ROLE OF MYELOPEROXIDASE MEDIATED OXIDATIVE MODIFICATION AND APOLIPOPROTEIN COMPOSITION IN HIGH DENSITY LIPOPROTEIN FUNCTION

by

ARUNDHATI UNDURTI

Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy

Thesis Advisor: Dr. Stanley L. Hazen

Department of Microbiology and Molecular Biology Cell Biology Program

CASE WESTERN RESERVE UNIVERSITY

August, 2010 CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

______Arundhati Undurti candidate for the ______degreePhD *.

Alan Levine (signed)______(chair of the committee)

Stanley Hazen ______

Jonathan Smith ______

Menachem Shoham ______

Mark Chance ______

______

(date) ______06-30-2010

*We also certify that written approval has been obtained for any proprietary material contained therein. For Amma and Nana TABLE OF CONTENTS

List of Figures 3

List of Tables 7

Abbreviations 8

Acknowledgements 11

Abstract 13

Chapter I: Introduction

Pathogenesis of Atherosclerosis

Endothelial Dysfunction 17 Fatty Streak Formation 17 Advanced Lesion Formation 18 Thrombotic Complications 18

Role of Lipoproteins in Atherosclerosis

Lipoprotein Classification and Metabolism 19 High Density Lipoprotein 20 Reverse Cholesterol Transport 21 Scavenger receptor B1 22 Spherical HDL 23 Non cholesterol efflux activities of HDL 24

Lipoprotein Oxidation in Atherogenesis

Myeloperoxidase 25 Mechanism of MPO mediated atherosclerosis development 26

Chapter II: Modification of High Density Lipoprotein by Myeloperoxidase Generates a Pro-inflammatory Particle

Abstract 35 Introduction 37 Materials and Methods 40 Results 47 Discussion 58

1 Chapter III: The Apolipoprotein Composition of High Density Lipoprotein Influences Cholesterol Efflux and Non cholesterol Efflux Activities of the Lipoprotein

Abstract 75 Introduction 76 Materials and Methods 79 Results 85 Discussion 90

Chapter IV: Generation of Two Fusion Proteins of the Extracellular Domain of Scavenger Receptor B1 to Identify Structure-Function Relationships between High Density Lipoprotein and Scavenger Receptor B1

Introduction 104 Materials and Methods 107 Results 118 Discussion 121

Chapter V: Discussion and Future Directions 153

References 164

2 LIST OF FIGURES

Chapter I

Figure I-1: The Structure of an artery 28

Figure I-2: Rupture of the fibrous cap and thrombotic complications 29

Figure I-3: Reverse cholesterol transport 30

Figure I-4: Formation of spherical HDL 31

Figure I-5: VCAM-1 expression is controlled by the transcription factor NF-ț% 32

Figure I-6: HDL signaling pathway 33

Chapter II

- Figure II-1: Oxidation of HDL by the MPO/H2O2/Cl system has functional consequences for classic atheroprotective activities of HDL 61

Figure II-2: HDL protects HUVEC and BAEC from multiple apoptogenic triggers while MPO-oxidized HDL fails to do so 62

Figure II-3: Exposure of HDL to the MPO oxidant system inhibits the anti- apoptotic activity of the particle as monitored by loss of capacity to both inhibit caspase-3 activity and induce eNOS activity 64

Figure II-4: HDL oxidized by physiologically relevant levels MPO-generated oxidants inhibits the anti-inflammatory activity of the particle in HUVEC and promotes VCAM-1 protein expression in BAEC independent of TNF-Į 65

Figure II-5: MPO-oxidized HDL induces bovine aortic endothelial cell NF-ț% DFWLYDWLRQ,..DFWLYDWLRQDQGSKRVSKRU\ODWLRQRI,ț%Į 67

Figure II-6: MPO-oxidized HDL fails to bind to the physiologic HDL receptor,

3 scavenger receptor B1 (SR-B1) and gains binding to an alternate receptor on endothelial cells 69

Figure II-7: The scavenger receptors CD36 and SR-A1 do not recognize HDL modified by the MPO/H2O2/Cl- system 71

Figure II-8: ApoA1 tyrosine, tryptophan and methionine residues do not appear to be involved in endothelial activation by MPO-oxidized HDL 72

Chapter III

Figure III-1: Spherical HDL A1 and spherical HDL A1/A2 are similar in diameter 94

Figure III-2: Spherical HDL containing both apoA1 and apoA2 is less anti- apoptotic than spherical HDL containing only apoA1 95

Figure III-3: Spherical HDL containing both apoA1 and apoA2 is less efficient at inhibiting TNF-ĮLQGXFHGVXUIDFH9&$0-1 protein expression than spherical HDL containing only apoA1 97

Figure III-4: Spherical HDL containing both apoA1 and apoA2 is more pro- inflammatory than spherical HDL containing only apoA1 upon MPO mediated oxidation 98

Figure III-5: MPO-oxidized sHDL A1 and MPO-oxidized sHDL A1/A2 induces bovine aortic endothelial cell NF-ț%DFWLYDWLRQDQG,..DFWLYDWLRQ 99

Figure III-6: Spherical HDL containing apoA1 only or spherical HDL containing both apoA1 and apoA2 are equally efficient at promoting cholesterol efflux from macrophages 101

Figure III-7: ApoA2 transgenic mice show less reverse cholesterol transport compared to C57Bl/6J mice 102

Chapter IV

Figure IV-1: Extracellular domain of SR-B1 125

Figure IV-2: Primer sequences for the directional cloning of extracellular domain of SR-B1 126

4 Figure IV-3a: Vector map of p-ENTR/d-TOPO 127

Figure IV-3b: Directional TOPO cloning of extracellular domain of SR-B1 128

Figure IV-4: SR-B1 extracellular domain is successfully cloned into p-ENTR/ d-TOPO vector 129

Figure IV-5a: The mammalian expression vector pSeCTag2C 130

Figure IV-5b: The multiple cloning site of the mammalian vector pSeCTag2C 131

Figure IV-6a: Restriction digest of pSecTag2C with Not I fails to cut the vector 132

Figure IV-6b: Primers for introducing a Not I site into pSecTag2C 133

Figure IV-6c: Restriction digest of pSecTag2C after introduction of a Not I site 133

Figure IV-7: The extracellular domain of SR-B1 is successfully ligated into the pSecTag2C vector 134

Figure IV-8: Western blot of whole cell extract and media of 293T cells transfected with pSecTag2C vector containing SR-B1 extracellular domain 135

Figure IV-9a: Coomassie gel of nickel column purification of SR-B1 fusion protein from the media of 293T cells 137

Figure IV-9b: Western blot analysis of purified SR-B1 fusion protein 138

Figure IV-10: SR-B1 fusion protein can bind to HDL 140

Figure IV-11a: The pMAL-c4X vector map 141

Figure IV-11b: .Forward and reverse primer sequences for introducing a multiple cloning site with an N-terminal Tev cleavage site into the pMAL-c4X vector 141

Figure IV-12: SR-B1 extracellular domain is successfully ligated into pMAL-c4x vector 143

Figure IV-13: SR-B1 fusion protein is produced in E.coli 144

Figure IV-14: Purification scheme for MBP-SR-B1-6x His fusion protein from E.coli 145

Figure IV-15a: Coomassie gel of purification of MBP-SR-B1-6x His fusion

5 protein with amylose beads 146

Figure IV-15b: Western blot analysis of MBP-SR-B1-6x His fusion protein purified with amylose beads 147

Figure IV-16: Coomassie gel of MBP-SR-B1-6x His purified on a nickel column 149

6 LIST OF TABLES

Table IV-1: Purification table for SR-B1 fusion protein purified from media of 293T cells on a nickel column 139

Table IV-2: Purification table of MBP-SR-B1-6x His fusion protein purified with amylose beads 148

Table IV-3: Purification table of MBP-SR-B1-6x His fusion protein purified on nickel column after prior purification with amylose beads 150

Table IV-4: Analysis of binding between MBP-SR-B1-6x His fusion protein and HDL (apoA1) 151

7 ABBREVIATIONS

ABCA1—ATP binding cassette transporter A1 ABCG1—ATP binding cassette transporter G1 AEBSF—4-(2-Aminoethyl) benzenesulfonyl fluoride ApoA1—apolipoprotein A1 ApoA2—apolipoprotein A2 ApoE—apolipoprotein E ATP—adenosine triphosphate BAEC—bovine aortic endothelial cells 8-Br-cAMP—8-bromo-cyclic adenosine monophosphate Cl-Tyr—chloro-tyrosine CVD—cardiovascular disease DKO—double knock-out DPM—disintegrations per minute DTPA—diethylene triamine pentaacetic acid DTT—dithiothreitol ELISA—enzyme linked immunosorbent assay EMSA—electrophoretic mobility shift assay eNOS—endothelial nitric oxide synthase

Fc—fragment, crystallizable FPLC—fast performance liquid chromatography GST—glutathione-S-transferase H-D exchange MS—hydrogen-deuterium exchange mass spectrometry HCl—hydrogen chloride HEK 293—human embryonic kidney cells HDL—high density lipoprotein HPLC—high performance liquid chromatography HRP—horse radish peroxidase HUVEC—human umbilical vein endothelial cells IDL—intermediate density lipoprotein

8 IPTG— LVRSURS\Oȕ-D-1-thiogalactopyranoside KCl—potassium chloride IKK—,ț%NLQDVH KO—knock out LCAT—lecithin cholesterol acyl transferase LDL—low density lipoprotein MAPK—mitogen activated protein kinase MBP—maltose binding protein MBP-SR-B1-6x His—fusion protein of extracellular domain of scavenger receptor B1 with N-terminal MBP tag and C-terminal 6x histidine tag

MgCl2—magnesium chloride MPM—mouse peritoneal macrophages MPO—myeloperoxidase - MPO/H2O2/Cl — myeloperoxidase/hydrogen peroxide/chloride oxidation system NaCl—sodium chloride NF-ț%—nuclear factor- ț% NO—nitric oxide oxHDL—oxidized high density lipoprotein oxLDL—oxidized low density lipoprotein PBS—phosphate buffered saline PCR—polymerase chain reaction PMSF-- phenylmethylsulfonyl fluoride POPC—1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine RCT—reverse cholesterol transport rHDL—reconstituted high density lipoprotein sHDL A1—spherical HDL containing only apoA1 sHDL A1/A2—spherical HDL containing both apoA1 and apoA2 SANS—small angle neutron scattering SR-B1—scavenger receptor B1

SR-B1-Fc—fusion protein of extracellular domain of SR-B1 with C-terminal Fc tag SDS-PAGE—sodium dodecyl sulfate-polyacrylamide gel electrophoresis

9 TEA—triethanolamine TNF—tumor necrosis factor UV—ultraviolet VCAM-1—vascular cell adhesion molecule VLDL—very low density lipoprotein

10 ACKNOWLEDGEMENTS

The work described in this thesis could not have been possible without the help and support of numerous people. I would like to thank my advisor, Dr. Stanley Hazen, for his guidance and support over the past five years. I would also like to thank Dr. Joseph

DiDonato for his help and advice over the past three years. A huge thank you to my committee—Dr. Jonathan Smith, Dr. Mark Chance, Dr. Menachem Shoham, Dr. Alan

Levine and Dr. Vernon Anderson (past member) for their scientific insights and discussion and for challenging me to be a better scientist. I want to especially thank my committee chair, Dr. Alan Levine, who has been the most supportive committee chair anyone could ask for.

Thank you to everyone in the Hazen lab, who made it fun to be there. A special thank you to Zhiping Wu, who was always willing to answer my questions and discuss experiments. To Joe Lupica, Bob Koeth, Maryam Zamanian and Michael Greenberg, who I have always been able to turn to when I needed help, a shoulder to cry on or when

I needed someone to simply laugh with. To Kim Brinson and Amber Gist, who have been wonderful friends. Amber was always willing to help me out with every administrative and scheduling issue that came up. Her support and friendship mean a lot to me.

A huge thank you to my parents for their unconditional love and support. They taught me to dream and to work hard to make those dreams come true. They gave up everything in India to move to the US, so that my brother and I could have the best education possible. I can only hope I have made them proud. They are the best parents anyone could ever ask for. Thank you to my brother, Aditya, for his love and support. To my grandparents, who have always loved me and supported me. And finally, to my

11 husband, Sagar. Words cannot express how much I love him. His unwavering love, support and humor have gotten me through the PhD. He has helped me hold everything in perspective. Every day is a great day because I get to come home to him. For us, the best is yet to come!

12 Role of Myeloperoxidase Mediated Oxidative Modification and Apolipoprotein Composition in High Density Lipoprotein Function

Abstract by ARUNDHATI UNDURTI

High levels of high density lipoprotein (HDL) are associated with a decreased risk of cardiovascular disease (CVD). The atheroprotective function of HDL has been attributed to its key role in the reverse cholesterol transport (RCT) pathway. However, recent evidence suggests that HDL can be rendered “dysfunctional”, impairing its ability to promote RCT. The work described here suggests two mechanisms that can render

HDL “dysfunctional.” The first mechanism involves oxidation of HDL by the enzyme myeloperoxidase (MPO). Recent studies demonstrate that MPO binds to HDL in vivo, selectively targeting HDL for oxidative modification. We now show that (patho) physiologically relevant levels of MPO-catalyzed oxidation result in loss of non cholesterol efflux activities of HDL including anti-apoptotic and anti-inflammatory functions. One mechanism responsible is shown to involve loss of oxidized HDL binding to the HDL receptor, scavenger receptor B1, and concurrent acquisition of binding to a novel unknown receptor independent of scavenger receptors CD36 and SR-A1. HDL modification by MPO is further shown to confer pro-inflammatory gain of function activities as monitored by NF-ț% activation and surface vascular cell adhesion molecule

(VCAM-1) levels on aortic endothelial cells. Multiple site-directed mutagenesis studies of HDL suggest that the pro-inflammatory activity does not involve methionine, tyrosine,

13 or tryptophan residues—oxidant sensitive residues previously mapped as sites of oxidation within human atheroma. A second mechanism for generating dysfunctional

HDL involves changing the apolipoprotein composition. Apolipoprotein A2 (apoA2) is the second most abundant protein in HDL. However, the role of apoA2 in the atheroprotective function of HDL is not well defined. We now show that apoA2 containing HDL is less anti-apoptotic and less anti-inflammatory than HDL containing only apoA1. Further, oxidation of apoA2 containing HDL by MPO generates a particle that has increased pro-inflammatory gain of function activity. Additionally, mice transgenic for mouse apoA2 have lower levels of macrophage RCT compared to wild type controls. Further analysis demonstrates that the rate of cholesterol delivery to the liver is impaired in apoA2 transgenic mice. Taken together, the findings described in this thesis support the idea that the quality of HDL is as important as quantity preventing

CVD.

14 CHAPTER 1

General Introduction

15 Atherosclerotic cardiovascular disease (atherosclerosis) is the leading cause of mortality and morbidity in the Unites States, Europe and parts of Asia (1). Traditionally, atherosclerosis was considered to be a mere plumbing problem—lipid accumulating in an artery wall over time, ultimately leading to blockage of the artery lumen (stenosis) and loss of blood flow to the heart. In recent decades, our understanding of the pathogenesis of atherosclerosis has increased significantly, providing opportunities for more effective prevention, diagnosis and treatment strategies.

PATHOGENESIS OF ATHEROSCLEROSIS

Atherosclerotic lesions occur primarily in large and medium sized arteries and lead to ischemia (loss of oxygenation) of heart, brain or extremities (2). The structure of a normal artery consists of three layers (3) (Figure I-1). The outermost layer or tunica adventitia consists primarily of connective tissue as well as nerves that supply the vessel.

The middle layer or tunica media consists of smooth muscle that controls the caliber of the artery. The tunica adventitia and tunica media are separated by an external elastic lamina. The innermost layer of the artery is the tunica intima, which consists of a single layer of endothelial cells surrounded by sub-endothelial connective tissue. The internal elastic lamina separates the tunica intima from the tunica media.

Atherosclerosis is recognized as a chronic inflammatory condition with a set of very specific molecular and cellular responses (4). Atherosclerotic lesions develop as early as adolescence and can progress over a lifetime. In many instances, the first symptom of atherosclerosis is a myocardial infarction or heart attack. The pathogenesis

16 of atherosclerosis can be divided into several stages, with inflammation playing a key role in all of the various stages of the disease.

A) Endothelial dysfunction

The endothelial lining of the artery (tunica intima) plays a crucial role in maintaining homeostatic and hemostatic balance (5). It regulates the contractility of the artery by producing vasodilators such as nitric oxide (NO) as well as vasoconstrictors such as endothelin and angiotensin II (6). Injury to the endothelium can be caused by various pro-inflammatory stimuli such as obesity, hypertension, smoking, a diet high in saturated fat and hyperglycemia, all of which are recognized as risk factors for developing atherosclerosis (2). This results in endothelial dysfunction characterized by increased permeability of the endothelium to circulating lipoproteins such as low density lipoprotein (LDL), decreased production of NO and increased expression of adhesion molecules such as vascular cell adhesion molecule (VCAM-1) and P-selectin. Under normal conditions, circulating white blood cells adhere poorly to the endothelium. The increased expression of adhesion molecules after an endothelial injury promotes the attachment of circulating monocytes to the endothelial layer and their subsequent migration into the sub-endothelial space, where they differentiate into macrophages (7-9).

B) Fatty streak formation

Macrophages in the sub-endothelial space secrete chemoattractant factors such as monocyte chemoattractant protein (MCP-1), which in turn attract more monocytes (10).

Macrophages also secrete other pro-inflammatory cytokines such as tumor necrosis factor

17 (TNF-Į) and interleukin -1, which results in increased binding of LDL to the endothelium and smooth muscle (2, 4). When LDL is trapped within the artery wall, it is oxidized and the oxidized LDL binds to scavenger receptors such as CD36 on the surface of macrophages (11). This results in internalization of the oxidized lipoprotein and the accumulation of lipid. Such lipid laden macrophages are known as foam cells and constitute the fatty streak, which is the hallmark of an early atherosclerotic lesion (12)

(Figure I-2).

C) Advanced lesion formation

Fatty streaks can progress to more advanced lesions that are characterized by the formation of a fibrous cap. The fibrous cap walls off the lesion from the lumen of the artery and represents a healing response to the injury (2). The fibrous cap encloses lipid, leukocytes and other debris that may form a necrotic core. The thick fibrous cap results in the formation of a stable lesion that may occlude a significant portion of the lumen of the artery. If blood flow is significantly reduced, patients can experience chest pain on exercise or other prolonged activity. Coronary angiography is used to detect these occlusive lesions and treatment includes stent placement or bypass surgery to normalize blood flow (13).

D) Thrombotic complications

Thrombosis causes the most serious clinical consequences of atherosclerosis.

Research over the past two decades has revealed that at least 50% of acute coronary syndromes and myocardial infarctions are caused by non-occlusive lesions that are

18 difficult to diagnose through coronary angiography (4). For example, serial angiographic studies have shown that the culprit lesions of many acute myocardial infarctions are not flow limiting (14, 15). The continued entry of macrophages into the lesion and their activation results in the secretion of not only pro-inflammatory cytokines but also proteases such as matrix metalloproteinases. These proteolytic enzymes can break down the fibrous cap, generating a vulnerable plaque that is prone to rupture (16). Vulnerable plaques are characterized by a thin fibrous cap, large lipid core and many inflammatory cells (2). Rupture of the fibrous cap exposes the pro-thrombotic necrotic core to the circulation and results in thrombus formation and occlusion of the artery (Figure I-3). A minority of acute coronary syndromes occur due to the superficial erosion of the endothelium, which exposes pro-thrombotic collagen in the sub-endothelium (17).

Endothelial apoptosis plays a pivotal role in the formation of such thrombi. For example, oxidized LDL promotes endothelial apoptosis as do other circulating ligands such as Fas and TNF-Į (18).

THE ROLE OF LIPOPROTEINS IN ATHEROSCLEROSIS

A) Lipoprotein classification and metabolism

Lipoproteins are a complex mixture of lipid and protein that transport the bulk of the body’s cholesterol and triacylglycerol in plasma (19). They consist of a cholesterol ester core surrounded by phospholipids, free cholesterol and various proteins known as apolipoproteins. Lipoproteins are classified on the basis of their density into chylomicrons, very low density lipoprotein (VLDL), intermediate density lipoprotein

(IDL), low density lipoprotein (LDL) and high density lipoprotein (HDL). Lipoprotein

19 metabolism includes an exogenous as well as an endogenous pathway (20). In the exogenous pathway, epithelial cells lining the small intestine absorb lipids (triglyceride, cholesterol and phospholipid) and repackage them into triglyceride rich chylomicrons. In the endogenous pathway, the liver secretes triglyceride rich VLDL. Both chylomicrons and VLDL enter the bloodstream and activate lipoprotein lipase (LPL), an enzyme present on endothelial cells lining the blood vessels. LPL catalyzes the hydrolysis of triglyceride, which releases glycerol and fatty acids to be absorbed primarily by adipose tissue and muscle. The hydrolyzed chylomicrons are known as chylomicron remnants while the hydrolyzed VLDL forms IDL. Chylomicron remnants are absorbed by the liver and undergo further hydrolysis within the cell. IDL can either be absorbed by the liver or undergo further hydrolysis by hepatic lipase to generate LDL. LDL has high cholesterol content and apoB100 as the principal apolipoprotein. The recognition of apoB100 by surface receptors of peripheral cells leads to the movement of cholesterol from LDL into cells. Thus, LDL is the primary lipoprotein that transports cholesterol from the liver to peripheral cells, earning it the nickname “bad cholesterol.” Epidemiological studies have shown that high plasma levels of LDL are associated with an increased risk of atherosclerosis (21), (22).

