THE ROLE OF ABCG5/G8 IN STEROL HOMEOSTASIS
BY
ALLISON L. MCDANIEL
A Dissertation submitted to the Graduate Faculty of
WAKE FOREST UNIVERSITY GRADUATE SCHOOL OF ARTS AND SCIENCES
in Partial Fulfillment of the Requirements
for the Degree of
DOCTOR OF PHILOSOPHY
Molecular and Cellular Pathology
May 2013
Winston-Salem, NC
Approved by:
Ryan E. Temel, Ph.D., Advisor
Richard Weinberg, M.D., Chair
Lawrence L. Rudel, Ph.D.
John S. Parks, Ph.D.
Gregory Shelness, Ph.D.
TABLE OF CONTENTS
LIST OF FIGURES………………………………………………………….…….……iii
LIST OF TABLES…………………………………………………………..…………...v
LIST OF ABBREVIATIONS………………………………………………...... …….…vi
ABSTRACT……………………………………………………………...……….….…viii
CHAPTER
I. INTRODUCTION………………………………………………………..….1
II. PHYTOSTEROL FEEDING CAUSES TOXICITY IN ABCG5/G8
KNOCKOUT MICE…………………………….………………….…..…..22
III. HEPATIC ABCG8 KNOCKDOWN DOES NOT RESULT IN HIGH
LEVELS OF PHYTOSTEROL ACCUMULATION……………….....….56
IV. HEPATIC ABCG8 KNOCKDOWN PREVENTS LXR AGONIST
INDUCED REVERSE CHOLESTEROL TRANSPORT…………...... 103
V. DISCUSSION…………………………………………..……………..…133
CIRRICULUM VITAE………………………………………………..…………..….145
ii
LIST OF FIGURES
CHAPTER I
Figure 1: Structures of cholesterol and two common phytosterols…...... 7
CHAPTER II
S. Figure 1: Bodyweight measurement………………………...... …32
Figure 1: Measurement of body and tissues weights…...... ………33
Figure 2: Assessment of liver pathology……………...... …………35
Figure 3: Tissue sterol concentrations……………...... …………..39
Figure 4: Plasma characterization…………...... ………………….41
Figure 5: Cardiac histology…………………...... ………………….44
CHAPTER III
S. Figure I: Dietary sterol content and composition……………...... ……….…68
Figure 1: ABCG8 and ABCG5 expression……………….…...... …………...70
Figure 2: Biliary cholesterol concentration……………………..………….…74
S. Figure II: Biliary lipid composition………………………….……….………...75
iii
S. Figure III: Body and liver weights of CON and G8HKD mice……….....……….77
Figure 3: Plasma sterol concentrations………………………………...... …….79
S. Figure IV: Plasma lipoprotein sterol distributions……………………...... ……82
Figure 4: Liver sterol concentrations………………………………...... ……….85
Figure 5: Fecal neutral sterol excretion……………………………...... …….89
S. Figure V: Liver sterol concentrations after 12 weeks of G8HKD and high
phytosterol diet feeding………………………………...... …………..92
CHAPTER IV
Figure 1: ABCG8 and ABCG5 expression…………...... ……………….…115
Figure 2: Biliary sterol concentrations…………………………...... …118
Figure 3: Plasma sterol mass and radioactivity……………...... ……….120
Figure 4: Liver sterol mass and radioactivity………………………...... …122
Figure 5: Fecal neutral sterol mass and radioactivity…………...... ………124
iv
LIST OF TABLES
CHAPTER II
Table 1: RT-PCR primers……………………...... …….……….29
S. Table 1: Dietary sterol compositions…………...... ……...……..32
Table 2: Hepatic and splenic gene expression……...... ……….37
CHAPTER III
S. Table I: Diet ingredients………………………………...... ……..67
v
LIST OF ABBREVIATIONS
ABCA1 – ATP-Binding Cassette Transporter A1
ABCB11 – ATP-Binding Cassette Transporter B11
ABCG1 – ATP-Binding Cassette Transporter G1
ABCG5 – ATP-Binding Cassette Transporter G5
ABCG8 – ATP-Binding Cassette Transporter G8
ACAT2 – Acyl-CoA:Cholesterol O-Acyltransferase 2
BLVRA – Biliverdin Reductase A
CD68 – Cluster of Differentiation 68
CHD – Coronary Heart Disease
CYP7A1 – Cholesterol 7α-hydroxylase
HDL – High Density Lipoprotein
HMGCS – Hydroxy-Methylglutaryl CoA Synthase
HO-1 – Hemeoxygenase 1
IL-6 – Interleukin 6
KO – Knockout
LDL – Low Density Lipoprotein
LXR – Liver X Receptor
NAFLD – Non Alcoholic Fatty Liver Disease
PLTP – Phospholipid Transfer Protein
RCT – Reverse Cholesterol Transport
RXR – Retinoid X Receptor
vi
SCD1 – Stearoyl-CoA Desaturase-1
SR-BI – Scavenger Receptor Class B Type I
SREBP1C – Sterol Regulatory Element Binding Protein 1C
TICE – Trans Intestinal Cholesterol Excretion
UGT1a – Diphosphoglucuronate Glucuronosyltransferase 1A
WT – Wild Type
vii
ABSTRACT
Allison L. McDaniel, BS, BA
THE ROLE OF ABCG5/G8 IN STEROL HOMEOSTASIS
Dissertation under the direction of
Ryan E. Temel, Ph.D., Assistant Professor of Pathology – Lipid Sciences
ATP-binding cassette transporters G5 and G8 (ABCG5/G8) excrete excess phytosterols and cholesterol from the body, thus playing a crucial role in sterol metabolism and whole body sterol homeostasis. The significance of phytosterol exclusion from the body is still unknown. Furthermore, there is evidence that
ABCG5/G8 plays slightly different roles in sterol metabolism in the liver and small intestine. The goal of these studies is to define the tissue-specific role of
ABCG5/G8 in whole body sterol homeostasis and to determine the significance of phytosterol exclusion from the body.
The first aim was to determine the significance of phytosterol exclusion from the
body. Wild-type and ABCG5/G8 knockout mice were fed a phytosterol-enriched
diet. The high-phytosterol diet was extremely toxic to the ABCG5/G8 knockout
mice but had no adverse effects on wild-type mice. ABCG5/G8 knockout mice died prematurely and developed a phenotype that included high levels of plant
viii sterols in many tissues, liver abnormalities, and severe cardiac lesions. These data show that plant sterols are excluded from the body because they are toxic when present at high levels.
The second aim was to determine whether hepatic ABCG5/G8 function is required for phytosterol exclusion from the plasma and tissues of mice. An anti- sense oligonucleotide (ASO) targeted to ABCG8 was used to knock down
ABCG8 expression in the liver of C57Bl/6 mice. Mice with hepatic ABCG8 knockdown did not accumulate high levels of phytosterols but did appear to have alterated hepatic cholesterol metabolism.
The third aim was to determine whether hepatic ABCG5/G8 function is necessary for LXR agonist mediated increases in cholesterol excretion and macrophage reverse cholesterol transport. An ABCG8 ASO was used to knock down ABCG8 expression in the liver of C57Bl/6 mice and RCT was measured. When mice had decreased hepatic ABCG8 expression, cholesterol excretion and macrophage
RCT were not stimulated with LXR agonist treatment. These data suggest that
ABCG5/G8, a downstream target of LXR, is required for LXR stimulated increases in cholesterol excretion and macrophage RCT.
Together, these studies show that the role of ABCG5/G8 in sterol metabolism and homeostasis is complex and has not been completely discovered.
ix
CHAPTER I
INTRODUCTION
Coronary heart disease (CHD) is the leading cause of death in the United States.
Approximately every 34 seconds, one American will have a coronary event, and
approximately every minute, one American will die of one1. In addition to mortality
and decreased quality of life for those affected, CHD brings a significant public
and private financial burden. For 2009, it was estimated that the total direct and
indirect cost of cardiovascular disease reached $312.6 billion dollars1, making it
the most costly disease in the United States.
One of the most popular drugs used in the treatment of CHD is statins. Statins
lower low density lipoprotein cholesterol (LDL-c) levels by inhibiting endogenous
cholesterol synthesis. It has long been observed that the strongest risk factors
that predict CHD are increased LDL-c and decreased high density lipoprotein
cholesterol (HDL-c) levels2. The widely used LDL-c lowering statins have, indeed,
reduced CHD events and mortality. Despite their successes, they have only
reduced CHD mortality by approximately 30%3, which still leaves a significant
CHD burden.
Since decreased HDL-c levels are also a strong predictor of CHD, much
emphasis has been placed on HDL metabolism research. Developing treatment
1
options that utilize the beneficial properties of HDL could be a powerful tool in battling CHD. Many mechanisms have been proposed to explain how HDL could decrease the formation of atherosclerosis4-6. The most widely accepted
mechanism is HDL driven reverse cholesterol transport (RCT).
RCT plays an important role in maintaining whole body cholesterol homeostasis.
It is undeniable that cholesterol is vital to the maintenance and function of many
biological processes. For example, cholesterol is an important component of
cellular membranes, can act as a signalling molecule, and serves as a precursor
for steroid hormones and bile acids. Too much bodily cholesterol accumulation
can, however, become detrimental. Cholesterol homeostasis is a delicate
balance between dietary cholesterol absorption, endogenous cholesterol
synthesis, cholesterol utilized for biological processes, and cholesterol excretion
from the body. Imbalances in cholesterol homeostasis that result in net
cholesterol accumulation can lead to diseases like atherosclerosis and non-
alcoholic fatty liver disease (NAFLD). For this reason, the body has complex
regulatory systems to help maintain correct sterol balance.
One part of this regulatory system is RCT. RCT is the movement of cholesterol
from peripheral tissues to the liver. In this process, cholesterol is effluxed from
the peripheral tissues onto HDL particles via ATP-binding cassette transporters
A1 (ABCA1) and G1 (ABCG1)7, 8. The HDL particles travel through the plasma compartment to the liver, where they offload the cholesterol by scavenger
2
receptor class B type I (SR-BI) mediated selective cholesterol uptake 9, 10. Once cholesterol reaches the liver it can be incorporated into membranes, converted into bile acids, esterified for storage, or secreted into the bile. The primary way for hepatic cholesterol to exit the body is through direct secretion into bile followed by fecal excretion. Because of its contributing role to cholesterol excretion from the body, RCT undoubtedly plays an important part in maintaining cholesterol homeostasis. Because increasing cholesterol excretion via RCT is an attractive therapeutic target for CHD treatment, it is important to study and understand the RCT pathway.
In order for biliary cholesterol to reach the small intestine for excretion, it must first be secreted into the bile. Two of the critical proteins that regulate this process are ATP-binding cassette transporter G5 (ABCG5) and ATP-binding cassette transporter G8 (ABCG8). Together, ABCG5 and ABCG8 (ABCG5/G8) make up a membrane bound heterodimer that is primarily expressed in the liver and small intestine. Both ABCG5 and ABCG8 must be expressed in order for the
proteins to be trafficked to the cell surface11, 12. Once at the cell surface,
ABCG5/G8 flops sterols from the inner leaflet to the outer leaflet of the canalicular membrane13. The canalicular membrane can then secrete
cholesterol-containing vesicles from the outer leaflet into bile14, 15.
Several mouse studies have demonstrated that altering ABCG5/G8 expression
affects biliary cholesterol levels. Yu L et al.16 first showed that ABCG5/G8
3
knockout (KO) mice had a 90% reduction in biliary cholesterol concentrations
when compared to wild type (WT) mice. Additional studies revealed that
overexpression of ABCG5/G8 caused increases to biliary cholesterol
concentrations17, and that biliary cholesterol concentrations correlate to the
relative amount of ABCG5/G8 expression18. Studies conducted in ABCG5 KO19,
20 and ABCG8 KO21 mice also show significant reductions in biliary cholesterol
concentrations, further confirming that expression of both genes is required for
biliary cholesterol secretion.
Mouse studies using dietary cholesterol and synthetic compounds to increase
ABCG5/G8 expression have also resulted in biliary cholesterol changes. The
gene cluster for ABCG5 and ABCG8 is a direct target of the oxysterol-activated
nuclear receptors Liver X Receptor (LXR) alpha and LXR beta. When fed a high
cholesterol diet, hepatic and small intestinal ABCG5/G8 mRNA levels were
significantly increased22. Administration of synthetic ligands of LXR and its
heterodimeric partner, retinoid X receptor (RXR), also caused significant
increases in hepatic and small intestinal ABCG5/G8 mRNA levels23.
Furthermore, treatment with an LXR agonist was shown to significantly increase biliary cholesterol concentrations in mice24, and these increases in biliary cholesterol concentrations required the presence of ABCG5/G825. These
comprehensive studies firmly establish the critical function of ABCG5/G8 in biliary cholesterol secretion and, therefore, the important role of ABCG5/G8 in biliary fecal sterol loss and RCT.
4
Since ABCG5/G8 is critical for cholesterol movement from the liver into the bile, it
follows that ABCG5/G8 likely plays a role in hepatic cholesterol homeostasis and
metabolism. This does appear to be the case, as several groups have reported
changes in hepatic cholesterol metabolism when ABCG5/G8 is absent26, 27. For example, on low cholesterol diets ABCG5/G8 KO mice have significant reductions in plasma and hepatic cholesterol concentrations28-30. Despite these
reductions, there are no compensatory increases in cholesterol synthesis genes.
Hepatic mRNA levels of HMG-CoA synthase and reductase are actually reduced
by 50% in ABCG5/G8 KO mice. Drawing conclusions from these studies about
the role of ABCG5/G8 in hepatic cholesterol metabolism is difficult, however,
since ABCG5/G8 deficiency causes significant plant sterol (or phytosterol)
accumulation.
The importance of ABCG5/G8 in preventing phytosterol absorption was actually
discovered prior to its role in biliary cholesterol secretion. In 1974, Bhattacharyya
and Connor described a new lipid storage disease, termed sitosterolemia, in two
sisters with plant sterol accumulation in blood and tissues31. Patients with
sitosterolemia accumulate plant sterols in many tissues and often present with
tendinous and cutaneous xanthomas and hypersterolemia32, 33. There are also
indications that plasma plant sterol accumulation has negative effects on platelet
biology34. Subsequent work identified genetic mutations to ABCG5 and ABCG8
as the cause of sitosterolemia35-37.
5
It has long been observed that although a typical diet generally contains similar
amounts of cholesterol and phytosterols, intestinal cholesterol absorption rates
are 40% to 60%, but phytosterols are mostly excluded from the body due to
intestinal absorption rates of less than 5%38, 39. When ABCG5/G8 is disrupted,
however, dietary phytosterols are hyper absorbed by the small intestine. Patients
who lack functional ABCG5/G8 absorb 20-30% of phytosterols from the small
intestinal lumen40, 41. Mouse models with ABCG5 and/or ABCG8 disruption display a phenotype similar to human sitosterolemia patients. There are subtle differences among the mouse models, but all have significant accumulation of plant sterols in plasma and tissues19, 20, 42-45.
The need for discrimination between plant sterols and cholesterol is not fully
understood. The discrimination against phytosterols has a basis in chemical
structure. Phytosterols and cholesterol both have the tetracyclic structure and 3β-
hydroxyl group which are characteristic of sterols. They differ from each other in
the position and number of double bonds and additional alkyl side chains. These
subtle structural differences between phytosterols and cholesterol result in
differential processing by mammalian systems. For example, campesterol, with a
single-carbon side chain at carbon 24, typically has a plasma concentration 500
times less than cholesterol; whereas, the concentration of sitosterol, with a 2-
carbon side chain at carbon 24, is about 20,000 times lower than cholesterol46.
Although they have limited absorption, phytosterols can still participate in a number of biological functions by acting as a cholesterol absorption inhibitor47, 48,
6 an antioxidant49, an anticarcinogen50, and an immune system regulator51. When hyper absorbed, phytosterols can potentially alter many more biological functions.
Figure 1. Structures of cholesterol and two common phytosterols
As previously mentioned, hepatic cholesterol metabolism is altered when phytosterols accumulate in ABCG5/G8 KO mice. It is not completely clear, however, how much of the changes in cholesterol metabolism are due to the mass accumulation of plant sterols versus the lack of ABCG5/G8 function. It is possible that the complete role of ABCG5/G8 in cholesterol metabolism is partly masked by the accumulation of plant sterols. Interestingly, a study was published in 2012 by Su K, et al52 that used ABCG5/G8 KO mice fed phytosterol-free diets in order to prevent phytosterol accumulation in plasma and tissues. When mice were fed a phytosterol-free high fat diet, development of nonalcoholic fatty liver disease was accelerated in the ABCG5/G8 KO mice when compared to WT
7
mice. These results support the idea that ABCG5/G8 plays a role in sterol
metabolism beyond its function in limiting phytosterol absorption.
Additionally, some studies raise the possibility that ABCG5/G8 may play slightly
different roles in the liver and the small intestine where they are primarily
expressed. Under an unusual circumstance, a patient with sitosterolemia
received a liver transplant that resolved the disease53. The transplanted liver
presumably had ABCG5/G8 intact, resulting in a unique human model of small
intestine specific ABCG5/G8 deficiency. Prior to transplant, the patient had a
plasma phytosterol concentration of greater than 500 μmol/L. Post-transplant, plasma phytosterol concentrations dropped to below 60 μmol/L. This study indicates that when small intestinal ABCG5/G8 function was absent, the presence of hepatic ABCG5/G8 was sufficient to limit phytosterol accumulation.
Subsequently, the authors of this study concluded that hepatic ABCG5/G8 function is the primary determinant of steady state plasma phytosterol concentration. Further studies need to be done to confirm this conclusion, and to date no other data from models of tissue-specific ABCG5/G8 deficiency have been published.
In conjunction with its potential tissue specific role in phytosterol metabolism, there is evidence that ABCG5/G8 could also play a tissue specific role in the
RCT pathway. As previously stated, ABCG5/G8 is an LXR target gene and expression is required for LXR agonist mediated increases in biliary cholesterol
8
concentrations54, 55. Recently, it was reported that constitutive LXRα activation in
the small intestine caused increases in RCT in mice56. The same study showed
that hepatic-specific LXR activation did not cause any significant changes to
RCT. In line with these findings, activation of small intestinal LXR with an
intestinal-specific LXR agonist promoted macrophage RCT in mice57. Since this evidence is all indirect, it is important to directly test whether ABCG5/G8 functions in a tissue specific manner to regulate RCT and macrophage specific
RCT.
Based on the gaps in knowledge highlighted by this introduction, experiments
were designed to answer the following experimental questions:
1) What is the significance of phytosterol exclusion from the body?
To determine the significance of phytosterol exclusion from the body, we
fed wild-type and ABCG5/G8 knockout mice a diet enriched with plant
sterols. The high-phytosterol diet was extremely toxic to the ABCG5/G8
knockout mice but had no adverse effects on wild-type mice. ABCG5/G8
knockout mice died prematurely and developed a phenotype that included
high levels of plant sterols in many tissues, liver abnormalities, and severe
cardiac lesions.
9
2) Is hepatic ABCG5/G8 function required to prevent phytosterol
accumulation in plasma and tissues?
In order to determine whether hepatic ABCG5/G8 function is required for
phytosterol exclusion from the body, an anti-sense oligonucleotide (ASO)
targeted to ABCG8 was used to knockdown ABCG8 expression in the liver
of C57Bl/6 mice. Surprisingly, mice with hepatic ABCG8 knockdown did
not accumulate high levels of phytosterols but did appear to have alterated
hepatic cholesterol metabolism.
3) Is hepatic ABCG5/G8 function required for LXR agonist mediated
increases in RCT and/or macrophage RCT?
In order to test whether hepatic ABCG5/G8 function is necessary for LXR
agonist mediated increases in cholesterol excretion and macrophage
reverse cholesterol transport, an anti-sense oligonucleotide (ASO)
targeting ABCG8 was used to knockdown ABCG8 expression in the liver
of C57Bl/6 mice and RCT was measured. Interestingly, when mice had
decreased hepatic ABCG8 expression, cholesterol excretion and
macrophage RCT were not stimulated with LXR agonist treatment. This
data suggest that it is ABCG5/G8, a downstream target of LXR, that is
required for LXR stimulated increases in cholesterol excretion and
macrophage RCT.
10
REFERENCE LIST
(1) Go AS, Mozaffarian D, Roger VL, Benjamin EJ, Berry JD, Borden WB,
Bravata DM, Dai S, Ford ES, Fox CS, Franco S, Fullerton HJ, Gillespie C,
Hailpern SM, Heit JA, Howard VJ, Huffman MD, Kissela BM, Kittner SJ,
Lackland DT, Lichtman JH, Lisabeth LD, Magid D, Marcus GM, Marelli A,
Matchar DB, McGuire DK, Mohler ER, Moy CS, Mussolino ME, Nichol G,
Paynter NP, Schreiner PJ, Sorlie PD, Stein J, Turan TN, Virani SS, Wong
ND, Woo D, Turner MB. Heart disease and stroke statistics--2013 update:
a report from the American Heart Association. Circulation 2013 January
1;127(1):e6-e245.
(2) Gordon T, Castelli WP, Hjortland MC, Kannel WB, Dawber TR. High
density lipoprotein as a protective factor against coronary heart disease.
The Framingham Study. Am J Med 1977 May;62(5):707-14.
(3) Third Report of the National Cholesterol Education Program (NCEP)
Expert Panel on Detection, Evaluation, and Treatment of High Blood
Cholesterol in Adults (Adult Treatment Panel III) final report. Circulation
2002 December 17;106(25):3143-421.
(4) Assmann G, Schulte H, von EA, Huang Y. High-density lipoprotein
cholesterol as a predictor of coronary heart disease risk. The PROCAM
11
experience and pathophysiological implications for reverse cholesterol
transport. Atherosclerosis 1996 July;124 Suppl:S11-S20.
(5) Gordon DJ, Probstfield JL, Garrison RJ, Neaton JD, Castelli WP, Knoke
JD, Jacobs DR, Jr., Bangdiwala S, Tyroler HA. High-density lipoprotein
cholesterol and cardiovascular disease. Four prospective American
studies. Circulation 1989 January;79(1):8-15.
(6) Barter PJ, Nicholls S, Rye KA, Anantharamaiah GM, Navab M, Fogelman
AM. Antiinflammatory properties of HDL. Circ Res 2004 October
15;95(8):764-72.
(7) Wang N, Silver DL, Thiele C, Tall AR. ATP-binding cassette transporter
A1 (ABCA1) functions as a cholesterol efflux regulatory protein. J Biol
Chem 2001 June 29;276(26):23742-7.
