasions. In: Wilson JR, Bacher S, Daehler CC, Groom QJ, Kumschick S, Lockwood JL, Robinson TB, Zengeya TA, Richardson DM (Eds) Frameworks used in Invasion Science. NeoBiota 62: 509–523. https://doi.org/10.3897/neobiota.62.52623 Abstract The IUCN recommends the use of two distinct schemes to assess the impacts of biological invasions on biodiversity at the species level. The IUCN Red List of Threatened Species (Red List) categorises native species based on their risk of extinction.
    [Show full text]
  • 5-YEAR REVIEW Short Form Summary Species Reviewed: Pritchardia Munroi (Lo‘Ulu) Current Classification: Endangered
    5-YEAR REVIEW Short Form Summary Species Reviewed: Pritchardia munroi (lo‘ulu) Current Classification: Endangered Federal Register Notice announcing initiation of this review: [USFWS] U.S. Fish and Wildlife Service. 2009. Endangered and threatened wildlife and plants; initiation of 5-year reviews of 103 species in Hawaii. Federal Register 74(49):11130-11133. Lead Region/Field Office: Region 1/Pacific Islands Fish and Wildlife Office (PIFWO), Honolulu, Hawaii Name of Reviewer(s): Marie Bruegmann, Plant Recovery Coordinator, PIFWO Jess Newton, Recovery Program Lead, PIFWO Assistant Field Supervisor for Endangered Species, PIFWO Methodology used to complete this 5-year review: This review was conducted by staff of the Pacific Islands Fish and Wildlife Office of the U.S. Fish and Wildlife Service (USFWS), beginning on March 16, 2009. The review was based on final critical habitat designation for plant species from the island of Molokai (USFWS 2003), as well as a review of current, available information. The National Tropical Botanical Garden provided an initial draft of portions of the review and recommendations for conservation actions needed prior to the next five-year review. The evaluation of Tamara Sherrill, biological consultant, was reviewed by the Plant Recovery Coordinator. The document was then reviewed by the Recovery Program Lead and the Assistant Field Supervisor for Endangered Species before submission to the Field Supervisor for approval. Background: For information regarding the species listing history and other facts, please refer to the Fish and Wildlife Service’s Environmental Conservation On-line System (ECOS) database for threatened and endangered species (http://ecos.fws.gov/tess_public). Application of the 1996 Distinct Population Segment (DPS) Policy: This Policy does not apply to plants.
    [Show full text]
  • Native Coastal Flora and Plant Communities in Hawai`I: Their Composition, Distribution, and Status
    Technical Report HCSU-014 NATIVE COASTAL FLORA AND PLANT COMMUNITIES IN HAWAI`I: THEIR COMPOSITION, DISTRIBUTION, AND STATUS Fredrick R. Warshauer1 James D. Jacobi2 Jonathan P. Price1 1Hawai`i Cooperative Studies Unit, University of Hawai`i at Hilo, Pacifi c Aquaculture and Coastal Resources Center, P.O. Box 44, Hawai`i National Park, HI 96718 2U.S. Geological Survey, Pacifi c Island Ecosystems Research Center, 677 Ala Moana Blvd., Suite 615, Honolulu, HI 96813 Hawai`i Cooperative Studies Unit University of Hawai`i at Hilo Pacifi c Aquaculture and Coastal Resources Center (PACRC) 200 W. Kawili St. Hilo, HI 96720 (808) 933-0706 December 2009 The views and conclusions contained in this document are those of the authors and should not be interpreted as representing the opinions or policies of the U.S. Government. Mention of trade names or commercial products does not constitute their endorsement by the U.S. Government. Technical Report HCSU-014 NATIVE COASTAL FLORA AND PLANT COMMUNITIES IN HAWAʻI: THEIR COMPOSITION, DISTRIBUTION, AND STATUS Fredrick R. Warshauer1 James D. Jacobi2 Jonathan P. Price1 1 Hawai‘i Cooperative Studies Unit, University of Hawai‘i at Hilo, Pacific Aquaculture and Coastal Resources Center, Kilauea Field Station, Hawai‘i National Park, HI 96718 2U.S. Geological Survey, Pacific Island Ecosystems Research Center, 677 Ala Moana Blvd., Suite 615, Honolulu, HI 96813 KEY WORDS Hawai‘i, coastal, plants, resource management, endangered species CITATION Warshauer, F. R., J. D. Jacobi, and J. Price 2009. Native coastal flora and plant communities in Hawai‘i: Their composition, distribution, and status. Hawai‘i Cooperative Studies Unit Technical Report HCSU-014.
    [Show full text]
  • Santalum Freycinetianum Var. Lanaiense Lanai Sandalwood (‘Iliahi)
    Santalum freycinetianum var. lanaiense Lanai sandalwood (‘iliahi) 5-Year Review Summary and Evaluation U.S. Fish and Wildlife Service Pacific Islands Fish and Wildlife Office Honolulu, Hawaii 5-YEAR REVIEW Species reviewed: Santalum freycinetianum var. lanaiense / Lanai sandalwood (‘iliahi) TABLE OF CONTENTS 1.0 GENERAL INFORMATION ........................................................................................... 3 1.1 Reviewers .......................................................................................................................3 1.2 Methodology used to complete the review:................................................................. 3 1.3 Background: .................................................................................................................. 3 2.0 REVIEW ANALYSIS........................................................................................................ 5 2.1 Application of the 1996 Distinct Population Segment (DPS) policy......................... 5 2.2 Recovery Criteria.......................................................................................................... 5 2.3 Updated Information and Current Species Status .................................................... 7 2.4 Synthesis.......................................................................................................................14 3.0 RESULTS .........................................................................................................................16 3.1 Recommended Classification:...................................................................................
    [Show full text]