B) High density lipoprotein

HDL is a heterogeneous mixture of lipoproteins in the density range of 1.063 to

1.21 mg/dl (23). The most abundant apolipoprotein on HDL is apoA1, followed by apoA2 (24). High levels of HDL are inversely associated with the risk of developing atherosclerosis—for every 1 mg/dl increase in HDL, the risk of developing

20 atherosclerosis and cardiovascular disease (CVD) decreases by 2-3% (25). These observations have lead to HDL being nicknamed as “good cholesterol.” Animal models also demonstrate the protective effect of HDL. Elevation of HDL levels through apoA1-

Milano (a variant of apoA1) infusions (26), (27), (28), (29) or transgenic expression of apoA1 (30) results in a decrease in lesion size in animal models of atherosclerosis. The apolipoprotein component of HDL, especially apoA1, has been extensively studied and is thought to account for most, if not all, of the atheroprotective properties of the particle as well as being involved in receptor mediated HDL signaling. ApoA1 is a 28 kDa protein and recent studies from our lab have shown that it adopts a ‘double super-helix” conformation in nascent HDL (31). ApoA2, the second most abundant apolipoprotein, is less well studied and its impact on the development of atherosclerosis is controversial.

Like apoA1, apoA2 is synthesized in the liver. It circulates in plasma as a dimer of two chains linked by a disulfide bridge (32). In humans, the relationship between apoA2 levels and CVD is not well established. The effects of apoA2 in mouse models of atherosclerosis are controversial, with some studies suggesting a pro-atherogenic role for apoA2 while others suggest a beneficial role (33), (34). In vitro studies are just as inconclusive. For example, some cell culture experiments have suggested that apoA2 enhances movement of cholesterol from cells while other investigators have found that apoA2 has no effect on cholesterol transport (35), (36). These conflicting reports have been summed up in a review as “Apolipoprotein A-II, a protein in search of a function”

(37).

C) Reverse cholesterol transport

21 The atheroprotective property of HDL has classically been attributed to its role in reverse cholesterol transport (RCT). RCT involves the movement of cholesterol from peripheral tissues such as the artery wall, to the liver (38) (Figure I-4). Lipid free apoA1

(synthesized and secreted by the liver) interacts with the transmembrane cholesterol transporter ATP binding cassette transporter (ABCA1), which transfers cholesterol and phospholipid to apoA1 to generate nascent HDL (this step is often referred to as cholesterol efflux). Nascent HDL is a substrate for the enzyme lecithin cholesterol acyl transferase (LCAT), which esterifies the cholesterol to generate spherical HDL with a cholesterol ester core. The particle surface remains relatively devoid of cholesterol, which provides the gradient for driving additional cholesterol from cells into the HDL particle. Spherical HDL can pick up additional cholesterol by interacting with the membrane transporter ABCG1. HDL can be remodeled by hepatic lipase and endothelial lipase, which hydrolyze triglyceride and phospholipid respectively. Spherical HDL is transported to the liver, where it binds to the surface receptor scavenger receptor B1 (SR-

B1) and the cholesterol is transferred into hepatocytes in a process known as selective cholesterol transport. Alternatively, cholesterol ester transfer protein (CETP) can mediate the transfer of cholesterol ester from HDL to apoB containing lipoprotein particles (ex:

LDL), which subsequently transfer the cholesterol ester by binding to low density lipoprotein receptor. The cholesterol ester that is transferred to liver is secreted into the bile by ABCG5 and ABCG8 transporters and ultimately eliminated through the feces (39,

40).

D) Scavenger receptor B1 (SR-B1)

22 Scavenger receptor B1 (SR-B1) is a 509 amino acid, 82 kDa membrane protein that belongs to the CD36 superfamily of proteins (41, 42). SR-B1 is highly expressed in tissues that are involved in lipid metabolism, such as the liver and adrenal glands (43).

Other cell types are also known to express SR-B1, including macrophages and endothelial cells (44, 45). Like other scavenger receptors, SR-B1 binds a variety of ligands such as apoptotic cells, advanced glycation end-product modified proteins and anionic phospholipids (46, 47). Most research has focused on the role of SR-B1 as a physiologically relevant HDL receptor. SR-B1 binds HDL with high affinity and mediates the selective transfer of cholesterol ester, unesterified cholesterol and phospholipids from HDL into cells (48, 49). Several studies have confirmed the important role of SR-B1 in HDL metabolism (50). Hepatic overexpression of SR-B1 is associated with decreased plasma HDL levels due to its increased clearance (51). SR-B1 knock out mice and SR-B1 transgenic mice have demonstrated a protective role for SR-

B1 against the development of atherosclerosis (52, 53). The important role of SR-B1 in mediating both the cholesterol efflux and non-efflux activities of HDL contributes to its atheroprotective effect. Recent work by Mineo et al.and Li et al. has demonstrated that the anti-apoptotic role of HDL involves binding of HDL to SR-B1 and the subsequent activation of a survival kinase pathway, which results in the phosphorylation and activation of eNOS and the enhanced production of NO (54, 55).

E) Spherical HDL

A majority of plasma HDL is present as spherical HDL, which is formed upon esterification of cholesterol by LCAT. There are two kinds of spherical HDL—spherical

23 HDL that contains only apoA1 on its surface (sHDL A1) or spherical HDL that contains both apoA1 and apoA2 (sHDL A1/A2) (56). There are three apoA1 molecules on sHDL A1 while sHDL A1/A2 has two apoA1 molecules and two apoA2 molecules. Since apoA2 is more lipophilic than apoA1, sHDL A1/A2 is formed when two molecules of apoA2 displace one apoA1 from sHDL A1 (Figure I-5). The difference in function, if any, between sHDL A1 and sHDL A1/A2 is as yet unknown.

F) Non cholesterol efflux activities of HDL

Research over the last two decades has shown that the atheroprotective function of HDL extends beyond its ability to participate in RCT (57). HDL inhibits the oxidative modification of LDL, decreasing foam cell formation (58). HDL also carries anti-oxidant enzymes such as paraoxonase and platelet activating factor-acetyl hydrolase and serves as a sink for lipid hydroperoxides (59). Cell culture studies have demonstrated that addition of HDL can decrease generation of reactive oxygen species (41). HDL also demonstrates anti-inflammatory properties by decreasing the expression of adhesion molecules on the endothelial cell surface and inhibiting the migration of monocytes—both key events in the early stages of atherosclerosis (60), (61). The anti-inflammatory properties of HDL are also evident in vivo, where it decreases expression of adhesion molecules and chemokines. In mouse models of atherosclerosis, apoA1 or HDL administration reduces lesion size (62). Pre-treatment of human umbilical vein endothelial cells (HUVEC) with

HDL reduces TNF-ĮLQGXFHG9&$0-1 expression and inhibits the nuclear translocation of the VCAM-1 transcription factor NF-ț% (57, 61) (Figure 6). The anti-apoptotic effect of HDL in endothelial cells has also been well documented. When HUVEC are exposed

24 to serum starvation conditions, the level of apoptosis can be reduced significantly by prior treatment of HUVEC with physiological concentrations of HDL. The mechanism for this protective effect has been shown to involve binding of HDL to its physiological receptor SR-B1. The binding activates Src tyrosine kinase, which in turn activates PI3 kinase. PI3 kinase activates the survival kinases Akt and MAP kinase (MAPK) by phosphorylating them. Activated Akt and MAPK phosphorylate endothelial nitric oxide synthase (eNOS), which results in enhanced nitric oxide (NO) production and protects endothelial cells from apoptosis (54) (55) (Figure I-7).

LIPOPROTEIN OXIDATION IN ATHEROGENESIS

A) Myeloperoxidase

Myeloperoxidase (MPO) is a member of the heme peroxidase family of enzymes.

MPO generates numerous reactive oxidant species that promote lipid peroxidation as well as post-translational modification of proteins (63), (64). MPO is found primarily in neutrophils and monocytes and uses hydrogen peroxide as a substrate to generate both halogenating and nitrating intermediates (65). MPO is unique in its ability to use hydrogen peroxide (itself derived from NADPH oxidase, xanthine oxidase or uncoupled eNOS) and chloride to generate hypochlorous acid, the active component of bleach (66),

(67). This makes MPO an important part of the innate immune response. Human evidence suggests that MPO is also an important player in the development of atherosclerosis. Immunohistochemical analysis reveals that MPO is enriched in human atherosclerotic plaque (68), (69). Individuals with decreased MPO levels are protected from CVD (70) while high systemic levels of MPO predict the presence of angiographic

25 coronary artery disease and future risk of major adverse cardiac events (non-fatal myocardial infarction, need for revascularization and death) (71). Surprisingly, mouse models of atherosclerosis seemed to indicate that MPO had a beneficial role in atherosclerosis development. For example, the atherosclerosis prone apoE knock out mouse showed increased atherosclerosis when MPO was knocked out (72) . These results were ultimately explained by the fact that mouse atherosclerotic lesions did not have chloro-tyrosine, the specific oxidation product of MPO. Further, mouse leukocytes have

10-20 fold less MPO than human leukocytes (63). Thus, traditional mouse models of atherosclerosis are not the best tool to study the effects of MPO on plaque development.

In mouse models of acute inflammation, MPO knock-out provides a protective benefit

(73).

B) Mechanism of MPO mediated atherosclerosis development

Epidemiological studies consistently demonstrate that high levels of LDL are directly correlated with incidence of CVD. Further, therapeutic interventions that decrease plasma

LDL concentration reduce the incidence of CVD. However, native LDL does not accumulate in the artery wall because high intracellular concentrations of LDL downregulate the LDL receptor and inhibit the first step of cholesterol synthesis. Rather it is modified or oxidized forms of LDL that play a key role in atherosclerosis development.

MPO is active in plaque tissue as demonstrated by the enrichment of chloro-tyrosine (a specific marker for MPO catalyzed oxidation) in human atheroma compared to normal arteries (69). When LDL is trapped in the sub-endothelial space, it can be oxidized by

MPO to generate oxidized LDL, which is a high affinity ligand for macrophage

26 scavenger receptors such as CD36 (74), (75). As described previously, internalization of oxidized LDL and the subsequent accumulation of cholesterol within macrophages generates foam cells. Binding and internalization of oxidized LDL is not subject to a negative feedback loop, allowing for substantial cholesterol accumulation in macrophages.

Work from several groups has provided evidence for the role of MPO in generating oxidized HDL. Interest in HDL oxidation was sparked by the observation that CVD events can occur even when patients have normal HDL levels and that HDL isolated from patients with CVD have pro-inflammatory activities. HDL isolated from plasma as well as atherosclerotic plaque of patients with CVD has higher levels of the MPO oxidation products, chloro-tyrosine and nitro-tyrosine (76), (77). Further, the level of oxidation of apoA1 was 500 fold greater compared to other proteins, suggesting that apoA1 is preferentially oxidized by MPO in plaque (76). Immunohistochemical analysis has revealed that MPO co-localizes with HDL in plaque. Mass spectrometry has identified the specific residues on apoA1 that are susceptible to MPO mediated oxidation—these include tyrosine, tryptophan and methionine residues (77). The oxidation of HDL by

MPO also has functional consequences. Oxidative modification of HDL generates a particle that is less efficient at promoting ABCA1 dependent cholesterol efflux from macrophages and that has reduced capacity to activate LCAT (31, 77). This has given rise to the concept of “dysfunctional HDL”—HDL that loses its atheroprotective properties because of oxidative modification. Thus, considering both the quantity as well as the quality of HDL may provide a more accurate assessment of a person’s risk for CVD.

27 Tunica adventitia

Tunica media

Tunica intima

Figure I-1. The structure of an artery. An artery consists of three layers; the outermost layer is the tunica adventitia, the middle layer is the tunica media and the innermost layer of endothelial cells is the tunica intima. The tunica adventitia and tunica media are separated by an external elastic lamina while the tunica media and the tunica intima are separated by the internal elastic lamina.

28 Figure I-2. Rupture of the fibrous cap and thrombotic complications. Proteases secreted by activated macrophages weaken the fibrous cap, ultimately resulting in its rupture and the formation of a thrombus at the site of rupture. The thrombus can occlude the entire lumen, stopping blood flow suddenly to the heart and causing a myocardial infarction.

This figure was originally published in Journal of Lipid Research. Seimon, T., and Tabas,

I. Mechanisms and consequences of macrophage apoptosis in atherosclerosis. Journal of

Lipid Research. 2009; 50: S382-387. © American Society for Biochemistry and

Molecular Biology.

29 ABCG5G55 Cholesterol ABCG8G88 BilBilee

apoA1 SR-B1 IntestineIntestine

FecesFFececes

SR-B1

Figure I-3. Reverse cholesterol transport. The membrane transporter ABCA1 transfers cholesterol and phospholipid to lipid free apoA1, which forms a nascent HDL particle.

ABCG1 transfers cholesterol and phospholipid to more mature forms of HDL, including nascent HDL. Nascent HDL is an excellent substrate for the enzyme LCAT, which esterifies the cholesterol to form a spherical HDL particle with a cholesterol ester core.

Spherical HDL binds to SR-B1 on the surface of the liver and selectively transfers its cholesterol to the liver. The cholesterol is then secreted as bile into the intestine and finally eliminated in feces.

30 Figure I-4. Formation of spherical HDL. The cholesterol in nascent HDL is esterified by LCAT to form spherical HDL containing three apoA1 molecules on its surface. The apolipoprotein apoA2 is more lipophilic than apoA1 and two molecules of apoA2 can displace one molecule of apoA1 to generate spherical HDL that has both apoA1 and apoA2 on its surface.

This figure was originally published in Journal of Biological Chemistry. Clay, M.A. et al.

Journal of Biological Chemistry. 2000; 275: 9019-9025. © American Society for

Biochemistry and Molecular Biology

31 Figure I-5. VCAM-1 expression is controlled by the transcription factor NF-ț%

Under normal conditions, NF-ț%LVKHOGLQDQLQDFWLYHFRPSOH[E\,ț%8SRQVWLPXlation by TNF-ĮRURWKHUSUR-LQIODPPDWRU\ VLJQDOV WKH ,ț% LV SKRVSKRU\ODWHG E\ ,ț% NLQDVH

DQGWKLVOHDGVWRWKHGHJUDGDWLRQRI,ț%$FWLYH1)-ț%LVUHOHDVHGDQGWUDQVORFDWHVLQWR the nucleus, where it binds to NF-ț%FRQVHQVXVVHTXHQFHDQGDFWLYDWHVWUDQVFription of

VCAM-1.

32 Figure I-6. HDL signaling pathway. When HDL binds to its receptor SR-B1, it triggers a survival pathway that includes Akt and MAP kinase. These kinases phosphorylate endothelial nitric oxide synthase (eNOS), which activates it to produce nitric oxide (NO).

NO has an anti-apoptotic effect on endothelial cells.

This figure was originally published in the Journal of Biological Chemistry. Mineo, C. et al. Journal of Biological Chemistry. 2003; 278: 9142-9149. © American Society for

Biochemistry and Molecular Biology.

33 CHAPTER 2

Modification of High Density Lipoprotein by Myeloperoxidase Generates a Pro- inflammatory Particle

Part of this chapter was published as Undurti, A., Huang, Y., Lupica, J.A., Smith, J.D., DiDonato, J.A., Hazen, S.L. (2009) Modification of High Density Lipoprotein by Myeloperoxidase generates a pro-inflammatory particle. J. Biol. Chem; 284(45): 30825- 35

34 ABSTRACT

High density lipoprotein (HDL) is the major atheroprotective particle in plasma.

Recent studies demonstrate that myeloperoxidase (MPO) binds to HDL in vivo, selectively targeting apolipoprotein A1 (apoA1) of HDL for oxidative modification and concurrent loss in cholesterol efflux and lecithin cholesterol acyl transferase activating activities, generating a “dysfunctional HDL” particle. We now show that (patho) physiologically relevant levels of MPO-catalyzed oxidation result in loss of non cholesterol efflux activities of HDL including anti-apoptotic and anti-inflammatory functions. One mechanism responsible is shown to involve loss of modified HDL binding to the HDL receptor, scavenger receptor B1, and concurrent acquisition of saturable and specific binding to a novel unknown receptor independent of scavenger receptors CD36 and SR-A1. HDL modification by MPO is further shown to confer pro-inflammatory gain of function activities as monitored by NF-ț% activation and surface vascular cell adhesion molecule (VCAM-1) levels on aortic endothelial cells exposed to MPO- oxidized HDL. Loss of non-cholesterol efflux activities and gain of pro-inflammatory functions requires modification of the entire particle and can be recapitulated by oxidation of reconstituted HDL particles comprised of apoA1 and non-oxidizable phosphatidylcholine species. Multiple site-directed mutagenesis studies of apoA1 suggest that the pro-inflammatory activity of MPO-modified HDL does not involve methionine, tyrosine, or tryptophan, oxidant sensitive residues previously mapped as sites of apoA1 oxidation within human atheroma. Thus, MPO catalyzed oxidation of HDL results not only in loss of classic atheroprotective reverse cholesterol transport activities of the

35 lipoprotein, but also both loss of non-cholesterol efflux related activities and gain of pro- inflammatory functions.

36 INTRODUCTION

High density lipoprotein (HDL) is a complex mixture of cholesterol carrying lipoprotein particles built upon a predominantly apolipoprotein A1 (apoA1) backbone.

HDL is currently thought to function primarily in mediating reverse cholesterol transport

(RCT), the net transport of cholesterol from peripheral tissues to the liver for ultimate elimination into the intestinal lumen as biliary cholesterol for excretion in feces (38).

RCT involves multiple biochemical processes, including both lipid poor apoA1 and HDL serving as acceptors of cholesterol efflux from peripheral cholesterol loaded cells, maturation of HDL from a nascent relatively cholesterol poor particle, into a cholesterol- laden spherical form through interaction with lecithin cholesterol acyl transferase

(LCAT), and delivery of cholesterol to liver and steroidogenic tissues through the HDL receptor, scavenger receptor B1 (SR-B1) (40).

While the RCT related functions of apoA1 and HDL are thought to primarily account for both the atheroprotective activity and the strong inverse association of HDL cholesterol and apoA1 levels and cardiovascular risks, other non cholesterol efflux related activities have also been identified and thus potentially contribute to the protective functions of HDL (57). For example, early seminal studies by Chisolm and colleagues showed anti-inflammatory properties of HDL where the cytotoxicity of oxidized low density lipoprotein for vascular endothelial cells and smooth muscle cells in culture could be prevented by HDL (78). Subsequent studies by Fogelman and colleagues have considerably extended upon these findings, including early demonstration that the anti- inflammatory function of HDL may become pro-inflammatory during the acute phase response (79), such as during acute influenza A infection (80). HDL shows anti-

37 inflammatory activities when incubated with cultured vascular endothelial cells activated by cytokines (61), and bolus infusion of HDL promotes anti-inflammatory effects in vivo, such as in a porcine model of acute inflammation (81). More recent studies have demonstrated a critical role for SR-B1 binding of HDL in mediating many anti- inflammatory and anti-apoptotic activities of HDL via initiation of a cascade of downstream signaling pathways involving activation of both Akt and MAP kinases, and eventual endothelial nitric oxide synthase (eNOS) activation (54, 55).

Since the initial findings of Van Lenten and colleagues (79), a growing body of data supports the notion that both acute phase responses and chronic inflammatory conditions, including cardiovascular disease (CVD), can render HDL “dysfunctional” or

“pro-inflammatory”, lacking in biological activities important in RCT (82, 83). HDL isolated from patients with CVD or chronic inflammatory disorders are less effective at preventing LDL induced monocyte migration in vitro (84). Recent studies have extended such observations to direct in vivo measures of RCT, demonstrating that inflammation impairs reverse cholesterol transport in murine models of endotoxemia (85).

One potential mechanism that may contribute to impairment in HDL function during inflammation and CVD is oxidative modification of the particle by myeloperoxidase (MPO). Zheng and colleagues first discovered that MPO, a leukocyte derived heme protein implicated in atherosclerosis, binds to HDL via a specific binding domain on apoA1, promoting selective targeting of the lipoprotein in human plasma and atherosclerotic plaque for oxidative modification and resultant loss of cholesterol efflux function (76, 77). Independent studies have confirmed these observations (86, 87) as well as shown that site-specific oxidative modification of apoA1 within nascent HDL

38 may inhibit the ability of the particle to activate LCAT, a critical process in HDL particle maturation and presumably the overall RCT pathway (88, 89).

Thus far, the functional consequences of MPO-mediated oxidative modification of HDL have only been linked to inhibition in the classic atheroprotective functions of the particle, namely, inhibition in cholesterol efflux activity and LCAT activation. The impact of MPO-catalyzed oxidation of HDL on alternative processes critical to RCT such as SRB1 interaction and non cholesterol efflux related activities of the particle remains unknown. Herein we show that apoA1 oxidation by the MPO/hydrogen peroxide (H2O2)/ chloride (Cl-) system at levels comparable to those observed within apoA1 recovered from human atheroma results in total ablation of HDL-mediated anti-apoptotic and anti- inflammatory activities through a mechanism involving loss of SR-B1 binding. We further show that MPO-dependent modification of HDL confers pro-inflammatory activities to the intact particle, but not individual components of HDL, resulting in vascular endothelial cell activation as monitored by both NF-ț% activation and Vascular

Cell Adhesion Molecule (VCAM-1) up-regulation and enhanced surface protein expression. Pathophysiological levels of MPO-catalyzed oxidation of HDL confers acquisition of saturable and specific binding activity to an unknown receptor(s) distinct from classic scavenger receptors (SR-B1, CD36 and SR-A1) on multiple primary and immortalized endothelial cells.