(8) Wang N, Lan D, Chen W, Matsuura F, Tall AR. ATP-binding cassette
transporters G1 and G4 mediate cellular cholesterol efflux to high-density
lipoproteins. Proc Natl Acad Sci U S A 2004 June 29;101(26):9774-9.
(9) Glass C, Pittman RC, Weinstein DB, Steinberg D. Dissociation of tissue
uptake of cholesterol ester from that of apoprotein A-I of rat plasma high
density lipoprotein: selective delivery of cholesterol ester to liver, adrenal,
and gonad. Proc Natl Acad Sci U S A 1983 September;80(17):5435-9.
(10) Silver DL, Wang N, Xiao X, Tall AR. High density lipoprotein (HDL) particle
uptake mediated by scavenger receptor class B type 1 results in selective
12
sorting of HDL cholesterol from protein and polarized cholesterol
secretion. J Biol Chem 2001 July 6;276(27):25287-93.
(11) Graf GA, Li WP, Gerard RD, Gelissen I, White A, Cohen JC, Hobbs HH.
Coexpression of ATP-binding cassette proteins ABCG5 and ABCG8
permits their transport to the apical surface. J Clin Invest 2002
September;110(5):659-69.
(12) Graf GA, Yu L, Li WP, Gerard R, Tuma PL, Cohen JC, Hobbs HH. ABCG5
and ABCG8 are obligate heterodimers for protein trafficking and biliary
cholesterol excretion. J Biol Chem 2003 November 28;278(48):48275-82.
(13) Kosters A, Kunne C, Looije N, Patel SB, Oude Elferink RP, Groen AK. The
mechanism of ABCG5/ABCG8 in biliary cholesterol secretion in mice. J
Lipid Res 2006 September;47(9):1959-66.
(14) Crawford JM, Mockel GM, Crawford AR, Hagen SJ, Hatch VC, Barnes S,
Godleski JJ, Carey MC. Imaging biliary lipid secretion in the rat:
ultrastructural evidence for vesiculation of the hepatocyte canalicular
membrane. J Lipid Res 1995 October;36(10):2147-63.
(15) Crawford AR, Smith AJ, Hatch VC, Oude Elferink RP, Borst P, Crawford
JM. Hepatic secretion of phospholipid vesicles in the mouse critically
depends on mdr2 or MDR3 P-glycoprotein expression. Visualization by
electron microscopy. J Clin Invest 1997 November 15;100(10):2562-7.
13
(16) Yu L, Hammer RE, Li-Hawkins J, Von BK, Lutjohann D, Cohen JC, Hobbs
HH. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in
biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002 December
10;99(25):16237-42.
(17) Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC, Hobbs
HH. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol
secretion and reduces fractional absorption of dietary cholesterol. J Clin
Invest 2002 September;110(5):671-80.
(18) Yu L, Gupta S, Xu F, Liverman AD, Moschetta A, Mangelsdorf DJ, Repa
JJ, Hobbs HH, Cohen JC. Expression of ABCG5 and ABCG8 is required
for regulation of biliary cholesterol secretion. J Biol Chem 2005 March
11;280(10):8742-7.
(19) Plosch T, Bloks VW, Terasawa Y, Berdy S, Siegler K, Van Der SF, Kema
IP, Groen AK, Shan B, Kuipers F, Schwarz M. Sitosterolemia in ABC-
transporter G5-deficient mice is aggravated on activation of the liver-X
receptor. Gastroenterology 2004 January;126(1):290-300.
(20) Chase TH, Lyons BL, Bronson RT, Foreman O, Donahue LR, Burzenski
LM, Gott B, Lane P, Harris B, Ceglarek U, Thiery J, Wittenburg H, Thon
JN, Italiano JE, Jr., Johnson KR, Shultz LD. The mouse mutation
"thrombocytopenia and cardiomyopathy" (trac) disrupts Abcg5: a
spontaneous single gene model for human hereditary
phytosterolemia/sitosterolemia. Blood 2010 February 11;115(6):1267-76.
14
(21) Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M, Shefer S, Batta
AK, Yu H, Chen J, Klein R, Looije N, Oude-Elferink R, Groen AK, Maeda
N, Salen G, Patel SB. A mouse model of sitosterolemia: absence of
Abcg8/sterolin-2 results in failure to secrete biliary cholesterol. BMC Med
2004 March 24;2:5.
(22) Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ.
Regulation of ATP-binding cassette sterol transporters ABCG5 and
ABCG8 by the liver X receptors alpha and beta. J Biol Chem 2002 May
24;277(21):18793-800.
(23) Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ.
Regulation of ATP-binding cassette sterol transporters ABCG5 and
ABCG8 by the liver X receptors alpha and beta. J Biol Chem 2002 May
24;277(21):18793-800.
(24) Plosch T, Kok T, Bloks VW, Smit MJ, Havinga R, Chimini G, Groen AK,
Kuipers F. Increased hepatobiliary and fecal cholesterol excretion upon
activation of the liver X receptor is independent of ABCA1. J Biol Chem
2002 September 13;277(37):33870-7.
(25) Yu L, York J, von BK, Lutjohann D, Cohen JC, Hobbs HH. Stimulation of
cholesterol excretion by the liver X receptor agonist requires ATP-binding
cassette transporters G5 and G8. J Biol Chem 2003 May
2;278(18):15565-70.
15
(26) Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M, Shefer S, Batta
AK, Yu H, Chen J, Klein R, Looije N, Oude-Elferink R, Groen AK, Maeda
N, Salen G, Patel SB. A mouse model of sitosterolemia: absence of
Abcg8/sterolin-2 results in failure to secrete biliary cholesterol. BMC Med
2004 March 24;2:5.
(27) Yu L, Hammer RE, Li-Hawkins J, von BK, Lutjohann D, Cohen JC, Hobbs
HH. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in
biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002 December
10;99(25):16237-42.
(28) Yu L, Hammer RE, Li-Hawkins J, von BK, Lutjohann D, Cohen JC, Hobbs
HH. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in
biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002 December
10;99(25):16237-42.
(29) Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M, Shefer S, Batta
AK, Yu H, Chen J, Klein R, Looije N, Oude-Elferink R, Groen AK, Maeda
N, Salen G, Patel SB. A mouse model of sitosterolemia: absence of
Abcg8/sterolin-2 results in failure to secrete biliary cholesterol. BMC Med
2004 March 24;2:5.
(30) McDaniel AL, Alger HM, Sawyer JK, Kelley KL, Kock ND, Brown JM,
Temel RE, Rudel LL. Phytosterol Feeding Causes Toxicity in ABCG5/G8
Knockout Mice. Am J Pathol 2013 April;182(4):1131-8.
16
(31) Bhattacharyya AK, Connor WE. Beta-sitosterolemia and xanthomatosis. A
newly described lipid storage disease in two sisters. J Clin Invest 1974
April;53(4):1033-43.
(32) Lee MH, Lu K, Patel SB. Genetic basis of sitosterolemia. Curr Opin Lipidol
2001 April;12(2):141-9.
(33) Hidaka H, Nakamura T, Aoki T, Kojima H, Nakajima Y, Kosugi K,
Hatanaka I, Harada M, Kobayashi M, Tamura A, . Increased plasma plant
sterol levels in heterozygotes with sitosterolemia and xanthomatosis. J
Lipid Res 1990 May;31(5):881-8.
(34) Rees DC, Iolascon A, Carella M, O'marcaigh AS, Kendra JR, Jowitt SN,
Wales JK, Vora A, Makris M, Manning N, Nicolaou A, Fisher J, Mann A,
Machin SJ, Clayton PT, Gasparini P, Stewart GW. Stomatocytic
haemolysis and macrothrombocytopenia (Mediterranean
stomatocytosis/macrothrombocytopenia) is the haematological
presentation of phytosterolaemia. Br J Haematol 2005 July;130(2):297-
309.
(35) Berge KE, Tian H, Graf GA, Yu L, Grishin NV, Schultz J, Kwiterovich P,
Shan B, Barnes R, Hobbs HH. Accumulation of dietary cholesterol in
sitosterolemia caused by mutations in adjacent ABC transporters. Science
2000 December 1;290(5497):1771-5.
17
(36) Lee MH, Lu K, Hazard S, Yu H, Shulenin S, Hidaka H, Kojima H, Allikmets
R, Sakuma N, Pegoraro R, Srivastava AK, Salen G, Dean M, Patel SB.
Identification of a gene, ABCG5, important in the regulation of dietary
cholesterol absorption. Nat Genet 2001 January;27(1):79-83.
(37) Lu K, Lee MH, Hazard S, Brooks-Wilson A, Hidaka H, Kojima H, Ose L,
Stalenhoef AF, Mietinnen T, Bjorkhem I, Bruckert E, Pandya A, Brewer
HB, Jr., Salen G, Dean M, Srivastava A, Patel SB. Two genes that map to
the STSL locus cause sitosterolemia: genomic structure and spectrum of
mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and
ABCG8, respectively. Am J Hum Genet 2001 August;69(2):278-90.
(38) Weihrauch JL, Gardner JM. Sterol content of foods of plant origin. J Am
Diet Assoc 1978 July;73(1):39-47.
(39) Schoenheimer R. NEW CONTRIBUTIONS IN STEROL METABOLISM.
Science 1931 December 11;74(1928):579-84.
(40) Bhattacharyya AK, Connor WE. Beta-sitosterolemia and xanthomatosis. A
newly described lipid storage disease in two sisters. J Clin Invest 1974
April;53(4):1033-43.
(41) Salen G, Kwiterovich PO, Jr., Shefer S, Tint GS, Horak I, Shore V, Dayal
B, Horak E. Increased plasma cholestanol and 5 alpha-saturated plant
sterol derivatives in subjects with sitosterolemia and xanthomatosis. J
Lipid Res 1985 February;26(2):203-9.
18
(42) Yu L, Hammer RE, Li-Hawkins J, von BK, Lutjohann D, Cohen JC, Hobbs
HH. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in
biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002 December
10;99(25):16237-42.
(43) Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M, Shefer S, Batta
AK, Yu H, Chen J, Klein R, Looije N, Oude-Elferink R, Groen AK, Maeda
N, Salen G, Patel SB. A mouse model of sitosterolemia: absence of
Abcg8/sterolin-2 results in failure to secrete biliary cholesterol. BMC Med
2004 March 24;2:5.
(44) Yu L, von BK, Lutjohann D, Hobbs HH, Cohen JC. Selective sterol
accumulation in ABCG5/ABCG8-deficient mice. J Lipid Res 2004
February;45(2):301-7.
(45) Kruit JK, Drayer AL, Bloks VW, Blom N, Olthof SG, Sauer PJ, de HG,
Kema IP, Vellenga E, Kuipers F. Plant sterols cause
macrothrombocytopenia in a mouse model of sitosterolemia. J Biol Chem
2008 March 7;283(10):6281-7.
(46) Ostlund RE, Jr., McGill JB, Zeng CM, Covey DF, Stearns J, Stenson WF,
Spilburg CA. Gastrointestinal absorption and plasma kinetics of soy
Delta(5)-phytosterols and phytostanols in humans. Am J Physiol
Endocrinol Metab 2002 April;282(4):E911-E916.
19
(47) Demonty I, Ras RT, van der Knaap HC, Duchateau GS, Meijer L, Zock
PL, Geleijnse JM, Trautwein EA. Continuous dose-response relationship
of the LDL-cholesterol-lowering effect of phytosterol intake. J Nutr 2009
February;139(2):271-84.
(48) POLLAK OJ. Reduction of blood cholesterol in man. Circulation 1953
May;7(5):702-6.
(49) Loizou S, Lekakis I, Chrousos GP, Moutsatsou P. Beta-sitosterol exhibits
anti-inflammatory activity in human aortic endothelial cells. Mol Nutr Food
Res 2010 April;54(4):551-8.
(50) Woyengo TA, Ramprasath VR, Jones PJ. Anticancer effects of
phytosterols. Eur J Clin Nutr 2009 July;63(7):813-20.
(51) Brull F, Mensink RP, van den HK, Duijvestijn A, Plat J. TLR2 activation is
essential to induce a Th1 shift in human peripheral blood mononuclear
cells by plant stanols and plant sterols. J Biol Chem 2010 January
29;285(5):2951-8.
(52) Su K, Sabeva NS, Liu J, Wang Y, Bhatnagar S, van der Westhuyzen DR,
Graf GA. The ABCG5 ABCG8 sterol transporter opposes the development
of fatty liver disease and loss of glycemic control independently of
phytosterol accumulation. J Biol Chem 2012 August 17;287(34):28564-75.
20
(53) Miettinen TA, Klett EL, Gylling H, Isoniemi H, Patel SB. Liver
transplantation in a patient with sitosterolemia and cirrhosis.
Gastroenterology 2006 February;130(2):542-7.
(54) Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ.
Regulation of ATP-binding cassette sterol transporters ABCG5 and
ABCG8 by the liver X receptors alpha and beta. J Biol Chem 2002 May
24;277(21):18793-800.
(55) Yu L, York J, von BK, Lutjohann D, Cohen JC, Hobbs HH. Stimulation of
cholesterol excretion by the liver X receptor agonist requires ATP-binding
cassette transporters G5 and G8. J Biol Chem 2003 May
2;278(18):15565-70.
(56) Lo SG, Murzilli S, Salvatore L, D'Errico I, Petruzzelli M, Conca P, Jiang
ZY, Calabresi L, Parini P, Moschetta A. Intestinal specific LXR activation
stimulates reverse cholesterol transport and protects from atherosclerosis.
Cell Metab 2010 August 4;12(2):187-93.
(57) Yasuda T, Grillot D, Billheimer JT, Briand F, Delerive P, Huet S, Rader DJ.
Tissue-specific liver X receptor activation promotes macrophage reverse
cholesterol transport in vivo. Arterioscler Thromb Vasc Biol 2010
April;30(4):781-6.
21
CHAPTER II
PHYTOSTEROL FEEDING CAUSES TOXICITY IN ABCG5/G8 KNOCKOUT MICE
Allison L McDaniel, Heather M Alger, Janet K Sawyer, Kathryn L Kelley, Nancy D Kock, J Mark Brown, Ryan E Temel, and Lawrence L Rudel
The following chapter was published in American Journal of Pathology. Stylistic variations are due to requirements of the journal.
22
ABSTRACT
Plant sterols, or phytosterols, are very similar in structure to cholesterol and are abundant in typical diets. It is unknown, however, why the body poorly absorbs plant sterols. Mutations in the ABC transporters G5 and G8 are known to cause an accumulation of plant sterols in blood and tissues (sitosterolemia). In order to determine the significance of phytosterol exclusion from the body, we fed wild type and ABCG5/G8 knockout mice a diet enriched with plant sterols. The high phytosterol diet was extremely toxic to the ABCG5/G8 knockout mice but had no adverse effects on wild type mice. ABCG5/G8 knockout mice died prematurely and developed a phenotype that included high levels of plant sterols in many tissues, liver abnormalities, and severe cardiac lesions. This study is the first to report such toxic effects of phytosterol accumulation in ABCG5/G8 knockout mice. We believe this new data supports the conclusion that plant sterols are excluded from the body because they are toxic when present at high levels.
INTRODUCTION
One of the longstanding mysteries of sterol metabolism is the need for discrimination between plant sterols (or phytosterols) and cholesterol. It has long been observed that while a typical diet generally contains similar amounts of cholesterol and phytosterols, intestinal cholesterol absorption rates are 40 to
60% while phytosterols are mostly excluded from the body due to intestinal absorption rates of less than 5% (1;2). The discrimination against phytosterols
23 has a basis in chemical structure. Campesterol, with a single carbon side chain at carbon 24 typically has a plasma concentration 500 times less than cholesterol while the concentration of sitosterol, with a 2 carbon side chain at carbon 24, is about 20,000 times lower than cholesterol (3).
The need for discrimination among sterols is not fully understood. In 1974,
Bhattacharyya and Conner (4) described a new lipid storage disease termed β- sitosterolemia, in two sisters with plant sterol accumulation in blood and tissues.
Subsequently, several other patients with sitosterolemia have been identified (5).
Patients accumulate plant sterols in many tissues and often present with tendinous and cutaneous xanthomas and hypercholesterolemia (5;6). There are also indications that plasma plant sterol accumulation has negative effects on platelet biology (7). Elimination of plant sterols from their diet is an effective treatment for patients (7;8).
Subsequent work has identified genetic mutations to the heterodimeric ABC transporters, ABCG5 and ABCG8, as the cause of sitosterolemia (9-11). Both
ABCG5 and ABCG8 must be expressed for their co-transport from the endoplasmic reticulum (ER) to the cell surface (12;13). Therefore, mutations to either or both of these proteins can result in a loss of functionality. These proteins are mainly expressed in the intestine and liver on the apical surface of enterocytes and hepatocytes (12;14). They apparently function to transport
24 cholesterol and phytosterols into bile in the liver and into the lumen of the small intestine (15), although the full functional significance is yet to be determined.
The identification of ABCG5 and ABCG8 as important players in sterol transport has led to the discovery and creation of several mouse models that lack one or both of the proteins. By genetic manipulations, ABCG5 single knockout, ABCG8 single knockout, and ABCG5/G8 double knockout mice have been created.
Additionally, one mouse model with a spontaneous mutation of ABCG5 has been previously described in the literature. The trac mutant mouse, which develops thrombocytopenia and cardiomyopathy, has a spontaneous point mutation at base 1435 of Abcg5 that results in a premature stop codon (16). The trac mutant mice and the genetically modified knockout mice have subtle differences among the models, but all have the fundamental accumulation of plant sterols in plasma and tissues (15;17-20). This phenotype is similar to that of human patients with sitosterolemia. Clearly, ABCG5 and ABCG8 play an essential role in excluding plant sterols from the body, although the purpose underlying this function is not well understood.
In order to determine the significance of phytosterol exclusion from the body, wild type and ABCG5/G8 knockout (KO) mice were fed a diet high in phytosterols
(0.2% w/w). The high phytosterol diet had no adverse effects on wild type mice, but surprisingly was extremely toxic to ABCG5/G8 KO mice. High levels of tissue plant sterol accumulation cause premature death, highly complex cardiac lesions,
25 liver damage, and hepatosplenomegaly, which have not been previously reported in this model.
METHODS
Animals and diet: ABCG5/G8 KO mice have been described previously (21).
WT and ABCG5/G8 KO mice on a mixed background of 81.5% C57Bl/6, 12.5%
SvJae, 6% 129SvEv were housed in a specific pathogen-free animal facility in plastic cages in a temperature-controlled room (22°C) with a daylight cycle from
6AM to 6PM. The mice were fed ad libitum a standard rodent chow diet
(5P00Prolab; LabDiet) prior to the start of the high-phytosterol diet and had free access to water. At 6-8 weeks of age, female WT and ABCG5/G8 KO mice were fed a low-fat (10% of energy as palm oil enriched fat) synthetic diet containing
0.2% (w/w) phytosterols and 0.001% (w/w) cholesterol (Supplemental Table 1) for 6 weeks. The diet was made at the Wake Forest University Primate Center
Diet Laboratory. Body weights were measured weekly throughout the study. All animal procedures were approved by the institutional animal care and use committee at Wake Forest University Health Sciences.
Measurement of plasma and tissue lipid concentrations: After a 4 h fast, blood was collected from mice that had been fed the synthetic diets for 6 weeks.
Tissues were flushed with saline, removed, weighed and either snap-frozen in liquid nitrogen or fixed in 10% neutral buffered formalin (NBF) for later analyses.
26
To determine total plasma cholesterol and phytosterol concentrations, 25μL of plasma was placed into a glass tube containing 21μg 5α-cholestane and extracted in 2:1 CHCl3:methanol overnight. Erythrocytes were separated from
plasma and rinsed with saline before an overnight extraction in 2:1
CHCl3:methanol. 5α-cholestane was used as an internal standard. For tissue
analysis of cholesterol and phytosterol concentrations, ∼50mg of frozen tissue
was placed into a glass tube containing 135 μg 5α-cholestane. Lipids were extracted in 2:1 CHCl3:methanol at room temperature overnight. Total sterol
mass was measured for all samples by gas-liquid chromatography as described
previously (22).
Hematologic measurements: After a four-hour fast, a blood sample was
obtained via submandibular puncture biweekly after high-phytosterol diet feeding
began. Separate tubes were used for blood collection of serum and plasma
samples. Samples were spun to separate erythrocytes. Serum chemistry values
were determined by ANTECH Diagnostics (Lake Success, NY). Hematocrit
values were determined by collection of blood into hematocrit tubes and spun to
pack red cells (VWR International, West Chester, PA).
Real Time Polymerase Chain Reaction (RT-PCR) analysis of gene
expression in livers and spleens: Frozen pieces (~50mg) of liver and spleen
were homogenized into 1ml of Trizol Reagent (Invitrogen) and total RNA was
extracted according to manufacturer’s instructions. Recovery and integrity of
27
RNA was determined and cDNA was made using Omniscript Reverse
Transcriptase (Qiagen) and 1μg of RNA according to manufacturer’s instructions.
Relative gene expression was determined in each cDNA sample using forward and reverse primers designed to each gene of interest (Table 1) and SYBR-
Green PCR master mix (Applied Biosciences). Reactions were monitored on an
ABI Prism 7000 Sequence Detection System using the cycling parameters: 50oC-
2min, 95oC-10min, (95oC-15sec, 60oC-1min)-40 cycles, 60oC-1min, 60oC dissociation. Relative expression of each gene was normalized to expression of a housekeeping gene (actin or 18S ribosomal RNA) to control for intra-/inter- sample variation and expressed as arbitrary units (AU).
28
TABLE 1
Gene Primer 1 (5’→3’) Primer 2 (5’→ 3’)
ABCA1 CGTTTCCGGGAAGTGTCCTA GCTAGAGATGACAAGGAGGATGGA
ABCB11 GACATGCTTGCGAGGACCTT AGCGTTGCCGGATGGA
BLVRA CTTGATGGAAGAGTTCGAATTCCT GTGAAGCGAAGAGATCCTTTTAGC
CD68 CCTCCACCCTCGCCTAGTC TTGGGTATAGGATTCGGATTTGA
CYP7A1 AGCAACTAAACAACCTGCCAGTACTA GTCCGGATATTCAAGGATGCA
Cyclophilin TGGAGAGCACCAAGACAGACA TGCCGGAGTCGACAATGAT
HMGCS GCCGTGAACTGGGTCGAA GCATATATAGCAATGTCTCCTGCAA
HO1 CAACAGTGGCAGTGGGAATTTA CCAGGCAAGATTCTCCCTTACC
IL-6 CTGCAAGAGACTTCCATCCAGTT AGGGAAGGCCGTGGTTGT
PLTP TGGGACGGTGTTGCTCAA CCCACGAGATCATCCACAGA
SCD1 CCGGAGACCCCTTAGATCGA TAGCCTGTAAAAGATTTCTGCAAACC
SR-BI TCCCCATGAACTGTTCTGTGAA TGCCCGATGCCCTTGA
SREBP1C GGAGCCATGGATTGCACATT GGCCCGGGAAGTCACTGT
UGT1A CACCACACCTGCGCCC CCAATCACATCCAAGGAGTGGTA
Table 1. RT-PCR primers.
