PRIMER NOTE Characterization of microsatellite loci in Brighamia insignis and transferability to other genera in the Hawai‘ian lobelioid group Jeremie B. Fant1,2,4 , Mereida Fluckes1,3, Evana James1,3, Hilary Noble1, and Jordan Wood1,2 Manuscript received 20 August 2019; revision accepted PREMISE: Microsatellite markers were developed to measure genetic diversity and relatedness 22 September 2019. of ex situ collections of Brighamia insignis (Campanulaceae). 1 Plant Science and Conservation, Chicago Botanic Garden, 1000 Lake Cook Road, Glencoe, Illinois 60022, USA METHODS AND RESULTS: Potential microsatellite markers were identified from two sources; 28 2 Plant Biology and Conservation, Northwestern University, O. T. were developed for B. insignis and an additional 12 markers from a previously published study Hogan Hall, 2205 Tech Drive, Evanston, Illinois 60208, USA of Lobelia villosa. Primer pairs were tested on 30 individuals of B. insignis and 24 individuals of 3 University of Illinois at Urbana-Champaign, Champaign, Illinois B. rockii to provide measures of genetic diversity and inbreeding. We assessed cross-species 61820, USA amplification in an additional 13 taxa that represented all six genera within the Hawai‘ian 4 Author for correspondence: [email protected] lobelioid group to determine the broader applicability of the markers. Citation: Fant, J. B., M. Fluckes, E. James, H. Noble, and J. Wood. CONCLUSIONS: Results indicate that these primers will provide useful estimates of genetic 2019. Characterization of microsatellite loci in Brighamia insignis and transferability to other genera in the Hawai‘ian lobelioid diversity and relatedness of ex situ collections of both Brighamia species. In addition, we group. Applications in Plant Sciences 7(11): e11303. have also demonstrated the widespread applicability of these markers for use in population doi:10.1002/aps3.11303 genetic studies of several species within the Hawai‘ian lobelioid group. KEY WORDS Brighamia; Campanulaceae; cross-amplification; Hawai‘ian lobelioids; Lobelia; microsatellites. With over 126 species, the Hawai‘ian lobelioids represent one of the best in collections; however, the majority of individuals have uncertain examples of adaptive radiation (Givnish et al., 2009). Unfortunately, parentage. Neutral molecular markers can be used to estimate re- for many species in this group, wild populations are so reduced that latedness of individuals with unknown parentage. Unfortunately, they are now of high conservation concern. For example, the genus previous genetic markers used for Brighamia studies have revealed Brighamia A. Gray is composed of two species, B. insignis A. Gray and only a limited amount of genetic diversity (Gemmill et al., 1998; B. rockii H. St. John, which were once found on multiple Hawai‘ian Walsh, 2015). Here we report 28 microsatellite markers developed islands (Gemmill et al., 1998) but are currently reduced to only one for B. insignis and 12 published primers from Lobelia villosa (Rock) individual of B. insignis and fewer than 100 individuals of B. rockii H. St. John & Hosaka (Tran et al., 2015) that were tested on B. in- (Walsh, 2016). Fortunately, the National Tropical Botanical Garden signis and B. rockii, as well as on an additional 13 taxa that repre- began making collections in the 1970s and has distributed germplasm sented all six genera in the Hawai‘ian lobelioid group. to botanic gardens around the world (Hannon and Perlman, 2002). According to the global plant collections database PlantSearch (https :// tools.bgci.org/plant_search.php), at least 56 other botanic gardens METHODS AND RESULTS maintain collections of this species. This conservation effort helped B. insignis escape extinction and could ultimately provide potential Genomic DNA was extracted using the modified 2× cetyltrimeth- in situ restoration material. However, recent genetic analysis of the ylammonium bromide (CTAB) method (Doyle and Doyle, 1987). ex situ populations suggests a loss of genetic diversity and fitness de- We tested all primers on 15 taxa that represented the six genera clines associated with inbreeding depression (Walsh, 2015). within the Hawai‘ian lobelioid group; for each taxon, one to two This loss of genetic diversity could be mitigated by developing a samples were tested. These included both species of Brighamia (B. in- robust breeding program that incorporates genetic data into breed- signis and B. rockii), two species of Clermontia Gaudich. (C. fau- ing decisions and ex situ management (Fant et al., 2016). An im- riei H. Lév. and C. samuelii C. N. Forbes subsp. hanaensis (H. St. portant first step in this process is to track the origins of all material John) Lammers), six species of Cyanea Gaudich. (C. fissa Hilldebr., Applications in Plant Sciences 2019 7(11): e11303; http://www.wileyonlinelibrary.com/journal/AppsPlantSci © 2019 Fant et al. Applications in Plant Sciences is published by Wiley Periodicals, Inc. on behalf of the Botanical Society of America. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made. 1 of 6 Applications in Plant Sciences 2019 7(11): e11303 Fant et al.—Brighamia microsatellites • 2 of 6 TABLE 1. Characteristics of 30 microsatellite loci used for screening in this study, including 18 newly developed markers for Brighamia insignis and 12 previously published markers for Lobelia villosa. Allele size GenBank accession Species and locus Primer sequences (5′–3′) Repeat motif range (bp) Fluorescent label no.a Brighamia insignis BRIN01 (GA) 202–222 Green [D3-PA] MK387344 F: CTTGTTGCAGGATGGGAGTT 17 R: GGGTATCCACCCTTTCCTTC BRIN05 (GT) 181–207 Blue [D4-PA] MK387346 F: GAATGGTTTTCACTTTCCCAAC 17 R: ATCTCTTACCCCGGAAGCAC BRIN07 (TG) (AG) 167 Green [D3-PA] MK387347 F: TTCAGCACAGATCCCTTTTG 16 7 R: TCCAGATTCAGCTCCTCCAG BRIN08 (TG) 146–154 Blue [D4-PA] MK387348 F: AGACGGCTCGGGGTATAACT 12 R: GTACCATTCTCGTATTTACCCA BRIN10 (CT) (CA) 148–186 Blue [D4-PA] MK387349 F: CAGCTGTTACCGTCTTCTGC 11 14 R: TTTCTAAAGTTACAAAATCAAGG BRIN41 (TG) 111–125 Black [D2-PA] MK387352 F: CAACGCTGATGATGATGATTG 14 R: ACCCTTCGTTCCAAAGATCC BRIN43 (CT) 174–248 Blue [D4-PA] MK387354 F: GGACCAACAATTGGAGAAACA 27 R: CTGATGCTGAACATCTGTAAACAA BRIN44 (AG) 142–162 Black [D2-PA] MK387355 F: ACTGGATTGAAAGCCTTACTTTG 14 R: CTAATGCACATTTTTGGATTGCT BRIN46 (TC) (AC) 232–254 Blue [D4-PA] MK387357 F: GGAAAACTGATGTGCGTTGA 13 10 R: TTGCTTCATGACTTGAGCTTG BRIN47 (GT) 152–188 Green [D3-PA] MK387358 F: CCCCTCCATTTCAAGGTTCT 12 R: CCTCAGCAGGGGAAAAGTAA BRIN51 (CT) (CA) 170–208 Green [D3-PA] MK387362 F: GACAAGGGACATGGCTGTTT 16 12 R: TGAGAGTTTGATCTGCACAAAA BRIN53 (AG) 165–177 Green [D3-PA] MK387363 F: GCTTGTTGCACAACATGAAA 12 R: TGATAGTCACAGTTTGGCTGA BRIN54 (GT) 168–176 Green [D3-PA] MK387364 F: TGTGAATGGCTGGTTGGTAA 9 R: GCCTAAAGGCAAAGAGTTTGAA BRIN56 (CA) 104 Black [D2-PA] MK387366 F: CGCGAAGTCCAGAAGAAAAC 11 R: TTTTGTTTCACTCTTCGTCCA BRIN57 (GT) (GA) 223–233 Blue [D4-PA] MK387367 F: TGGGAGAAAATTGAAAGCAAA 7 22 R: GTACAAAGAATCCACTCACTCGC BRIN59 (GA) — Green [D3-PA] MK387351 F: ACCAGGGATTGTTCGCTAAG 29 R: GGCTCTGTGGCATTCAAAGT BRIN61 (AG) 183–191 Green [D3-PA] MK387369 F: GTGAGCTGGGTGGTTGTTTT 14 R: AGGAGGACCCCTCAACAATC BRIN66 (GT) (GA) 157–181 Blue [D4-PA] MK387370 F: GTACTGCATGCCCTGTGTT 10 10 R: GATGCGCTCAAACGAGAGTT Lobelia villosa LOVI4 (AC) 248–268 M13F-green [D3-PA] F: ACGTCTAGGGGCACTGCCAAGCCAG 12 R: TCCAAATGGGAGACTACTGCAGAAAGG LOVI23 (AC) 401–437 M13F-blue [D4-PA] F: TCTTTTGTCCATGCCAGCGTG 11 R: AGGTACTCGGTCTGAGCGTTTCG LOVI33 (GT) (GA) 372–378 M13F-black [D2-PA] F: ACAGGGGGCAAAACTGGTCACC 8 9 R: TGCAAGGATGACGAAGGGGCTC LOVI34 (CA) 155 M13F-blue [D4-PA] F: ACAGGCGCTATGGCGTCCCT 10 R: GTTGTATGCATCATGAGACCGTC LOVI35 (CA) 230–256 M13F-black [D2-PA] F: GCTTACAACAAATTGCCTC 17 R: AGCCTCGAAATCATCCGGCCCA LOVI37 (GA) 470–478 M13F-green [D3-PA] F: GGATCACTCAAGGATGAACTCGCAAGG 14 R: TGTGTAATGGACCTTGGGCTGTCTC LOVI48 (AC) A(AC) 400–420 M13F-green [D3-PA] F: TCACCGAACGATTCATCGAACCA 7 5 R: ACGAGTGAGAGACTTTTGGGTGATCA LOVI52 (AC) — M13F-blue [D4-PA] F: CGAATGATCTATTATTCCAGCC 11 R: AGACACTTCCTCGAGTTGGTG LOVI56 (CT) (CA) 536–640 M13F-black [D2-PA] F: AGCATCAGCAAGACACTTGC 9 14 R: AGTAAGGGATAAAGCAGACCTGG LOVI73 (CA) 468–478 M13F-black [D2-PA] F: TCACAAATGCTCCATCGCGAG 9 R: TGTAGCGGAAAGTACCGGATCCA LOVI90 (CA) 200–206 M13F-blue [D4-PA] F: ACCGGCTGTAATCACGCGTTGG 12 R: CTACTGTGTGAAGTCGGAAAACC LOVI93 (GT) 287–397 M13F-green [D3-PA] F: TCTAGCAGAAGCCTCACCCCGGA 10 R: CACCAGAACTCAAGCAAGGCGAC Note: — = no amplified product. aAccession numbers are provided for loci developed for Brighamia insignis. Loci for Lobelia villosa were previously published in Tran et al. (2015). http://www.wileyonlinelibrary.com/journal/AppsPlantSci © 2019 Fant et al. Applications in Plant Sciences 20197(11):e11303 inPlant Applications h ttp://www.wileyonlinelibrary.com/journal/AppsPlantSci TABLE 2. Allele size ranges for the 18 newly developed markers for Brighamia insignis and 12 previously published markers for Lobelia villosa, tested on 15 taxa from the Hawai‘ian lobelioid complex.a Brighamia Brighamia Clermontia Clermontia Cyanea Cyanea Cyanea Cyanea Cyanea Cyanea Delissea Delissea Delissea Lobelia insignis rockii fauriei samuelii fissa hardyi leptostegia hirtella pseudofauriei salicina kauaiensis rhytidosperma waianaeensis niihauensis Trematolobelia Locus (n = 30) (n = 24) (n = 2) (n = 1) (n = 2) (n = 2) (n =