39 MATERIALS AND METHODS

MPO, HDL and apoA1 isolation, preparation and characterization

MPO was purified from detergent extracts of human leukocytes by lectin affinity

and gel filtration chromatography, as described previously (73). HDL (1.063 < d < 1.21)

was isolated by sequential ultracentrifugation from human plasma obtained from the

Blood Bank of the Cleveland Clinic as described previously (90). HDL was extensively

dialyzed against 20mM VRGLXP SKRVSKDWH ȝ0 ('7$ SH 7.4 and stored at 4°C.

Human apoA1 was isolated from plasma of healthy donors after delipidation of HDL and

separation on a Q sepharose HP HiLoad 26/10 column (GE Healthcare, Piscataway, New

Jersey, USA), as described previously (91), (92). Recombinant human apoA1 was

generated in an E coli expression system and isolated by sequential column

chromatographies as described (31). ApoA1 was dialyzed against 20mM sodium

SKRVSKDWHS+ȝ0('7$5HFRQVWLWXWHGQDVFHQW+'/ U+'/ ZDVSUHSDUHGXVLQJ sodium cholate dialysis method (93) and stable isotope dilution mass spectrometry confirmed a particle with a molar ratio similar to the starting composition of 100:10:1, 1- palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC): cholesterol: apoA1, and <0.1% residual cholate. rHDL particle size was characterized by native gel electrophoresis and dual beam light scattering, confirming a 96A particle size. Biological materials isolated from blood of healthy donors (e.g. MPO, HDL, apoA1) were performed under protocols approved by the Cleveland Clinic Institutional Review Board, and all participants gave written informed consent.

MPO modification of HDL and apoA1

40 MPO mediated modification of HDL and aSR$ ZDV FDUULHG RXW ZLWK ȝ0 protein in 20mM sodium phosphate buffer pH 7.4 containing 100mM sodium chloride

(Cl-) ȝ0 diethylenetriamine pentaacetic acid (DTPA), 60nM MPO as described previously (77 7KHUHDFWLRQZDVLQLWLDWHGE\DGGLQJȝ0K\GURJHn peroxide (H2O2)in three aliquots at 15 minute intervals (modification ratio of 1:10 between protein and hydrogen peroxide). The reaction was incubated at 37°C for a total of 90 min. A 100 fold excess of L-methionine was added to quench the reaction. The modified lipoprotein was stored at 4°C. Where indicated, one of the components of the oxidation system was

- omitted (-MPO, -H2O2,-Cl) as an oxidation control.

Determination of chloro-tyrosine (ClTyr) content

Protein bound chloro-tyrosine (ClTyr) was quantified by stable isotope dilution

HPLC with on-line electrospray ionization tandem mass spectrometry using an API 4000 triple quadrupole mass spectrometer (Applied Biosystems, Foster, CA) interfaced with a

Cohesive HPLC (Franklin, MA) with Ionics redesigned source as upgrade (73). Briefly, synthetic [13C6] labeled standards were added to an aliquot of non-modified and MPO modified HDL and used as internal standards for quantification of natural-abundance analytes. Simultaneously, a universal labeled precursor amino acid, [13C9, 15N1 tyrosine] was added. Lipoproteins were hydrolyzed in methane sulfonic acid and then passed over mini solid phase C18 columns (Supelclean DSC-18LT minicolumn, 3 ml, Supelco,

Pennsylvania, USA). Results were normalized to the precursor tyrosine. Artificial formation of chloro [13C9, 15N1] tyrosine was monitored routinely and was negligible.

41 Mice and isolation of mouse peritoneal macrophages (MPMs)

All animal studies were approved by the Institutional Animal Care and Utilization

Committee of Cleveland Clinic. All mice used were on a C57Bl6/J background and maintained on normal chow. CD36 knock-out (KO), SR-A1 KO and CD36/SR-A1 double knock out (DKO) mice were generously provided by Dr. Maria Febbraio

(Cleveland Clinic). Mouse peritoneal macrophages (MPMs) were elicited by thioglycollate injection as previously described (94). MPMs were cultured in RPMI with

10% fetal bovine serum overnight and non-adherent cells were removed by washing.

Determination of cholesterol efflux activity

Cholesterol efflux was determined as previously described (95). Briefly,

5$:FHOOVLQZHOOSODWHVZHUHORDGHGZLWKȝ&LPO>3H] cholesterol overnight in 1% FBS DMEM media. The next day, ABCA1 expression was induced with 8-bromo- cyclic adenosine monophosphate (8-Br-cAMP) for 16 h. The day after induction,

5ȝJPO+'/ȝJPO+'/H[SRVHGWRWKHFRPSOHWH032R[LGDWLRQV\VWHPRUȝJPO

HDL incubated with the indicated components of the oxidation system, were added to each well with or without 8-Br-cAMP. After 6 h incubation at 37°C, the medium was removed, centrifuged and counted. The cells were extracted with hexane/isopropanol

(3:2) and radioactivity counted as a measure of cholesterol retained within the cell. The percent cholesterol efflux was calculated as the radioactivity in the medium divided by total radioactivity (medium radioactivity plus cell radioactivity).

Determination of LCAT activating activity

42 The activation of LCAT by rHDL or MPO oxidized rHDL spiked with trace

amounts of [3H] cholesterol was measured as described previously (88). The reaction

PL[WXUHFRQWDLQHGȝJFKROHVWHUROLQP0SKRVSKDWHS+P0('7$P0

NaCl, 0.6% fatty acid free bovine serum albumin and 20ng of purified 6x Histidine

tagged human LCAT. Reactions were carried out in triplicate at 37°C for 35 min. LCAT

activity was determined by calculating the conversion efficiency of [3H] cholesterol to

[3H] cholesteryl ester after lipid extraction of the reaction mixture and subsequent thin-

layer chromatography.

Apoptosis assays

Human umbilical vein endothelial cells (HUVEC) were serum deprived for 6 h

ZLWKVLPXOWDQHRXVLQFXEDWLRQZLWKȝJSURWHLQPO+'/RUȝJSURWHLQPOR[LGL]HG

HDL. Where indicated, individual components (lipids extracted by Bligh-Dyer method

(96), delipidated apoA1 or POPC small unilamellar vesicles) were added. After 6 hours, apoptosis was measured with an annexin V-FITC apoptosis detection kit (BD

Pharmingen, Franklin Lakes, New Jersey, USA) or APO-BRDU kit (BD Biosciences,

New Jersey, USA). Flow cytometry of labeled cells was performed on a FACScan. An alternate endothelial cell type, bovine aortic endothelial cells (BAEC) and an alternate apoptogenic trigger, UV irradiation (254nm, 12.4 watts, for 10 min), were used where indicated. Caspase-3 activity, in HUVEC that were deprived of serum for 24 h, was determined as described previously (55).

Determination of surface VCAM-1 protein levels

43 Surface VCAM-1 protein levels were determined in HUVEC (TNF-Į LQGXFHG

VCAM-1) and BAEC (no TNF-ĮDGGLWLRQ &HOOVZHUHLQFXEDWHGZLWKȝJSURWHLQPO

RI+'/ȝJSURWHLQPOR[LGL]HG+'/RUZKHUHLQGLFDWHGLQGLYLGXDOSURWHLQDQGOLSLG components for 6 h. After three washes with PBS, cells were fixed in 4% paraformaldehyde on ice for 30 min. Surface VCAM-1 protein was determined using anti-VCAM-1 primary antibody (Santa Cruz Biotechnology, California, USA) with sheep anti-mouse HRP (GE Healthcare, Piscataway, New Jersey, USA) as secondary antibody, detection by SureBlue TMB Peroxidase substrate (KPL, Gaithersburg, Maryland, USA) and measuring absorbance at 450 nm on a 96 well plate reader (Spectramax 384 Plus,

Molecular Devices, Sunnyvale, California) after addition of 1M hydrochloric acid (HCl) to stop the reaction.

eNOS activity assay

Conversion of tritium labeled arginine (GE Healthcare, Piscataway, New Jersey,

USA) to citrulline was used as a measure of eNOS activity. HUVEC were treated with the indicated protein concentrations of HDL or oxHDL for 10 min and the media collected and spun down to pellet debris. Arginine and citrulline separation was achieved by high performance liquid chromatography (HPLC) and the [3H] citrulline peak was

quantified by liquid scintillation counting.

Electrophoretic mobility shift assay (EMSA)

BAEC were treated with HDL or oxidized HDL for 6 h and NF-ț%DFWLYDWLRQLQ

whole cell extracts was determined by electrophoretic mobility shift assay (EMSA) with

44 supershift detected using antibody specific to p65 subunit of NF-ț% (97). ,ț% NLQDVH

(IKK) activity was determined by immunoprecipitation of the IKK complex using IKKJ antibody, followed by performance of a kinase assay using recombinant GST-INB-D (1-

54) and 32P-ATP as substrates, as described previously (98). As an additional specificity control, recombinant mutant GST-INB-D where serines 32 and 36 were mutated to alanine was generated and used as substrate.

Iodination of HDL

HDL was iodinated with 1mCi Bolton-Hunter reagent (Perkin Elmer, Waltham,

Massachusetts, USA) to a specific activity of 200 dpm/ng protein as per manufacturer’s instructions. Briefly, the vial containing the Bolton-Hunter reagent was pre-cooled and brought to dryness under a gentle stream of nitrogen. HDL was added to the pre-cooled vial in 20mM sodium phosphate buffer, pH 8-8.5 and incubated overnight at 4°C. The next day, unreacted reagent was separated on a 30 ml Econo-Pac 10 DG disposable column (Bio-Rad, Hercules, California, USA) and 0.5 ml aliquots were collected. The aliquots were counted and pooled and trichloro acetic acid (TCA) precipitation was used to determine percent of radioactive label that was protein bound. The iodinated HDL was subsequently oxidized by MPO as described previously (77).

SR-B1 specific binding assay of HDL and MPO-oxidized HDL

Binding to SR-B1 was assessed as described previously (49). Human embryonic kidney (HEK 293T) cells transfected with SR-B1 or control pCGCG vector (99) were incubated with radiolabeled HDL or oxidized HDL for 1.5 h at 4°C. Binding to wild-type

45 and knock-out MPMs was performed as described previously (75). Specific binding was calculated as total binding minus binding in the presence of 30 fold excess of unlabeled

HDL (non-specific binding). Competition binding experiments with [125I]-oxidized HDL isolated from plasma and oxidized rHDL synthesized with the pan Trp->Phe mutant apoA1 were performed at 30-fold molar excess of the unlabeled ligands.

Statistical analysis

All experiments were performed at least three times. Results are reported as means r standard error of at least triplicate determinations. Student’s two-tailed t-test was used for statistical analyses and p < 0.05 was considered significant. Multiple comparisons were performed using ANOVA. Non-linear regression was used to fit binding curves with GraphPad Prism 5.0 software.

46 RESULTS

HDL oxidative modification by (patho) physiologically relevant levels of the MPO-

- H2O2-Cl system inhibits the efflux and LCAT activating activity of the lipoprotein.

In initial studies, we sought to test the hypothesis that HDL oxidation by (patho)

- physiologically relevant levels of the MPO-H2O2-Cl system resulted in loss of anti- apoptotic activity concurrent with loss of classic cholesterol efflux and LCAT activation properties of the particle. To do so we first exposed isolated human HDL to the MPO

- oxidant system and confirmed that exposure to the complete MPO-H2O2-Cl system resulted in loss of HDL-dependent cholesterol efflux activity when the modified lipoprotein was incubated with cholesterol-loaded macrophages (Fig. II-1A), as well as inhibition of LCAT catalyzed cholesteryl ester formation (Fig. II-1B). MPO is the only known enzyme in mammals capable of generating chlorinating oxidants, enabling quantification of protein bound chlorotyrosine levels (ClTyr) to serve as a specific

“dosimeter” of exposure to MPO-mediated oxidation in vivo (100). The specificity of

ClTyr as a post translational modification of proteins formed by MPO-generated chlorinating oxidants has been confirmed in multiple models of inflammation using MPO knockout mice (73), with human MPO transgenic mice (101), and in studies employing neutrophils from MPO deficient human donors (102). We therefore quantified ClTyr levels in the MPO-oxidized HDL preparations and confirmed that the degree of oxidation produced in vitro (Fig. II-1C) is comparable to levels previously observed in apoA1 recovered from human atherosclerotic aortic tissues, where ClTyr levels as high as 25 mmol ClTyr/mol Tyr have been observed (76). Functional impairment in HDL mediated cholesterol efflux and LCAT activity, and parallel increases in HDL apoA1 ClTyr

47 content, showed an absolute requirement for the presence of each of the components of

- the oxidation system (MPO, H2O2, Cl ) since eliminating any one of the components inhibited ClTyr production and functional impairment in the classic cholesterol transporting functions of HDL (Fig. II-1). For all subsequent functional characterization studies described below for HDL exposed to MPO-catalyzed oxidation, the oxidized

HDL preparations (oxHDL) used were first similarly characterized by mass spectrometry to confirm the degree of oxidation was pathophysiologically relevant (as indicated by levels of ClTyr within range observed for apoA1 recovered from human arterial tissues), and to be accompanied by significant impairment in cholesterol efflux and LCAT activating activities.

HDL oxidative modification by (patho) physiologically relevant levels of the MPO-

- H2O2-Cl system inhibits the anti-apoptotic activity of the lipoprotein.

Human umbilical vein endothelial cells (HUVECs) undergo apoptosis upon serum deprivation and previous studies have shown that isolated human HDL, but not LDL, inhibits serum starvation induced endothelial cell apoptosis (103). In cells that were serum deprived for 6 h, the level of apoptosis as measured by both annexin staining (Fig.

II-2A) and TUNEL (Fig. II-2B) increased nearly 3 fold. As expected, simultaneous incubation with ȝJSURWHLQ/ml isolated HDL markedly reduced the level of endothelial cell apoptosis. In contrast, the same concentration of MPO-oxidized HDL (oxHDL) was ineffective at preventing HUVEC apoptosis (Fig. II-2A, II-2B). Further, anti-apoptotic activity required the presence of the intact native particle since co-incubation of

48 comparable levels of isolated human plasma derived apoA1 and liposomes generated from HDL lipids failed to promote anti-apoptotic effect (Fig. II-2).

Since plasma HDL is a heterogeneous group of lipoproteins (104) with varying lipid composition, we next sought to identify the components of the lipoprotein involved in the anti-apoptotic activity. Reconstituted nascent HDL (rHDL) was prepared using human apoA1 (isolated from plasma) as the sole protein and the relatively oxidant resistant lipid 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) as the sole phospholipid. Exposure of serum starved HUVEC to 500ȝJ SURWHLQPO U+'/ recapitulated the anti-apoptotic activity observed with isolated human plasma derived

HDL, demonstrating that an intact particle comprised of only apoA1 and a relatively non- oxidizable phosphatidylcholine molecular species is all that is needed for facilitating the anti-apoptotic activity of HDL (Fig. II-2). Interestingly, oxidation of rHDL with MPO resulted in the loss of the anti-apoptotic effect (Fig. II-2A, II-2B). Similar behavior for rHDL vs. oxrHDL and loss of macrophage cholesterol efflux activity, and LCAT activation, were also observed (data not shown). The similar anti-apoptotic activity of plasma HDL and rHDL, but not with isolated apoA1 or HDL lipid liposomes, highlights the importance of the structural integrity of HDL for its anti-apoptotic activity, as well as the likelihood that oxidation of the protein (apoA1) and not lipid component of rHDL is responsible for ablating the anti-apoptotic effect.

To further explore the generality of these observations, the anti-apoptotic activity of isolated human HDL verses MPO-generated oxHDL were examined using multiple distinct endothelial cells (HUVECs, bovine aortic endothelial cells (BAECs) and human aortic endothelial cells (HAECs) to alternative apoptogenic triggers. Ultraviolet light

49 exposure is a classic apoptogenic trigger. When each of the endothelial cell lines were irradiated with 254 nm UV light, a nearly 10 fold increase in apoptosis was observed,

ZKLFK ZDV PDUNHGO\ DWWHQXDWHG E\ FRQFRPLWDQW DGGLWLRQ RI ȝJ SURWHLQPO LVROated human HDL. In contrast, neither MPO generated oxHDL nor the individual components of native HDL (isolated lipid poor apoA1 or liposomes produced from HDL extracted lipids) reduced the rate of apoptosis significantly (Fig. II-2C, II-2D; data for only

HUVECs and BAECs shown).

HDL modified by MPO loses its capacity to inhibit caspase activation and to activate endothelial nitric oxide synthase activity

One of the mechanisms that accounts for the anti-apoptotic effect of HDL is its ability to inhibit caspase-3 activation, the terminal caspase that mediates proteolytic cleavage of key cellular proteins (55). Since pathophysiologically relevant levels of

MPO-catalyzed oxidation of HDL causes the lipoprotein to lose its anti-apoptotic activity, we decided to measure the ability of native vs. MPO-oxidized HDL to inhibit caspase-3 activation. Under serum starvation conditions, HDL inhibited caspase-3 activation while

HDL modified by the complete MPO oxidation system failed to inhibit caspase-3 activity

(Fig. II-3A). Previous investigations have also shown that the mechanism whereby HDL exerts anti-apoptotic activity originates with HDL binding to its receptor, SR-B1, followed by activation of signaling pathways involving the survival kinases Akt and

MAPK, which phosphorylate and activate eNOS (54). Activation of eNOS results in simultaneous production of nitric oxide, which is protective against apoptosis, and the co- product citrulline. We therefore next examined the ability of native HDL vs. oxHDL to

50 activate eNOS. [3H] citrulline production from tracer levels of [3H] arginine was used as a means of gauging the activity level of eNOS following exposure of HUVEC to HDL versus HDL exposed to the MPO oxidant system. As expected, HDL treatment of

HUVEC lead to activation of eNOS as indicated by the increased conversion of arginine to citrulline (Fig. II-3B). In contrast, endothelial cell exposure to oxHDL failed to induce eNOS activation (Fig. II-3B). Inhibition of both caspase-3 and eNOS activation by oxHDL was only seen upon incubation with HDL exposed to the complete MPO-H2O2-

Cl- system since omission of any individual component permitted HDL to retain its anti- apoptotic activity.

MPO dependent oxidation of HDL inhibits the anti-inflammatory properties of the particle as monitored by inhibition in TNF-ĮLQGXFHGYDVFXODUFHOODGKHVLRQPROHFXOH

(VCAM-1) protein expression in endothelial cells

VCAM-1 is involved in the development of atherosclerosis by mediating the migration and extravasation of leukocytes across the vascular endothelium (105, 106).

HDL is reported to inhibit VCAM-1 expression in endothelial cells (78) in an SR-B1 specific manner (107). We hypothesized that MPO-dependent oxidative modification of

HDL may inhibit this anti-inflammatory and atheroprotective activity of HDL. When activated with TNF-Į+89(&VXUIDFH9&$0-1 protein levels increased 3 fold (Fig. II-

4A). HDL pre-WUHDWPHQW ȝJSURWHLQPO UHVXOWHGLQDVLJQLILFDQWGHFUHDVHLQ71)-Į stimulated surface VCAM-1 protein (Fig. II-4A), attesting to the anti-inflammatory actions of the lipoprotein. Remarkably, incubation of endothelial cells with MPO- oxidized HDL did not inhibit, but rather, further enhanced TNF-Į LQGXFHG 9&$0-1

51 protein expression in HUVEC, with the surface VCAM-1 level increasing nearly 5 fold.

The marked increase in TNF-Į LQGXFHG 9&$0-1 protein expression promoted by co- incubation of HDL modified by MPO required the complete MPO oxidant system since elimination of any one of the components during the oxidation reaction (-MPO, -H2O2,-

Cl-), failed to confer pro-inflammatory activity to the particle (Fig. II-4A).

- Exposure of HDL to the MPO-H2O2-Cl system confers a pro-inflammatory gain of function activity to the modified particle

The increased VCAM-1 surface expression noted on endothelial cells exposed to oxHDL beyond levels observed with TNF-Į DFWLYDWLRQ VXJJHVWHG WKDW R[+'/ PD\ activate endothelial cells independent of TNF-Į VWLPXODWLRQ 7R WHVW WKLV K\SRWKHVLV

BAECs were cultured in media supplemented with increasing concentrations of either

HDL or MPO generated oxHDL in the absence of cytokine agonists and surface levels of

VCAM-1 protein determined. (For reference, normal plasma levels of apoA1 are 1200-

ȝJSURWHLQP/ ([SRVXUHWRR[+'/LQGXFHGRYHUD-fold increase in endothelial cell surface VCAM-1 protein within 6 h while exposure to native HDL failed to increase surface VCAM-1 protein (Fig. II-4B). OxHDL-induced increase in surface VCAM-1 protein was dose-dependent (Fig. II-4B), and required HDL modification by the complete oxidation system to confer the pro-inflammatory activity to the lipoprotein (Fig. II-4C).

Similar to the cholesterol efflux, LCAT activating, anti-apoptotic and anti-inflammatory activities of HDL, the newly acquired pro-inflammatory activity of oxHDL was only observed with a structurally intact lipoprotein particle, and could be recapitulated with

52 reconstituted HDL particles generated with non-oxidizable phospholipid species, but not

oxidation of either lipid poor apoA1 or HDL lipids (Fig. II-4D).