29
Histology: Hearts were preserved in 10% neutral buffered formalin (NBF) for at least 24 hours, processed routinely for histology, cut at 6 microns, and sections were stained with hematoxylin and eosin (H and E), Masson’s trichrome and Von
Kossa. Snap-frozen liver samples were preserved for 48 hours in 10% NBF, followed by cryo-preservation in 20% sucrose, prior to routine histology processing and staining with H and E. Tissues were examined by light microscopy in a blinded fashion by a board certified anatomic veterinary pathologist. To determine Kupffer cell infiltration, cells were counted in a single microscopic field for each liver section. Kupffer cell number was normalized to the total number of hepatocytes in each field. In order to quantitate cardiac fibrosis, trichrome stained sections were used. An outline of the heart chambers was traced and subtracted from the total heart area. Then, areas of fibrosis were traced and normalized to the calculated heart area.
Statistical Analyses and Data Presentation: Data are expressed as the mean
± SEM. Significance of differences was determined for each group of values by
ANOVA (Tukey-Kramer honestly significant difference) or unpaired t-test.
A p value < 0.05 was considered significant. All analyses were performed using
GraphPad Prism 4 software (LaJolla, CA).
30
RESULTS
ABCG5/G8 KO mice failed to gain weight and developed hepatosplenomegaly when fed a high phytosterol diet
When fed a diet rich in plant sterols, wild type mice maintained a normal phenotype, while ABCG5/G8 KO mice showed generally poor health, characterized by weight loss, hunching, lethargy, and decreased life span
(unpublished observations by McDaniel & Alger). Figure 1A shows that wild type mice gained weight over a six week timecourse of the high phytosterol diet feeding, while the ABCG5/G8 KO mice did not gain weight relative to their baseline measurement. This phenotype was not seen in ABCG5/G8 KO mice fed a diet containing an identical amount of cholesterol (see Supplemental Fig 1 &
Supplemental Table 1 at http://ajp.amjpathol.org). This observation suggests that the effects were not caused by a general accumulation of sterols in the body, but rather, were caused specifically by the accumulation of plant sterols.
Further investigation revealed that by 6 weeks, the ABCG5/G8 KO mice fed the high phytosterol diet had a high liver to bodyweight ratio (Fig 1B). Measurement of organ weights showed significantly higher liver mass and spleen mass (Fig
1C) in ABCG5/G8 KO mice compared to wild type mice. This organ enlargement translated into significantly increased percentages of total bodyweight for liver and spleen (Fig 1D). By contrast, there was no change in the mass or percentage of bodyweight of the kidneys or lungs of ABCG5/G8 KO mice (Fig 1C
& 1D).
31
Supplemental Figure 1. Bodyweight measurement. Animals were fed a high cholesterol diet (0.2% w/w) for 6 weeks. WT (n=5), ABCG5/G8 KO (n=8). Bodyweights were measured weekly.
Diet Cholesterol Campesterol Stigmasterol Sitosterol High (mg Phytostero sterol/100g 11 51.8 54.2 91.4 l dried weight) % of diet 5 25 26 44 High (mg Cholester sterol/100g 199.9 5.6 3.7 12.3 ol dried weight) % of diet 90 3 2 6
Supplemental Table 1. Dietary sterol compositions.
32
Figure 1. Measurement of body and tissues weights. Animals were fed a diet rich in plant sterols (0.2%) for 6 weeks. WT (n=5), ABCG5/G8 KO (n=10). (A) weekly bodyweight in grams, (B) terminal liver to bodyweight ratio multiplied by 100, (C) terminal organ mass in grams, and (D) percentage of total bodyweight as individual tissue. * indicates p<0.05 as measured by ANOVA and Tukey- Kramer post-test.
33
In ABCG5/G8 KO mice, plant sterol accumulation caused liver damage
To further characterize the health of the phytosterol-fed ABCG5/G8 KO mice, serum chemistry values were assessed. Serum ALT/SGPT (alanine transaminase/glutamic-pyruvic transaminase) concentrations were found to be elevated in ABCG5/G8 KO mice at all timepoints, in contrast to concentrations in wild type mice that remained in the normal range (Fig 2A). ABCG5/G8 KO mice showed no changes in serum glucose, urea nitrogen (BUN), creatinine, total protein, alkaline phosphatase, calcium, or phosphorus when compared to wild type mice over the 6 week dietary timecourse (data not shown).
Sections of liver from wild type and ABCG5/G8 KO mice stained with H and E were reviewed by an anatomic veterinary pathologist (Fig 2B-E). ABCG5/G8 KO mouse livers (Fig 2D-E) had piecemeal necrosis and hepatocellular degeneration, cellular rounding and detachment (red arrows), and prominent diffuse Kupffer cell hyperplasia (green arrows). Quantification of Kupffer cells in these livers revealed a 2.19 fold increase in the number of Kupffer cells present in ABCG5/G8 KO mouse livers as compared to wild type. This increase in
Kupffer cells was also reflected by a higher ratio of Kupffer cells to hepatocytes
(WT = 0.68, KO = 2.01). Further confirming the histological increase in Kupffer cells, a significant 2.3 fold increase in the hepatic macrophage marker, CD68, was measured by mRNA levels in ABCG5/G8 KO mice (Table 2). Wild type mouse livers (Fig 2B-C) were considered normal.
34
Figure 2. Assessment of liver pathology. (A), biweekly measures of serum ALT (SGPT) expressed as U/dL showed significant increases in the phytosterol fed ABCG5/G8 KO mice. (B-E) Photomicrographs of liver from wild type mice (B, C) and ABCG5/G8 KO mice (D, E). Liver from the wild type mice was considered within normal limits. That from the ABCG5/G8 KO mice shows piecemeal hepatocellular necrosis with cellular rounding and detachment (red & yellow arrows), nuclear pyknosis, hepatocellular swelling, and Kupffer cell hyperplasia (green arrows). H and E 100X. *indicates p<0.05 as measured by ANOVA and Tukey-Kramer post-test.
35
In order to examine the effects of phytosterol accumulation on hepatic lipid and bile acid metabolism, a variety of genes were selected and mRNA levels were measured by RT-PCR. As previously reported by Yu et al (21), ABCG5/G8 KO mice had a significant decrease in hepatic hydroxymethylglutaryl CoA synthase
(HMGCS) mRNA when compared to wild type mice. Other significant changes to hepatic mRNA levels included an increase in stearoyl-CoA desaturase-1 (SCD1) and a decrease in ATP-binding cassette transporter B11 (ABCB11). Expression levels of scavenger receptor class B member I (SR-BI), ATP-binding cassette transporter A1 (ABCA1), phospholipid transfer protein (PLTP), sterol regulatory element binding protein 1C (SREBP1C), and cholesterol 7α-hydroxylase
(CYP7A1) were not significantly different between wild type and ABCG5/G8 KO mice. Preliminary data was obtained suggesting that in these mice, phytosterols are not converted into C21 bile acids as had been suggested to occur in rats
(23)(Alger and Bjorkhem, unpublished results). More work, however, needs to be done to determine the specific roles phytosterols may play in hepatic lipid and bile acid metabolism.
36
Hepatic Gene Expression
WT ABCG5/G8 KO p Bilirubin Metabolism BLVRA 12.38 ± 0.94 10.86 ± 1.84 0.5656 HO-1 7.73 ± 0.79 24.93 ± 4.06 * 0.0061 UGT1a 38.29 ± 4.14 18.34 ± 2.77 * 0.0069
Inflammatory Markers CD68 12.7 ± 2.68 29.8 ± 3.29 * 0.007 IL-6 3.1 ± 0.65 3.4 ± 0.66 0.7672
Lipid Metabolism HMGCS 27.90 ± 2.68 14.62 ± 2.82 * 0.0145 SR-BI 8.8 ± 1.86 9.2 ± 1.45 0.8670 ABCA1 4.3 ± 0.40 5.3 ± 0.76 0.2924 SCD1 145.5 ± 18.53 305.5 ± 45.01 * 0.0167 PLTP 1.36 ± 0.31 1.18 ± 0.11 0.6046 SREBP1C 2.3 ± 0.27 3.1 ± 0.32 0.1271
Bile Acid Metabolism CYP7A1 22.9 ± 8.61 18.1 ± 2.66 0.6104 ABCB11 9.3 ± 0.97 4.4 ± 0.34 * 0.0029
Splenic Gene Expression
WT ABCG5/G8 KO p
BLVRA 10.61 (0.62) 13.86 (0.97) * 0.0369 HO-1 26.31 (1.66) 31.19 (6.83) 0.5059 HMGCS 8.53 (0.97) 8.25 (0.86) 0.6891
Table 2. Hepatic and splenic gene expression. mRNA was extracted from terminal tissues. Gene expression was normalized to Cyclophilin or 18s ribosomal RNA and expressed as average units (AU) ± SEM. * indicates p<0.05 as measured by unpaired t-test.
37
ABCG5/G8 KO mice accumulated plant sterols in a variety of tissues
Because ABCG5/G8 KO mice accumulate plant sterols in liver and plasma on a chow based diet with only natural phytosterol levels (15), we measured the total sterol concentrations across several tissues. Liver, heart, spleen, kidney, lung, and adrenal tissues from ABCG5/G8 KO mice all have greatly increased levels of phytosterols, relative to wild type mice, but minimal changes in the amount of total sterol present - with the exception of adrenal tissue (Fig 3A & B). As a result, phytosterols account for a large percentage of the total sterol amounts in the tissues of ABCG5/G8 KO mice. In fact, tissue total sterol composition reached as high as 77% phytosterol in the liver (Fig 3C). Other plant sterol- containing tissues had a range of total sterol composition from 41-72% phytosterol (Fig 3C). As previously reported in chow-fed ABCG5/G8 KO mice
(19), plant sterols did not accumulate in the brain to the same extent as other tissues (Fig 3A & C).
38
Figure 3. Tissue sterol concentrations. Sterols from terminal tissues were extracted and analyzed by GC. Plant sterol values are shown in white and cholesterol values are shown in black. (A) Plant sterol mass expressed as μg/mg of tissue wet weight. (B) Cholesterol mass expressed as μg/mg of tissue wet weight. (C) Tissue plant sterol and cholesterol values expressed as percentages of the total sterol concentration.
39
Total plasma sterol concentration was over 2-fold higher in ABCG5/G8 KO mice compared to wild type mice (Fig 4A). This increase was due to a plasma phytosterol concentration of 250mg/dL (Fig 4A), which resulted in almost 75% of total plasma sterol to be plant sterol in ABCG5/G8 KO mice (Fig 4B). As previously reported in chow fed ABCG5/G8 KO mice, plasma cholesterol concentrations decreased in the phytosterol-fed ABCG5/G8 KO mice as compared to wild type mice ((15), Fig 4A).
Hematocrit and erythrocyte sterol composition were also measured since macrothrombocytopenia has been observed in both human patients with sitosterolemia and in ABCG5/G8 KO mice (7;20). After receiving the phytosterol- enriched diet for only 2 weeks, ABCG5/G8 KO mice had lower hematocrit, compared to wild type mice (Fig 4C) that persisted at weeks 4 and 6.
Additionally, the erythrocyte sterol composition of ABCG5/G8 KO mice, which began at 38% phytosterol at baseline, increased to almost 60% phytosterol over the 6 week dietary timecourse (Fig 4D).
40
Figure 4. Plasma characterization. Terminal plasma samples were collected for analysis. (A) Sterols were extracted and expressed as mg/dL of plasma. Plant sterol values are shown in white and cholesterol values are shown in black. (B) Plasma plant sterol and cholesterol values expressed as percentages of the total sterol concentration. (C) Biweekly hematocrit measurements are expressed as % of blood that is erythrocytes. (D) Biweekly erythrocyte plant sterol content is shown as a percentage of the total sterol concentration. * indicates p<0.05 as measured by ANOVA and Tukey-Kramer post-test.
41
Erythrocyte clearance gene expression was elevated in ABCG5/G8 KO mice
The liver and spleen both play an important role in erythrocyte removal from the plasma. Since the liver and spleen were significantly enlarged and the erythrocytes of ABCG5/G8 KO mice contained a large amount of plant sterol that could affect their function, RT- PCR was used to measure the expression of several hepatic and splenic genes involved in erythrocyte clearance. These genes were selected based on previous studies by Meurs et al (24) describing the erythrocyte clearance pathway and the genes involved in the controlled breakdown of erythrocyte bilirubin. These genes included BLVRA (biliverdin reductase A), HO-1 (hemeoxygenase 1), UGT1A (diphosphoglucuronate glucuronosyltransferase 1A), and HMGCS (HMG-CoA synthase). Relative hepatic and splenic gene expression was normalized to cyclophilin and compared between wild type and ABCG5/G8 KO mice on the high phytosterol diet. Consistent with the findings of hepatosplenomegaly and reduced hematocrit, expression of hepatic HO-1, UGT1-a, and HMGCS along with splenic
BLVRA were significantly altered in mice lacking ABCG5/G8 (Table 2).
ABCG5/G8 KO mice develop complex cardiac lesions
During necropsy, an unusual cardiac phenotype was detected in the ABCG5/G8
KO mice. Approximately half of the phytosterol-fed ABCG5/G8 KO mice had irregularly shaped and sized areas of pallor in the left ventricle (Fig 5A). In order
42 to characterize these cardiac lesions, hearts fixed in neutral buffered formalin were sectioned and stained with H and E, Von Kossa, and Masson’s trichrome. H and E staining confirmed that the wild type hearts did not have lesions (Fig 5B).
H and E stained hearts from ABCG5/G8 KO mice, however, had extensive myocardiocyte loss with replacement by fibrosis and calcification (Fig 5B). Von
Kossa and Masson’s trichrome stains confirmed the presence of calcium and collagen in these cardiac lesions (Fig 5B). Morphometric quantification of the fibrosis revealed a >20 fold increase in the amount of myocardial fibrosis detected in ABCG5/G8 KO mice compared to wild type mice. When cross sectional fibrosis was measured, approximately 20% of the area was fibrotic in
ABCG5/G8 KO mouse heart, but less than 1% of the area was fibrotic in wild type mouse heart.
43
Figure 5. Cardiac histology. (A) Gross images of hearts from wild type (top) and ABCG5/G8 KO mice (bottom – labeled G5G8 in the figure). The ABCG5/G8 KO mice had areas of pallor on the left ventricular free wall (red arrows). Lesions were absent in the wild type hearts. (B) Photomicrographs of wild type and ABCG5/G8 KO mouse hearts. Wild type hearts were considered within normal limits. Hearts from ABCG5/G8 KO mice had extensive left ventricular myocardial loss (H and E) with replacement by fibrous connective tissue (Masson’s trichrome) and extensive mineralization (Von Kossa). Lesions were absent in the wild type mice. 4X and 40X magnification is indicated.
44
DISCUSSION
This study shows for the first time specific toxicities that occur when phytosterols accumulate at high levels in the body. ABCG5/G8 KO mice, which hyperabsorb plant sterols, fail to gain weight, become lethargic and hunched, and die prematurely when fed a high phytosterol diet. This phenotype is specific to plant sterol accumulation, as we did not see signs of poor health in ABCG5/G8 KO mice fed a high (0.2% w/w) cholesterol diet. Toxic side effects have not been reported in other studies where ABCG5/G8 double knockout mice were fed chow based diets containing relatively lower levels of phytosterols (15;19).
In agreement with other studies (15;19), campesterol and sitosterol were the main plant sterol species that accumulated in ABCG5/G8 KO mice fed the plant sterol rich diet. Plant sterols accumulated to very high levels in the tissues of phytosterol-fed ABCG5/G8 KO mice. Phytosterols constituted 77% of all hepatic sterols in our mice and ranged from 41-72% of sterols in spleen, heart, kidney, lung, and adrenal glands. These values are much higher than reported values in
ABCG5/G8 knockout mice fed a chow diet (15). On a chow diet, plasma phytosterol concentrations in ABCG5/G8 KO mice averaged 30-50mg/dL (15;19).
On the high phytosterol diet we used, however, plasma phytosterol levels reached 5 times that amount.
The extreme levels of phytosterol accumulation caused damage in several tissues. ABCG5/G8 KO mice had hepatosplenomegaly and liver damage. Most
45 strikingly, ABCG5/G8 KO mice developed extensive myocardial calcification and fibrosis with loss of myocardiocytes. Contrastingly, cardiomyopathy with multifocal myocardial fibrosis was reported in the trac mutant mouse, but cardiac lesions were not described (16).
The trac mutant mice have a naturally occurring spontaneous mutation only in
ABCG5 that causes them to accumulate plant sterols. Interestingly, this particular mutation seems to be associated with a less severe phenotype than seen here in phytosterol-fed ABCG5/G8 KO mice. The trac mutant mice, however, were not fed the high phytosterol diet. Trac mutant mice become hunched and have a shortened life span of 4-6 months on a regular chow diet (16). In comparison,
ABCG5/G8 KO mice died as early as 3 months of age when fed the high phytosterol diet (5 weeks of diet feeding). Other gross indicators of poor health found in our ABCG5/G8 KO mice, like lethargy and failure to gain weight, were not reported in trac mutant mice.
The differences between these mouse models could be attributed to the amount of phytosterols that accumulate in the body. Trac mutant mice have plasma phytosterol concentrations of approximately 130mg/dL, which fall in between chow-fed ABCG5/G8 knockout mice (30-50mg/dL) and phytosterol-fed
ABCG5/G8 KO mice (>250mg/dL). This would support the idea that the level of toxicity of phytosterols depends on the total amount of accumulation in the body.
46
Studies in both humans and mouse models have revealed macrothrombocytopenia as a marker of sitosterolemia (7;20). The plasma phenotype of ABCG5/G8 KO mice fed a high phytosterol diet was consistent with those findings. Erythrocyte phytosterol content increased by 20% and significant decreases in hematocrit were seen as early as 2 weeks of phytosterol-enriched diet feeding. Hepatic HO-1, UGT-1A, HMGCS, and splenic BLVRA expression levels were significantly altered in ABCG5/G8 KO mice. These data indicate that the erythrocyte clearance pathway is upregulated, which could be an attempt to clear altered red blood cells.
Other studies have not reported large accumulations of phytosterols in the brain of ABCG5/G8 knockout mice (19). Alternatively, P.J. Jansen et al. measured a small but significant amount of phytosterols, 600-1000 ng/mg dry weight, in the brain of chow fed ABCG5 or ABCG8 knockout mice (25). In our study, we also found small but significant amounts of plant sterols that averaged 230 ng/mg in the brain of ABCG5/G8 KO mice fed a high phytosterol diet. These levels of phytosterols in the brain were miniscule (<2%) compared to the amounts that accumulated in other tissues.
The findings of this study are useful in relation to dietary phytosterol supplementation, which is currently used to reduce the risk of coronary heart disease (CHD) (26;27). Plant sterols are thought to reduce plasma cholesterol concentrations by inhibiting cholesterol absorption (28;29). Most individuals are
47 able to exclude plant sterols from the body via ABCG5/G8, and the FDA allows phytosterol-enriched foods to be classified as “generally recognized as safe.” In several species of animals, presumably with ABCG5/G8 intact, that have been administered high doses of plant sterols, there have been no reports of toxicity
(2). Some debate still exists, however, about the safety of dietary phytosterol supplementation, specifically concerning their potential cytotoxic effects on endothelial cells in arteries.
Our study shows that an extremely high concentration of phytosterols in plasma and tissues is widespread and toxic. This phenotype seems to depend specifically on the amount of phytosterols that accrue. The presence of intact
ABCG5/G8 in an individual appears to offer full protection against dietary phytosterol accumulation, and there is no indication that long term exposure could cause levels of phytosterols to build up to toxic levels. Consequently, dietary supplementation with phytosterols appears safe for the general population.
Our findings also lend novel insight into the body’s need for discrimination between plant sterols and cholesterol. We have shown for the first time that high levels of tissue plant sterol accumulation cause premature death, extensive cardiac lesions, liver damage, and hepatosplenomegaly. These toxicities appear related to accumulation of high levels of unesterified phytosterols that cannot be efficiently metabolized into bile acids nor esterified for storage in lipid droplets.
48
Accumulation as the free sterol probably results in accumulation in membranes with subsequent disruption of membrane integrity. In conclusion, our data show that ABCG5/G8’s role in phytosterol exclusion from the body is one of protection from the toxic effects of plant sterols.
49
REFERENCE LIST
1. Weihrauch JL and Gardner JM: Sterol content of foods of plant origin. J Am
Diet Assoc 1978, 73: 39-47
2. Schoenheimer R: NEW CONTRIBUTIONS IN STEROL METABOLISM.
Science 1931, 74: 579-584
3. Ostlund RE, Jr., McGill JB, Zeng CM, Covey DF, Stearns J, Stenson WF,
and Spilburg CA: Gastrointestinal absorption and plasma kinetics of
soy Delta(5)-phytosterols and phytostanols in humans. Am J Physiol
Endocrinol Metab 2002, 282: E911-E916
4. Bhattacharyya AK and Connor WE: Beta-sitosterolemia and xanthomatosis.
A newly described lipid storage disease in two sisters. J Clin Invest
1974, 53: 1033-1043
5. Lee MH, Lu K, and Patel SB: Genetic basis of sitosterolemia. Curr Opin
Lipidol 2001, 12: 141-149
6. Hidaka H, Nakamura T, Aoki T, Kojima H, Nakajima Y, Kosugi K, Hatanaka
I, Harada M, Kobayashi M, Tamura A, and .: Increased plasma plant
sterol levels in heterozygotes with sitosterolemia and xanthomatosis.
J Lipid Res 1990, 31: 881-888
50
7. Rees DC, Iolascon A, Carella M, O'marcaigh AS, Kendra JR, Jowitt SN,
Wales JK, Vora A, Makris M, Manning N, Nicolaou A, Fisher J, Mann
A, Machin SJ, Clayton PT, Gasparini P, and Stewart GW:
Stomatocytic haemolysis and macrothrombocytopenia
(Mediterranean stomatocytosis/macrothrombocytopenia) is the
haematological presentation of phytosterolaemia. Br J Haematol
2005, 130: 297-309
8. Belamarich PF, Deckelbaum RJ, Starc TJ, Dobrin BE, Tint GS, and Salen
G: Response to diet and cholestyramine in a patient with
sitosterolemia. Pediatrics 1990, 86: 977-981
9. Berge KE, Tian H, Graf GA, Yu L, Grishin NV, Schultz J, Kwiterovich P,
Shan B, Barnes R, and Hobbs HH: Accumulation of dietary
cholesterol in sitosterolemia caused by mutations in adjacent ABC
transporters. Science 2000, 290: 1771-1775
10. Lee MH, Lu K, Hazard S, Yu H, Shulenin S, Hidaka H, Kojima H, Allikmets
R, Sakuma N, Pegoraro R, Srivastava AK, Salen G, Dean M, and
Patel SB: Identification of a gene, ABCG5, important in the regulation
of dietary cholesterol absorption. Nat Genet 2001, 27: 79-83
11. Lu K, Lee MH, Hazard S, Brooks-Wilson A, Hidaka H, Kojima H, Ose L,
Stalenhoef AF, Mietinnen T, Bjorkhem I, Bruckert E, Pandya A,
Brewer HB, Jr., Salen G, Dean M, Srivastava A, and Patel SB: Two
genes that map to the STSL locus cause sitosterolemia: genomic
51
structure and spectrum of mutations involving sterolin-1 and sterolin-
2, encoded by ABCG5 and ABCG8, respectively. Am J Hum Genet
2001, 69: 278-290
12. Graf GA, Li WP, Gerard RD, Gelissen I, White A, Cohen JC, and Hobbs HH:
Coexpression of ATP-binding cassette proteins ABCG5 and ABCG8
permits their transport to the apical surface. J Clin Invest 2002, 110:
659-669
13. Graf GA, Yu L, Li WP, Gerard R, Tuma PL, Cohen JC, and Hobbs HH:
ABCG5 and ABCG8 are obligate heterodimers for protein trafficking
and biliary cholesterol excretion. J Biol Chem 2003, 278: 48275-
48282
14. Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, and Mangelsdorf
DJ: Regulation of ATP-binding cassette sterol transporters ABCG5
and ABCG8 by the liver X receptors alpha and beta. J Biol Chem
2002, 277: 18793-18800
15. Yu L, Hammer RE, Li-Hawkins J, von BK, Lutjohann D, Cohen JC, and
Hobbs HH: Disruption of Abcg5 and Abcg8 in mice reveals their
crucial role in biliary cholesterol secretion. Proc Natl Acad Sci U S A
2002, 99: 16237-16242
16. Chase TH, Lyons BL, Bronson RT, Foreman O, Donahue LR, Burzenski
LM, Gott B, Lane P, Harris B, Ceglarek U, Thiery J, Wittenburg H,
52
Thon JN, Italiano JE, Jr., Johnson KR, and Shultz LD: The mouse
mutation "thrombocytopenia and cardiomyopathy" (trac) disrupts
Abcg5: a spontaneous single gene model for human hereditary
phytosterolemia/sitosterolemia. Blood 2010, 115: 1267-1276
17. Plosch T, Bloks VW, Terasawa Y, Berdy S, Siegler K, Van Der SF, Kema
IP, Groen AK, Shan B, Kuipers F, and Schwarz M: Sitosterolemia in
ABC-transporter G5-deficient mice is aggravated on activation of the
liver-X receptor. Gastroenterology 2004, 126: 290-300
18. Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M, Shefer S, Batta AK,
Yu H, Chen J, Klein R, Looije N, Oude-Elferink R, Groen AK, Maeda
N, Salen G, and Patel SB: A mouse model of sitosterolemia: absence
of Abcg8/sterolin-2 results in failure to secrete biliary cholesterol.
BMC Med 2004, 2: 5
19. Yu L, von BK, Lutjohann D, Hobbs HH, and Cohen JC: Selective sterol
accumulation in ABCG5/ABCG8-deficient mice. J Lipid Res 2004, 45:
301-307
20. Kruit JK, Drayer AL, Bloks VW, Blom N, Olthof SG, Sauer PJ, de HG, Kema
IP, Vellenga E, and Kuipers F: Plant sterols cause
macrothrombocytopenia in a mouse model of sitosterolemia. J Biol
Chem 2008, 283: 6281-6287
53
21. Yu L, Hammer RE, Li-Hawkins J, von BK, Lutjohann D, Cohen JC, and
Hobbs HH: Disruption of Abcg5 and Abcg8 in mice reveals their
crucial role in biliary cholesterol secretion. Proc Natl Acad Sci U S A
2002, 99: 16237-16242
22. Temel RE, Gebre AK, Parks JS, and Rudel LL: Compared with Acyl-
CoA:cholesterol O-acyltransferase (ACAT) 1 and lecithin:cholesterol
acyltransferase, ACAT2 displays the greatest capacity to differentiate
cholesterol from sitosterol. J Biol Chem 2003, 278: 47594-47601
23. Boberg KM, Lund E, Olund J, and Bjorkhem I: Formation of C21 bile acids
from plant sterols in the rat. J Biol Chem 1990, 265: 7967-7975
24. Meurs I, Hoekstra M, van Wanrooij EJ, Hildebrand RB, Kuiper J, Kuipers F,
Hardeman MR, van Berkel TJ, and Van EM: HDL cholesterol levels
are an important factor for determining the lifespan of erythrocytes.
Exp Hematol 2005, 33: 1309-1319
25. Jansen PJ, Lutjohann D, Abildayeva K, Vanmierlo T, Plosch T, Plat J, von
BK, Groen AK, Ramaekers FC, Kuipers F, and Mulder M: Dietary
plant sterols accumulate in the brain. Biochim Biophys Acta 2006,
1761: 445-453
26. Wu T, Fu J, Yang Y, Zhang L, and Han J: The effects of
phytosterols/stanols on blood lipid profiles: a systematic review with
meta-analysis. Asia Pac J Clin Nutr 2009, 18: 179-186
54
27. AbuMweis SS, Barake R, and Jones PJ: Plant sterols/stanols as cholesterol
lowering agents: A meta-analysis of randomized controlled trials.
Food Nutr Res 2008, 52:
28. Rozner S and Garti N: The activity and absorption relationship of
cholesterol and phytosterols. Colloid Surf A Physicochem Eng Asp
2006, 282: 435-456
29. Katan MB, Grundy SM, Jones P, Law M, Miettinen T, and Paoletti R:
Efficacy and safety of plant stanols and sterols in the management of
blood cholesterol levels. Mayo Clin Proc 2003, 78: 965-978
55
CHAPTER III
HEPATIC ABCG8 KNOCKDOWN DOES NOT RESULT IN HIGH LEVELS OF PHYTOSTEROL ACCUMULATION
Allison L. McDaniel, Lawrence L Rudel, J. Mark Brown, Ryan E. Temel
56
ABSTRACT
ABCG5/G8 limits sterol accumulation in the body by transporting cholesterol and phytosterols into bile in the liver and into the lumen of the small intestine. Under an unusual circumstance, a patient with β–sitosterolemia received a liver transplant that resolved the disease. This study indicates that when small intestinal ABCG5/G8 function remains absent, the presence of hepatic
ABCG5/G8 is sufficient to limit phytosterol accumulation. The authors of this study concluded that hepatic ABCG5/G8 function is the primary determinant of steady state plasma phytosterol concentration. To date no other data from models of tissue-specific ABCG5/G8 deficiency have been published to confirm this finding. In order to determine whether hepatic ABCG5/G8 function is required for phytosterol exclusion from the body, an anti-sense oligonucleotide (ASO) targeted to ABCG8 was used to knockdown ABCG8 expression in the liver of
C57Bl/6 mice. Surprisingly, mice with hepatic ABCG8 knockdown did not accumulate high levels of phytosterols but did appear to have alterated hepatic cholesterol metabolism.
INTRODUCTION
Sitosterolemia is a lipid storage disease in which genetic mutations to adenosine triphosphate-binding cassette transporter G5 or G8 (ABCG5/G8) cause significant plant sterol (or phytosterol) accumulation in the blood and tissues of patients. Since the discovery of sitosterolemia, many studies have examined the
57 role of ABCG5/G8 in sterol metabolism. Genetic mouse models of whole body
ABCG5/G8 deficiency have phenotypes similar to human patients with sitosterolemia, including reduced levels of biliary sterols and marked accumulation of plant sterols in their blood and tissues1, 2. These findings reveal
that the apparent physiological role of ABCG5/G8 is to limit sterol accumulation in the body by transporting cholesterol and phytosterols into bile in the liver and into the lumen of the small intestine.
The effects of phytosterol accumulation in models of ABCG5/G8 deficiency are substantial. Several groups have reported changes in hepatic cholesterol metabolism when phytosterols are increased1, 3, 4. For example, on low
cholesterol diets ABCG5/G8 KO mice have significant reductions in plasma and
hepatic cholesterol concentrations1, 4, 5. Despite these reductions, there are no
compensatory increases in the expression genes involved in cholesterol
synthesis. Hepatic mRNA levels of HMG-CoA synthase and reductase are
actually reduced by 50% in ABCG5/G8 KO mice. The consequences of
accumulation become dire when the phytosterol concentrations reach very high
levels. We recently reported that feeding ABCG5/G8 KO mice a diet enriched in
phytosterols (0.2% w/w) was extremely toxic5. The high plant sterol diet caused
dramatic increases to plasma and tissue phytosterol concentrations in
ABCG5/G8 KO mice, resulting in premature death, liver abnormalities, and
severe cardiac lesions.
58
From these studies of ABCG5/G8 KO mice, it is not completely clear how much of the changes in sterol metabolism are due to the mass accumulation of plant sterols versus the lack of ABCG5/G8 function. It is possible that the complete role of ABCG5/G8 in sterol metabolism is partly masked by the accumulation of plant sterols. Interestingly, a study was published in 2012 by Su K, et al6 that
used ABCG5/G8 KO mice fed phytosterol-free diets in order to prevent
phytosterol accumulation in plasma and tissues. When mice were fed a
phytosterol-free high fat diet, development of nonalcoholic fatty liver disease was
accelerated in the ABCG5/G8 KO mice when compared to WT mice. These
results support the idea that ABCG5/G8 plays a role in sterol metabolism beyond
its function in limiting phytosterol absorption.
Additionally, some studies raise the possibility that ABCG5/G8 may play slightly
different roles in the liver and the small intestine where they are primarily
expressed. Under an unusual circumstance, a patient with sitosterolemia
received a liver transplant that resolved the disease7. The transplanted liver
presumably had ABCG5/G8 intact, resulting in a unique human model of small
intestine specific ABCG5/G8 deficiency. Prior to transplant, the patient had a
plasma phytosterol concentration of greater than 500 μmol/L. Post-transplant, plasma phytosterol concentrations dropped to below 60 μmol/L. This study indicates that when small intestinal ABCG5/G8 function remained absent, the presence of hepatic ABCG5/G8 was sufficient to limit phytosterol accumulation.
Subsequently, the authors of this study concluded that hepatic ABCG5/G8
59 function is the primary determinant of steady state plasma phytosterol concentration. Further studies need to be done to confirm this conclusion, and to date no other data from models of tissue-specific ABCG5/G8 deficiency have been published.
The goal of this study was to address the relative contribution of hepatic
ABCG5/G8 function to whole body sterol metabolism. In order to do this, an anti- sense oligonucleotide (ASO) targeted to ABCG8 was used to knockdown ABCG8 expression in the liver of C57Bl/6 mice. Based on the results from the human liver transplant patient, we hypothesized that phytosterols would accumulate in the plasma and tissues of mice with hepatic ABCG8 knockdown. Surprisingly, mice with hepatic ABCG8 knockdown did not accumulate high levels of phytosterols but did significantly alterat hepatic cholesterol metabolism.
METHODS
Animals and diet: Female C57Bl/6 mice 6-8 weeks of age were ordered from
Harlan Laboratories (Indianapolis, IN). At 7-9 weeks of age, mice were fed a low- fat (10% of energy as palm oil enriched fat) synthetic diet containing either 0.01%
(w/w) phytosterols and 0.003% (w/w) cholesterol (Low Sterol Diet); 0.01% (w/w) phytosterols and 0.2% (w/w) cholesterol (High Cholesterol Diet); or 0.2% (w/w) phytosterols and 0.003% (w/w) cholesterol (High Phytosterol Diet) (Supplemental
Table I, Supplemental Figure I) for 6 or 12 weeks. The diets were made at the
Wake Forest University Primate Center Diet Laboratory. In conjunction with diet
60 feeding, mice received bi-weekly intraperitoneal injections of a nontargeting control ASO or ABCG8 ASO (50mg/kg/week). The 20-mer phosphorothioate
ASOs were designed to contain 2'-0-methoxyethyl groups at positions 1 to 5 and
15 to 20, and were synthesized, screened, and purified as described previously8 by ISIS Pharmaceuticals (Carlsbad, CA).
ABCG5/G8 KO mice have been described previously1. At 6-8 weeks of age, female WT and ABCG5/G8 KO mice (81.5% C57Bl/6, 12.5% SvJae, 6%
129SvEv) were fed a low-fat (10% of energy as palm oil enriched fat) synthetic diet containing either 0.01% (w/w) phytosterols and 0.003% (w/w) cholesterol
(Low Sterol Diet); 0.01% (w/w) phytosterols and 0.2% (w/w) cholesterol (High
Cholesterol Diet); or 0.2% (w/w) phytosterols and 0.003% (w/w) cholesterol (High
Phytosterol Diet) (Supplemental Table I, Supplemental Figure I) for 6 weeks. The diets were made at the Wake Forest University Primate Center Diet Laboratory.
All mice were fed ad libitum a standard rodent chow diet (5P00Prolab; LabDiet) prior to the start of the high-phytosterol diet and had free access to water. Mice were housed in a specific pathogen-free animal facility in plastic cages in a temperature-controlled room (22°C) with a daylight cycle from 6AM to 6PM.
Bodyweights were measured weekly throughout all studies. Experimental animals were euthanized following a 4 h fast during the light cycle. All experimental protocols were approved by the Institutional Animal Care and Use
Committee at the Wake Forest University School of Medicine.
61
Real Time Polymerase Chain Reaction (RT-PCR) analysis of gene expression in liver and duodenum: Total mRNA was extracted from ∼100 mg of liver and small intestinal segment 2 with Trizol (Invitrogen Life Technologies) using the protocol provided by the manufacturer. The mRNA was resuspended in diethyl pyrocarbonate water, and 1 μg of mRNA was reverse transcribed to cDNA using qScript cDNA SuperMix (Quanta Biosciences) under the following conditions: 25°C for 5 min, 42°C for 30 min, and 85°C for 5 min. The cDNA was diluted 1:10 using diethyl pyrocarbonate water, and real-time PCR was done in triplicate with 5 μl of cDNA, 10 μl of SYBR GREEN PCR master mix (Applied
Biosystems), 3 μl of diethyl pyrocarbonate water, and 1 μl of forward and reverse primer (20 pmol) for a final reaction volume of 20 μl. The primer sequences are are as follows: ABCG8 (F: 5’-AAC CCT GCG GAC TTC TAC G; R: 5’-CTG CAA
GAG ACT GTG CCT TCT); ABCG5 (F: 5’-TCC TGC ATG TGT CCT ACA GC; R:
5’-ATT TGC CTG TCC CAC TTC TG); β-actin (F: 5’-GCT CTG GCT CCT AGC
ACC AT; R: 5’-GCC ACC GAT CCA CAC AGA GT). PCR was then run on the
Sequence Detection System 7500 (Applied Biosystems) using the following conditions: 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 10 s and
60°C for 30 s. The fluorescence measurement used to calculate threshold cycle
(Ct) was made at the 60°C point. A dissociation curve was run at the end of the reaction to ensure a single amplification product. All Ct values were normalized to β-actin mRNA concentration of the sample to take total mRNA concentration into account. The average of Ct values from the CON LS mice were set to 1 and
62 all other groups were expressed as the fold change compared to the CON LS group.
Immunoblotting: Tissue homogenates were made from liver and duodenum in a membrane buffer (0.25M sucrose, 2mM MgCl2, 20mM Tris, pH 7.5).
Homogenates were spun for 10 minutes at 2000 x g, 4°C. Supernatants were
collected and spun for 45 minutes at 100,000rpm, 4°C. The pellet was
resuspended in a membrane solubilization buffer (1% Triton X-100, 4mM CaCl2,
80mM NaCl, 50mM Tris, pH 8.0) using a 1cc 28G1/2 U-100 insulin syringe to completely resuspend the pellet. The membrane proteins (15μg/lane) were separated by 4–12% SDS-PAGE, transferred to polyvinylidene difluoride membranes, and incubated with an anti-ABCG8 antibody. The ABCG8 antibody was kindly provided by Greg Graf, University of Kentucky.
Measurement of Biliary, Plasma, and Hepatic lipid concentrations: At necropsy, blood was collected by heart puncture and was placed into a tube containing protease inhibitor cocktail (Sigma) dissolved in 5% EDTA, 5% NaN3.
Gallbladder bile was collected, and then the liver was removed, weighed, and snap-frozen in liquid N2. The small intestine from the pyloric valve to the cecum
was removed, cleaned of fat and luminal contents while on ice, and cut into either
three sections of equal length. The intestinal sections were snap-frozen in liquid
N2 and stored along with the liver and bile samples at −80°C. The blood was
centrifuged at 12,000 g for 10 min at 4°C, and plasma lipids were extracted with
63
2:1 CHCl3/methanol in the presence of 21 μg 5α-cholestane at room temperature overnight. The lipid extract was dried down under N2 and saponified by adding
1mL ethanol and 100μL 50% KOH and heating at 60°C for 1 hour. Neutral lipids
were extracted by adding hexane and deionized water, vortexing, and
centrifuging at 2,000 g for 10 min. The hexane phase was then analyzed by gas- liquid chromatography9 for total sterol content. To determine plasma lipoprotein
sterol distribution, lipoprotein classes were separated by gel filtration
chromatography as described previously10.
For analysis of the liver lipid composition, ∼100 mg of liver was thawed, minced,
and weighed in a glass tube. Lipids were extracted with 2:1 CHCl3/methanol in
the presence of 135 μg 5α-cholestane at room temperature overnight. The lipid
extract was dried down under N2 and redissolved in a measured volume of 2:1
CHCl3/methanol. Dilute H2SO4 was added to the sample, which was then
vortexed and centrifuged to split the phases. An aliquot of the organic phase was
dried down under N2, dissolved in hexane, and analyzed for free sterol content by gas-liquid chromatography9. The remaining organic phase was saponified by
adding 2mL ethanol and 200μL 50% KOH and heating at 60°C for 2 hours.
Neutral lipids were extracted by adding hexane and deionized water, vortexing,
and centrifuging at 2,000 g for 10 min. The hexane phase was then analyzed by
gas-liquid chromatography9 for total sterol content.
64
For analysis of biliary lipid concentrations, a measured volume (3–10 μl) of bile was extracted with 2:1 CHCl3/MeOH in the presence of 10 μg 5α-cholestane. The organic phase was analyzed for sterol content by gas-liquid chromatography9 and for PL content using Phospholipids B (Wako) enzymatic assay kit11, 12. The
aqueous phase was analyzed for BA content by an enzymatic assay using
hydroxysteroid dehydrogenase13, 14.
Fecal Neutral Sterol excretion: After being fed the synthetic diets for 5 weeks,
mice were singly housed on wire bottom cages. After 3 days, the feces were
collected, dried in a 70°C vacuum oven, weighed, and crushed into a fine powder. A measured mass (50–100 mg) of feces was placed into a glass tube containing 135 μg of 5α-cholestane as an internal standard. The feces were saponified and the neutral lipids were extracted into hexane as described above.
Mass analysis of the extracted neutral sterols was conducted by gas-liquid
chromatography as described previously9. Fecal neutral cholesterol mass
represents the sum of cholesterol, coprostanol, and coprostanone in each
sample.
Statistical Analyses and Data Presentation: Data are expressed as the mean
± SEM. Significance of differences was determined for each group of values by
ANOVA (Tukey-Kramer honestly significant difference) or unpaired t-test.
A p value < 0.05 was considered significant. All analyses were performed using
JMP version 5.0.12 software (SAS Institute, Inc., Cary, NC).
65
RESULTS
In order to test whether hepatic knockdown of ABCG5/G8 function would result in phytosterol accumulation, an ABCG8 ASO was used to decrease hepatic ABCG8 mRNA levels in C57Bl/6 mice. Mice treated with a non-targeting control ASO
(CON) and the ABCG8 hepatic knockdown (G8HKD) mice were challenged with
diets containing different amounts of sterols (Supplemental Figure I). The low
sterol (LS) diet contained 0.003% cholesterol and 0.01% phytosterol. The high
cholesterol (HC) diet contained 0.2% cholesterol and 0.01% phytosterol. The
high phytosterol (HP) diet contained 0.003% cholesterol and 0.2% phytosterol.
All three diets were identical otherwise (Supplemental Table I). The predominant
phytosterol species in all diets was sitosterol (%), followed by campesterol (%)
and stigmasterol (%) (Supplemental Figure I).
66
Low Sterol High Cholesterol High Phytosterol
g of ingredient/100g of diet
Fish Oil (Omega Protein) 0.2000 0.2000 0.2000
Palm Oil 4.0000 4.0000 4.0000
Casein, USP 8.0000 8.0000 8.0000
Lactalbumin 4.0000 4.0000 4.0000
Dextrin 17.0000 17.0000 17.0000
Sucrose 17.0000 17.0000 17.0000
Wheat Flour, self-rising 35.0000 35.0000 35.0000
Alphacel 7.2687 7.0688 7.0687
Crystalline Cholesterol 0.0000 0.2000 0.0000
Vitamin Mixture, Teklad 2.5000 2.5000 2.5000
Hegsted Salt Mixture 5.0000 5.0000 5.0000
B-sitosterol (ICN) 0.0103 0.0103 0.2103
Tenox 20A 0.0018 0.0018 0.0018
MTS-50 0.0191 0.0191 0.0191
Supplemental Table I: Diet Ingredients. All diets are comprised of 12% of energy as lipid, 71% of energy as carbohydrate, and 18% of energy as protein.
67
Supplemental Figure I: Dietary Sterol Content and Composition. Sterols were extracted from diet samples and analyzed by gas-liquid chromatography. IA) Dietary sterol content expressed as mg of sterol/100g dry weight. IB) Dietary sterol composition expressed as the percentage of individual sterol species to total sterols.
68
We chose to feed the HP diet in order to examine whether a large amount of dietary phytosterol would be required to detect phytosterol accumulation in G8HKD
mice. Additionally, we fed the HC diet in order to determine whether phenotypic
effects seen in G8HKD mice were specific to the type of dietary sterol that was fed.