MPO modified HDL activates endothelial cell NF-ț% LQ %$(& DQG LQGXFHV WKH

SKRVSKRU\ODWLRQRI,ț%Į

VCAM-1 expression is strongly influenced by the transcription factor NF-ț%

(108). Previous studies have demonstrated that HDL can inhibit TNF-Į LQGXFHG

activation of NF-ț% (60). We therefore next tested the hypothesis that exposure of

BAECs to oxHDL induces NF-ț%DFWLYDWLRQ:KLOHLQFXEDWLRQRI%$(&ZLWK+'/GLG

not activate NF-ț%WUHDWPHQWZLWK032-oxidized HDL induced NF-ț%DFWLYDWLRQLQD

time dependent manner (from between 1 h to 6 h of oxidized HDL exposure), as

determined by EMSA (Fig. II-5A). Also, immunoblot analysis revealed phosphorylation

RI,ț%ĮRQ,ț%FRQVHUYHGVHULQHUHVLGXHVDQGDKDOOPDUNRI,..DFWLYLW\ZKLFKLV immediately upstream of NF-ț% DFWLYDWLRQ (109) (Fig. II-5A). To verify that the

DNA:protein complex was indeed NF-ț%DQDQWLERG\VSHFLILFWRWKHSVXEXQLWRI1)-

ț%ZDVXVHGDQGGHPRQVWUDWHGDµVXSHU-shift’ while an irrelevant control IgG antibody did not (Fig. II-5A). MPO generated oxHDL induced NF-ț% DFWLYDtion required the

- complete oxidation system; when MPO, H2O2 or Cl was eliminated during the oxidation

reaction, the HDL failed to be oxidized and did not activate NF-ț% )LJ II-5B). IKK

antibody-specific immuno-SXOOGRZQ FRXSOHG NLQDVH DVVD\V XVLQJ ,ț%Į Ds a specific

substrate for IKK demonstrated that oxidized HDL treatment of BAEC activates the IKK

complex (Fig. II-5C).

53 Mechanism of loss of anti-apoptotic and anti-inflammatory activities of oxHDL involves loss of binding to the HDL receptor, scavenger receptor B1 (SR-B1)

SR-B1 is the physiologic HDL receptor (48). Previous studies have shown that

HDL binding to SR-B1 is a prerequisite step in the signaling cascade that leads to phosphorylation and activation of eNOS, inhibition of caspase-3 and subsequent anti- apoptotic activity of HDL (54, 55). SR-B1 binding has also been shown to mediate the anti-inflammatory activities of the particle (110). We hypothesized that a possible mechanism accounting for loss of anti-apoptotic and anti-inflammatory activities of MPO generated oxHDL could be loss of binding to SR-B1, thus accounting for why the modified particle no longer could turn on the survival pathway that protects endothelial cells from apoptosis, or activate eNOS. Consistent with this notion, binding studies in

293T cells transfected with SR-B1 showed that HDL binds to SR-B1 in a saturable and specific manner, whereas HDL modified by (patho)physiologic levels of MPO-catalyzed oxidation can no longer bind to SR-B1, even at high concentrations (Fig. II-6A).

Oxidized HDL acquires saturable and specific binding activity to endothelial cells via a receptor(s) independent of the scavenger receptors CD-36 and SR-A1

While the loss of SR-B1 binding could account for the loss of anti-apoptotic and anti-inflammatory activities of oxidized HDL, it does not satisfactorily explain the gain of pro-inflammatory function observed with MPO-modified HDL. Interestingly, despite loss of SR-B1 binding activity, oxHDL demonstrated saturable and specific binding to endothelial cells, consistent with recognition by an alternative receptor(s) (Fig. II-6B).

We hypothesized that the scavenger receptors CD36 and SR-A1, pattern recognition

54 receptors with broad ligand specificity, may facilitate the observed specific binding of oxHDL to endothelial cells. This was a particularly attractive hypothesis since these scavenger receptors have been linked to both recognition of modified lipoproteins and the pathogenesis of atherosclerosis (11, 111). However, binding studies with MPO-generated oxHDL and mouse peritoneal macrophages excluded a potential role for either CD36 or

SR-A1 as a receptor for the modified particle since the absence of each receptor individually (Kd for binding of oxHDL to CD36 knock out (KO) macrophages was 42 ±

 ȝJPO DQG .G IRU ELQGLQJ RI R[+'/ WR 65-A1 KO macrophages was 30 ± 8.2

ȝJPO DVZHOODVLQFRPELQDWLRQLQFHOOVUHFRYHUHGIURPWKHGRXEOHNQRFNRXWIDLOHGWR alter the observed saturable and specific binding of oxHDL to cells (Fig. II-7A, II-7B).

Methionine, tyrosine and tryptophan residues identified as targets for MPO-catalyzed oxidation of HDL in vivo do not appear to participate in oxHDL binding to endothelial cells

In a final series of studies, we sought to identify potential residues on apoA1 within nascent HDL that may participate in the acquisition of saturable and specific binding to endothelial cells upon exposure to MPO-generated halogenating oxidants.

MPO-generated halogenating oxidants can potentially modify any amino acid residue via amide bonds and susceptible groups on side chains, including Cys, Met, Trp, His, Lys,

Arg, and Gln. Multiple site-specific oxidative modifications to apoA1 that occur within human atherosclerotic plaque have been extensively mapped through proteomics studies

(77), (112). While the inventory of residues targeted for oxidation in vivo is by no means complete, we hypothesized that one or more of the residues already identified as targets

55 of oxidation through in vitro and in vivo studies may participate in the acquisition of

saturable and specific binding upon HDL oxidation. To test this hypothesis, we examined

the binding characteristics of reconstituted nascent HDL (rHDL) generated with distinct

site-directed mutant forms of apoA1. In addition to recombinant wild type (Wt) human

apoA1 as control, three mutants were prepared for study: one in which all four tryptophan

residues (Trp 8, 50, 72 and 108) are converted to phenylalanine (4WF); a second in

which all 3 methionines residues (Met 86, 112 and 148) are converted to valine (3MV);

and third in which all 7 tyrosine residues are converted to phenylalanine (7YF).

Cholesterol efflux studies with equivalent levels of Wt apoA1 versus each of these

LQGLYLGXDOPXWDQWIRUPVRIDSR$ WKHDPRXQWRIOLSLGIUHHDSR$XVHGȝJPOZDV chosen based on the concentration curve in Figure II-8A) showed the lipid free protein possessed comparable cholesterol efflux activity (Fig. II-8B). Upon exposure to the

- MPO-H2O2-Cl system, the pan Trp->Phe mutant demonstrated resistance to oxidative

inactivation of cholesterol efflux activity as previously reported (49), whereas each of the

alternative mutant forms showed similar sensitivity as Wt for MPO-dependent oxidative

functional inactivation (Fig. II-8B), consistent with prior published observations (95). As

expected, both Wt and all rHDL forms containing the site-directed mutant forms of

apoA1 did not show VCAM-1 activation upon incubation with endothelial cells in the

non-oxidized form. Interestingly (unfortunately), upon MPO-catalyzed oxidation, all of

the rHDL generated with mutant apoA1 behaved similarly to Wt rHDL, promoting

endothelial cell surface expression of VCAM (Figure II-8C). In a final series of studies

we sought to confirm that VCAM up-regulation induced by binding oxHDL vs. oxidized

mutant forms of rHDL occurred via the same potential receptor. Competition binding

56 studies were therefore performed within BAEC. Binding of [125I] oxHDL was substantially inhibited in the presence of a 30-fold molar excess of non-labeled oxidized pan Trp->Phe mutant rHDL (Figure II-8D), indicating binding of the two oxidized lipoproteins occurs via the same receptor(s). Collectively, these studies suggest that methionines, tyrosines, and tryptophans, residues identified as targets for MPO-catalyzed oxidation in vivo, do not participate in the acquisition of pro-inflammatory gain of function phenotype conferred to HDL following exposure to (patho) physiological levels

- of the MPO-H2O2-Cl system.

57 DISCUSSION

Taken together, the present studies show that the biological consequence of MPO- catalyzed oxidation of HDL extends well beyond the classic RCT related activities of cholesterol efflux and LCAT activation. New insights shown into how MPO catalyzed oxidation of HDL affects the non cholesterol efflux activities of the lipoprotein include:

(i) the discovery that oxidation of HDL by MPO to pathophysiologically relevant levels results in loss of binding to the HDL receptor SR-B1; (ii) the discovery that loss of oxHDL binding to SR-B1 ultimately results in loss of ability of oxHDL to activate eNOS and inhibit caspase-3 and is the mechanism contributing to the loss of anti-apoptotic activity of the lipoprotein; (iii) the discovery that pathophysiologically relevant levels of

MPO catalyzed oxidation of HDL generates a particle that not only loses its anti- inflammatory activity but also gains a pro-inflammatory function as monitored by endothelial cell VCAM-1 protein up-regulation and NF-ț% DFWLYDWLRQ YLD DFWLYDWLRQ RI the IKK complex; (iv) the demonstration that the mechanism underlying the gain of function pro-inflammatory activity of oxHDL is acquisition of saturable and specific binding to an as yet unrecognized receptor(s) that is distinct from the scavenger receptors

CD36 and SR-A1; and (v) the demonstration that the pro-inflammatory activity of oxHDL is mediated by apoA1 residues that are distinct from those involved in loss of cholesterol efflux and loss of LCAT binding and activation activity.

An intriguing finding in the present studies is the acquisition of saturable and specific binding of MPO-generated oxHDL to an alternative as of yet unrecognized receptor on endothelial cells. Studies with cells from CD-36 KO, SR-A1 KO and DKO mice unambiguously show the classic scavenger receptors CD-36 and SR-A1 do not participate in binding as the apparent binding affinity of the modified HDL did not

58 change upon exposure to cells from the genetically engineered strains. Moreover, the ability to recapitulate specific and saturable binding to endothelial cells, NF-kB activation, and up-regulation in VCAM expression, using oxidized reconstituted HDL comprised of only human apoA1 and the relatively non-oxidizable phospholipid POPC, but not oxidized individual components of the particle, is consistent with recognition of a new structural motif generated on the apolipoprotein following oxidant exposure.

Unfortunately, attempts to identify the precise modified residue(s) on apoA1 that facilitate the saturable and specific binding to endothelial cells have thus far proven elusive. It was somewhat surprising that many residues previously identified as targets for oxidation on apoA1 in vitro and in vivo by MPO are not apparently involved in binding. However, there are numerous alternative oxidant sensitive groups within apoA1 that are no doubt targets for HOCl-mediated oxidation whose products may mediate binding to the alternate receptor. For example, the amine moiety of lysine (apoA1 has 21 lysines) and the NH2-terminus are highly reactive with hypochlorous acid forming chloramines, secondary reactive chlorinating species which can further react with adjacent susceptible groups, or decompose into multiple alternative species. In prior studies we have shown that the NH-chloramine formed by HOCl-dependent oxidation of

NH-amine groups on lysine of apoA1 can form 2-aminoadipic acid (113). Moreover, NH- dichloramine formation is also a relatively facile reaction, though the final decomposition product(s) formed are less clear. In model dipeptide systems where halogenation of the

N-termini formed ND-dichloramines, nitriles were one of the observed products (114) .

Alternatively, chlorination of N-termini of target proteins has also been reported to generate multiple deamination derivatives (114). Even the amide bond itself within a

59 polypeptide is a potential target for halogenation by HOCl, forming chloramides. Further studies are needed to define the identity of the receptor recognizing oxHDL and to better understand at the structural level the features responsible on oxHDL that promote binding to the endothelial cell receptor(s) and subsequent NF-ț%DFWLYDWLRQZLWKUHVXOWDQWJDLQRI pro-inflammatory activity.

In summary, the present studies identify further mechanisms whereby MPO- mediated oxidative reactions may contribute to the pathogenesis of CVD. MPO levels have been shown in multiple studies to track with incident risks of CVD events in subjects (71, 113, 115, 116). The present studies may help to explain prior reports of pro- inflammatory HDL in the acute phase setting, as well as during chronic inflammation such as in CVD. MPO is the most abundant protein within neutrophils and monocytes, and is classically used as a quantitative index of acute inflammation and leukocyte activation. Two novel targets for pharmacologic inhibition are suggested by the present studies – the first is MPO itself, to inhibit formation of dysfunctional HDL forms. The second and equally intriguing possibility is to inhibit MPO-generated oxHDL binding to the as of yet unrecognized receptor. Finally, the present studies lend further support to the idea that it is both the quality and the quantity of HDL that is important for understanding its overall biological functions in CVD.

60 - Figure II-1. Oxidation of HDL by the MPO/H2O2/Cl system has functional consequences for classic atheroprotective activities of HDL. A, RAW macrophages were loaded with [3+@FKROHVWHURO DQG LQFXEDWHG IRU  K ZLWK ȝJ SURWHLQPO +'/

- HDL oxidized by the complete MPO/H2O2/Cl system (oxHDL), or HDL exposed to the indicated components of the complete MPO system. The percent cholesterol efflux was determined as described under Methods. B, Demonstration that MPO-catalyzed oxidation of reconstituted nascent HDL inhibits LCAT activating activity. C, The content of protein

- bound chlorotyrosine on HDL exposed to the MPO/H2O2/Cl system (or the indicated components) was determined by stable isotope dilution LC/MS/MS as described under

Methods. Arrow indicates upper range of chlorotyrosine content reported in apoA1 recovered from human atherosclerotic plaque (15). Results represent the mean of triplicate determinations of a representative experiment performed at least three times.

61 Figure II-2. HDL protects HUVEC and BAEC from multiple apoptogenic triggers while MPO-oxidized HDL fails to do so. A, HUVEC were placed in serum free medium along with the indicated treatments for 6 hours. Apoptosis was quantified by either annexin positive staining by flow cytometry, or TUNEL staining (panel B). C, D,

HUVEC or BAEC were exposed to 254nm UV irradiation for 10 min followed by incubation with the indicated treatments for 6 hours. Apoptosis was quantified by

62 TUNEL staining. Results represent the mean of triplicate determinations of a representative experiment performed at least three times.

63 Figure II-3. Exposure of HDL to the MPO oxidant system inhibits the anti- apoptotic activity of the particle as monitored by loss of capacity to both inhibit caspase-3 activity and induce eNOS activity. A, The anti-apoptotic activity of HDL as monitored by inhibition in caspase-3 activation. Serum starvation of HUVEC for 24 h increases endothelial cell caspase-3 activity. The anti-apoptotic activity of HDL exposed

- to the complete MPO/H2O2/Cl system (or the indicated components) is also shown. B,

The capacity of HDL or HDL previously exposed to the indicated components of the

- MPO/H2O2/Cl system to activate endothelial cell eNOS was determined by monitoring

[3H] citrulline formation from [3H] arginine as described under Methods. Results represent the mean of triplicate determinations of a representative experiment performed at least three times.

64 Figure II-4. HDL oxidized by physiologically relevant levels MPO-generated oxidants inhibits the anti-inflammatory activity of the particle in HUVEC and promotes VCAM-1 protein expression in BAEC independent of TNF-Į A, HUVEC surface VCAM-1 protein expression was quantified by ELISA in the absence and presence of TNF-D as described under Methods. In parallel, the impact of concomitant

LQFXEDWLRQZLWKȝJSURWHLQPO+'/+'/SUHYLRXVO\H[SRVHGWRWKH complete

- MPO/H2O2/Cl system (oxHDL), or HDL incubated with the indicated components of the

- MPO/H2O2/Cl system, on HUVEC surface VCAM-1 protein levels was determined by

65 ELISA as described under Methods. * p<0.05. B, BAEC were incubated with the indicated concentrations of isolated human HDL or HDL exposed to the complete

- MPO/H2O2/Cl system (oxHDL) and VCAM-1 surface protein levels were determined as described under Methods. C, %$(&ZHUHLQFXEDWHGZLWKȝJSURWHLQPORI+'/ previously exposed to the indicated components of the MPO oxidation system and surface VCAM-1 protein levels were determined by ELISA as described under Methods.

D, %$(&ZHUHLQFXEDWHGIRUKZLWKȝJSURtein/ml HDL, oxHDL, isolated human

- apoA1, apoA1 previously exposed to the complete MPO/H2O2/Cl system (oxApoA1), lipid extract of HDL, small unilamellar vesicles (SUV) comprised of POPC, lipid extract

- of oxHDL, POPC SUV exposed to the complete MPO/H2O2/Cl system (oxPOPC),

- reconstituted nascent HDL (rHDL), or rHDL exposed to the complete MPO/H2O2/Cl system (ox rHDL) and then cell surface VCAM-1 protein levels in BAEC were determined as described under Methods. NA represents “no addition.” All results represent the mean of triplicate determinations of a representative experiment performed at least three times.

66 Figure II-5. MPO-oxidized HDL induces bovine aortic endothelial cell NF-ț% activation, IKK activation and phosphorylatLRQ RI ,ț%Į A, BAEC were incubated with TNF-D for 30 min (lanes 1-3), media only (NA), HDL for 3 h, or oxHDL for the indicated times. Electrophoretic mobility shift assays (EMSA) for NF-NB activation were then performed in whole cell lysates as described under Methods. Where indicated, lysates were also incubated with anti-NF-NB p65 or isotype control IgG and super shift

(SS) of the NF-NB complex monitored. Parallel immunoblots (IB) were generated using

hosphor serine 32- and 36-VSHFLILF ,ț%-Į DQWLERG\ S-,ț%-Į  GHPRQVWUDWLQJ

SKRVSKRU\ODWLRQRI,ț%-ĮRQVHULQHVDQGLQR[+'/WUHDWHGFHOOV,PPXQREORWZLWK

67 VSHFLILF DQWLERG\ WR ,ț%-Į LV DOVR VKRZQ DORQJ ZLWK Dn immunoblot of lysates probed with anti-E-actin to demonstrate equal loading in each lane. B, EMSA analysis of BAEC lysates as in panel A except that cells were exposed to HDL modified by the complete

- MPO/H2O2/Cl system (oxHDL) or the complete oxidant system minus the indicated

- components (ie –MPO, -H2O2 or –Cl ). Note that BAEC NF-ț% DFWLYDWLRQ is only

- observed by exposure to HDL previously incubated with the complete MPO/H2O2/Cl system since eliminating any one of the components of the oxidation system produces a

HDL particle that fails to activate endothelial cell NF-ț%C, BAEC were incubated with

TNF-D (30 min) as positive control, media alone (NA) as negative control, or either HDL

- (3 hours) or HDL previously exposed to the complete MPO/H2O2/Cl system (oxHDL, 2 or 3 hours). IKK activity was then determined in BAEC lysates using IKK-specific immuno-pulldown coupled kinase assay (KA). IKK complex was immunoprecipitated with antibody to IKKJ and kinase activity using recombinant GST-INBD (1-54) and 32P-

$73 DV VXEVWUDWH ZDV SHUIRUPHG DV GHVFULEHG XQGHU 0HWKRGV 1RWHWKDW,ț%ĮLV phosphorylated in response to stimulation by TNF-Į DQG R[+'/ EXW QRW +'/

Specificity of the kinase reaction was confirmed by demonstrating failure of the site- specific mutant GST-,ț%-Į -54) [32A/36A] to be phosphorylated in TNF-Į-stimulated extracts. Parallel immunoblots using antibodies specific to either IKKJ or E-actin are also shown. Equivalent levels of GST-,ț%-Į VXEVWUDWH DGGLWLRQ WR WKH ,.. FRPSOH[HV LV shown by Commassie blue (CB) staining. NA refers to “no addition.”

68 Figure II-6. MPO-oxidized HDL fails to bind to the physiologic HDL receptor, scavenger receptor B1 (SR-B1) and gains binding to an alternate receptor on endothelial cells. A, Specific binding of HDL, and HDL previously oxidized by exposure

- to the complete MPO/H2O2/Cl system (oxHDL) was determined on 293T human embryonic kidney cells transiently transfected with either human SR-B1 or vector as described under Methods. B, Specific binding of HDL previously modified by the

- complete MPO/H2O2/Cl system determined using BAECs as described under Methods.

69 Results represent the mean of triplicate determinations of a representative experiment performed at least three times.

70 Figure II-7. The scavenger receptors CD36 and SR-A1 do not recognize HDL

- modified by the MPO/H2O2/Cl system. Specific binding of HDL previously modified

- by the complete MPO/H2O2/Cl system (oxHDL) to the indicated mouse peritoneal macrophages (MPMs) was determined as described under Methods. Note that oxHDL binds equally well to A, wild type (WT) MPMs, and B, double knock out (DKO) MPMs.

Results represent the mean of triplicate determinations of a representative experiment performed at least three times.