Since it has been well established that whole body ABCG5/G8 knockout (KO)
mice accumulate significant amounts of plasma and tissue plant sterols, we fed
ABCG5/G8 KO mice and their wild type (WT) littermates all three diets to
compare to the CON and G8HKD mice.
ABCG8 ASO treatment decreases hepatic RNA and protein levels
In order to determine the effectiveness of our ABCG8 ASO, we measured
hepatic RNA and protein levels of ABCG8. In all groups treated with the ABCG8
ASO, hepatic ABCG8 RNA levels were decreased (Figure 1A). Compared to
CON mice, hepatic ABCG8 RNA was decreased by 83% in the G8HKD mice on
the LS diet, 82% on the HC diet, and 69% on the HP diet. These decreases in
hepatic RNA translated to decreases in hepatic ABCG8 protein expression as
well (Figure 1C). Hepatic ABCG8 protein expression was decreased in the G8HKD mice on all diets when compared to CON mice. As expected, administration of the ABCG8 ASO had no effect on the hepatic mRNA levels of ABCG5 (Figure
1B).
69
Figure 1. ABCG8 and ABCG5 expression. Liver and duodenum were collected from CON and G8HKD mice at necropsy. RNA and membrane proteins were isolated as described in the methods section. Gene expression for individual
70 samples was measured by rt-PCR. Average units were calculated and normalized to β-actin. A) Hepatic ABCG8 RNA expression. B) Hepatic ABCG5 RNA expression. C) Duodenal ABCG8 RNA expression. D) Duodenal ABCG5 RNA expression. Data are expressed as mean±SEM (n=4-5 per diet group). Data analyzed by 2-way ANOVA followed by Student t tests for post hoc analysis. Bars that do not share a common letter are significantly different (p<0.05). Membrane proteins from liver and duodenum (15μg) were fractionated by 4-12% polyacrylamide gel in the presence of SDS and immunoblotted with an anti- ABCG8 antibody. E) Gel shows hepatic ABCG8. F) Gel shows duodenal ABCG8.
71
ASOs preferentially target gene expression in the liver. High doses and long term treatment can, however, cause RNA knockdown in other tissues. Since
ABCG5/G8 is also expressed in the small intestine, we measured small intestinal
RNA and protein levels. ABCG8 ASO treatment did decrease small intestinal
RNA levels by 45% on the LS diet, 26% on the HC diet, and 43% on the HP diet when compared to CON ASO treatment (Figure 1D). These decreases in mRNA levels translated only to minimal decreases in small intestinal ABCG8 protein expression (Figure 1F). Administration of the ABCG8 ASO had no effect on duodenal mRNA levels of ABCG5 (Figure 1E).
G8HKD mice have decreased biliary cholesterol concentrations
To further test the effectiveness of our ABCG8 ASO, we measured biliary lipids in
G8HKD mice and compared them to ABCG5/G8 KO mice. Since ABCG5/G8 function is critical for biliary cholesterol secretion, knocking down hepatic ABCG8 should decrease biliary cholesterol concentrations. Similar to previous reports,
ABCG5/G8 KO mice have almost no biliary cholesterol (Figure 2A). This observation in ABCG5/G8 KO mice is independent of the amount of dietary sterol fed. Biliary cholesterol concentrations in G8HKD mice were also significantly
decreased in all dietary groups (Figure 2B). When compared to CON mice, biliary
cholesterol concentrations were decreased in the G8HKD mice by 80% on the LS
diet, 72% on the HC diet, and 65% on the HP diet. The amount of dietary
cholesterol decreased the effectiveness of the ABCG8 ASO, which translated to
72 a less impressive decrease in biliary cholesterol concentration in G8HKD mice on the HC diet. Biliary phospholipid and biliary bile acid concentrations are largely unaffected in both ABCG5/G8 KO and G8HKD mice (Supplemental Figure II).
73
Figure 2. Biliary cholesterol concentration. Sterols were extracted from the gall bladder bile of WT, ABCG5/G8 KO, CON, and G8HKD mice and measured by gas-liquid chromatography. Biliary cholesterol concentration is expressed as μmol/mL of bile. Data are expressed as mean±SEM (n=3-8 per group). Data analyzed by 2-way ANOVA followed by Student’s t test for post hoc analysis. Bars that do not share a common letter are significantly different (p<0.05).
74
Supplemental Figure II: Biliary Lipid Composition. Lipids were extracted from the gall bladder bile of WT, ABCG5/G8 KO, CON, and G8HKD mice and analyzed by enzymatic assays for phospholipid and bile acid content. Biliary lipid concentration is expressed as μmol of lipid/mL of bile. Data are expressed as mean±SEM (n=3-8 per group). Data analyzed by 2-way ANOVA followed by Student t tests for post hoc analysis. Bars that do not share a common letter are significantly different (p<0.05).
75
G8HKD mice have a normal outward appearance when fed HP diet
As we have previously shown, feeding a HP diet to ABCG5/G8 KO mice is
extremely toxic. These mice failed to gain weight, died prematurely, and
accumulated very high levels of plant sterols in many tissues which seemed to
cause liver abnormalities and severe cardiac lesions. When compared to the
ABCG5/G8 KO mice fed the HP diet, ABCG5/G8 KO mice fed the LS or HC diet
accumulated less phytosterol in liver and plasma (Figure 3B and Figure 4A) and
appeared phenotypically normal. G8HKD mice fed LS, HC, or HP diets also
appeared phenotypically normal. The mice gained weight normally
(Supplemental Figure III) and did not die prematurely (unpublished observation,
ALM). Liver to bodyweight ratios were not different from CON mice in the G8HKD
mice fed LS or HP diets (Supplemental Figure III). There was, however, a
significant increase in the liver size of G8HKD mice fed the HC diet. Livers of these
mice appeared large and pale at the time of necropsy (unpublished observation,
ALM).
76
Supplemental Figure III: Body and liver weights of CON and G8HKD mice. IIA) Percent change in body weight from baseline after six weeks of diet and ASO treatment. IIB) Liver weight as a percentage of body weight after six weeks of diet and ASO treatment. Data are expressed as mean±SEM (n=4-5 per group). Data analyzed by 2-way ANOVA followed by Student t tests for post hoc analysis. Bars that do not share a common letter are significantly different (p<0.05).
77
G8HKD mice do not accumulate high levels of plasma phytosterols
As others have reported, ABCG5/G8 KO mice accumulate high levels of phytosterol in plasma. Plasma phytosterol concentrations in ABCG5/G8 KO mice ranged from 60-257mg/dL depending on the diet fed (Figure 3B). ABCG5/G8 KO
mice fed the HP diet have the highest concentration of plasma phytosterol
(257mg/dL), followed by ABCG5/G8 KO mice fed the LS diet (131mg/dL) and the
HC diet (60mg/dL). These values were significantly higher than all WT groups
who had plasma phytosterol concentrations of less than 5mg/dL. When
expressed as a percentage, whole body ABCG5/G8 deficiency results in a high
percentage of total plasma sterols as plant (24-74%) (Figure 3D). ABCG5/G8 KO
mice fed the HP diet have the highest percentage of plasma phytosterol (74%),
followed by ABCG5/G8 KO mice fed the LS diet (52%) and the HC diet (24%).
The predominant phytosterol species that accumulated in ABCG5/G8 KO mice
was sitosterol, which was also the main phytosterol species in our diets.
78
79
Figure 3. Plasma sterol concentrations. Sterols were extracted from the plasma of WT, ABCG5/G8 KO, CON, and G8HKD mice and measured by gas- liquid chromatography. 2A & 2E) Plasma total sterol concentrations. 2B & 2F) Plasma phytosterol concentrations. 2C & 2G) Plasma cholesterol concentrations. 2D & 2H) Individual sterol species as a percentage of total plasma sterol concentration. Data are expressed as mean±SEM (n=4-10 per group). Data analyzed by 2-way ANOVA followed by Student’s t test for post hoc analysis. Bars that do not share a common letter are significantly different (p<0.05).
80
Hepatic specific knockdown of ABCG5/G8 function did result in a statistically significant increase in plasma phytosterol levels in G8HKD mice compared to CON
mice on the LS and HP diets, but not the HC diet (Figure 3F). The increases
were, however, minimal with plasma phytosterol concentrations reaching a
maximum of 15mg/dL in the G8HKD mice fed HP diet. G8HKD mice fed the HP diet
have the highest concentration of plasma phytosterol (15mg/dL), followed by
G8HKD mice fed the LS diet (5mg/dL) and the HC diet (0.4mg/dL). When
expressed as a percentage, G8HKD mice accumulate only a small percentage of
total plasma sterols as plant (0.2-13%) (Figure 3H). G8HKD mice fed the HP diet have the highest percentage of plasma phytosterol (13%), followed by G8HKD
mice fed the LS diet (4%) and the HC diet (0.2%). The predominant phytosterol
species that accumulated in G8HKD mice was campesterol, which differed from
the ABCG5/G8 KO mice that predominantly accumulated sitosterol.
Plasma cholesterol levels are significantly reduced in ABCG5/G8 KO mice compared to WT mice on the LS and HP diets, and not changed on the HC diet
(Figure 3C). Further confirming that G8HKD mice are protected from the
ABCG5/G8 KO phenotype, there were no significant reductions in any G8HKD
plasma cholesterol levels compared to CON mice (Figure 3G). In fact, plasma
cholesterol was doubled in G8HKD mice compared to CON mice fed the HC diet.
This significant increase in plasma cholesterol concentration was primarily in
VLDL and HDL fractions (Supplemental Figure IV).
81
Supplemental Figure IV: Plasma Lipoprotein Sterol Distribution. Plasma lipoprotein sterol distributions were determined by online gel-filtration HPLC using Infinity Cholesterol reagent. TL indicates Transition Lipoprotein. IIIA-IIIC) 10μL of plasma from 5 WT mice per diet group (solid line) or 5 ABCG5/G8 KO mice per diet group (dashed line) mice was pooled for analysis. Tracings
82 represent the values for pooled samples. IIID-IIIF) Plasma sterol from CON (n=4- 5 per diet group; solid line) and G8HKD (n=5 per diet group; dashed line) mice was analyzed. Tracings represent the average of values for individual mice.
83
G8HKD mice do not accumulate large amounts of hepatic phytosterol
As expected, ABCG5/G8 KO mice accumulate significant amounts of phytosterol
in liver (Figure 4A). The amount of hepatic phytosterol detected (1.8-6.2μg/mg
wet weight) depended on the amount of dietary sterol mice are fed. ABCG5/G8
KO mice fed the HC diet accumulated the most hepatic phytosterol (6.2ug/mg
wet weight), followed by ABCG5/G8 KO mice fed the HP diet (3.0μg/mg wet
weight) and the LS diet (1.8μg/mg wet weight). These values were significantly higher than all WT groups who had hepatic phytosterol concentrations of less
than 0.3μg/mg wet weight. It is surprising that ABCG5/G8 KO mice fed the HC
diet accumulated three times more hepatic phytosterol than the ABCG5/G8 KO
mice fed HP diet, since the HC diet contained much less phytosterol than the HP
diet. When expressed as a percentage of total hepatic sterol, however,
ABCG5/G8 KO mice fed the HP diet have the highest percentage of hepatic
phytosterol (77%), followed by ABCG5/G8 KO mice fed the LS diet (55%) and
the HC diet (13%) (Figure 4B). The predominant phytosterol species that
accumulated in ABCG5/G8 KO mice was sitosterol, which was also the main
phytosterol species in our diets. All ABCG5/G8 KO mice accumulated a
significant amount of phytosterol in the unesterified form (Figure 4C). Only
ABCG5/G8 KO mice fed the HC diet were able to accumulate a significant
amount of esterified phytosterol (Figure 4D).
84
85
Figure 4. Liver sterol concentrations. Sterols were extracted from the livers of WT, ABCG5/G8 KO, CON, and G8HKD mice and measured by gas-liquid chromatography. All hepatic lipid values were normalized to the wet weight of the extracted piece of liver. 2A & 2E) Total hepatic sterol concentrations of cholesterol and phytosterols. 2B & 2F) Individual sterol species as a percentage of total hepatic sterol. 2C & 2G) Hepatic free sterol concentrations of cholesterol and phytosterols. 2D & 2H) Hepatic esterified sterol concentrations of cholesterol and phytosterols. Hepatic esterified sterol was calculated by multiplying the mass difference between total sterol and free sterol by 1.67. Data are expressed as mean±SEM (n=4-9 per group). Data analyzed by 2-way ANOVA followed by Student’s t test for post hoc analysis. Bars that do not share a common letter within the sterol statistics row are significantly different (p<0.05).
86
When fed the same diets, G8HKD mice do have a significant increase in hepatic
phytosterol concentrations compared to CON mice on the HC and HP diets, but
not the LS diet (Figure 4E). The increases were, however, minimal with hepatic
phytosterol concentrations reaching a maximum of 0.55μg/mg wet weight in the
G8HKD mice fed HP diet. G8HKD mice fed the HP diet have the highest
concentration of hepatic phytosterol (0.55μg/mg wet weight), followed by G8HKD mice fed the HC diet (0.51μg/mg wet weight) and the LS diet (0.19μg/mg wet weight). When expressed as a percentage of total hepatic sterols, G8HKD accumulate 0.7-11% of sterol as phytosterol in the liver. G8HKD fed the HP diet
have the highest percentage of hepatic phytosterol (11%), followed by G8HKD
mice fed the LS diet (4%) and the HC diet (0.7%) (Figure 4F). The predominant
phytosterol species that accumulated in the G8HKD mice was campesterol, which differed from the ABCG5/G8 KO mice that predominantly accumulated sitosterol.
The minor amount of hepatic phytosterol found in G8HKD mice was mostly stored
in esterified form (Figure 4G and H).
There was no significant difference in the amount of hepatic cholesterol
measured between WT and ABCG5/G8 KO mice on any diet (Figure 4A). There
was also no significant difference in the amount of hepatic cholesterol measured
between WT and G8HKD mice on the LS or HP diet (Figure 4E). Interestingly,
there was a significant 5.7 fold increase in hepatic cholesterol concentration in
G8HKD mice compared to CON mice when fed the HC diet.
87
ABCG5/G8 KO and G8HKD mice have reduced FNS excretion when fed HC
diet
In order to get a more complete picture of sterol balance in our mouse models, we measured FNS excretion. ABCG5/G8 KO mice had no significant differences in fecal neutral phytosterol excretion when compared to WT mice on any of the diets (Figure 5A). We did see a large increase in fecal neutral phytosterol excretion in both WT and ABCG5/G8 KO mice fed the HP diet. There were no differences in fecal neutral cholesterol excretion in ABCG5/G8 KO mice compared to WT mice on the LS and HP diets. We did, however, measure a significant reduction in fecal neutral cholesterol excretion in ABCG5/G8 KO mice on the HC diet when compared to WT.
88
Figure 5. Fecal neutral sterol excretion. Neutral sterols were extracted from the feces of WT, ABCG5/G8 KO, CON, and G8HKD mice and measured by gas- liquid chromatography. Fecal neutral sterol excretion of cholesterol and phytosterols was normalized to the number of days feces were collected and mouse body weights. Data are expressed as mean±SEM (n=4-9 per group). Data analyzed by 2-way ANOVA followed by Student’s t test for post hoc analysis. Bars that do not share a common letter within the sterol statistics row are significantly different (p<0.05).
89
Similarly, G8HKD mice had no significant differences in fecal neutral phytosterol
excretion when compared to CON mice on any of the diets (Figure 5B). Both
CON and G8HKD mice that were fed the HP diet had large increases in fecal
neutral phytosterol excretion. There were no differences in fecal neutral
cholesterol excretion in G8HKD mice compared to CON mice on the LS and HP
diets. Interestingly, we also measured a highly significant reduction in fecal
neutral cholesterol excretion in G8HKD mice compared to CON mice on the HC
diet.
G8HKD mice are protected from further phytosterol accumulation after 12
weeks of treatment
In order to determine whether the amount of phytosterol accumulation in G8HKD
mice would increase over time, we treated C57Bl/6 mice with control ASO or
ABCG8 ASO and fed the HP diet for 12 weeks. On the HP diet, the G8HKD mice treated for 6 weeks accumulated a small amount of hepatic phytosterol
(0.55μg/mg wet weight) (Figure 4E). When diet and ASO treatment were increased to 12 weeks, the G8HKD mice only increased hepatic phytosterol
accumulation slightly (0.68μg/mg wet weight) (Supplemental Figure VA).
Additionally, the percentage of total hepatic sterols as plant increased from 13%
after 6 weeks to 16% after 12 weeks of treatment (Supplemental Figure VB).
Hepatic free phytosterols in G8HKD mice increased to 0.35μg/mg wet weight and
90 hepatic esterified phytosterols decreased to 0.55μg/mg wet weight after 12 weeks of treatment (Supplemental Figure VC and D).
91
Supplemental Figure V: Liver sterol concentrations after 12 weeks of G8HKD and high phytosterol diet feeding. C57Bl/6 mice were fed the high phytosterol diet and treated with CON or ABCG8 ASO for 12 weeks. Sterols were extracted from liver and measured by gas-liquid chromatography. All hepatic lipid values were normalized to the wet weight of the extracted piece of liver. VA) Total hepatic sterol concentrations. VB) Individual sterol species as a percentage of total hepatic sterol. VC) Hepatic free sterol concentrations of cholesterol and total phytosterols. VD) Hepatic esterified sterol concentrations of cholesterol and total phytosterols. Hepatic esterified sterol was calculated by multiplying the mass difference between total sterol and free sterol by 1.67. Data are expressed as mean±SEM (n=4 per group). Data analyzed by 2-way ANOVA followed by Student t tests for post hoc analysis. Bars that do not share a common letter within the sterol statistics row are significantly different (p<0.05).
92
DISCUSSION
The major finding of this study is that liver-specific impairment of ABCG5/G8 function does not result in high levels of phytosterol accumulation. Compared to their WT counterparts, mice with whole body ABCG5/G8 deficiency had very high plasma and hepatic phytosterol concentrations in a dietary sterol dependent manner. The G8HKD mice did not achieve these high levels of plasma and hepatic
phytosterol. Therefore, intestinal ABCG5/G8 function is sufficient to prevent high
levels of plant sterol accumulation in mice. This supports the idea that small
intestinal ABCG5/G8 is part of the body’s first line of defense in preventing
dietary plant sterol buildup. When small intestinal ABCG5/G8 is functional, it
appears that hepatic ABCG5/G8 serves as a backup to secrete into bile any plant
sterols that do get absorbed.
Although the G8HKD mice did not accumulate as much plasma and liver plant
sterols as the ABCG5/G8 KO mice on the same diets, G8HKD plasma and liver
plant sterol concentrations were still significantly elevated when compared to
their CON counterparts. The small amount of phytosterol present in G8HKD mice was primarily campesterol. ABCG5/G8 whole body knockout mice also accumulated significant amounts of campesterol, but the primary phytosterol species in their liver and plasma was sitosterol. The same finding was reported in
ABCG5/G8 KO mice by Yu, L et al2. These observations could mean that campesterol is the first phytosterol species to accumulate under conditions of dietary challenge or alterations of hepatic ABCG5/G8 function. Since
93 campesterol is more efficiently absorbed than sitosterol1, 15, it follows that
campesterol would be the first plant sterol species to accumulate.
The majority of hepatic phytosterols in the ABCG5/G8 KO mice on the LS and
HP diets were free sterol. One explanation for this could be related to the
availability of sterols for incorporation into plasma membranes. Since a large
percentage of the total hepatic sterols in our ABCG5/G8 KO mice on the LS and
HP diets were phytosterols (55-75%), the phytosterols were likely used in their
free form to help maintain cellular membrane structures. This idea could be supported by our data from the ABCG5/G8 KO mice fed the HC diet. Those mice had a much higher concentration of hepatic cholesterol, likely resulting in less membrane incorporation and more esterification and storage of phytosterols.
Alternatively, it is known that the sterol esterifying enzyme ACAT2 (acyl-
CoA:cholesterol O-acyltransferase 2) preferentially selects cholesterol over phytosterols for esterification9. This could also explain why the majority of hepatic
phytosterols were in the free form in ABCG5/G8 KO mice fed LS and HP diets.
Since ABCG5/G8 is required for biliary sterol secretion1, 16, its crucial role in
biliary RCT is firmly established. RCT is traditionally defined as the transport of excess peripheral cholesterol to the liver via HDL where it is then secreted into
bile and excreted in the feces 17. Until recently, biliary secretion was the
universally accepted pathway by which peripheral cholesterol was excreted from
the body in the feces. If biliary cholesterol excretion was the only contributor to
94 fecal sterol loss, one would expect dramatically decreased fecal sterol output to accompany decreases in biliary cholesterol levels. This is not the case, however, in several mouse models that exhibit little to no biliary cholesterol secretion 18-20.
Along with several studies conducted in rats, dogs, and humans 18, 21-23, these
observations have led our group and others to the discovery of a novel pathway
for non-biliary cholesterol excretion which is called transintestinal cholesterol
excretion (TICE).
The hallmark features of models that primarily use the TICE pathway to excrete
cholesterol are severly diminished biliary cholesterol secretion, with no
accumulation of hepatic cholesterol due to normal levels of fecal neutral sterol
excretion. Since our G8HKD mice had dramatically decreased levels of biliary
cholesterol, we predicted that the TICE pathway would compensate for the loss
of biliary sterol secretion, resulting in normal FNS excretion and no accumulation
of hepatic cholesterol in the G8HKD mice. This appears to be the case when comparing G8HKD mice on the LS and HP diets to the CON mice. Despite the more than 80% reduction in biliary cholesterol levels, G8HKD mice had levels of
FNS excretion and hepatic cholesterol similar to CON mice on the LS and HP
diets.
Surprisingly, we found an opposite result in G8HKD mice fed the HC diet. G8HKD
mice on the HC diet had more than a 70% reduction in biliary cholesterol
concentration. The high level of dietary cholesterol fed to these mice unmasked a
95 significant reduction in fecal neutral sterol excretion and a dramatic increase in hepatic cholesterol accumulation when compared to CON mice. These data suggest that the G8HKD mice have a disfunction in the TICE pathway and
subsequently cannot compensate for the reduction in biliary sterol secretion with
the dietary cholesterol challenge.
In 2003, Yu, L et al24 reported that ABCG5/G8 is required for LXR agonist
induced increases in fecal neutral sterol excretion. Presumably, since biliary
cholesterol secretion could not be increased with an LXR agonist due to
ABCG5/G8 deficiency, fecal neutral sterol excretion also could not be increased.