71 Figure II-8. ApoA1 tyrosine, tryptophan and methionine residues do not appear to be involved in endothelial activation by MPO-oxidized HDL. A, Dose response curve of isolated human apoA1 mediated cholesterol efflux activity (ABCA1-dependent) from cholesterol-laden RAW macrophages. B, ABCA1-mediated cholesterol efflux activity of various apoA1 in the absence vs. presence of MPO-catalyzed oxidation was examined in

RAW macrophages at sub-saturating levels of protein (5Pg/ml). ApoA1 forms used included isolated human apoA1 (h-ApoA1), recombinant human apoA1 (rh-ApoA1), and the indicated site directed mutant forms of recombinant human apoA1. 4WF represents

72 recombinant human apoA1 in which the endogenous tryptophans at residues 8, 50, 72, and 108 were converted to phenylalanine. 3MV represents recombinant human apoA1 in which endogenous methionines at residues 86, 112, 148 were converted to valine. 7YF represents recombinant human apoA1 in which endogenous tyrosines at residues 18, 29,

100, 115, 166, 192, and 236 were converted to phenylalanine. Note that oxidation by the complete MPO system substantially inhibits ABCA1 mediated cholesterol efflux from all apoA1 forms examined except for the oxidant resistant 4WF mutant. C, Recombinant

HDL (rHDL) were generated using each of the recombinant human apoA1 forms indicated in panel B. The capacity of the indicated rHDL to promote BAEC activation in

- native form vs. following oxidation by the MPO-H2O2-Cl system was then determined by quantifying endothelial cell VCAM-1 surface protein levels. NA refers to “no addition”. Wt refers to rHDL generated with the “wild type” human sequence for apoA1.

D, Competition binding data demonstrating that excess MPO-oxidized rHDL generated with the 4WF apoA1 mutant significantly inhibits binding of oxHDL to BAECs. Results represent the mean of triplicate determinations of a representative experiment performed at least three times.

73 CHAPTER 3

The Apolipoprotein Composition of High Density Lipoprotein Influences Cholesterol Efflux and Non cholesterol Efflux Activities of the Lipoprotein

74 ABSTRACT

High density lipoprotein (HDL) is a heterogeneous class of lipoprotein particles that are atheroprotective. The major protein component of HDL is apolipoprotein A1

(apoA1). In humans, the second major apolipoprotein in HDL is apolipoprotein A2

(apoA2). The role of apoA2 in the atheroprotective function of HDL and in HDL metabolism is not well defined. We now show that apoA2 containing spherical HDL particles (sHDL A1/A2) have less anti-apoptotic and anti-inflammatory function than spherical HDL particles containing only apoA1 (sHDL A1). Further, sHDL A1/A2 that are

- oxidized to (patho) physiologically relevant levels of oxidation by the MPO/H2O2/Cl system have increased pro-inflammatory gain of function activity as monitored by surface vascular cell adhesion molecule (VCAM-1) levels and NF-ț%DFWLYDWLRQLQDRUWLF endothelial cells. Additionally, mice transgenic for mouse apoA2 have lower levels of macrophage reverse cholesterol transport (RCT) compared to wild type controls, as measured by the percent fecal cholesterol excretion. Preliminary analysis of the individual components of the RCT pathway showed that sHDL A1/A2 was as efficient as sHDL A1 in promoting total cholesterol efflux, which is the first step in the RCT pathway.

Assessment of the effect of apoA2 on the later steps of the pathway revealed that the rate of cholesterol delivery to the liver was significantly lower in the apoA2 transgenic mice compared to controls. Taken together, these data suggest that sHDL A1/A2 is less atheroprotective than sHDL A1, both in its reverse cholesterol transport function as well as its non-cholesterol efflux activities. Additionally, oxidized sHDL A1/A2 acquires increased pro-inflammatory function than oxidized sHDL A1, generating a particle that is even more pro-atherogenic upon MPO catalyzed oxidation.

75 INTRODUCTION

High density lipoprotein (HDL) levels are inversely associated with the risk for cardiovascular disease (CVD) (117). HDL plays a key role in the reverse cholesterol transport (RCT) pathway, which involves the movement of cholesterol from peripheral cells to the liver for ultimate excretion in the feces as biliary cholesterol (38). Apart from its role in RCT, HDL has additional atheroprotective functions such as anti-apoptotic, anti-inflammatory and anti-thrombotic activity (57). However, a growing body of data now suggests that not all HDL is equally atheroprotective. Chronic inflammatory conditions such as atherosclerosis can render HDL “dysfunctional”, lacking in both RCT and non-RCT functions. Recently, we demonstrated that HDL that is oxidized to (patho) physiologically relevant levels of oxidation by the enzyme myeloperoxidase (MPO) loses not only its cholesterol efflux activities but also its anti-apoptotic and anti-inflammatory functions (118). Further, oxidation conferred upon the particle a gain of function pro- inflammatory activity.

While the term HDL suggests a single, homogeneous particle, in reality, HDL is an extremely heterogeneous mixture of particles that have a density between 1.063-1.21 g/ml (23). The major protein component of HDL is apolipoprotein A1 (apoA1), followed by apolipoprotein A2 (apoA2) (119). The bulk of HDL is formed by spherical particles that have a cholesterol ester core surrounded by phospholipids and apolipoproteins. The apolipoprotein component of spherical HDL can include apoA1 as the sole protein

(sHDL A1) or it can include both apoA1 and apoA2 (sHDL A1/A2) (120). When lipid free apoA1 interacts with the ABCA1 transporter on the surface of a peripheral cell, it picks up cholesterol and forms a nascent HDL particle that has two apoA1 molecules on its

76 surface (40). The cholesterol in nascent HDL is esterified by the enzyme lecithin cholesterol acyl transferase (LCAT) to cholesterol ester, generating a larger, mature spherical HDL that now has three apoA1 molecules on its surface (sHDL A1). When sHDL A1 interacts with apoA2, one of the apoA1 molecules is displaced by two molecules of apoA2, generating a spherical HDL particle with two molecules of apoA1 and two molecules of apoA2 (sHDL A1/A2) (56).

While the atheroprotective role of apoA1 is well established, the role of apoA2 remains controversial. Mature apoA2 is present in plasma as a dimer of two 77 amino acid chains linked by a disulfide bond (121, 122). Clinical epidemiological studies have failed to unequivocally establish the relationship between plasma apoA2 level and CVD

(123, 124). Animal studies have indicated that apoA2 may be pro-atherogenic. For example, transgenic mice overexpressing human or mouse apoA2 have increased susceptibility to atherosclerosis (125-128). In vitro studies on the role of apoA2 in the various stages of the RCT pathway have also proven inconclusive. For instance, while some studies have reported a negative effect of apoA2 on cholesterol efflux (129, 130), other studies have found no difference in the cholesterol efflux capacity of HDL particles containing only apoA1 or both apoA1 and apoA2 (36, 131-133).

What role, if any, apoA2 plays in the non-cholesterol efflux functions of HDL, namely its anti-apoptotic and anti-inflammatory activity, is unknown. Further, the effect of oxidation on the function of sHDL A1 versus sHDL A1/A2 is also unknown. Herein we show that sHDL A1/A2 has less anti-apoptotic and less anti-inflammatory activity in endothelial cells than sHDL A1. We also show that transgenic mice overexpressing mouse apoA2 have less macrophage RCT and lower hepatic cholesterol ester uptake than their

77 wild-type controls even though the in vitro cholesterol efflux capacity of sHDL A1/A2 is similar to that of sHDL A1. Finally, we also demonstrate that oxidation of sHDL A1/A2 by the MPO oxidation system generates a HDL particle that is more pro-inflammatory than the HDL particle generated by oxidation of sHDL A1, as monitored both by the surface expression of vascular cell adhesion molecule (VCAM-1) and NF-ț%DFWLYDWLRQ7DNHQ together, these data suggest that apoA2 containing HDL may be less atheroprotective than HDL containing only apoA1 and that oxidation of apoA2 containing HDL generates a particle that has increased pro-atherogenic function.

78 MATERIALS AND METHODS

Generation and characterization of spherical HDL

Spherical HDL was kindly provided by Dr. Kerry-Anne Rye (The Heart Research

Institute, Sydney, Australia). Human apoA1 and apoA2 were isolated from plasma after delipidation of HDL and separation on a Q sepharose Fast Flow gel attached to a fast protein liquid chromatography (FPLC) system (56). Discoidal HDL containing 1- palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), cholesterol and apoA1 (in a molar ratio of 100:10:1) was prepared by the cholate dialysis method, as described previously (93). Discoidal HDL was converted to spheres by incubation with low density

OLSRSURWHLQ /'/ /&$7IDWW\DFLGIUHHERYLQHVHUXPDOEXPLQDQGȕ-mercaptoethanol for 24 h at 37°C, as described previously (56). The spherical A1 HDL (sHDL A1) was isolated by sequential ultracentrifugation in the density range 1.063-1.21 g/ml. Spherical

HDL containing apoA2 (sHDL A1/A2) was prepared by displacing apoA1 from sHDL A1 with lipid free apoA2 during a 1 h incubation at room temperature. The sHDL A1/A2 was isolated by sequential ultracentrifugation (56). One molecule of apoA1 was displaced by two molecules of apoA2, confirmed by ELISA using antibodies specific to apoA1 and apoA2. Size of the spherical HDL particles was determined by native gel electrophoresis.

Phospholipid, free cholesterol and cholesterol ester content was determined as described previously (31).

MPO modification of spherical HDL

MPO mediated modification of sHDL A1 and sHDL A1/A2 was carried out in

20mM sodium phosphate buffer pH 7.4 containing 100mM sodium chloride (Cl-)ȝ0

79 diethylenetriamine pentaacetic acid (DTPA) and 60nM MPO as described previously

(118). The reaction was initiated by adding the appropriate amount of hydrogen peroxide, in three aliquots at 15 minute intervals, per mole of spherical HDL particle. The reaction was incubated at 37°C for a total of 90 min. A 100 fold excess of L-methionine was added to quench the reaction. The modified lipoprotein was stored at 4°C.

Cholesterol efflux activity

Cholesterol efflux was determined as previously described (118). Briefly,

RAW264.7 cells in 48 ZHOOSODWHVZHUHORDGHGZLWKȝ&LPO>3H] cholesterol overnight in 1% FBS DMEM. The next day, ABCA1 expression was induced with 8-Br-cAMP for

16 h. The day after induction, the indicated particle concentrations of sHDL A1 or sHDL

A1/A2 were added to each well with or without 8-Br-cAMP. After 6 h incubation at 37°C, the medium was removed, centrifuged and counted. The cells were extracted with hexane/isopropanol (3:2) and radioactivity counted as a measure of cholesterol retained within the cell. The percent cholesterol efflux was calculated as the radioactivity in the medium/total radioactivity (medium radioactivity plus cell radioactivity).

Apoptosis assays

Human umbilical vein endothelial cells (HUVEC) were serum deprived for 6 h with simultaneous incubation with the indicated particle concentration of sHDL A1 or sHDL A1/A2. After 6 hours, apoptosis was measured using caspase-3 activity assay, as described previously (118). An alternate apoptogenic trigger, UV irradiation (254nm,

12.4 watts, for 10 min), was also used. HUVEC were treated with the indicated particle

80 concentration of sHDL A1 or sHDL A1/A2 after exposure to UV irradiation and apoptosis measured using caspase-3 activity assay.

Surface VCAM-1 measurement

Surface VCAM-1 protein levels were determined in HUVEC (TNF-Į LQGXFHG

VCAM-1) and bovine aortic endothelial cells, BAEC, (no TNF-Į addition) (118). Cells were incubated with the indicated particle concentrations of sHDL A1 or sHDL A1/A2 for 6 h. After three washes with PBS, cells were fixed in 4% paraformaldehyde on ice for 30 min. Surface VCAM-1 protein was determined using anti-VCAM-1 primary antibody

(Santa Cruz Biotechnology, California, USA) with sheep anti-mouse HRP (GE

Healthcare, Piscataway, New Jersey, USA) as secondary antibody, detection by SureBlue

TMB Peroxidase substrate (KPL, Gaithersburg, Maryland, USA) and measuring absorbance at 450 nm on a 96 well plate reader (Spectramax 384 Plus, Molecular Devices,

Sunnyvale, California) after addition of 1M hydrochloric acid (HCl) to stop the reaction.

EMSA

BAEC were treated with oxidized sHDL A1 or oxidized sHDL A1/A2 for 6 h and

NF-ț%DFWLYDWLRQLQZKROHFHOOH[WUDFWVZDVGHWHUPLQHGE\HOHFWURSKRUHWLFPRELOLW\VKLIW assay (EMSA) with supershift detected using antibody specific to p65 subunit of NF-ț%

,ț%NLQDVH ,.. DFWLYLW\ZDVGHWHUPLQHGE\LPPXQRSUHFLSLWDWLRQRIthe IKK complex using IKKJ antibody, followed by performance of a kinase assay using recombinant

GST-INB-D (1-54) and 32P-ATP as substrates, as described previously (118). As an

81 additional specificity control, recombinant mutant GST-INB-D where serines 32 and 36 were mutated to alanine was generated and used as substrate.

Animal studies

Transgenic mice overexpressing mouse apoA2 were kindly provided by Dr. Jake

Lusis (UCLA). All animals were bred and housed in a temperature controlled room with a 12 hour light-dark cycle at the Cleveland Clinic Biological Resources Unit. Animals were fed Teklad Rodent Chow pellets. All experiments were approved by the

Institutional Animal Care and Use Committee.

Isolation of bone marrow macrophages

Mouse bone marrow macrophages were isolated from femurs of euthanized mice as described previously (134). Briefly, bone marrow was flushed with PBS supplemented with 50 U/ml penicilliQȝJPOVWUHSWRP\FLQDQG)%6&HOOVZHUHZDVKHGWZLFH with PBS and resuspended in RPMI-1640 media supplemented with 10% FBS, 2 mmol/L glutamine, penicillin/streptomycin, 20% murine L-cell preconditioned media and 50

ȝPRO/ ȕ-mercaptoethanol. Cells were cultured overnight in teflon bags at 37°C. The following day, additional media was added and cells were cultured for 5 days.

Reverse cholesterol transport

Bone marrow macrophages were cholesterol loaded by culturing in serum free

RPMI media supplemented with penicillin/streptomycin, 10 ng/ml recombinant human

0&6) DQG  PJPO DFHW\ODWHG /'/ ODEHOHG ZLWK  ȝ&L >14 C] cholesterol/ml. The

82 reaction was incubated at 37°C for 48 h. On the day of the experiment, cells were centrifuged, resuspended iQ530,PHGLDDQGVSLNHGZLWKȝ&LRI>3H] sitostanol.

C57Bl/6J and apoA2 transgenic mice were placed in metabolic cages, injected subcutaneously with 300ȝORIUHVXVSHQGHGERQHPDUURZPDFURSKDJHVSHUDQLPDO)HFHV were collected for 48 h and percent reverse cholesterol transport was calculated as ratio of labeled cholesterol in the feces to labeled cholesterol that was injected (134).

Liver lipid extraction

Approximately 50 mg of liver from each C57Bl/6J and apoA2 transgenic mice was weighed, 2 ml of water was added and the liver was homogenized with a Polytron homogenizer. 5 ml of chloroform/methanol (2:1) was added and vortexed for 2 min. The mixture was centrifuged at 3000 rpm for 10 min and organic phase (bottom phase) was collected. The aqueous phase was extracted a second time with 2 ml of chloroform and spinning at 3000 rpm for 10 min. The organic phase was collected and pooled with the first one. The organic phase was evaporated under liquid nitrogen and counted by adding

10 ml of scintillation fluid. The percent injected dose of radiolabeled cholesterol was calculated as counts in the liver divided by the total counts injected and was expressed per milligram of liver tissue.

Statistical analysis

All experiments were performed at least three times, unless otherwise indicated.

Results are reported as means r standard error of at least triplicate determinations.

Student’s two-tailed t-test was used for statistical analyses and p < 0.05 was considered

83 significant. Multiple comparisons were performed using ANOVA. Group differences in

RCT were compared using a two-tailed paired student t-test.

84 RESULTS

Characterization of spherical HDL reveals that both sHDL A1 and sHDL A1/A2 are similar in size

Spherical HDL containing only apoA1 (sHDL A1) was generated from nascent

HDL by incubating with LDL and LCAT for 24 h at 37°C, as described previously (56).

Spherical HDL containing both apoA1 and apoA2 (sHDL A1/A2) was subsequently generated by incubating sHDL A1 with apoA2 for 1 h at room temperature. The more lipophilic apoA2 displaces one apoA1 from the surface of the sHDL A1 particle (which contains three apoA1) (135), to generate a spherical HDL particle that has two molecules of apoA1 and two molecules of apoA2, as confirmed by ELISA with antibodies specific to apoA1 and apoA2. This composition of sHDL A1 and sHDL A1/A2 is similar to what is observed in vivo. Native gel electrophoresis of both spherical HDL particles demonstrated that they had a similar diameter of 9nm (Figure III-1).

Spherical HDL containing apoA2 has less anti-apoptotic activity than spherical HDL containing only apoA1

Human umbilical vein endothelial cells (HUVEC) undergo apoptosis upon serum starvation and isolated human HDL inhibits this process (103). In cells that were serum deprived for 6 h, the level of apoptosis, as measured by caspase-3 activity, increased more than 5 fold (Figure III-2A). HUVEC also undergo apoptosis when exposed to UV irradiation and this increase in apoptosis can be attenuated by pre-treatment of cells with

HDL. In HUVEC exposed to UV irradiation for 10 min, the level of apoptosis increased

8 fold (Figure III-2B). Incubation of HUVEC with physiological concentrations of sHDL

85 A1 significantly decreased both serum starvation induced apoptosis as well as UV irradiation induced apoptosis, in a concentration dependent manner (Figure III-2A and

III-2B). When HUVEC were treated with the same particle concentration of sHDL A1 or sHDL A1/A2, the sHDL A1/A2 was less effective at inhibiting either serum starvation induced apoptosis or UV irradiation induced apoptosis (Figure III-2C and III-2D).

Spherical HDL containing apoA2 is not as effective as HDL containing only apoA1 in decreasing cytokine induced adhesion molecule expression on endothelial cells

VCAM-1 is involved in the development of atherosclerosis by mediating the migration of leukocytes across the vascular endothelium (9). HDL inhibits the expression of VCAM-1 in endothelial cells (57, 60). The cytokine TNF-ĮLVDSRWHQWVWLPXODWRURI

VCAM-1 expression in HUVEC (136). When HUVEC are exposed to TNF-ĮIRUKWKH surface VCAM-1 protein levels increased more than 7 fold (Figure III-3). Pre-treatment of HUVEC with increasing physiological concentrations of sHDL A1 for 2 h decreased surface VCAM-1 protein OHYHOV DW ȝ0 DQG ȝ0 RI V+'/ A1 (corresponding to an

DSR$ FRQFHQWUDWLRQ RI ȝJPO DQG PJPO UHVSHFWLYHO\  :KHQ+89(& ZHUH SUH- treated with the same particle concentration of sHDL A1/A2, the decrease in surface

VCAM-1 protein level was significantly less than that observed with sHDL A1 (Figure

III-3).

- Exposure of sHDL A1/A2 to the MPO/H2O2/Cl system confers a pro-inflammatory gain of function activity to the modified particle

86 Previous work from our lab has shown that exposure of isolated plasma HDL to

- the MPO/H2O2/Cl system generates a dysfunctional particle that not only loses anti- inflammatory activity but also gains pro-inflammatory activity, as monitored by the increase in surface VCAM-1 protein levels in aortic endothelial cells (118). We hypothesized that sHDL A1/A2 may gain increased pro-inflammatory activity, compared to sHDL A1, upon oxidation. Increasing oxidation of sHDL A1 generates an HDL particle that upregulates surface VCAM-1 protein on BAEC (Figure III-4). Treatment of BAEC with sHDL A1/A2 that is oxidized in the same mole ratio of particle to hydrogen peroxide as sHDL A1, leads to an increase in surface VCAM-1 protein levels beyond what is observed with oxidized sHDL A1 (Figure III-4).

MPO modified sHDL A1 and sHDL A1/A2 activate endothelial cell NF-ț% DQG LQGXFH

SKRVSKRU\ODWLRQRI,ț%Į

VCAM-1 expression is controlled by the transcription factor NF-ț%,QFXEDWLRQ of BAEC with oxidized HDL activates NF-ț%DQGFDXVHVSKRVSKRU\ODWLRQRI,ț%ĮRQWKH conserved serine residues 32 and 36, a hallmark of IKK activity, which is upstream of

NF-ț%DFWLYDWLRQ([SRVXUHRI%$(&WR032R[LGL]HGV+'/A1 or sHDL A1/A2 activates

NF-ț% DV GHWHUPLQHG E\ (06$ )LJXUH III-5A). Also, immunoblot analysis revealed phRVSKRU\ODWLRQRI ,ț%Į )LJXUH III-5B). To verify that the DNA-protein complex was indeed NF-ț% DQ DQWLERG\ VSHFLILF WR WKH S VXEXQLW RI 1)-ț% ZDV XVHG DQG demonstrated a “supershift,” while a control IgG antibody did not (Figure III-5A). IKK antibody-specific immuno-SXOOGRZQ FRXSOHG NLQDVH DVVD\V XVLQJ ,ț%Į DV D VSHFLILF

87 substrate for IKK demonstrated that oxidized sHDL A1 and oxidized sHDL A1/A2 treatment of BAEC activates the IKK complex (Figure III-5C).

Both sHDL A1 and sHDL A1/A2 promote cholesterol efflux from macrophages

Macrophage RAW cells were loaded with [3H] cholesterol and cholesterol efflux capacity of both sHDL A1 and sHDL A1/A2 were determined. Surprisingly, both forms of spherical HDL promoted total cholesterol efflux equally at all particle concentrations tested (Figure III-6). This preliminary experiment, however, will need to be repeated to confirm this result (n = 1).

ApoA2 transgenic mice have lower levels of fecal cholesterol excretion compared to wild-type controls

Cholesterol efflux is the first step in the reverse cholesterol transport pathway.