Several years later, multiple studies showed the existence of the TICE pathway
and that it could compensate for loss of biliary sterol secretion18-23. In 2009, van
der Veen et al25 showed that the TICE pathway could be strongly stimulated by
LXR activation. Since fecal neutral sterol excretion could not be stimulated in
ABCG5/G8 KO mice treated with an LXR agonist, these historic studies support
the idea that ABCG5/G8 may play an important role in the TICE pathway. More
specifically, our data from the G8HKD mice suggest that it is hepatic ABCG5/G8
function that may be required for the TICE pathway to operate. Alternatively, it is
possible that the decreased biliary cholesterol secretion is causing the increased
heptic cholesterol levels in G8HKD mice fed a high cholesterol diet, not a disfunctional TICE pathway. Further studies need to be done to confirm what our data suggest.
96
The findings from this study show that hepatic ABCG5/G8 function is not necessary to prevent bodily phytosterol accumulation and support a novel tissue specific role for hepatic ABCG5/G8 in cholesterol metabolism. These initial results generated using ASO technology highlight the importance of developing a genetic mouse model of complete tissue-specific ABCG5/G8 deficiency in which to perform additional studies. These future studies have the potential to unveil the complete role of ABCG5/G8 in hepatic sterol metabolism.
97
REFERENCE LIST
(1) Yu L, Hammer RE, Li-Hawkins J, von BK, Lutjohann D, Cohen JC, Hobbs
HH. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in
biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002 December
10;99(25):16237-42.
(2) Yu L, von BK, Lutjohann D, Hobbs HH, Cohen JC. Selective sterol
accumulation in ABCG5/ABCG8-deficient mice. J Lipid Res 2004
February;45(2):301-7.
(3) Calpe-Berdiel L, Escola-Gil JC, Ribas V, Navarro-Sastre A, Garces-
Garces J, Blanco-Vaca F. Changes in intestinal and liver global gene
expression in response to a phytosterol-enriched diet. Atherosclerosis
2005 July;181(1):75-85.
(4) Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M, Shefer S, Batta
AK, Yu H, Chen J, Klein R, Looije N, Oude-Elferink R, Groen AK, Maeda
N, Salen G, Patel SB. A mouse model of sitosterolemia: absence of
Abcg8/sterolin-2 results in failure to secrete biliary cholesterol. BMC Med
2004 March 24;2:5.
(5) McDaniel AL, Alger HM, Sawyer JK, Kelley KL, Kock ND, Brown JM,
Temel RE, Rudel LL. Phytosterol Feeding Causes Toxicity in ABCG5/G8
Knockout Mice. Am J Pathol 2013 April;182(4):1131-8.
98
(6) Su K, Sabeva NS, Liu J, Wang Y, Bhatnagar S, van der Westhuyzen DR,
Graf GA. The ABCG5 ABCG8 sterol transporter opposes the development
of fatty liver disease and loss of glycemic control independently of
phytosterol accumulation. J Biol Chem 2012 August 17;287(34):28564-75.
(7) Miettinen TA, Klett EL, Gylling H, Isoniemi H, Patel SB. Liver
transplantation in a patient with sitosterolemia and cirrhosis.
Gastroenterology 2006 February;130(2):542-7.
(8) Crooke RM, Graham MJ, Lemonidis KM, Whipple CP, Koo S, Perera RJ.
An apolipoprotein B antisense oligonucleotide lowers LDL cholesterol in
hyperlipidemic mice without causing hepatic steatosis. J Lipid Res 2005
May;46(5):872-84.
(9) Temel RE, Gebre AK, Parks JS, Rudel LL. Compared with Acyl-
CoA:cholesterol O-acyltransferase (ACAT) 1 and lecithin:cholesterol
acyltransferase, ACAT2 displays the greatest capacity to differentiate
cholesterol from sitosterol. J Biol Chem 2003 November
28;278(48):47594-601.
(10) Kieft KA, Bocan TM, Krause BR. Rapid on-line determination of
cholesterol distribution among plasma lipoproteins after high-performance
gel filtration chromatography. J Lipid Res 1991 May;32(5):859-66.
(11) Temel RE, Lee RG, Kelley KL, Davis MA, Shah R, Sawyer JK, Wilson MD,
Rudel LL. Intestinal cholesterol absorption is substantially reduced in mice
deficient in both ABCA1 and ACAT2. J Lipid Res 2005
November;46(11):2423-31.
99
(12) Lee RG, Kelley KL, Sawyer JK, Farese RV, Jr., Parks JS, Rudel LL.
Plasma cholesteryl esters provided by lecithin:cholesterol acyltransferase
and acyl-coenzyme a:cholesterol acyltransferase 2 have opposite
atherosclerotic potential. Circ Res 2004 November 12;95(10):998-1004.
(13) Mashige F, Tanaka N, Maki A, Kamei S, Yamanaka M. Direct
spectrophotometry of total bile acids in serum. Clin Chem 1981
August;27(8):1352-6.
(14) Turley SD, Dietschy JM. Re-evaluation of the 3 alpha-hydroxysteroid
dehydrogenase assay for total bile acids in bile. J Lipid Res 1978
September;19(7):924-8.
(15) Lutjohann D, Bjorkhem I, Beil UF, Von BK. Sterol absorption and sterol
balance in phytosterolemia evaluated by deuterium-labeled sterols: effect
of sitostanol treatment. J Lipid Res 1995 August;36(8):1763-73.
(16) Graf GA, Yu L, Li WP, Gerard R, Tuma PL, Cohen JC, Hobbs HH. ABCG5
and ABCG8 are obligate heterodimers for protein trafficking and biliary
cholesterol excretion. J Biol Chem 2003 November 28;278(48):48275-82.
(17) Glomset JA. The plasma lecithins:cholesterol acyltransferase reaction. J
Lipid Res 1968 March;9(2):155-67.
(18) Pertsemlidis D, Kirchman EH, Ahrens EH, Jr. Regulation of cholesterol
metabolism in the dog. I. Effects of complete bile diversion and of
cholesterol feeding on absorption, synthesis, accumulation, and excretion
rates measured during life. J Clin Invest 1973 September;52(9):2353-67.
100
(19) Voshol PJ, Havinga R, Wolters H, Ottenhoff R, Princen HM, Oude Elferink
RP, Groen AK, Kuipers F. Reduced plasma cholesterol and increased
fecal sterol loss in multidrug resistance gene 2 P-glycoprotein-deficient
mice. Gastroenterology 1998 May;114(5):1024-34.
(20) Temel RE, Tang W, Ma Y, Rudel LL, Willingham MC, Ioannou YA, Davies
JP, Nilsson LM, Yu L. Hepatic Niemann-Pick C1-like 1 regulates biliary
cholesterol concentration and is a target of ezetimibe. J Clin Invest 2007
July;117(7):1968-78.
(21) Sperry W. Lipid Excretion IV: A study of the relationship of the bile to the
fecal lipids with special reference to certain problems of sterol metabolism.
J Biol Chem 1927;52:2353-7.
(22) Bandsma RH, Stellaard F, Vonk RJ, Nagel GT, Neese RA, Hellerstein MK,
Kuipers F. Contribution of newly synthesized cholesterol to rat plasma and
bile determined by mass isotopomer distribution analysis: bile-salt flux
promotes secretion of newly synthesized cholesterol into bile. Biochem J
1998 February 1;329 ( Pt 3):699-703.
(23) Deckelbaum RJ, Lees RS, Small DM, Hedberg SE, Grundy SM. Failure of
complete bile diversion and oral bile acid therapy in the treatment of
homozygous familial hypercholesterolemia. N Engl J Med 1977 March
3;296(9):465-70.
(24) Yu L, York J, von BK, Lutjohann D, Cohen JC, Hobbs HH. Stimulation of
cholesterol excretion by the liver X receptor agonist requires ATP-binding
101
cassette transporters G5 and G8. J Biol Chem 2003 May
2;278(18):15565-70.
(25) van d, V, van Dijk TH, Vrins CL, van MH, Havinga R, Bijsterveld K, Tietge
UJ, Groen AK, Kuipers F. Activation of the liver X receptor stimulates
trans-intestinal excretion of plasma cholesterol. J Biol Chem 2009 July
17;284(29):19211-9.
102
CHAPTER IV
HEPATIC ABCG8 KNOCKDOWN PREVENTS LXR AGONIST INDUCED REVERSE CHOLESTEROL TRANSPORT
Allison L. McDaniel, Lawrence L Rudel, J. Mark Brown, Ryan E. Temel
103
ABSTRACT
Key regulators of ABCG5/G8 expression are the nuclear receptors liver x receptor (LXR) α and LXRβ. LXR activation using synthetic agonists leads to increased fecal neutral sterol loss in mice, presumably because ABCG5/G8 mediates an increase in biliary cholesterol concentration. There is evidence that
ABCG5/G8’s role in RCT may be tissue-specific. In liver-specific LXRα knockout mice, cholesterol excretion and macrophage RCT were not stimulated upon LXR agonist treatment. Because ABCG5/G8 is transcriptionally regulated by LXR, hepatic ABCG5/G8 mRNA was not induced with LXR agonist treatment in those mice. Taken together, these studies suggest that hepatic ABCG5/G8, a downstream target of LXR, may be required for LXR mediated increases in RCT.
In order to test whether hepatic ABCG5/G8 function is necessary for LXR agonist mediated increases in cholesterol excretion and macrophage reverse cholesterol transport, an anti-sense oligonucleotide (ASO) targeting ABCG8 was used to knockdown ABCG8 expression in the liver of C57Bl/6 mice and RCT was measured. Interestingly, when mice had decreased hepatic ABCG8 expression, cholesterol excretion and macrophage RCT were not stimulated with LXR agonist treatment. This data suggest that it is ABCG5/G8, a downstream target of
LXR, that is required for LXR stimulated increases in cholesterol excretion and macrophage RCT.
104
INTRODUCTION
Reverse cholesterol transport (RCT) is an important pathway that helps prevent
excess accumulation of cholesterol in peripheral tissues. RCT is defined as the
movement of cholesterol from peripheral tissues to the liver via HDL or when
cholesteryl ester transfer protein is present, LDL1. Once cholesterol reaches the
liver it can be secreted into the bile by the ATP-binding cassette transporters G5
and G8 (ABCG5/G8)2. Biliary cholesterol that reaches the lumen of the small intestine can then be reabsorbed or excreted in the feces. Because of its critical role in biliary cholesterol secretion, ABCG5/G8 can significantly affect the amount of biliary cholesterol available for excretion into the feces.
Key regulators of ABCG5/G8 expression are the nuclear receptors liver x receptor (LXR) α and LXRβ. LXR activation using synthetic agonists leads to increased fecal neutral sterol loss in mice3. Presumably this increase is caused
by an ABCG5/G8 mediated increase in biliary cholesterol concentration since
ABCG5/G8 KO mice did not have increased fecal neutral sterol excretion when
treated with an LXR agonist4. It has also been shown that LXR agonist stimulated
macrophage RCT is impaired in ABCG5/G8 KO mice5. From these global
knockout studies, it is clear that ABCG5/G8 plays an important role in LXR
stimulated cholesterol excretion and macrophage RCT.
Interestingly, there is evidence that the role of ABCG5/G8 in RCT may be tissue-
specific. In liver-specific LXRα knockout mice, cholesterol excretion and
105
macrophage RCT were not stimulated upon LXR agonist treament6. Because
ABCG5/G8 is transcriptionally regulated by LXR, hepatic ABCG5/G8 mRNA was
not induced with LXR agonist treatment in those mice. Taken together, these
studies suggest that hepatic ABCG5/G8, a downstream target of LXR, may be
required for LXR mediated increases in RCT.
We hypothesized that knocking down hepatic ABCG5/G8 function would
decrease LXR stimulated cholesterol excretion and macrophage RCT. In order to
test this hypothesis, an anti-sense oligonucleotide (ASO) targeting ABCG8 was
used to knockdown ABCG8 expression in the liver of C57Bl/6 mice and
macrophage RCT was measured. Indeed, when mice had decreased hepatic
ABCG8 expression, cholesterol excretion and macrophage RCT were not
stimulated with LXR agonist treatment.
METHODS
Animals and diet: Female C57Bl/6 mice 6-8 weeks of age were ordered from
Harlan Laboratories (Indianapolis, IN). At 7-9 weeks of age, mice were fed a low- fat (10% of energy as palm oil enriched fat), low sterol (0.01% (w/w) phytosterols,
0.003% (w/w) cholesterol) synthetic diet for 6 weeks. The diets were made at the
Wake Forest University Primate Center Diet Laboratory. In conjunction with diet
feeding, mice received bi-weekly intraperitoneal injections of a nontargeting
control ASO or ABCG8 ASO (50mg/kg/week). The 20-mer phosphorothioate
106
ASOs were designed to contain 2'-0-methoxyethyl groups at positions 1 to 5 and
15 to 20, and were synthesized, screened, and purified as described previously7 by ISIS Pharmaceuticals (Carlsbad, CA).
All mice were fed ad libitum a standard rodent chow diet (5P00Prolab; LabDiet) prior to the start of the synthetic diet and had free access to water. Mice were housed in a specific pathogen-free animal facility in plastic cages in a temperature-controlled room (22°C) with a daylight cycle from 6AM to 6PM.
Experimental animals were euthanized following a 4 h fast during the light cycle.
All experimental protocols were approved by the Institutional Animal Care and
Use Committee at the Wake Forest University School of Medicine.
J774 Cell Culture and [3H]-Cholesterol Loading: J774 mouse macrophages were a generous gift from Dr. George Rothblat (The Children’s Hospital of
Philadelphia). Cells were grown in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin. [3H]-
Cholesterol loading was initiated by incubating cells for 48 hours with 5 μCi/ml
[3H]-cholesterol and 100 μg/ml acetylated LDL in 10% FBS containing RPMI-
1640. The resulting foam cells were washed twice with phosphate buffered saline and equilibrated for an additional 12-hour period in serum free RPMI-1640 supplemented with 0.2%bovine serum albumin (BSA). Cells were then harvested and resuspended in serum-freeRPMI-1640 immediately before injection. On average, the cell suspension contained ~10x106 cells/ml at ~3x106 dpm/ml. All
107
cell suspensions were analyzed microscopically in order to count and to ensure
viability before injection, and all mice were injected within 5 minutes of
resuspension of freshly isolated foam cells.
In Vivo Macrophage RCT: In vivo measurement of macrophage RCT was
conducted essentially as described by Rader and colleagues (Zhang et al., 2003;
Naik et al. 2006), with minor modifications. Briefly, mice were gavaged with either
vehicle or 25 mg/kg T0901317 daily for seven consecutive days. On the 5th day
of treatment, mice were injected intraperitoneally with ~500 μl [3H]-cholesterol labeled foam cell suspension containing ~10x106 cells/ml at ~3x106 dpm/ml. To allow quantitative fecal collection, mice were housed individually on wire bottom cages for 48 hours with ad libitum access to food and water. At 6, 24, and 48 hours post injection, blood was collected via the submandibular vein, and 20 μl of isolated plasma was used to determine [3H]-cholesterol recovery.
Measurement of Biliary, Plasma, and Hepatic lipid concentrations and [3H]-
cholesterol recovery: At necropsy, blood was collected by heart puncture and
was placed into a tube containing protease inhibitor cocktail (Sigma) dissolved in
5% EDTA, 5% NaN3. Gallbladder bile was collected, and then the liver was
removed, weighed, and snap-frozen in liquid N2. The small intestine from the
pyloric valve to the cecum was removed, cleaned of fat and luminal contents
while on ice, and cut into either three sections of equal length. The intestinal
108
sections were snap-frozen in liquid N2 and stored along with the liver and bile samples at −80°C.
Blood was centrifuged at 12,000 g for 10 min at 4°C, and plasma lipids were extracted with 2:1 CHCl3/methanol in the presence of 21 μg 5α-cholestane at
room temperature overnight. The lipid extract was dried down under N2 and
saponified by adding 1mL ethanol and 100μL 50% KOH and heating at 60°C for
1 hour. Neutral lipids were extracted by adding hexane and deionized water, vortexing, and centrifuging at 2,000 g for 10 min. The hexane phase was then analyzed by gas-liquid chromatography8 for total sterol content. To determine
plasma lipoprotein sterol distribution, lipoprotein classes were separated by gel
filtration chromatography as described previously9.
For analysis of the liver lipid composition, ∼100 mg of liver was thawed, minced, and weighed in a glass tube. Lipids were extracted with 2:1 CHCl3/methanol in
the presence of 135 μg 5α-cholestane at room temperature overnight. Following
extraction, a measured volume of solvent was dried down under N2 and
resuspended in scintillation cocktail for count recovery determination. Total tissue
recovery is calculated per total organ weight. The remaining lipid extract was
dried down under N2 and redissolved in a measured volume of 2:1
CHCl3/methanol. Dilute H2SO4 was added to the sample, which was then
vortexed and centrifuged to split the phases. An aliquot of the organic phase was
dried down under N2, dissolved in hexane, and analyzed for free sterol content
109
by gas-liquid chromatography8. The remaining organic phase was saponified by
adding 2mL ethanol and 200μL 50% KOH and heating at 60°C for 2 hours.
Neutral lipids were extracted by adding hexane and deionized water, vortexing, and centrifuging at 2,000 g for 10 min. The hexane phase was then analyzed by gas-liquid chromatography8 for total sterol content.
For analysis of biliary lipid concentrations, a measured volume (3–10 μl) of bile was extracted with 2:1 CHCl3/MeOH in the presence of 10 μg 5α-cholestane. The organic phase was analyzed for sterol content by gas-liquid chromatography8 and for PL content using Phospholipids B (Wako) enzymatic assay kit10, 11. The
aqueous phase was analyzed for BA content by an enzymatic assay using
hydroxysteroid dehydrogenase12, 13.
Fecal Neutral Sterol excretion and [3H]-cholesterol recovery: After 3 day
fecal collection, the feces were dried in a 70°C vacuum oven, weighed, and
crushed into a fine powder. A measured mass (50–100 mg) of feces was placed
into a glass tube containing 135 μg of 5α-cholestane as an internal standard. The feces were saponified and the neutral lipids were extracted into hexane as described above. Following extraction, a measured volume of solvent was dried
3 down under N2 and resuspended in scintillation cocktail for [ H] recovery determination. Mass analysis of the extracted neutral sterols was conducted by gas-liquid chromatography as described previously8. Fecal neutral cholesterol
110
mass represents the sum of cholesterol, coprostanol, and coprostanone in each
sample.
The [3H] bile acid-containing aqueous phase was acidified by adding 200μL HCl.
The acidified aqueous phase (pH <1) was then extracted 6 times with 2 ml
hexane to quantitatively recover [3H]-bile acids. All [3H]-bile acid hexane phases
were pooled, dried under N2, and resuspended in scintillation cocktail for [3H] recovery determination.
Real Time Polymerase Chain Reaction (RT-PCR) analysis of gene expression in liver and duodenum: Total mRNA was extracted from ∼100 mg of liver and small intestinal segment 2 with Trizol (Invitrogen Life Technologies) using the protocol provided by the manufacturer. The mRNA was resuspended in diethyl pyrocarbonate water, and 1 μg of mRNA was reverse transcribed to cDNA using qScript cDNA SuperMix (Quanta Biosciences) under the following conditions: 25°C for 5 min, 42°C for 30 min, and 85°C for 5 min. The cDNA was diluted 1:10 using diethyl pyrocarbonate water, and real-time PCR was done in triplicate with 5 μl of cDNA, 10 μl of SYBR GREEN PCR master mix (Applied
Biosystems), 3 μl of diethyl pyrocarbonate water, and 1 μl of forward and reverse primer (20 pmol) for a final reaction volume of 20 μl. The primer sequences are as follows: ABCG8 (F: 5’-AAC CCT GCG GAC TTC TAC G; R: 5’-CTG CAA
GAG ACT GTG CCT TCT); ABCG5 (F: 5’-TCC TGC ATG TGT CCT ACA GC; R:
5’-ATT TGC CTG TCC CAC TTC TG); Cyclophilin (F: 5’-GCG GCA GGT CCA
111
TCT ACG; R: 5’-TCC ATC CAG CCA TTC AGT C). PCR was then run on the
Sequence Detection System 7500 (Applied Biosystems) using the following
conditions: 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 10 s and
60°C for 30 s. The fluorescence measurement used to calculate threshold cycle
(Ct) was made at the 60°C point. A dissociation curve was run at the end of the
reaction to ensure a single amplification product. All Ct values were normalized
to the cyclophilin mRNA concentration of the sample to take total mRNA
concentration into account. The averages of Ct values from the vehicle treated
CON mice were set to 1 and all other groups were expressed as the fold change
compared to the vehicle treated CON group.
Statistical Analyses and Data Presentation: Data are expressed as the mean
± SEM. Significance of differences was determined for each group of values by
ANOVA (Tukey-Kramer honestly significant difference) or unpaired t-test.
A p value < 0.05 was considered significant. All analyses were performed using
JMP version 5.0.12 software (SAS Institute, Inc., Cary, NC).
112
RESULTS
In order to test whether hepatic ABCG5/G8 function would be necessary for LXR
agonist mediated increases in fecal neutral sterol excretion, C57Bl/6 were
injected with an ABCG8 ASO to decrease hepatic ABCG8 mRNA levels (G8HKD).
Additionally, a control group of mice (CON) were injected with a non-targeting
ASO. Mice were concomitantly treated with ASOs and fed a low cholesterol
(0.01% w/w), low fat (10% of energy as palm oil) synthetic diet for 6 weeks. For
the last 7 days of treatment, mice were gavaged daily with either vehicle or an
LXR agonist (T0901317, 25mg/kg/day). To measure macrophage RCT, mice
were injected with [3H]-cholesterol labeled J-774 macrophages 2 days prior to
necropsy.
LXR agonist treatment attenuates ASO knockdown of hepatic ABCG8
It is known that ABCG8 is transcriptionally upregulated by LXR activation14. Since
ASOs also target mRNA, it was unclear whether ASO knockdown of ABCG8 would be overcome by LXR stimulation. Hepatic levels of ABCG8 and ABCG5 were measured by RT-PCR. All mice treated with ABCG8 ASO had reduced
ABCG8 mRNA levels, but LXR agonist treatment limited the effectiveness of the
ABCG8 ASO (Figure 1). Vehicle treated G8HKD mice had a 64% reduction in
hepatic ABCG8 mRNA when compared to CON mice (Figure 1A). As expected,
LXR agonist treatment of CON mice caused a significant increase in hepatic
ABCG8 mRNA levels (+317%). When administered to G8HKD mice, the LXR
113
agonist caused hepatic ABCG8 mRNA to be increased by 160% compared to
vehicle treated G8HKD mice. Hepatic ABCG8 mRNA, however, was still 223%
less in G8HKD mice treated with LXR agonist than the CON mice treated with LXR agonist. As a control, hepatic ABCG5 mRNA expression was also measured.