Since apoA2 transgenic mice are more prone to developing atherosclerosis, we hypothesized that apoA2 transgenic mice would be less efficient than their wild-type controls in promoting reverse cholesterol transport. Plasma analysis revealed that the plasma [14C] cholesterol counts, which are a measure of the ability of plasma lipoproteins to accept cholesterol from lipid laden cells, were higher in both male and female apoA2 transgenic mice compared to wild-type controls (Figure III-7A). However, the total fecal cholesterol (a measure of reverse cholesterol transport) was lower in male and female apoA2 transgenic mice (Figure III-7B) suggesting that despite the elevated plasma HDL levels, the HDL was not as effective in transferring cholesterol to the feces for excretion.

88 ApoA2 transgenic mice have lower hepatic and bile cholesterol uptake compared to wild-type controls

The plasma [14C] cholesterol counts, which are a measure of the ability of plasma lipoproteins to accept cholesterol from lipid laden cells, were higher in apoA2 transgenic mice compared to wild-type controls. This finding reflects the higher levels of plasma

HDL in the apoA2 transgenic mice. However, since the percent fecal cholesterol excretion in the apoA2 transgenic mice was lower, we measured both hepatic and bile

[14C] cholesterol counts to determine the mechanism of impaired reverse cholesterol transport in these mice. The hepatic uptake of cholesterol and its flux from liver to bile constitute the later steps of the reverse cholesterol transport pathway. We therefore determined the radioactivity counts in the liver and bile to determine the mechanism of the lower percent fecal cholesterol excretion in apoA2 transgenic mice. Hepatic [14C] cholesterol counts were significantly lower in apoA2 transgenic mice (Figure III-7C), suggesting that hepatic uptake of cholesterol was impaired. The [14C] cholesterol levels in the bile were also lower in apoA2 transgenic mice compared to wild-type controls

(Figure III-7D).

89 DISCUSSION

Taken together, the present studies show that spherical HDL containing apoA2 is less athero-protective than spherical HDL containing only apoA1. The less athero- protective effect of sHDL A1/A2 is evident not only in its decreased ability to mediate the classic function of HDL, reverse cholesterol transport, but also in its decreased capacity to promote non cholesterol efflux activities such as anti-apoptotic and anti-inflammatory activities. New insights shown into how apoA2 affects the function of the HDL particle include: (i) The discovery that at a physiological particle concentration, sHDL A1/A2 is not as effective as sHDL A1 in protecting endothelial cells from apoptosis (ii) The discovery that at all physiological particle concentrations tested, sHDL A1/A2 is less anti- inflammatory i.e. it is not as effective as sHDL A1 in decreasing cytokine induced

VCAM-1 protein upregulation on endothelial cells (iii) The discovery that pathophysiologically relevant levels of MPO mediated oxidation generates a sHDL A1/A2 particle that gains pro-inflammatory function, as monitored by endothelial cell VCAM-1 protein upregulation and NF-ț%DFWLYDWLRQYLDDFWLYDWLRQRIWKH IKK complex. Further, the pro-inflammatory activity of oxidized sHDL A1/A2 is higher than sHDL A1 oxidized to the same ratio of HDL particle to oxidant (iv) The discovery that apoA2 transgenic mice have a lower level of fecal cholesterol excretion, a measure of reverse cholesterol transport, compared to their wild-type controls.

To our knowledge, this is the first systematic study of the role of apoA2 utilizing spherical HDL particles generated in vitro. An advantage to using the in vitro generated

HDL particles is the ability to work with a homogeneous particle preparation and to be able to precisely control the ratio of apoA1 and apoA2 in the particle, chosen to reflect

90 what is observed in vivo. One of the intriguing findings in the present study is that compared to sHDL A1, sHDL A1/A2 gains increased pro-inflammatory function upon MPO mediated oxidation, as monitored by VCAM-1 protein upregulation. This observation holds true for the various oxidation ratios tested. Previous work from our group has demonstrated that MPO mediated oxidation of HDL isolated from plasma or MPO mediated oxidation of reconstituted HDL (oxHDL) generates a particle that gains pro- inflammatory activity with concomitant loss of binding to the HDL receptor, scavenger receptor B1 (SR-B1). The gain of function, pro-inflammatory activity of oxHDL can be explained by the finding that it acquires saturable and specific binding to an alternate as of yet unrecognized receptor that is independent of the classic scavenger receptors CD-36 and SR-A1 (118). As with oxHDL, it is likely that exposure of sHDL A1 and sHDL A1/A2

- to the MPO/H2O2/Cl system results in the generation of a new structural motif that is recognized by the alternate receptor. Since oxidized sHDL A1/A2 gains increased pro- inflammatory activity compared to oxidized sHDL A1, it is possible that oxidation of apoA2 results in increased binding of the HDL particle to the receptor and/or increased pro-inflammatory signal transduction. A second, interesting finding in the present study is that sHDL A1/A2 has less anti-apoptotic activity than sHDL A1. The anti-apoptotic activity of HDL has been previously demonstrated to include binding of HDL to SR-B1, which ultimately results in enhanced nitric oxide (NO) formation (55). A testable hypothesis to explain why sHDL A1/A2 is less anti-apoptotic than sHDL A1 is that apoA2 containing HDL has decreased binding to SR-B1 and thus, decreased production of the protective molecule NO. Finally, a third intriguing finding in the present study is that apoA2 transgenic mice have significantly lower levels of reverse cholesterol transport

91 compared to their wild-type controls. To determine the mechanism of reduced fecal cholesterol excretion, radioactivity counts in the plasma, liver and bile were determined.

ApoA2 transgenic mice have higher [14C] plasma cholesterol, a reflection of the higher

HDL cholesterol levels in the apoA2 transgenic mice. While the plasma [14C] cholesterol counts do not provide information about the rate of cholesterol flux between macrophages and plasma, the in vitro cholesterol efflux data suggests that spherical HDL containing apoA2 have similar total cholesterol efflux as spherical HDL containing only apoA1. Analysis of the later steps of the reverse cholesterol transport pathway revealed that hepatic uptake of [14C] cholesterol was significantly lower in apoA2 transgenic mice.

The lowered hepatic cholesterol uptake in apoA2 transgenic mice could be a result of (or a combination of) (i) reduced binding of apoA2 containing HDL to the principal hepatic cholesterol uptake receptor SR-B1 (ii) apoA2 containing HDL is less efficient at transferring its cholesterol cargo to SR-B1 (iii) hepatic SR-B1 levels are reduced in apoA2 transgenic mice. We also observed significantly lower counts in bile in apoA2 transgenic mice, compared to wild-type controls. Ongoing studies in our lab are aimed at identifying the mechanism of lowered reverse cholesterol transport in apoA2 transgenic mice, including analysis of binding and cholesterol ester transfer activity of apoA2 containing HDL and analysis of the hepatic expression of SR-B1 and the bile transporters

ABCG5 and ABCG8.

In summary, the present studies indicate that apoA2 containing HDL may be less athero-protective, both in its reverse cholesterol transport activity as well as its non- cholesterol efflux activities. These findings may help to explain prior reports that mice overexpressing either mouse or human apoA2 have an increased susceptibility to

92 atherosclerosis. The findings of the present study add to the growing body of evidence that various factors, including apolipoprotein composition, can influence the atheroprotective functions of HDL.

93 Figure III-1. Native gel analysis of sHDL A1 and sHDL A1/A2. Non-reducing native gel analysis reveals that both sHDL A1 and sHDL A1/A2 have a similar diameter of 9nm.

94 Figure III-2. Spherical HDL containing both apoA1 and apoA2 is less anti-apoptotic than spherical HDL containing only apoA1. A, HUVEC were placed in serum-free medium along with the indicated concentrations of spherical HDL containing only apoA1

95 and apoptosis was measured as a function of caspase-3 activation. B, HUVEC were exposed to 254-nm UV irradiation for 10 min followed by incubation with the indicated concentrations of spherical HDL containing only apoA1. Apoptosis was measured as a function of caspase-3 activation. C, HUVEC were exposed to 254-nm UV irradiation for

10 miQ IROORZHG E\ LQFXEDWLRQ ZLWK ȝM spherical HDL containing apoA1 only or spherical HDL containing both apoA1 and apoA2. Apoptosis was measured as a function of caspase-3 activation. D, HUVEC were placed in serum-IUHHPHGLXPDORQJZLWKȝM spherical HDL containing apoA1 only or spherical HDL containing both apoA1 and apoA2. Apoptosis was measured as a function of caspase-3 activation. Note that the physiological HDL conFHQWUDWLRQLVEHWZHHQDQGȝM.

96 Figure III-3. Spherical HDL containing both apoA1 and apoA2 is less efficient at inhibiting TNF-Į induced surface VCAM-1 protein expression than spherical HDL containing only apoA1. HUVEC surface VCAM-1 protein expression was quantified by enzyme-linked immunosorbent assay in the presence and absence of TNF-Į for 6 h. In parallel, the impact of the indicated concentrations of spherical HDL containing only apoA1 or spherical HDL containing both apoA1 and apoA2 was determined by enzyme- linked immunosorbent assay.

97 Figure III-4. Spherical HDL containing both apoA1 and apoA2 is more pro- inflammatory than spherical HDL containing only apoA1 upon MPO mediated oxidation. BAEC were incubated for 6 h with ȝM apoA1 only containing spherical

HDL or ȝ0apoA1 and apoA2 containing spherical HDL that were previously exposed to different mole ratios of hydrogen peroxide per mole HDL particle using the

- MPO/H2O2/Cl system. Surface VCAM-1 protein expression was determined by enzyme- linked immunosorbent assay.

98 Figure III-5. MPO-oxidized sHDL A1 and MPO-oxidized sHDL A1/A2 induces bovine aortic endothelial cell NF-ț%DFWLYDWLRQDQG,..DFWLYDWLRQ A, BAEC were

99 incubated with TNF-ĮIRUPLQ ILUVWWKURXJKWKLUGODQHV , media only (NA), isolated plasma HDL (pHDL), spherical HDL containing only apoA1 (sHDL A1), spherical HDL containing both apoA1 and apoA2 (sHDL A1/A2), isolated plasma HDL exposed to

- - MPO/H2O2/Cl system (ox-pHDL), sHDL A1 exposed to MPO/H2O2/Cl system (ox-

- sHDL A1), sHDL A1/A2 exposed to MPO/H2O2/Cl system (ox-sHDL A1/A2) for 6 h at a

SDUWLFOHFRQFHQWUDWLRQRIȝ0(06$IRU1)-ț%DFWLYDWLRQZDVSHUIRUPHGRQZKROHFHOO lysates. Where indicated, the whole cell lysates were incubated with anti- NF-ț%SRU isotype control IgG antibody. Parallel Oct-1 band shift was performed to demonstrate equal loading of all the samples. B, Immunoblots (IB) were generated using phosphor serine 32- and 36-specific -ĮDQWLERG\ S-,ț%-Į GHPRQVWUDWLQJSKRVSKRU\ODWLRQRI,ț%-Į on serines 32 and 36 in oxHDL treated cells. Immunoblot with speciILFDQWLERG\WR,ț%-Į is also shown, along with an immunoblot of lysates probed with anti-E-actin to demonstrate equal loading in each lane. C, BAEC were incubated with the indicated

FRPSRQHQWVIRUKDWDSDUWLFOHFRQFHQWUDWLRQRIȝ0,..DFWLYLW\ZDVGetermined in

BAEC lysates using IKK-specific immuno-pulldown coupled kinase assay (KA). IKK

FRPSOH[ ZDV LPPXQRSUHFLSLWDWHG ZLWK DQWLERG\ WR ,..Ȗ DQG NLQDVH DFWLYLW\ ZDV determined using recombinant GST-,ț%Į -54) and [32P] ATP as substrates. Equivalent levels of GST-,ț%-ĮVXEVWUDWHDGGLWLRQWRWKH ,..FRPSOH[HVLVVKRZQE\&RPPDVVLH blue (CB) staining.

100 Figure III-6. Spherical HDL containing apoA1 only or spherical HDL containing both apoA1 and apoA2 are equally efficient at promoting cholesterol efflux from macrophages. RAW macrophages were loaded with [3H] cholesterol and incubated for 6 h with the indicated concentrations of spherical HDL. The percentage cholesterol efflux was determined as the ratio of cholesterol in the medium divided by the total cholesterol

(medium + cells). This preliminary experiment needs to be repeated (n = 1).

101 Figure III-7. ApoA2 transgenic mice show less reverse cholesterol transport compared to C57Bl/6J mice. C57Bl/6J or apoA2 transgenic mice were injected sub- cutaneously with dual labeled macrophages, feces were collected for a 48 h period and percent fecal cholesterol excretion calculated as described in the Materials and Methods.

The % injected dose of radiolabel in plasma, liver and bile after 48 h was calculated as described in Materials and Methods. A, apoA2 transgenic mice have 53% higher plasma

[14C] cholesterol compared to wild-type mice. B, The percent fecal excretion of cholesterol is 40% lower in apoA2 transgenic mice compared to wild-type controls. C,

The [14C] counts in the livers of apoA2 transgenic mice is 16% lower compared to wild- type controls. D, The [14C] counts in the bile of apoA2 transgenic mice is 35% lower compared to wild-type controls.

102 CHAPTER 4

Generation of Two Fusion Proteins of the Extracellular Domain of Scavenger Receptor B1 to Identify Structure-Function Relationships between High Density Lipoprotein and Scavenger Receptor B1

103 INTRODUCTION

Scavenger receptor B1 (SR-B1) is a 509 amino acid, 82 kDa membrane protein that belongs to the CD36 superfamily of proteins (41, 42). It shares several structural similarities to CD36, including a large extracellular domain and two membrane spanning domains that are flanked by short cytoplasmic amino- and carboxy-terminal tails (50).

SR-B1 is N-glycosylated at several sites as well as fatty acid acylated on two cysteine residues (137). SR-B1 is highly expressed in tissues that are involved in lipid metabolism, such as the liver and adrenal glands (43). Other cell types are also known to express SR-

B1, including macrophages and endothelial cells (44, 45). Like other scavenger receptors,

SR-B1 binds a variety of ligands such as apoptotic cells, advanced glycation end-product modified proteins and anionic phospholipids (46, 47). Most research has focused on the role of SR-B1 as a physiologically relevant high density lipoprotein (HDL) receptor. SR-

B1 binds HDL with high affinity and mediates the selective transfer of cholesterol ester, unesterified cholesterol and phospholipids from HDL into cells (48, 49).

Several studies have confirmed the important role of SR-B1 in HDL metabolism

(50). Hepatic overexpression of SR-B1 is associated with decreased plasma HDL levels due to its increased clearance (51). SR-B1 knock out mice and SR-B1 transgenic mice have demonstrated a protective role for SR-B1 against the development of atherosclerosis

(52, 53). Surprisingly, apoE/SR-B1 double knock-out mice on a normal chow diet die at an early age from complex, occlusive coronary artery lesions, reminiscent of the lesions observed in acute coronary syndromes in humans (138). The important role of SR-B1 in mediating both the cholesterol efflux and non-efflux activities of HDL contributes to its atheroprotective effect. Recent work by Li et al. has demonstrated that the anti-apoptotic

104 role of HDL involves binding of HDL to SR-B1 and the subsequent activation of a survival kinase pathway, which results in the phosphorylation and activation of eNOS and the enhanced production of NO (55).

While the signaling events involved in the atheroprotective effect of HDL and

SR-B1 are well established, very little is known about the proximal binding event between HDL and SR-B1. It has been previously demonstrated that the conformation of apoA1 in HDL particles is critical to the binding activity between HDL and SR-B1 (139).

Williams et al. have demonstrated that amphipathic helices in apoA1 play an important role in the binding of HDL to SR-B1 (140). Using “retroviral library-based activity dissection,” Gu et al. have demonstrated that two glutamate residues in the extracellular domain of murine SR-B1 are critical for binding (141). However, not much else is known about other key residues, both in apoA1 and in SR-B1, that are important in mediating the binding between the lipoprotein and its receptor.

This chapter describes efforts to produce a fusion protein of the SR-B1 extracellular domain, the key domain involved in HDL binding. Two fusion proteins were produced—extracellular domain of SR-B1 fused to the Fc (fragment, crystallizable) region of an immunoglobulin (IgG) and extracellular domain of SR-B1 fused to maltose binding protein (MBP), abbreviated as SR-B1-Fc and MBP-SR-B1-6x His respectively.

One of the fusion proteins (SR-B1-Fc) was demonstrated to have binding activity towards

HDL. These fusion proteins will allow for the characterization of the structure-function relationship between SR-B1 and HDL using multiple, complementary biophysical approaches, such as hydrogen-deuterium exchange mass spectrometry and small angle neutron scattering (SANS). A combination of such approaches can provide global

105 structural information such as the shape of the binding complex, as well as local information about the residues on apoA1 and SR-B1 that are involved in binding.

106 MATERIALS AND METHODS

Amplification of extracellular domain of SR-B1

The extracellular domain of SR-B1 was amplified so that it could be directionally cloned into the p-ENTR/d-TOPO vector and ultimately moved in-frame from the p-

ENTR/d-TOPO vector into the mammalian expression vector pSecTag2C. The cDNA of human SR-B1 was purchased from Origene (catalog # SC116692; PubMed reference sequence NM_005505.3). The extracellular domain of SR-B1 (Figure IV-1) was amplified using forward and reverse primers that were designed to allow for directional cloning into the p-ENTR/d-TOPO vector (Invitrogen, catalog # K2400-20). The forward primer included the CACC sequence (which allows for directional cloning into the p-

ENTR/d-TOPO vector using topoisomerase enzyme) followed by a Hind III restriction site at the 5’ end (the Hind III restriction site ensures that SR-B1 can be moved in-frame from the p-ENTR/d-TOPO vector into the pSecTag2C mammalian expression vector).

The reverse primer included a Not I restriction site at the 5’ end (Figure IV-2). The polymerase chain reaction (PCR) amplification conditions were as follows:

Step Temperature (°C) Time

1 95 5 min

2 94 30 s Repeat 3 58 30 s steps 2-4 18 times 4 72 75 s

5 72 10 min

64 Hold

107 After amplification, the PCR product was separated on a 1% agarose gel and purified using a QIAquick Gel Extraction Kit (Qiagen, catalog # 28704). The concentration of the

PCR product was determined on a 1% agarose gel, using a low DNA mass ladder as a standard (Invitrogen, catalog # 10068-013) for comparison.

Directional cloning of extracellular domain of SR-B1 into p-ENTR/d-TOPO entry vector

The extracellular domain of SR-B1 was directionally cloned into the p-ENTR/d-

TOPO vector, according to manufacturer’s instructions (Figure IV-3a and IV-3b). Briefly,

20 ng of SR-B1 insert and 20 ng of vector (2:1 ratio between insert and vector) were mixed with 300mM NaCl, 15mM MgCl2 and incubated for 5 minutes at room temperature. The reaction was plDFHGRQLFHDQGȝ/ZDVXVHGWRWUDQVIRUPRQHYLDORI chemically competent E. coli. After incubating the mixture for 30 min on ice, the bacteria were heat-VKRFNHGIRUVDWƒ&DQGSODFHGEDFNRQLFHȝ/RI62&PHGLXPZDV added and the cells were allowed to recover for 1 h at 37°C. Two different volumes

ȝ/DQGȝ/ ZHUHSODWHGRQNDQDP\FLQSODWHVDQGLQFXEDWHGRYHUQLJKWDWƒ&

Isolation of plasmid DNA and restriction digest verification

The purpose of this step was to verify that the extracellular domain of SR-B1 was successfully cloned into the p-ENTR/d-TOPO vector. Three colonies were selected from each of the two kanamycin plates and grown overnight in 3mL LB Broth with 50 ȝJP/ kanamycin. The following day, plasmid DNA was isolated using Qiaprep Spin Miniprep

Kit (Qiagen, catalog # 27104). Briefly, the bacterial cells were harvested by

108 centrifugation at 6000 x g IRU  PLQ 7KH SHOOHW ZDV UHVXVSHQGHG LQ ȝ/ EXIIHU 3

P07ULVS+P0('7$ ȝ/RIO\VLVEXIIHU3 P01D2+ SDS)

ZDVDGGHGWRHDFKWXEHDQGLQYHUWHGWKRURXJKO\ȝ/RIQHXWUDOL]DWLRQEXIIHU1 0 potassium acetate, pH 5.5) was added and samples centrifuged for 10 min at 13,000 rpm.

The supernatant was applied to a spin column and centrifuged for 30 s. The column was washed with 0.5mL of buffer PB and centrifuged for 30 s. Buffer PE was added and centrifuged twice to remove all traces of ethanol. The DNA was eluted with 10mM Tris,

S+P0('7$7RYHULI\WKDWWKHFORQLQJZDVVXFFHVVIXOȝ/ DSSUR[LPDWHO\0 ng) of DNA was digested with Hind III and Not I at 37°C for 1 h and separated on a 1% agarose gel. Restriction digest released a single band from the vector backbone that migrated at the right size (1200 base pairs) for the extracellular domain of SR-B1 (Figure

IV-4). Sequencing verified that the insert was SR-B1 and that it was in the correct reading frame.

Introduction of Not I restriction site into the mammalian vector pSecTag2C

A Not I restriction site was introduced in the pSecTag2C vector so that the SR-B1 extracellular domain could be moved into this vector from p-ENTR/d-TOPO vector using

Hind III and Not I restriction sites. The mammalian expression vector pSecTag2C contains an N-WHUPLQDO,Jț-chain leader sequence that allows the protein to be secreted into the media. The C-terminal contains an Fc region of IgG2A that will be fused to the

extracellular domain of SR-B1 and also includes two affinity tags—a myc tag followed

by a 6x His tag (Figure IV-5a and IV-5b). The Fc region of an IgG2A antibody was

previously inserted between EcoRI and Xho I restriction sites in the multiple cloning site

109 of the vector. The insertion of the Fc region between these restriction sites eliminated a

Not I restriction site, as evidenced by the fact that the vector was not cut with Not I

(Figure IV-6a). Therefore, to introduce the extracellular domain of SR-B1 into the pSecTag2C vector, a Not I site was introduced between Bam HI and EcoRI restriction sites. Briefly, the pSecTag2C vector was digested with Bam HI and EcoRI and purified on a 1% agarose gel. Sense and anti-sense primers with the Not I site (Figure IV-6b) were annealed using the following program using a PCR thermocycler:

Step Temperature (°C) Time (minutes)

1954

27010

35525

44510

53510

62115

pSecTag2C vector previously digested with Bam HI and EcoRI (100ng) was ligated with

QJRIDQQHDOHGSULPHU UDWLREHWZHHQSULPHUDQGYHFWRU XVLQJȝ/RI7'1$

OLJDVHIRUKDWURRPWHPSHUDWXUHȝ/RI;/-10 bacteria were transformed wiWKȝ/

RIWKHOLJDWLRQUHDFWLRQ%DFWHULDZHUHDOORZHGWRUHFRYHUIRUKDWƒ&DQGȝ/ZDV plated on an ampicillin plate and incubated overnight at 37°C. Plasmid DNA was isolated using Qiaprep Spin Miniprep Kit and digested with Not I at 37°C for 2 h. Agarose gel analysis revealed that the pSecTag2C vector was now digested with Not I (Figure IV-6c).

110 Cloning the extracellular domain of SR-B1 into the mammalian vector pSecTag2C

The DNA encoding the extracellular domain of SR-B1 (250ng) was ligated with

100ng of the Hind III/Not I linearized S6HF7DJ&YHFWRUXVLQJȝ/RI7'1$OLJDVH

7KHWRWDOUHDFWLRQYROXPHZDVȝ/DQGWKHUHDFWLRQZDVLQFXEDWHGDWURRPWHPSHUDWXUH for 3 h. The reaction mixture (5 ȝ/ ZDVWUDQVIRUPHGLQWRȝ/RI;/-10 and plated on ampicillin plates. Plasmid DNA was isolated and digested with Hind III and Not I at

37°C for 2 h. Agarose gel analysis showed that a single band was released from the vector backbone that migrated to the right size (1200 base pairs) for the extracellular domain of SR-B1 (Figure IV-7). Sequencing confirmed that the insert was the extracellular domain of SR-B1.

Transfection of HEK 293T cells and protein purification

Mammalian cells were transfected with the DNA for the extracellular domain of

SR-B1 fused to Fc and subsequently screened for SR-B1 protein production. Human embryonic kidney (HEK 293T) cells in 10cm dishes were transfected with pSecTag2C vector containing extracellular domain of SR-B1 fused to Fc and control pSecTag2C vector. Lipofectamine 2000 (Invitrogen, catalog # 11668-027) was used to transfect cells

DFFRUGLQJWRPDQXIDFWXUHU¶VLQVWUXFWLRQV%ULHIO\ȝJRI'1$ZDVGLOXWHGLQP/RI

Opti-MEM I reduced serum medium. Lipofectamine ȝ/ was diluted in 1.5mL of

Opti-MEM reduced serum medium and incubated for 5 min at room temperature. The diluted DNA was combined with diluted lipofectamine and incubated for 20 min at room temperature. DNA-lipofectamine complexes were added to cells and mixed by gently

111 rocking the dish back and forth. Cells were incubated at 37°C. Transfection efficiency was monitored by transfecting a separate plate of cells with GFP. After 48 h, the media

(10mL) was collected, concentrated 10-fold through a 10,000 MW cut-off filter and dialyzed into 50mM Tris, pH 7.4 buffer. The media was then purified on an immobilized metal affinity column (IMAC) (GE Healthcare), henceforth referred to as “nickel column.” Concentrated and dialyzed media ȝ/ ZDVURWDWHGZLWKȝ/RISDFNHG nickel beads for 3 h at 4°C. Beads were washed three times with 25mM Tris, pH 7.6,

250mM NaCl and eluted with 100mM imidazole, pH 8.

Analysis of binding between SR-B1 fusion protein and HDL

The purpose of this step was to verify that the fusion protein containing the extracellular domain of SR-B1 fused to Fc (SR-B1-Fc) binds to HDL. HDL was isolated from plasma and labeled with iodine, as described previously (118). HEK 293T cells were transfected with full length SR-B1, as described in the methods section of chapter 2, and incubated with the indicated concentrations of iodinated HDL for 1.5 h at 4°C.

Specific binding was calculated as total binding minus binding in the presence of 20-fold excess of unlabeled HDL. A parallel competition binding experiment with SR-B1-Fc fusion protein was performed at 20-fold molar excess of the unlabeled fusion protein. If the fusion protein binds to HDL in solution, we expect to see a decrease in binding of iodinated HDL to the cells.

Introduction of a multiple cloning site into pMAL-c4x vector

112 A multiple cloning site was introduced into the pMAL-c4x vector so that the extracellular domain of SR-B1 could be transferred from the pSecTag2C vector to the bacterial expression vector pMAL-c4x, which encodes an N-terminal maltose binding protein (MBP) tag. The pMAL-c4x vector with CD36 insert was obtained from Dr. Roy

Silverstein (Figure IV-11a). To transfer the extracellular domain of SR-B1 from the pSecTag2C vector, a multiple cloning site with Hind III and Not I restriction enzyme sites (Figure IV-11b) was introduced into the pMAL-c4x vector using site directed mutagenesis, as per manufacturer’s instructions (Agilent, catalog # 200521). Sequencing of plasmid DNA of resultant clones confirmed the introduction of the multiple cloning site with concomitant deletion of the CD36 insert.

Cloning the extracellular domain of SR-B1 into the pMAL-c4x vector

The extracellular domain of SR-B1 was cloned into the pMAL-c4x vector followed by the introduction of a C-terminal 6x Histidine tag. Both the pMAL-c4x vector and pSecTag2C vector (to release the extracellular domain of SR-B1) were digested with

Hind III and Not I at 37°C for 2 h. The pMAL-c4x vector (100ng) and the released SR-

B1 insert (180ng) ZHUHLQFXEDWHGZLWKȝ/RI7'1$OLJDVHIRUKDWURRP temperature. XL-10 bacteria were transformed as before and plasmid DNA isolated from the clones the following day. Restriction digest with Hind III and Not I released a single band from the vector backbone at 1200 base pairs, which was confirmed by sequencing as the extracellular domain of SR-B1 (Figure IV-12). Site directed mutagenesis was then used to introduce a C-terminal 6x Histidine tag followed by a stop codon.

113 Forward primer sequence:

5’GCTGGTGTTGATGCCCAAGGTGATGCACTATGGGAGCGCCGCCAGC CAT

CAT CAC CAC CAT CAC TGA GCGGCCGCTCTAGAGCTTGGCACTG 3’

Reverse primer sequence:

5’CAGTGCCAAGCTCTAGAGCGGCCGCTCAGTGATGGTGGTGATGATGGCTGG

CGCTCCCATAGTGCATCACCTTGGGCATCAACACCAGC 3’

Protein production and purification on an amylose column

The purpose of this step was to transform E.coli with the pMAL-c4x vector containing SR-B1 extracellular domain, verify SR-B1 fusion protein (henceforth abbreviated as MBP-SR-B1-6x His) production and purify the protein using the N- terminal MBP tag. E.coli, the plysS strain of Rosetta, ZDVWUDQVIRUPHGZLWKȝ/RIthe pMAL-c4x vector containing the extracellular domain of SR-B1. Bacteria were plated on ampicillin/chloramphenicol plates. The next day, 4 colonies were isolated and grown

RYHUQLJKW LQ P/ /% EURWK ZLWK ȝJP/ DPSLFLOOLQ ȝJP/ FKORUDPSKHQLFRO DQG

2% glucose. The following day, the bacterial cells were diluted 1:10 into 3mL LB broth and grown for 2.5 h at 37°C with shaking at 300rpm. IPTG (0.4mM) was added to induce protein synthesis and bacteria were grown for an additional 3 h at room temperature with shaking at 300rpm to screen for protein production. After 3 h of induction, the bacteria

ZHUHFHQWULIXJHGUHVXVSHQGHGLQȝ/RI[6'6EXIIHUDQGERLOHGDWƒ&IRUPLQ

ȝ/of samples was fractionated on a 10% SDS-PAGE gel and candidate clones were identified for use in large scale protein production. For large scale protein production, a

VWDUWHUFXOWXUHRIP//%EURWKZLWKJOXFRVHȝJP/DPSLFLOOLQDQGȝJP/

114 chloramphenicol was inoculated with a fresh single colony (< 2 weeks old). The culture was grown overnight at 37°C with shaking at 300 rpm. The next day, the overnight culture was diluted 1: 100 into four 500mL culture media in 2 L flasks and grown for 2.5 h at 37°C with shaking at 300 rpm. The absorbance at 600 nm was measured every half- hour until it reached 0.4. The flasks were placed at 4°C for 10 min to bring the cultures to room temperature and IPTG was added to a final concentration of 0.4mM. The flasks were then placed at room temperature and grown for 4 h with shaking at 300rpm. After 4 h, the bacteria were pelleted by centrifugation at 4,000 x g for 15 min at 4°C. The pellets were resuspended in 10mL of lysis buffer (100mM TEA, pH 7.5, 170mM NaCl, 10mM

DTT with 1mM PMSF, 10mM benzamidine, 1mM AEBS)ȝJP/DSURWLQLQȝJP/

EHVWDWLQ ȝJP/ OHXSHSWLQ ȝJP/ SHSVWDWLQ  7KH SHOOHWV ZHUHO\VHGLQDPLFUR- fluidizer (Model # B12-04DJC M3, Microfluidics Corporation, Cincinnati, OH) under high pressure (20,000 psi) and centrifuged at 20,000 x g for 30 min at 4°C to separate the soluble from the insoluble material. Soluble lysate was adjusted to a final concentration of 50mM KCl, 50mM ATP and 100mM MgCl2 by addition and placed at 37°C for 30 min to disrupt the interaction between SR-B1 and the heat shock protein chaperone

GroEL. In the meantime, amylose resin (3 mg/mL capacity) was prepared by washing resin with 8 column volumes of water followed by two washes with 5 column volumes of column buffer (100mM TEA, pH 7.5, 150mM NaCl, 50mM KCl, 5mM DTT). After 30 min, the soluble fraction was added to the amylose resin and rotated overnight at 4°C.

The following day, the sample + resin was loaded into a column and the flow-through was collected. Once the amylose resin was settled, it was washed with 4 column volumes of the following wash buffers to remove proteins bound non-specifically to the resin.

115 Wash 1: 100mM TEA, pH 7.5, 150mM NaCl, 50mM KCl, 5mM DTT, 25mM ATP, and

50mM MgCl2

Wash 2: 100mM TEA, pH 7.5, 150mM NaCl, 50mM KCl, 5mM DTT, 10mM ATP, and

20mM MgCl2

Wash 3: 100mM TEA, pH 7.5, 150mM NaCl, 50mM KCl, 5mM DTT, 5mM ATP, and

10mM MgCl2

Wash 4: 50mM Tris, pH 8, 500mM NaCl, and 1mM DTT

The washes were collected and 100mM maltose in 50mM Tris, pH 8, 500mM NaCl,

1mM DTT was used to elute the protein from the amylose resin. Six elution fractions of 1 column volume each were collected.

Purification of MBP-SR-B1-6x His fusion protein on immobilized metal affinity column (nickel column)

The SR-B1 fusion protein was purified on a nickel affinity column. The SR-B1 fusion protein eluted from the amylose column was dialyzed into 50mM Tris, pH 7.4 buffer. Nickel resin (10 mg/mL capacity) was added to the protein along with NaCl to a final concentration of 500mM to reduce non-specific binding. The mixture was rotated for 2 h at 4°C. The protein + resin was then loaded into a column and allowed to settle.

The column was washed four times with 3 column volumes of 50mM Tris, pH 7.4,

500mM NaCl. The protein was eluted with 2 column volumes of 100mM imidazole in

50mM Tris, pH 7.4, 500mM NaCl (3 fractions were collected) followed by 250mM imidazole (2 fractions were collected).

116 Analysis of binding between MBP-SR-B1-6x His fusion protein and HDL

The purpose of this step was to determine if MBP-SR-B1-6x His fusion protein could bind to HDL in solution. Reconstituted, nascent HDL (mole ratio of POPC phospholipid: cholesterol: apoA1 is 100:10:1) and MBP-SR-B1-6x His fusion protein were incubated at a 1:1 molar ratio for 1 h at 4°C in 50mM Tris, pH8.0 and 150mM NaCl.

The control incubations included reconstituted, nascent HDL incubated with MBP alone and reconstituted, nascent HDL incubated with amylose beads alone. Amylose beads were added after 1 h and the reaction mixture was rotated at 4°C for 2 h. The amylose beads were then centrifuged and the apoA1 concentration in the supernatant was measured using ELISA with an antibody specific to human apoA1. The amount of apoA1 bound to the beads was calculated as the amount of apoA1 initially added minus the amount of apoA1 in the supernatant.

117 RESULTS

SR-B1-Fc fusion protein is secreted into the media of HEK 293T cells and can be purified on an immobilized metal affinity column (nickel column)

Western blot analysis of SDS-PAGE fractionated transfected cell proteins with anti-myc antibody revealed that SR-B1-Fc protein was present in both extract and media of HEK 293T cells transfected with SR-B1-Fc vector but not control vector (Figure IV-8).

Commercially available SR-B1 antibodies could not recognize SR-B1-Fc protein because the SR-B1 amino acids against which these antibodies were raised did not include any in the extracellular domain. The SR-B1-Fc fusion protein was purified from the media on a nickel affinity column. 10% SDS-PAGE fractionation showed a single band at 100 kDa after nickel purification (Figure IV-9a). The total yield of the fusion protein after nickel column purification was ~ȝJSHUFPSODWH 7DEOHIV-1). Western blot analysis of the eluted fractions from the nickel column with anti-myc antibody showed a single band at 100 kDa, the expected molecular weight of SR-B1-Fc fusion protein (Figure IV-9b).

SR-B1-Fc fusion protein binds to HDL

The ability of the SR-B1-Fc fusion protein to bind to HDL was tested in a competition binding assay. Isolated plasma HDL that was radio-labeled with iodine was added at varying concentrations to HEK 293T cells transiently transfected with full length SR-B1. Specific binding was calculated as the total binding minus the binding in the presence of 20-fold excess of unlabeled HDL. When the unlabeled SR-B1-Fc fusion protein was added in a 20-fold excess to labeled HDL, the binding of HDL to SR-B1 decreased significantly, indicating that the SR-B1-Fc fusion protein was able to bind to

118 HDL in solution (Figure IV-10). Unlabeled control IgG, when added in 20-fold excess, did not decrease HDL binding to SR-B1 significantly, suggesting that the binding between the SR-B1-Fc fusion protein and HDL was not due to non-specific interaction between the Fc region of the fusion protein and HDL.

MBP-SR-B1-6x His fusion protein is produced in E.coli and can be partially purified on amylose and nickel affinity columns

The low yield of SR-B1-Fc fusion protein in HEK 293T cells prompted its movement into a bacterial expression vector. The pMAL-c4x vector was chosen because of previous success in our lab of using this vector to produce an N-terminal maltose binding protein (MBP) tagged CD36 scavenger receptor protein, which has a very similar structure to SR-B1. After successful transfer of SR-B1 into the pMAL-c4x vector and the introduction of a C-terminal 6x His tag, several bacterial colonies were screened for protein production. Bacterial cells that were induced with IPTG produced a protein that migrated at the expected molecular weight (90 kDa) for the fusion protein (MBP-SR-B1-

6x His fusion protein) (Figure IV-13). In bacterial cells that were un-induced with IPTG, no protein band was visible at 90 kDa. The MBP-SR-B1-6x His fusion protein could be partially purified on an amylose column (Figure IV-15a), with a total yield of 37.7% of the fusion protein (Table IV-2). The partially purified protein was recognized by a polyclonal SR-B1 antibody that was generated in the lab using four multiple antigen peptides (MAP) against the extracellular domain of SR-B1. The partially purified protein was also recognized by an MBP antibody (Figure IV-15b). A second purification step on

119 a nickel affinity column had a total yield of 77% of the loaded fusion protein (Table IV-

3) and did not purify the protein any further (Figure IV-16).

MBP-SR-B1-6x His fusion protein does not bind to HDL in solution

The ability of MBP-SR-B1-6x His fusion protein to bind to HDL in solution was tested by incubating the SR-B1 fusion protein with reconstituted, nascent HDL at a molar ratio of 1:1 for 1 h at 4°C. Amylose beads were then added to pull-down the fusion SR-

B1 protein along with any HDL that was bound to it. The binding controls included HDL that was incubated with MBP alone and HDL that was incubated with amylose beads alone. As indicated in Table IV-4, the amount of HDL (apoA1) that was bound to the SR-

B1 fusion protein was similar to the amount of HDL (apoA1) that was bound to either of the controls. Thus, the MBP-SR-B1-6x His fusion protein was not able to bind to HDL in solution.

120 DISCUSSION

This chapter describes the production of two fusion proteins of the extracellular domain of SR-B1. The first fusion protein produced was the extracellular domain of SR-

B1 fused to the Fc region of an IgG molecule (SR-B1-Fc). The presence of the Fc region at the C-terminal end of the protein enhances solubility while also enabling easy purification of the fusion protein from the media. Other affinity tags (myc tag and 6x His tag) provide additional options for the purification of the protein. SR-B1 fusion protein that was purified from the media of HEK 293T cells was functional based on its ability to bind to HDL in solution. However, a huge drawback to using this approach was that 10 mL of media only yielded ~100μg of protein. Structural studies (H-D exchange mass spectrometry, cross-linking, SANS) followed by functional characterization (confirming binding sites by mutating the key residues, delineating the residues involved in various aspects of SR-B1 function) requires tens of milligrams of protein, which would be very difficult to produce given the current low yield. A second SR-B1 fusion protein with an

N-terminal MBP tag and a C-terminal 6x His tag (MBP-SR-B1-6x His) was produced in a pMAL-c4x bacterial expression vector in order to increase SR-B1 fusion protein yield.

This decision was further guided by previous success in our lab in using the pMAL-c4x vector to generate functional CD36 fusion protein (belonging to the same family as SR-

B1 and with a similar structure).

The MBP tagged SR-B1 fusion protein was produced in large amounts in E.coli

(> 30 mg/L) and was partially purified on an amylose column. Further purification can be achieved by cleaving the N-terminal MBP tag using Tev protease, which will cleave the polypeptide backbone immediately N-terminal to the SR-B1 coding region. This can be

121 followed by purification on a nickel affinity column. A key feature of any fusion protein of SR-B1 should be its ability to bind to HDL in solution, enabling its use in H-D exchange mass spectrometry, cross-linking analysis or SANS. The partially purified, bacterially expressed SR-B1 fusion protein could not bind to HDL in solution, as determined by a quantitative HDL pull-down binding assay. Native gel analysis also failed to reveal binding between the fusion protein and HDL and showed that most of the

SR-B1 fusion protein was aggregating and very little, if any, entered the gel.

There are various trouble-shooting strategies that can be followed in the future to produce a functional SR-B1 fusion protein in E.coli. While the MBP-SR-B1-6x His fusion protein is soluble, native gel analysis indicated that there was significant aggregation. The extracellular domain of SR-B1 has six cysteine residues in its carboxy domain, which participate in disulfide bond formation. Disulfide bond formation in E.coli takes place in the periplasm, which is an oxidizing environment. Thioredoxin and glutaredoxin facilitate disulfide bond formation in the periplasm (142, 143). However, thioredoxin and glutaredoxin are kept in a reduced state by thioredoxin reductase (trxB) and glutathione, respectively. Glutathione, in turn, is reduced by glutathione reductase

(gor). It has been demonstrated that disrupting the trxB and gor genes can promote disulfide bond formation in the cytoplasm (144-146). Alternatively, co-expression of thioredoxin can also promote disulfide bond formation. The fusion protein can also be refolded in vitro through a variety of techniques, after initially denaturing it using chaotropic agents such as guanidinium hydrochloride or urea. Low molecular weight thiol reagents (DTT or 2-mercaptoethanol) can be added during the denaturing step to reduce non-native intra- and inter-molecular disulfide bonds (147-150). Prior to refolding,

122 these reducing agents can be removed through dialysis after lowering the pH of the solution to prevent disulfide bonds from re-forming. Dilution (through dialysis) of the protein-denaturant solution into a refolding solution has been shown to promote folding of certain proteins such as lysozyme (151). Another commonly used technique for protein refolding involves performing size exclusion chromatography, which gradually exchanges the denaturant buffer with the additional advantage of further purifying the protein (152). Solid support assisted protein refolding is an additional technique that has been used successfully to refold proteins. For example, a protein with an N- or C-terminal

6x histidine tag is allowed to bind to nickel matrix and denaturant buffer is exchanged, allowing for refolding of the protein. The refolded protein can then be eluted with high concentrations of imidazole (153). Another strategy to ensure correct protein folding in

E.coli is to use a vector that codes for an N-terminal signal peptide of MBP (ex: pMAL- p4x) that results in the export of the fusion protein to the periplasm, where the oxidizing environment is much more amenable to disulfide bond formation.