There was no reduction in hepatic ABCG5 mRNA in the G8HKD mice, and LXR
agonist treatment increased hepatic ABCG5 mRNA to similar levels in both CON
and G8HKD mice (Figure 1B).
114
Figure 1. ABCG8 and ABCG5 mRNA expression. Liver and duodenum were collected from CON and G8HKD mice at necropsy and RNA was isolated as described in the methods section. Gene expression for individual samples was measured by RT-PCR. Average units were calculated and normalized to β-actin. A) Hepatic ABCG8 RNA expression. B) Hepatic ABCG5 RNA expression. C) Duodenal ABCG8 RNA expression. D) Duodenal ABCG5 RNA expression. Data are expressed as mean±SEM (n=5-10 per group). Data analyzed by 2-way ANOVA followed by Student t tests for post hoc analysis. Bars that do not share a common letter are significantly different (p<0.05).
115
ASOs preferentially target gene expression in the liver. High doses and long term
treatment can, however, cause mRNA knockdown in other tissues. Since
ABCG5/G8 is also expressed in the small intestine, small intestinal mRNA
expression of ABCG8 and ABCG5 was measured. Similar to our previous report
(Chapter III, Fig 1C), intestinal ABCG8 mRNA was decreased by 39% in G8HKD mice compared to CON mice (Figure 1C). LXR agonist treatment increased duodenal ABCG8 expression significantly in CON mice (+152%) and to a lesser extent in G8HKD mice (+136%) when compared to respective vehicle treatment
groups. Similar to hepatic ABCG5, There was no reduction in duodenal ABCG5 mRNA in the G8HKD mice, and LXR agonist treatment increased duodenal
ABCG5 mRNA to similar levels in both CON and G8HKD mice (Figure 1D).
Biliary cholesterol concentration is not reduced in LXR agonist treated
G8HKD mice
To further confirm the effectiveness of the ABCG8 ASO, hepatic biliary lipid
concentrations were measured (Figure 2). Since ABCG5/G8 function correlates
with biliary cholesterol concentrations15, biliary cholesterol concentrations was
predicted to be decreased in G8HKD mice treated with both vehicle and LXR
agonist. With vehicle treatment, G8HKD mice had a 57% reduction in biliary
cholesterol concentration when compared to CON mice (Figure 2A). Compared
to vehicle treatment, CON mice had a 56% increase in biliary cholesterol
concentration after LXR agonist administration. G8HKD mice treated with LXR
116 agonist also had increased biliary cholesterol concentrations (+78%) when compared to vehicle treatment of G8HKD mice. Unfortunately, this LXR agonist induced increase to biliary cholesterol concentration in G8HKD mice reached a level similar to LXR agonist treated CON mice. Biliary phospholipid and biliary bile acid concentrations were not changed between any of the groups (Figure 2B
& 2C).
117
Figure 2. Biliary sterol concentrations. Sterols were extracted from the gall bladder bile of CON and G8HKD mice and measured for cholesterol by gas- liquid chromatography and for phospholipids and bile acids by enzymatic assays. Molar ratios of each lipid were calculated by dividing the concentration of each lipid by the total biliary lipid concentration. Data are expressed as mean±SEM (n=6-9 per group). Data analyzed by 2-way ANOVA followed by Student’s t test for post hoc analysis. Bars that do not share a common letter are significantly different (p<0.05).
118
LXR agonist treatment increases plasma sterol mass and radioactivity in
CON and G8HKD mice
Plasma total sterol was not changed in G8HKD mice when compared to CON mice
on the low cholesterol diet (Figure 3A). LXR agonist treatment significantly
increased plasma total sterol in both CON and G8HKD mice compared to vehicle treatment. Not surprisingly, there were no significant differences in plasma triglyceride levels between any of the groups (Figure 3B). After injection with [3H]- cholesterol labeled macrophages, plasma levels of [3H]-cholesterol were
increased in both CON and G8HKD mice treated with the LXR agonist (Figure 3C).
The plasma [3H]-cholesterol levels at necropsy (48h post macrophage injection)
closely mirrored the plasma total sterol mass.
119
Figure 3. Plasma sterol mass and radioactivity. Sterols were extracted from the plasma of CON and G8HKD mice and measured by gas-liquid chromatography or counted for [3H]- cholesterol. 2A) Plasma total sterol concentrations. 2B) Plasma triglyceride concentrations. 2C) Time course of plasma [3H]- cholesterol recovery. Data are expressed as mean±SEM (n=4-5 per group). Data analyzed by 2-way ANOVA followed by Student’s t test for post hoc analysis. Bars that do not share a common letter are significantly different (p<0.05).
120
LXR agonist treatment increases hepatic triglyceride in CON and G8HKD mice
As expected for low dietary cholesterol feeding, total hepatic sterol concentrations remained very low in all groups (<4μg/mg wet weight) (Figure
4A). In agreement with previous reports, hepatic sterol concentrations were slightly but significantly decreased with LXR agonist treatment in CON mice. LXR agonist treatment did not significantly alter hepatic sterol concentrations in G8HKD mice. It is well established that treatment with the LXR agonist T0901317 causes hepatic hypertriglyceridemia16. CON and G8HKD mice had significant hepatic
triglyceride accumulation with T0901317 treatment (Figure 4B). There were no
significant differences in hepatic [3H]-cholesterol recovery between any of the
groups (Figure 4C).
121
Figure 4. Liver sterol mass and radioactivity. Sterols were extracted from the livers of CON and G8HKD mice and measured by gas-liquid chromatography or counted for [3H]-cholesterol. All hepatic lipid values were normalized to the wet weight of the extracted piece of liver. 2A) Total hepatic sterol concentrations. 2B) Hepatic triglyceride concentrations. 2C) Hepatic [3H]- cholesterol recovery. Data are expressed as mean±SEM (n=4-5 per group). Data analyzed by 2-way ANOVA followed by Student’s t test for post hoc analysis. Bars that do not share a common letter are significantly different (p<0.05).
122
LXR agonist treatment does not increase fecal neutral sterol excretion in
G8HKD mice
Finally, fecal neutral sterol excretion was not significantly different between
vehicle treated CON and G8HKD mice (Figure 5A). LXR agonist treatment greatly increased fecal neutral sterol excretion in CON mice, but not G8HKD mice. This surprising result was replicated in fecal neutral [3H]sterol recovery (Figure 5B).
There was no significant difference in fecal neutral [3H]sterol count between
vehicle treated CON and G8HKD mice. LXR agonist treatment greatly increased fecal neutral [3H]sterol count in CON mice, but not G8HKD mice. This effect of
LXR agonist treatment seems to be specific to neutral sterol excretion, since
levels of acidic [3H]sterol excretion were increased to a similar extent in both LXR agonist treated CON and G8HKD mice (Figure 5C).
123
Figure 5. Fecal neutral sterol mass and radioactivity. Neutral sterols were extracted from the feces of CON and G8HKD mice and measured by gas-liquid chromatography or counted for [3H]-sterol content. 5A) Fecal neutral sterol excretion normalized to the number of days feces were collected and mouse body weights. 5B) [3H]-cholesterol recovery in the feces. 5C) [3H]-bile acid recovery in the feces. Data are expressed as mean±SEM (n=10 per group). Data analyzed by 2-way ANOVA followed by Student’s t test for post hoc analysis. Bars that do not share a common letter are significantly different (p<0.05).
124
RESULTS
The major finding of this study is that cholesterol excretion and macrophage RCT
are not stimulated by LXR agonist treatment when hepatic ABCG8 expression is blunted. Hepatic ABCG8 mRNA levels were less than half in LXR stimulated
G8HKD mice than in LXR stimulated CON mice. This attenuation of hepatic
ABCG8 mRNA levels, led to differences in fecal neutral sterol loss and
macrophage RCT when comparing LXR stimulated CON and G8HKD mice.
Similar to previous reports3, LXR agonist treatment greatly increased fecal
neutral sterol excretion in CON mice. In G8HKD mice, however, LXR agonist
treatment failed to significantly increase fecal neutral sterol excretion.
Macrophage RCT, as measured by fecal [3H]cholesterol recovery, closely
mirrored mass fecal neutral sterol excretion. Macrophage RCT was greatly
enhanced in LXR stimulated CON mice but not in LXR stimulated G8HKD mice.
These results suggest that full upregulation of hepatic ABCG8 mRNA is required
for LXR agonist mediated increases in cholesterol excretion and macrophage
RCT.
Since it has been well established that biliary cholesterol concentrations correlate
with ABCG5/G8 expression15, it is surprising that biliary cholesterol
concentrations were similar in LXR stimulated CON and G8HKD mice, despite the differences in hepatic ABCG8 mRNA levels. Biliary cholesterol concentrations were highly variable in the LXR agonist treated CON mice, which could help to explain why there was no apparent difference between the LXR agonist treated
125
groups. Additionally, this possible disconnect between hepatic ABCG8 mRNA
levels and biliary cholesterol concentrations could support the idea that
ABCG5/G8 has another function besides biliary cholesterol secretion that is
crucial to the RCT pathway.
In fact, LXR agonist treatment can still cause fecal neutral sterol excretion to be
increased in several mouse models where biliary contributions to fecal sterol loss
are absent17, 18. These mouse models, however, do not manipulate biliary
cholesterol by altering ABCG5/G8 expression. Calpe-Berdiel L, et al19 reported
that ABCG5/G8 KO mice have impaired LXR agonist stimulated macrophage
RCT. The discrepancy between ABCG5/G8 KO mice and the other models that
also have impaired biliary cholesterol concentrations, suggest that there is a
function of ABCG5/G8 other than biliary cholesterol secretion that is required for
LXR agonist mediated increases to RCT.
Our results agree with the findings by Zhang, Y et al6 that hepatic LXRα expression is required for RCT in mice. Since ABCG5/G8 is transcriptionally regulated by LXR, hepatic ABCG5/G8 mRNA was not increased with LXR agonist treatment in hepatic LXRα KO mice. Similarly, hepatic ABCG8 expression was blunted in LXR agonist treated G8HKD mice that did not have
increased RCT. Our data suggest that it is ABCG5/G8, a downstream target of
LXR, that is required for LXR stimulated increases in cholesterol excretion and
macrophage RCT.
126
Recent studies indicate, however, that the small intestine plays a significant role
in LXR agonist driven cholesterol excretion. For example, macrophage RCT was
stimulated in mice receiving an intestine-specific LXR agonist compound20. In these mice, intestinal but not hepatic ABCG5/G8 (and other target genes) was upregulated. Constitutive activation of small intestinal LXRα has also been shown to increase RCT21. These contradictive findings are puzzling and highlight
the need for more studies to examine the tissue specific role of ABCG5/G8 in
RCT.
127
REFERENCE LIST
(1) Cuchel M, Rader DJ. Macrophage reverse cholesterol transport: key to the
regression of atherosclerosis? Circulation 2006 May 30;113(21):2548-55.
(2) Yu L, Hammer RE, Li-Hawkins J, Von BK, Lutjohann D, Cohen JC, Hobbs
HH. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in
biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002 December
10;99(25):16237-42.
(3) Plosch T, Kok T, Bloks VW, Smit MJ, Havinga R, Chimini G, Groen AK,
Kuipers F. Increased hepatobiliary and fecal cholesterol excretion upon
activation of the liver X receptor is independent of ABCA1. J Biol Chem
2002 September 13;277(37):33870-7.
(4) Yu L, York J, Von BK, Lutjohann D, Cohen JC, Hobbs HH. Stimulation of
cholesterol excretion by the liver X receptor agonist requires ATP-binding
cassette transporters G5 and G8. J Biol Chem 2003 May
2;278(18):15565-70.
(5) Calpe-Berdiel L, Rotllan N, Fievet C, Roig R, Blanco-Vaca F, Escola-Gil
JC. Liver X receptor-mediated activation of reverse cholesterol transport
from macrophages to feces in vivo requires ABCG5/G8. J Lipid Res 2008
September;49(9):1904-11.
128
(6) Zhang Y, Breevoort SR, Angdisen J, Fu M, Schmidt DR, Holmstrom SR,
Kliewer SA, Mangelsdorf DJ, Schulman IG. Liver LXRalpha expression is
crucial for whole body cholesterol homeostasis and reverse cholesterol
transport in mice. J Clin Invest 2012 May 1;122(5):1688-99.
(7) Crooke RM, Graham MJ, Lemonidis KM, Whipple CP, Koo S, Perera RJ.
An apolipoprotein B antisense oligonucleotide lowers LDL cholesterol in
hyperlipidemic mice without causing hepatic steatosis. J Lipid Res 2005
May;46(5):872-84.
(8) Temel RE, Gebre AK, Parks JS, Rudel LL. Compared with Acyl-
CoA:cholesterol O-acyltransferase (ACAT) 1 and lecithin:cholesterol
acyltransferase, ACAT2 displays the greatest capacity to differentiate
cholesterol from sitosterol. J Biol Chem 2003 November
28;278(48):47594-601.
(9) Kieft KA, Bocan TM, Krause BR. Rapid on-line determination of
cholesterol distribution among plasma lipoproteins after high-performance
gel filtration chromatography. J Lipid Res 1991 May;32(5):859-66.
(10) Temel RE, Lee RG, Kelley KL, Davis MA, Shah R, Sawyer JK, Wilson MD,
Rudel LL. Intestinal cholesterol absorption is substantially reduced in mice
deficient in both ABCA1 and ACAT2. J Lipid Res 2005
November;46(11):2423-31.
129
(11) Lee RG, Kelley KL, Sawyer JK, Farese RV, Jr., Parks JS, Rudel LL.
Plasma cholesteryl esters provided by lecithin:cholesterol acyltransferase
and acyl-coenzyme a:cholesterol acyltransferase 2 have opposite
atherosclerotic potential. Circ Res 2004 November 12;95(10):998-1004.
(12) Mashige F, Tanaka N, Maki A, Kamei S, Yamanaka M. Direct
spectrophotometry of total bile acids in serum. Clin Chem 1981
August;27(8):1352-6.
(13) Turley SD, Dietschy JM. Re-evaluation of the 3 alpha-hydroxysteroid
dehydrogenase assay for total bile acids in bile. J Lipid Res 1978
September;19(7):924-8.
(14) Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ.
Regulation of ATP-binding cassette sterol transporters ABCG5 and
ABCG8 by the liver X receptors alpha and beta. J Biol Chem 2002 May
24;277(21):18793-800.
(15) Yu L, Gupta S, Xu F, Liverman AD, Moschetta A, Mangelsdorf DJ, Repa
JJ, Hobbs HH, Cohen JC. Expression of ABCG5 and ABCG8 is required
for regulation of biliary cholesterol secretion. J Biol Chem 2005 March
11;280(10):8742-7.
(16) Grefhorst A, Elzinga BM, Voshol PJ, Plosch T, Kok T, Bloks VW, van der
Sluijs FH, Havekes LM, Romijn JA, Verkade HJ, Kuipers F. Stimulation of
lipogenesis by pharmacological activation of the liver X receptor leads to
130
production of large, triglyceride-rich very low density lipoprotein particles. J
Biol Chem 2002 September 13;277(37):34182-90.
(17) Temel RE, Sawyer JK, Yu L, Lord C, Degirolamo C, McDaniel A, Marshall
S, Wang N, Shah R, Rudel LL, Brown JM. Biliary sterol secretion is not
required for macrophage reverse cholesterol transport. Cell Metab 2010
July 4;12(1):96-102.
(18) Kruit JK, Plosch T, Havinga R, Boverhof R, Groot PH, Groen AK, Kuipers
F. Increased fecal neutral sterol loss upon liver X receptor activation is
independent of biliary sterol secretion in mice. Gastroenterology 2005
January;128(1):147-56.
(19) Calpe-Berdiel L, Escola-Gil JC, Ribas V, Navarro-Sastre A, Garces-
Garces J, Blanco-Vaca F. Changes in intestinal and liver global gene
expression in response to a phytosterol-enriched diet. Atherosclerosis
2005 July;181(1):75-85.
(20) Yasuda T, Grillot D, Billheimer JT, Briand F, Delerive P, Huet S, Rader DJ.
Tissue-specific liver X receptor activation promotes macrophage reverse
cholesterol transport in vivo. Arterioscler Thromb Vasc Biol 2010
April;30(4):781-6.
(21) Lo SG, Murzilli S, Salvatore L, D'Errico I, Petruzzelli M, Conca P, Jiang
ZY, Calabresi L, Parini P, Moschetta A. Intestinal specific LXR activation
131 stimulates reverse cholesterol transport and protects from atherosclerosis.
Cell Metab 2010 August 4;12(2):187-93.
132
CHAPTER V
DISCUSSION
It has been well established that ABCG5/G8 is a critical regulator of sterol
homeostasis because of its ability to secrete/excrete phytosterols and cholesterol
from the body. The studies presented in this dissertation, however, show that the
role of ABCG5/G8 in sterol metabolism and homeostasis is more complex and
has not been completely discovered.
In regards to phytosterol metabolism, ABCG5/G8 functions to restrict plant sterol
absorption. It appears that ABCG5/G8 excludes plant sterols from the body
because they are toxic when present at high levels. In Chapter II, WT and
ABCG5/G8 KO mice were fed a diet enriched with plant sterols. The high-
phytosterol diet was extremely toxic to the ABCG5/G8 KO mice but had no adverse effects on WT mice. ABCG5/G8 KO mice died prematurely and developed a phenotype that included high levels of plant sterols in many tissues,
liver abnormalities, and severe cardiac lesions.
The findings of this study are useful in relation to dietary phytosterol
supplementation, which is currently used to reduce the risk of coronary heart
disease (CHD)1, 2. Plant sterols are thought to reduce plasma cholesterol concentrations by inhibiting cholesterol absorption3, 4. Most individuals are able to
133
exclude plant sterols from the body via ABCG5/G8, and the FDA allows
phytosterol-enriched foods to be classified as “generally recognized as safe.” In
several species of animals, presumably with ABCG5/G8 intact, that have been
administered high doses of plant sterols, there have been no reports of toxicity5.
Some debate still exists, however, about the safety of dietary phytosterol supplementation, specifically concerning their potential cytotoxic effects on endothelial cells in arteries.
Our study shows that an extremely high concentration of phytosterols in plasma and tissues is toxic. This phenotype seems to depend specifically on the amount of phytosterols that accrue. The presence of intact ABCG5/G8 in an individual appears to offer full protection against dietary phytosterol accumulation, and there is no indication that long term exposure could cause levels of phytosterols to build up to toxic levels. Consequently, dietary supplementation with phytosterols appears safe for the general population.
Our findings also lend novel insight into the body’s need for discrimination between plant sterols and cholesterol. We have shown for the first time that high levels of tissue plant sterol accumulation cause premature death, extensive cardiac lesions, liver damage, and hepatosplenomegaly. These toxicities appear related to accumulation of high levels of unesterified phytosterols that cannot be efficiently metabolized into bile acids nor esterified for storage in lipid droplets.
Accumulation as the free sterol probably results in accumulation in membranes
134
with subsequent disruption of membrane integrity. Further studies need to be
done, however, in order to determine the molecular mechanisms that underlie phytosterol toxicity. Our data show that ABCG5/G8’s role in phytosterol exclusion
from the body is one of protection from the toxic effects of plant sterols.
A previous study from Miettinen, TA et al6 showed that hepatic ABCG5/G8
function was sufficient to limit phytosterol accumulation, suggesting that hepatic
ABCG5/G8 is the primary determinant of steady state plasma phytosterol
concentration. In Chapter III, we report that hepatic ABCG5/G8 function is not
required to prevent phytosterol accumulation in mice. CON, G8HKD, WT, and
ABCG5/G8 KO mice were fed varying amounts of dietary sterol, and plasma and
tissue sterol concentrations were compared between the groups. Compared to
their WT counterparts, mice with whole body ABCG5/G8 deficiency accumulated
very high plasma and hepatic phytosterol concentrations in a dietary sterol
dependent manner. The G8HKD mice did not achieve these high levels of plasma and hepatic phytosterol. These results show that small intestinal ABCG5/G8
function is sufficient to prevent high levels of plant sterol accumulation in mice.
This would support the idea that small intestinal ABCG5/G8 is part of the body’s
first line of defense in preventing dietary plant sterol absorption and
accumulation. When small intestinal ABCG5/G8 is functional, it appears that
hepatic ABCG5/G8 serves as a backup to secrete into bile any dietary plant
sterols that do get absorbed.
135
The G8HKD mouse model also provided an opportunity to study the role of hepatic
ABCG5/G8 function in cholesterol metabolism in a system without dramatic
phytosterol accumulation. This is important because the effects of phytosterol accumulation in models of ABCG5/G8 deficiency are substantial. ABCG5/G8 KO mice on low cholesterol diets have significant reductions in plasma and hepatic cholesterol concentrations 7-9. Despite these reductions, there are no
compensatory increases in cholesterol synthesis genes. It is unclear how much
of the changes in sterol metabolism were due to the mass accumulation of plant sterols versus the lack of ABCG5/G8 function.
Based on data in Chapter III, it appears that hepatic ABCG5/G8 plays an important role in cholesterol metabolism, independent of its ability to transport
phytosterols. G8HKD mice had significant reductions in biliary cholesterol
concentrations irregardless of the amount of dietary sterol fed. Despite the reduction in biliary cholesterol, G8HKD mice were able to maintain levels of
hepatic cholesterol and fecal neutral sterol excretion similar to those of CON
mice on the low sterol and high phytosterol diets. On the high cholesterol diet,
however, G8HKD mice could not maintain appropriate cholesterol homeostasis.
The G8HKD mice accumulated very high levels of hepatic cholesterol and had a
significant decrease in fecal neutral sterol excretion when compared to CON mice. These data suggest that G8HKD mice have a disfunction in the TICE
pathway and subsequently cannot compensate for the reduction in biliary
cholesterol secretion in the face of a dietary cholesterol challenge.
136
Since ABCG5/G8 is required for biliary sterol secretion7, 10, its crucial role in
biliary RCT is firmly established. Until recently, biliary secretion was the
universally accepted pathway by which peripheral cholesterol was excreted from
the body in the feces. If biliary cholesterol excretion was the only contributor to
fecal sterol loss, one would expect dramatically decreased fecal sterol output to
accompany decreases in biliary cholesterol levels. This is not the case, however,
in several mouse models that exhibit little to no biliary cholesterol secretion 11-13.
Along with several studies conducted in rats, dogs, and humans 11, 14-16, these
observations have led our group and others to the discovery of a novel pathway
for non-biliary cholesterol excretion which is called transintestinal cholesterol
excretion (TICE).
The hallmark features of models that primarily use the TICE pathway to excrete
cholesterol are severly diminished biliary cholesterol secretion, with no
accumulation of hepatic cholesterol due to normal levels of fecal neutral sterol
excretion. Since our G8HKD mice had dramatically decreased levels of biliary
cholesterol, we predicted that the TICE pathway would compensate for the loss
of biliary sterol secretion, resulting in normal FNS excretion and no accumulation
of hepatic cholesterol in the G8HKD mice. This appears to be the case when comparing G8HKD mice on the LS and HP diets to the CON mice. Despite the more than 80% reduction in biliary cholesterol levels, G8HKD mice had levels of
FNS excretion and hepatic cholesterol similar to CON mice on the LS and HP
diets.
137
Surprisingly, we found an opposite result in G8HKD mice fed the HC diet. G8HKD
mice on the HC diet had more than a 70% reduction in biliary cholesterol
concentration. The high level of dietary cholesterol fed to these mice unmasked a significant reduction in fecal neutral sterol excretion and a dramatic increase in hepatic cholesterol accumulation when compared to CON mice. These data suggest that the G8HKD mice have a disfunction in the TICE pathway and
subsequently cannot compensate for the reduction in biliary sterol secretion with
the dietary cholesterol challenge.
Chapter IV focused on the role of hepatic ABCG5/G8 in LXR agonist stimulated
cholesterol excretion and macrophage RCT. Key regulators of ABCG5/G8
expression are the nuclear receptors liver x receptor (LXR) α and LXRβ. LXR
activation using synthetic agonists leads to increased fecal neutral sterol loss in
mice17. Presumably this increase is caused by an ABCG5/G8 mediated increase in biliary cholesterol concentration since ABCG5/G8 KO mice did not have increased fecal neutral sterol excretion when treated with an LXR agonist18. It has also been shown that LXR agonist stimulated macrophage RCT is impaired in ABCG5/G8 KO mice19.
Furthermore, there is evidence that ABCG5/G8’s role in RCT may be tissue- specific. In liver-specific LXRα knockout mice, cholesterol excretion and macrophage RCT were not stimulated upon LXR agonist treament20. Because
ABCG5/G8 is transcriptionally regulated by LXR, hepatic ABCG5/G8 mRNA was
138
not induced with LXR agonist treatment in those mice. These studies suggest
that LXR stimulated cholesterol and macrophage RCT may be mediated by
hepatic ABCG5/G8, downstream targets of LXR activation.
In Chapter IV, it was reported that cholesterol excretion and macrophage RCT
were not stimulated by LXR agonist treatment when hepatic ABCG8 expression
was blunted. These results agree with the findings by Zhang, Y et al20 that
hepatic LXRα expression is required for RCT in mice. Since ABCG5/G8 is transcriptionally regulated by LXR, hepatic ABCG5/G8 mRNA was not increased with LXR agonist treatment in hepatic LXRα KO mice. Similarly, hepatic ABCG8 expression was blunted in LXR agonist treated G8HKD mice, and they did not
have increased RCT. Our data suggest that it is ABCG5/G8, a downstream
target of LXR, that is required for LXR stimulated increases in cholesterol
excretion and macrophage RCT.
It has been reported that the LXR agonist T0901317 can strongly stimulate the
TICE pathway21. Initially shown in Chapter III, it appears that G8HKD mice have a
disfunction in the TICE pathway. In support of this observation, LXR agonist
treatment could not stimulate cholesterol excretion or macrophage RCT in G8HKD mice. In corroboration with our findings in Chapter III, these results suggest that hepatic ABCG5/G8 expression is required for TICE.
139
While the data is promising, it is important to emphasize the preliminary nature of
these results that were generated using an ASO to knockdown hepatic ABCG8
mRNA. Due to the nature of ASO technology, hepatic ABCG8 knockdown was
incomplete. Additionally, there were some small effects of the ABCG8 ASO on
small intestinal ABCG8 mRNA levels. It would be best to conduct a similar set of
experiments in tissue-specific ABCG5/G8 KO mice.
The most exciting discovery from this body of work is the evidence that a novel role for ABCG5/G8 in cholesterol metabolism and homeostasis exists. At first
glance, it seems that the biology of ABCG5 and ABCG8 is fully understood – once sterols enter a hepatocyte or enterocyte, ABCG5/G8 can secrete them out into bile or the lumen of the small intestine. These studies show, however, that
the role of ABCG5/G8 in maintaining sterol balance is much more complex.
Important questions that remain are: how does sterol reach ABCG5/G8 for
secretion? And what, if any, additional function could ABCG5/G8 have other than
biliary sterol secretion? It is essential to answer these questions to more fully
understand cholesterol metabolism in the liver and small intestine.
140
REFERENCE LIST
(1) AbuMweis SS, Barake R, Jones PJ. Plant sterols/stanols as cholesterol
lowering agents: A meta-analysis of randomized controlled trials. Food
Nutr Res 2008;52.
(2) Wu T, Fu J, Yang Y, Zhang L, Han J. The effects of phytosterols/stanols
on blood lipid profiles: a systematic review with meta-analysis. Asia Pac J
Clin Nutr 2009;18(2):179-86.
(3) Rozner S, Garti N. The activity and absorption relationship of cholesterol
and phytosterols. Colloid Surf A Physicochem Eng Asp 2006;282:435-56.
(4) Katan MB, Grundy SM, Jones P, Law M, Miettinen T, Paoletti R. Efficacy
and safety of plant stanols and sterols in the management of blood
cholesterol levels. Mayo Clin Proc 2003 August;78(8):965-78.
(5) Schoenheimer R. NEW CONTRIBUTIONS IN STEROL METABOLISM.
Science 1931 December 11;74(1928):579-84.
(6) Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M, Shefer S, Batta
AK, Yu H, Chen J, Klein R, Looije N, Oude-Elferink R, Groen AK, Maeda
N, Salen G, Patel SB. A mouse model of sitosterolemia: absence of
Abcg8/sterolin-2 results in failure to secrete biliary cholesterol. BMC Med
2004 March 24;2:5.
141
(7) Yu L, Hammer RE, Li-Hawkins J, von BK, Lutjohann D, Cohen JC, Hobbs
HH. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in
biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002 December
10;99(25):16237-42.
(8) Klett EL, Lu K, Kosters A, Vink E, Lee MH, Altenburg M, Shefer S, Batta
AK, Yu H, Chen J, Klein R, Looije N, Oude-Elferink R, Groen AK, Maeda
N, Salen G, Patel SB. A mouse model of sitosterolemia: absence of
Abcg8/sterolin-2 results in failure to secrete biliary cholesterol. BMC Med
2004 March 24;2:5.
(9) McDaniel AL, Alger HM, Sawyer JK, Kelley KL, Kock ND, Brown JM,
Temel RE, Rudel LL. Phytosterol Feeding Causes Toxicity in ABCG5/G8
Knockout Mice. Am J Pathol 2013 April;182(4):1131-8.
(10) Graf GA, Yu L, Li WP, Gerard R, Tuma PL, Cohen JC, Hobbs HH. ABCG5
and ABCG8 are obligate heterodimers for protein trafficking and biliary
cholesterol excretion. J Biol Chem 2003 November 28;278(48):48275-82.
(11) Pertsemlidis D, Kirchman EH, Ahrens EH, Jr. Regulation of cholesterol
metabolism in the dog. I. Effects of complete bile diversion and of
cholesterol feeding on absorption, synthesis, accumulation, and excretion
rates measured during life. J Clin Invest 1973 September;52(9):2353-67.
(12) Voshol PJ, Havinga R, Wolters H, Ottenhoff R, Princen HM, Oude Elferink
RP, Groen AK, Kuipers F. Reduced plasma cholesterol and increased
142
fecal sterol loss in multidrug resistance gene 2 P-glycoprotein-deficient
mice. Gastroenterology 1998 May;114(5):1024-34.
(13) Temel RE, Tang W, Ma Y, Rudel LL, Willingham MC, Ioannou YA, Davies
JP, Nilsson LM, Yu L. Hepatic Niemann-Pick C1-like 1 regulates biliary
cholesterol concentration and is a target of ezetimibe. J Clin Invest 2007
July;117(7):1968-78.
(14) Sperry W. Lipid Excretion IV: A study of the relationship of the bile to the
fecal lipids with special reference to certain problems of sterol metabolism.
J Biol Chem 1927;52:2353-7.
(15) Bandsma RH, Stellaard F, Vonk RJ, Nagel GT, Neese RA, Hellerstein MK,
Kuipers F. Contribution of newly synthesized cholesterol to rat plasma and
bile determined by mass isotopomer distribution analysis: bile-salt flux
promotes secretion of newly synthesized cholesterol into bile. Biochem J
1998 February 1;329 ( Pt 3):699-703.
(16) Deckelbaum RJ, Lees RS, Small DM, Hedberg SE, Grundy SM. Failure of
complete bile diversion and oral bile acid therapy in the treatment of
homozygous familial hypercholesterolemia. N Engl J Med 1977 March
3;296(9):465-70.
(17) Plosch T, Kok T, Bloks VW, Smit MJ, Havinga R, Chimini G, Groen AK,
Kuipers F. Increased hepatobiliary and fecal cholesterol excretion upon
143
activation of the liver X receptor is independent of ABCA1. J Biol Chem
2002 September 13;277(37):33870-7.
(18) Yu L, York J, Von BK, Lutjohann D, Cohen JC, Hobbs HH. Stimulation of
cholesterol excretion by the liver X receptor agonist requires ATP-binding
cassette transporters G5 and G8. J Biol Chem 2003 May
2;278(18):15565-70.
(19) Calpe-Berdiel L, Rotllan N, Fievet C, Roig R, Blanco-Vaca F, Escola-Gil
JC. Liver X receptor-mediated activation of reverse cholesterol transport
from macrophages to feces in vivo requires ABCG5/G8. J Lipid Res 2008
September;49(9):1904-11.
(20) Zhang Y, Breevoort SR, Angdisen J, Fu M, Schmidt DR, Holmstrom SR,
Kliewer SA, Mangelsdorf DJ, Schulman IG. Liver LXRalpha expression is
crucial for whole body cholesterol homeostasis and reverse cholesterol
transport in mice. J Clin Invest 2012 May 1;122(5):1688-99.
(21) van d, V, van Dijk TH, Vrins CL, van MH, Havinga R, Bijsterveld K, Tietge
UJ, Groen AK, Kuipers F. Activation of the liver X receptor stimulates
trans-intestinal excretion of plasma cholesterol. J Biol Chem 2009 July
17;284(29):19211-9.
144
Allison L. McDaniel, BS, BA
Curriculum Vitae
Wake Forest University School of Medicine
NAME: Allison Leigh McDaniel, BS, BA
POSITION TITLE: Doctoral Candidate Department of Pathology Section on Lipid Sciences Wake Forest University School of Medicine GPA: 3.55
ADDRESS: Medical Center Boulevard Winston-Salem, NC 27157 Phone: (423)754-6822 Email: [email protected] [email protected]
EDUCATION: Bachelor of Science, Biology Bachelor of Art, Political Science Cum Laude Emory & Henry College, Emory, VA May 2006 GPA: 3.34
CAREER DEVELOPMENT
In Progress Doctor of Philosophy, Molecular Pathology Wake Forest University School of Medicine
EMPLOYMENT
2007 – Present Graduate Student Research Fellow Department of Pathology, Section on Lipid Sciences, Wake Forest University School of Medicine, Graduate School of Arts and Sciences, Winston-Salem, NC Advisor: Ryan Temel, PhD Co-Advisors: Larry Rudel, PhD & J Mark Brown, PhD
2006 – 2007 Quality Assurance Laboratory Chemist GlaxoSmithKline Pharmaceuticals, Bristol, TN
145
HONORS
2011 Early Career Investigator Travel Award Kern Lipid Conference, Vail, CO
2008 – 2011 Graduate Fellow, T32 Integrative Lipid Sciences, Inflammation, and Chronic Diseases Training Program, Wake Forest University School of Medicine, Winston-Salem, NC
2005, 2002 Dean’s List Emory & Henry College, Emory, VA
2004 – 2006 Member, Beta Beta Beta National Biology Honor Society Emory & Henry College, Emory, VA
2003 – 2006 Member, Pi Sigma Alpha National Political Science Honor Society Emory & Henry College, Emory, VA
2003 – 2006 Member, Pi Gamma Mu National Humanities Honor Society Emory & Henry College, Emory, VA
BIBLIOGRAPHY
Published manuscripts:
1. McDaniel AL, Alger HM, Sawyer JK, Kelley KL, Kock ND, Brown JM, Temel RE, and Rudel LL. Phytosterol feeding causes toxicity in ABCG5/G8 knockout mice. [Paper accepted by American Journal of Pathology]
2. Beason DP, Hsu JE, Marshall SM, McDaniel AL, Temel RE, Abboud JA, Soslowsky LJ. Hypercholesterolemia increases supraspinatus tendon stiffness and elastic modulus across multiple species. J Shoulder Elbow Surg. 2012 Sep 13. [Epub ahead of print] PMID: 22981355
3. Owens AP 3rd, Passam FH, Antoniak S, Marshall SM, McDaniel AL, Rudel L, Williams JC, Hubbard BK, Dutton JA, Wang J, Tobias PS, Curtiss LK, Daugherty A, Kirchhofer D, Luyendyk JP, Moriarty PM, Nagarajan S, Furie BC, Furie B, Johns DG, Temel RE, Mackman N. Monocyte tissue factor-dependent activation of coagulation in hypercholesterolemic mice and monkeys is inhibited by simvastatin. J Clin Invest. 2012 Feb 1;122(2):558-68. Epub 2012 Jan 3. PMID: 22214850
146
4. Rayner KJ, Esau CC, Hussain FN, McDaniel AL, Marshall SM, van Gils JM, Ray TD, Sheedy FJ, Goedeke L, Liu X, Khatsenko OG, Kaimal V, Lees CJ, Fernandez-Hernando C, Fisher EA, Temel RE, Moore KJ. Inhibition of miR-33a/b in non-human primates raises plasma HDL and lowers VLDL triglycerides. Nature, 2011 Oct 19;478(7369):404-7. PMID: 22012398
5. Medina MW, Gao F, Naidoo D, Rudel LL, Temel RE, McDaniel AL, Marshall SM, Krauss RM. Coordinately regulated alternative splicing of genes involved in cholesterol biosynthesis and uptake. PLoS One, 2011 Apr 29;6(4):e19420. PMID: 21559365
6. Temel RE, Sawyer JK, Yu L, Lord C, Degirolamo C, McDaniel A, Marshall S, Wang N, Shah R, Rudel LL, Brown JM. Biliary sterol secretion is not required for macrophage reverse cholesterol transport. Cell Metabolism, 2010 Jul 4;12(1):96-102. PMID: 20620999
Manuscripts in preparation:
1. McDaniel AL, Brown JM, Temel RE. Hepatic ABCG8 knockdown does not cause phytosterol accumulation in mice. Planned submission to Arteriosclerosis, Thrombosis and Vascular Biology.
2. McDaniel AL, Brown JM, Temel RE. Transintestinal cholesterol excretion and macrophage reverse cholesterol transport are not stimulated in hepatic ABCG8 knockdown mice treated with an LXR agonist. Journal TBA.
Abstracts/Presentations at National Meetings:
1. McDaniel AL, Brown JM, Temel RE. Transintestinal cholesterol excretion and macrophage reverse cholesterol transport are not stimulated in hepatic ABCG8 knockdown mice treated with an LXR agonist. Gordon Research Conference, Lipid and Lipoprotein Metabolism in Health and Disease, June 2012 [poster presentation].
2. Owens AP, Passam FH, Antoniak S, Marshall SM, McDaniel AL, Rudel L, Williams JC, Hubbard BK, Dutton JA, Wang J, Tobias PS, Curtiss LK, Daugherty A, Kirchhofer D, Luyendyk JP, Moriarty PM, Nagarajan S, Furie BC, Furie B, Johns DG, Temel RE, Mackman N. Monocyte Tissue Factor- Dependent Activation of Coagulation in Hypercholesterolemic Mice and Monkeys Is Inhibited by Simvastatin. Abstract # 42: Arteriosclerosis, Thrombosis, and Vascular Biology Scientific Sessions, 2012.
3. McDaniel AL, Sawyer JK, Lee RG, Graham MJ, Crooke RM, Rudel LL, Brown JM, Temel RE. Liver specific knockdown of ABCG8 causes
147
dysfunction of trans intestinal cholesterol efflux. Kern Lipid Conference, 2011[poster presentation].
4. McDaniel AL, Marshall SM, Kelley KL, Lee RG, Graham MJ, Crooke RM, Rudel LL, Temel, RE. Effects of hepatic NPC1L1 suppression on cholesterol metabolism in vervet monkeys. Abstract # P198: Arteriosclerosis, Thrombosis, and Vascular Biology Scientific Sessions, 2011.
5. Cuffe HA, Chung S, Marshall SM, McDaniel AL, Temel RE, Parks JS. Dietary cholesterol is associated with increased adipocyte size and cholesterol content in visceral, but not subcutaneous, fat in African green monkeys. Abstract # P327: Arteriosclerosis, Thrombosis, and Vascular Biology Scientific Sessions, 2011.
6. Owens AP, Marshall SM, McDaniel AL, Williams JC, Johns DG, Temel RE, Mackmam N. Simvastatin intervention attenuates dyslipidemic increases in microparticle tissue factor, inflammation, and the activation of coagulation in nonhuman primates without affecting LDL-C. Abstract # 28: Arteriosclerosis, Thrombosis, and Vascular Biology Scientific Sessions, 2011.
7. McDaniel AL, Marshall S, Kelley KL, Sawyer JK, Kavanagh K, Sprecher DL, Rudel LL, Olsen EJ, Temel RE. PPARδ agonist GW501516 raises plasma HDL-cholesterol and LCAT activity in African green monkeys. Gordon Research Conference, Lipid and Lipoprotein Metabolism in Health and Disease, June 2010 [poster presentation]. 8. McDaniel AL, Marshall SM , Kelley KL, Lee RG, Graham MJ, Crooke RM, Yu L, Rudel LL, Temel RE. Effects of NPC1L1 ASO on cholesterol metabolism in vervet monkeys. Gordon Research Conference, Lipid and Lipoprotein Metabolism in Health and Disease, June 2010.
9. Owens AP, Temel RE, Barcel DA, Marshall SM, McDaniel AL, Mackmam N. Hyperlipidemia Increases Microparticle Tissue Factor and the Activation of Coagulation: A Tale of Mice and Monkeys. Abstract # 20151: Scientific Sessions of the American Heart Association, 2010.
10. McDaniel AL, Lan T, Marshall SM, Boyd CA, Kelley KL, Wilson MD, Sawyer JK, Rudel LL, Temel RE. Dietary n-3 fatty acids have minimal effects on intestinal Niemann-Pick C1 like 1 expression and cholesterol absorption [abstract]. Arterioscler Thromb Vasc Biol. 2009; 29(7):e30 [poster presentation].
148
PRESENTATIONS
2012 The tissue specific role of ABCG5/G8 in sterol transport. Lipid Sciences Program Project Group Meeting, Wake Forest School of Medicine, Winston- Salem, NC.
2012 Tissue specific contributions of ABCG5/G8 to sterol transport. 2nd Annual Mini-Symposium on Integrative Lipid Sciences, Inflammation, and Chronic Diseases, Wake Forest School of Medicine, Winston-Salem, NC.
2011 Liver specific knockdown of ABCG8 causes dysfunction of trans intestinal cholesterol efflux [abstract]. Poster presentation, Kern Lipid Conference.02-2009 The Role of Liver Derived Apo-B Containing Lipoproteins in a Non-Biliary Model of Cholesterol Excretion. Wake Forest School of Medicine, Winston- Salem, NC.
2011 The role of hepatic ABCG5/G8 and NPC1L1 in the Trans-Intestinal Cholesterol Efflux pathway. Mini-Symposium on Integrative Lipid Sciences, Inflammation, and Chronic Diseases, Wake Forest School of Medicine, Winston- Salem, NC.
2011 Hepatic ABCG8: A key player in the TICE pathway? Lipid Sciences Program Project Group Meeting, Wake Forest School of Medicine, Winston- Salem, NC.
2010 The Role of Hepatic ABCG5/G8 in Whole Body Sterol Homeostasis. Molecular Pathology Graduate Program Seminar, Wake Forest School of Medicine, Winston-Salem, NC
2010 PPARδ agonist GW501516 raises plasma HDL-cholesterol and LCAT activity in African green monkeys [abstract]. Poster Presentation, Gordon Research Conference, Lipid and Lipoprotein Metabolism in Health and Disease.
TEACHING EXPERIENCE
Lectures:
2012 Anatomy & Physiology, Doctorate of Physical Therapy Course, Winston Salem State University, Winston-Salem, NC
2012 Anatomy & Physiology, Undergraduate Course, Winston-Salem State University, Winston-Salem, NC
Other:
149
2008 Assistant Instructor, CampMed for Middle School Students, Department of Biology, State University of New York – Jefferson Community College
2005 – 2006 Supplemental Instructor, Undergraduate General Biology, Emory & Henry College, Emory, VA
PROFESSIONAL MEMBERSHIPS
2008 – Present Member, American Heart Association 2008 – Present Member, Council on Atherosclerosis, Thrombosis and Vascular Biology
COMMUNITY ACTIVITIES
2012 – Present U.S. Army Family Readiness Group (FRG) Leader, Alpha Troop, 1-17 CAV, 82nd CAB, Fort Bragg, NC
Role: Supervises the committees, groups and functions for a FRG consisting of Soldiers, civilians and volunteers assigned to the unit and their families (immediate and extended) for morale, cohesion, communication, unit cooperation and the well being of company personnel and their families. Duties: Supports the commander’s family readiness goals; provides overall leadership of the FRG; schedules, plans, and conducts company Family Readiness Group meetings; delegates FRG responsibilities to select volunteers in order to promote participation in FRG activities and accomplishment of FRG objectives; acts as a liaison between battalion and company level FRGs; identifies needs or unique problems of unit families; tracks FRG appropriated fund budget; serves as a member of the battalion-level steering committee.
2012 – Present Chairperson, Young Alumni Council, Emory & Henry College, Emory, VA
Role: Supervises members of the Young Alumni Council in their efforts to help recent graduates transition into proactive members of the alumni network, encourage young alumni involvement and annual giving, give a voice to young alumni concerns and ideas, plan and promote social, community and networking events designed for young alumni Duties: Provides overall leadership of the Young Alumni Council; schedules, plans, and conducts Young Alumni Council meetings and alumni events; acts as a liason between alumni and Emory & Henry College.
2011 – Present Member, Young Alumni Council, Emory & Henry College, Emory, VA
150