If all the above strategies fail to generate functional protein, it may be worth reconsidering the mammalian expression system that can produce high levels of SR-B1 extracellular domain fused to the Fc region of IgG. An adenoviral vector can be used to transfect HEK 293T cells with the DNA for SR-B1-Fc fusion protein. An adenoviral based transfection method would be easier and better tolerated than most transient transfection methods (ex: electroporation, lipofectamine). Hollow fiber technology can be used to scale up SR-B1-Fc fusion protein production. Hollow fibers are tube like filters with a defined molecular weight cut-off. The fibers are sealed within a cartridge such that cells grow on the outside of the fiber (extra-capillary space) while medium is pumped

123 through the inside. Hollow fiber technology allows for high cell density to be maintained in a small surface area for many months. Secreted SR-B1-Fc fusion protein would be too large to pass through the fibers and can be concentrated upto 100-fold in the extra- capillary space. Thus, the combination of an adenoviral transfection system with hollow fiber technology may enable increased SR-B1-Fc fusion protein production. This functionally active fusion protein can then be used to address the question of where on

SR-B1 does apoA1 bind and vice versa. These methods were not tried initially because the expertise needed to establish an adenoviral expression vector system was not readily available and would have taken longer than the amount of time present. Additionally, the successful production of MBP tagged CD36 protein in our lab guided our decision to produce SR-B1 using a bacterial expression vector.

124 Figure IV-1. The extracellular domain of SR-B1 (in red) consists of 407 amino acids

(from amino acid 37 to amino acid 443). The extracellular domain interacts with HDL, which turns on signaling pathways that mediate some of the atheroprotective activities of

HDL.

125 Figure IV-2. Primers were designed to allow for directional cloning of the extracellular domain of SR-B1 into the pENTR/D-TOPO vector. Forward primer was designed to include the sequence CACC at the 5‘end followed by a Hind III restriction site. Reverse primer was designed to include a Not I restriction site at the 5’ end. The restriction sites were included to enable transfer of the extracellular domain of SR-B1 from the p-

ENTR/d-TOPO vector into a mammalian expression vector.

126 Figure IV-3a. Vector map of p-ENTR/d-TOPO.

The extracellular domain of SR-B1 was first cloned into the p-ENTR/d-TOPO vector, which allows for its subsequent cloning into an expression vector and production of SR-

B1 protein. The p-ENTR/d-TOPO vector contains a kanamycin resistance gene, which allows for the isolation of clones that have been successfully transformed with the recombinant p-ENTR/d-TOPO plasmid containing the extracellular domain of SR-B1.

127 Figure IV-3b. Directional TOPO cloning of extracellular domain of SR-B1.

The extracellular domain of SR-B1 was directionally cloned by adding the bases CACC to the 5' end of the forward primer. The overhang in the vector invades the double- stranded 5' end of the PCR product (extracellular SR-B1 domain), anneals to it and helps to stabilize the PCR product in the correct orientation. This allows for a cloning efficiency of > 90%.

128 Base pairs

Figure IV-4. SR-B1 extracellular domain is successfully cloned into p-ENTR/d-

TOPO vector.

After directional cloning of extracellular domain of SR-B1 into the p-ENTR/d-TOPO vector, E.coli were transformed and plated on kanamycin plates. Several colonies were picked, grown in LB broth containing kanamycin and plasmid DNA was isolated. To verify that the cloning was successful, the plasmid DNA was digested with the restriction enzymes Hind III and Not I, expected to release the extracellular domain of SR-B1 at

1200 base pairs (bp).

Lane A, uncut p-ENTR/d-TOPO vector.

Lane B, restriction digest of p-ENTR/d-TOPO vector with Hind III and Not I releases a

1200 bp fragment.

Sequencing confirmed that SR-B1 extracellular domain was inserted in the correct orientation.

129 Figure IV-5a. The mammalian expression vector pSeCTag2C.

The extracellular domain of SR-B1 was transferred from the p-ENTR/d-TOPO vector into pSecTag2C. This vector contains an N-WHUPLQDO,JțOHDGHUVHTXHQFHDQG&-terminal

Fc region of IgG2A followed by a myc tag and 6x Histidine tag.

130 Figure IV-5b. The multiple cloning site of the mammalian vector pSeCTag2C.

The Fc portion of an IgG molecule was previously cloned in between the EcoR I and Xho

I restriction sites, eliminating the Not I restriction site that was necessary for moving the extracellular domain of SR-B1 into this vector. This was corrected by introducing a Not I site between BamH I and EcoR I restriction sites, which allowed the extracellular domain of SR-B1 to be cloned in between Hind III and Not I restriction sites. The final fusion protein would have the extracellular domain of SR-B1 fused to the Fc region of IgG, followed by an in-frame P\FWDJDQGD[+LVWDJ7KH,JțFKDLQOHDGHUVHTXHQFHDOORZV for the transport of the SR-B1 fusion protein into the media.

131 Base pairs

Figure IV-6a. The mammalian vector pSecTag2C (5100 base pairs) was initially not cut by Not I restriction enzyme because this site was eliminated by the introduction of the Fc region of IgG.

Lane A, uncut pSecTag2C (upper band is open circular DNA and lower band is supercoiled form).

Lane B, pSecTag2C vector remained uncut with Not I enzyme (upper band is open circular form and lower band is supercoiled form).

Lane C, pSecTag2C vector was successfully cut with Hind III enzyme, linearizing the

DNA.

132 Figure IV-6b. Sense and anti-sense primers used for introducing a Not I restriction site in the pSecTag2C vector. The primers were annealed and then ligated into the pSecTag2C vector.

Base pairs

Figure IV-6c. After the ligation reaction between the pSecTag2C vector and the primers,

XL-10 strain of E.coli was transformed with the ligation reaction and plated on ampicillin plates. Plasmid DNA was isolated and cut with Not I restriction enzyme to determine if the ligation reaction was successful.

Lane A, uncut pSecTag2C vector (5100 base pairs).

Lane B, pSecTag2C vector was cut by Not I after the ligation reaction, linearizing it.

133 Base pairs

Figure IV-7. The extracellular domain of SR-B1 is successfully ligated into the pSecTag2C vector.

The extracellular domain of SR-B1 (in p-ENTR/d-TOPO vector) and the pSecTag2C vector were cut with the restriction enzymes Hind III and Not I and ligated using T4

DNA ligase. XL-10 E.coli were transformed with the ligation mixture and plated on ampicillin plates. Plasmid DNA was isolated and cut with Hind III and Not I to check if the extracellular domain of SR-B1 was successfully ligated into the pSecTag2C vector.

Lane A, Restriction digest of pSecTag2C vector after ligation reaction releases the extracellular domain of SR-B1 at 1200 base pairs.

Lane B, Uncut pSecTag2C vector.

134 kDa

Figure IV-8. Western blot of whole cell extract and media of 293T cells transfected with pSecTag2C vector containing SR-B1 extracellular domain.

A myc antibody was used to detect the SR-B1-Myc-6x His tagged fusion protein (SR-B1-

Fc), whose expected molecular weight is 100 kDa.

Lane A, Extract from endothelial cells (negative control).

Lane B, Myc-IKKȖ (myc positive control).

Lane C, Whole cell extract from 293T cells transfected with control vector.

Lane D, Whole cell extract from 293T cells transfected with SR-B1-Myc-6x His containing pSecTag2C vector.

Lane E, Media from 293T cells transfected with control vector.

Lane F, Media from 293T cells transfected with SR-B1-Myc-6x His containing pSecTag2C vector.

135 Note that both the whole cell extract and media, from cells transfected with pSecTag2C vector containing SR-B1 extracellular domain, express the SR-B1 fusion protein at 100 kDa.

136 kDa

Figure IV-9a. Coomassie gel of nickel column purification of SR-B1 fusion protein from the media of 293T cells.

Media from cells transfected with pSecTag2C vector containing SR-B1 extracellular domain was concentrated (10mL media from one 10-cm plate was concentrated to

0.5mL), dialyzed and purified on an immobilized metal affinity column (nickel column).

The column was washed with 25mM Tris, pH 7.4, 250mM NaCl and eluted with 100mM imidazole. An aliquot of each of the fractions was run on a 10% SDS-PAGE. Note that the SR-B1 fusion protein is eluted in elution fraction # 2 at 100 kDa. The prominent band in the load, flow-through, wash 1 and wash 2 is bovine serum albumin in the media

(molecular weight is 66 kDa).

137 kDa

Figure IV-9b. Western blot analysis of purified SR-B1 fusion protein.

After purification on a nickel column, the purified SR-B1 fusion protein (elution fraction

# 2 on the previous coomassie gel) was probed with anti-myc antibody to confirm its identity.

Lane A, Myc-,..Ȗ P\FSRVLWLYHFRQWURO 

Lane B, The SR-B1 fusion protein (100 kDa) is recognized by myc antibody.

138 Table IV-1. Purification table for SR-B1 fusion protein purified from media of 293T cells on a nickel column.

10mL media from a 10-cm plate was concentrated to 0.5mL and dialyzed before loading onto the nickel affinity column. The yield was calculated as the (total protein in elution fractions)/ (total protein loaded onto column) * 100%.

139 Figure IV-10. The SR-B1 fusion protein can bind to HDL.

The ability of the SR-B1 fusion protein to bind to HDL was determined in a competition binding assay. HDL isolated from plasma was labeled with iodine and added at the indicated concentrations to HEK 293T cells transiently transfected with full-length SR-

B1. Specific binding was calculated as the total binding minus the binding in the presence of 20-fold excess of unlabeled HDL. Unlabeled SR-B1 fusion protein, when added in a

20-fold excess to labeled HDL, decreases the binding of the labeled HDL to SR-B1 transfected cells. Control IgG when added in 20-fold excess does not decrease labeled

HDL binding significantly.

140 Figure IV-11a. The pMAL-c4X vector map.

The vector encodes a fusion protein with an N-terminal maltose binding protein (MBP) tag.

Figure IV-11b. Forward and reverse primer sequences for introducing a multiple cloning site with an N-terminal Tev cleavage site into the pMAL-c4X vector. The vector that was obtained contained CD36 (SR-B1 related protein) as insert. The multiple cloning site was redesigned such that the reading frame of the SR-B1 protein was maintained from the

141 pSecTag2C mammalian expression vector. Introduction of the multiple cloning site also eliminated the CD36 insert.

142 Base pairs

Figure IV-12. SR-B1 extracellular domain is successfully ligated into pMAL-c4x vector.

After introduction of the multiple cloning site, pMAL-c4x vector was digested with the restriction enzymes Hind III and Not I. pSecTag2C vector was also digested with Hind

III and Not I (which released extracellular domain of SR-B1). Ligation reaction between the digested pMAL-c4x vector and SR-B1 insert was carried out in the presence of T4

DNA ligase, XL-10 E.coli were transformed with the ligation mixture and plated on ampicillin plates. Plasmid DNA was isolated and restriction digest with Hind III and Not

I released the extracellular domain of SR-B1 at 1200 base pairs, confirming that the ligation reaction was successful. Sequencing also confirmed that SR-B1 extracellular domain was inserted into the pMAL-c4x vector. Finally, site directed mutagenesis was used to insert a C-terminal 6x Histidine tag. Insertion of the 6x Histidine tag was confirmed by sequencing.

143 kDa

Figure IV-13. SR-B1 fusion protein is produced in E.coli. pMAL-c4x vector containing SR-B1 extracellular domain was transformed into plysS strain of E.coli and plated on ampicillin/chloramphenicol plates. Colonies were isolated and grown in 3mL LB broth for 2.5 h at 37°C. Bacterial cells were induced with 0.4mM

IPTG, grown for an additional 3 h, pelleted and ERLOHGLQ[6'6EXIIHUȝ/ZDVUXQ on a 10% SDS-PAGE to check for fusion protein production. The expected molecular weight of the SR-B1 fusion protein (MBP-SR-B1-6x His) is 90 kDa.

Note that induced bacteria produce a protein that migrates to the right molecular weight while uninduced bacteria do not produce any such protein.

144 Figure IV-14. Purification scheme for MBP-SR-B1-6x His fusion protein from E.coli.

The first purification step involves purification on an amylose column, which binds to

MBP. After eluting with maltose, the protein can be further purified on a nickel column.

Tev protease cleavage of MBP after amylose column purification may further purify the protein.

145 kDa

Figure IV-15a. Coomassie gel of purification of MBP-SR-B1-6x His fusion protein with amylose beads.

Bacteria were grown for 4 h after induction by 0.4mM IPTG and pelleted by centrifugation. The pellets were lysed and the soluble fraction (supernatant) was incubated with amylose resin overnight. The resin was washed four times and 100mM maltose was used to elute SR-B1 fusion protein off the amylose beads. An aliquot of each of the fractions was run on a 10% SDS-PAGE. The expected molecular weight of the SR-

B1 fusion protein is 90 kDa.

146 kDa

Figure IV-15b. Western blot analysis of MBP-SR-B1-6x His fusion protein purified with amylose beads.

Anti-SR-B1 antibody and anti-MBP antibody were used to confirm the identity of the fusion protein. While both antibodies revealed a band at the expected molecular weight of

90 kDa, several smaller bands were also visible, highlighting the need for further purification.

147 Table IV-2. Purification table of MBP-SR-B1-6x His fusion protein purified with amylose beads.

The yield was calculated as the (total protein in elution fractions)/ (total protein loaded onto column) * 100%.

148 kDa

Figure IV-16. Coomassie gel of MBP-SR-B1-6x His purified on a nickel column.

MBP-SR-B1-6x His fusion protein that was purified on amylose beads was incubated with nickel resin for 2 h at 4°C. The resin was washed three times and fusion protein eluted with 100mM imidazole (first three elution fractions) followed by 250mM imidazole (elution 4 and elution 5). An aliquot of each of the fractions was run on a 10%

SDS-PAGE. The nickel column did not purify the protein any further.

149 Table IV-3. Purification table of MBP-SR-B1-6x His fusion protein purified on nickel column after prior purification with amylose beads.

The yield was calculated as the (total protein in elution fractions) / (total protein loaded onto column) * 100%.

150 Table IV-4. Analysis of binding between MBP-SR-B1-6x His fusion protein and

HDL (apoA1).

SR-B1 fusion protein was incubated with reconstituted, nascent HDL at a molar ratio of

1:1 for 1 h at 4°C. Binding controls included HDL that was incubated with MBP alone and HDL that was incubated with amylose beads alone. After the 1 h incubation, amylose beads were added to pull-down SR-B1 fusion protein and any HDL that may have bound to it. Beads were centrifuged and apoA1 concentration in the supernatant was determined using ELISA. The amount of apoA1 bound to the beads was calculated as the initial amount of apoA1 added minus the amount of apoA1 in the supernatant.

151 CHAPTER 5

Discussion and Future Directions

152 DISCUSSION AND FUTURE DIRECTIONS

High density lipoprotein (HDL) is a heterogeneous mixture of cholesterol carrying lipoprotein particles that is built upon a predominately apolipoprotein A1

(apoA1) backbone. It has long been recognized that HDL levels are inversely associated with the risk of developing atherosclerosis and cardiovascular disease (CVD) (117). The mechanism of atheroprotection of HDL has primarily been attributed to its central role in the reverse cholesterol transport (RCT) pathway (154). In this pathway, lipid poor apoA1 and HDL accept cholesterol and phospholipid from peripheral tissues (ex: lipid laden macrophages) by interacting with the ABCA1 and ABCG1 cell membrane transporters respectively. Upon accepting cholesterol, lipid poor apoA1 is converted into nascent

HDL, which is a substrate for the enzyme lecithin: cholesterol acyl transferase (LCAT).

LCAT esterifies the cholesterol to generate a spherical HDL particle with a core of cholesterol ester. The interaction of spherical HDL with scavenger receptor B1 (SR-B1) transfers the cholesterol ester into the liver. In the liver, the transporters ABCG5 and

ABCG8 transport the cholesterol into bile, from where it is ultimately excreted into the feces (38, 40). Apart from its role in RCT, mounting evidence suggests that HDL has several non-cholesterol efflux activities. The interaction of HDL with SR-B1 in endothelial cells turns on an Akt and MAP kinase mediated signaling pathway that ultimately results in enhanced nitric oxide production and protection from apoptosis (55).

HDL also has anti-inflammatory activity in endothelial cells, where in an SR-B1 dependent manner, it prevents cytokine mediated expression of pro-inflammatory adhesion molecules (ex: VCAM-1, ICAM-1) as well as the pro-inflammatory

153 transcription factor NF-ț% (57, 107). These findings highlight the fact that HDL may have multiple atheroprotective roles, not all of which involve cholesterol transport.

Despite the strong inverse association between HDL levels and atherosclerosis, high HDL levels are not always protective. A growing body of evidence suggests that

HDL can be rendered “dysfunctional” through various mechanisms, including oxidation

(82, 155). Zheng and colleagues first discovered that the leukocyte heme protein myeloperoxidase (MPO) binds to HDL and preferentially oxidizes it, both in human plasma and atherosclerotic plaque (76, 77). Further, site specific oxidative modification of apoA1 inhibits its ability to activate LCAT, preventing maturation of the HDL particle

(88). The first part of thesis describes the impact that MPO mediated oxidation has on the non-cholesterol efflux activities of HDL. Modification of HDL by the MPO/hydrogen

- peroxide (H2O2)/ chloride (Cl ) system at levels comparable to those observed in atheroma results in reduction of the anti-apoptotic and anti-inflammatory activities of the lipoprotein through a mechanism involving loss of SR-B1 binding. Further, oxidation confers a pro-inflammatory activity, as seen by upregulation of surface VCAM-1 protein levels and NF-ț%DFWLYDWLRQ:KLOHWKHORVVRI65-B1 binding could explain the loss of anti-apoptotic and anti-inflammatory activity, it does not satisfactorily explain the gain of function pro-inflammatory activity. We observed that despite loss of SR-B1 binding, oxidized HDL acquired saturable and specific binding to endothelial cells and that this binding was independent of the scavenger receptors CD36 and SR-A1, which have also been implicated in the pathogenesis of atherosclerosis and can bind various modified lipoproteins.

154 Several questions remain to be answered, including most importantly, the identity of the receptor that binds to oxidized HDL and mediates its pro-inflammatory gain of function activity. An attractive candidate that was not tested previously is oxidized low density lipoprotein receptor 1 (LOX-1). This receptor belongs to the C-type lectin superfamily and is expressed on endothelial cells, smooth muscle cells, monocytes and platelets (156). LOX-1 levels are elevated in early atherosclerotic lesions and LOX-1 knock out mice show reduced atherosclerotic plaque development while LOX-1 overexpression enhances plaque formation (157). Like the other scavenger receptors,

LOX-1 binds a variety of ligands including oxidized low density lipoprotein (oxLDL), apoptotic cells, advanced glycation end products and anionic phospholipids such as phosphatidylserine (158). Interestingly, Marsche et al. have previously demonstrated that

LOX-1 binds to hypochlorite modified HDL in human endothelial cells (159). Upon ligand binding, LOX-1 stimulates activation of NF-ț%DQGWKHVXEVHTXHQWH[SUHVVLRQRI adhesion molecules such as VCAM-1 (160), making it an extremely attractive oxidized

HDL receptor candidate. Peritoneal macrophages can be easily obtained from both wild- type and LOX-1 receptor knock-out mice and can be used to test the hypothesis that

LOX-1 may be an oxidized HDL receptor. If this were the case, we would expect saturable and specific binding of oxidized HDL to wild-type macrophages but not to macrophages isolated from LOX-1 receptor knock-out mice. Additional methods, such as knocking down LOX-1 expression in endothelial cells using siRNA, coupled with monitoring of VCAM-1 protein surface levels, can be used to confirm that LOX-1 binds to oxidized HDL.

155 An unbiased approach to identify the oxidized HDL receptor using biotin label transfer technology was initially tried but failed to identify any receptor. Another unbiased approach, which was used to successfully identify the LDL receptor, is ligand blotting (161). Preparations of detergent solubilized membranes can be subjected to non- denaturing sodium dodecyl sulfate (SDS) electrophoresis and then transferred to nitrocellulose paper. Labeled oxidized HDL (ex: 125I labeled oxidized HDL) can be incubated with the paper and visualized by autoradiography. Alternatively, oxidized HDL can be incubated with the paper followed by a biotinylated antibody against oxidized

HDL, which can then be visualized using standard Western blot techniques. This technique can reveal the molecular weight of the receptor and subsequent sequencing of the band from a coomassie gel can reveal the receptor identity. Optimization of several steps will be necessary for this technique to be successful, including membrane permeabilization that preserves the structure and binding activity of the receptor, conditions under which to bind the oxidized HDL ligand and wash steps to reduce non- specific binding.

Another interesting question raised by the work presented in this thesis is the identity of the amino acids in apoA1 that mediate the pro-inflammatory activity of oxidized HDL. MPO generated halogenating oxidants can modify a variety of amino acid residues with susceptible side chains including cysteine, methionine, tryptophan, tyrosine, histidine, lysine, arginine and glutamine. Previous work from our lab has identified tyrosine and tryptophan residues as targets for MPO mediated oxidation and that the oxidation of these residues impairs the cholesterol efflux and LCAT activating activity of apoA1 (88, 95). We hypothesized that these residues may also be involved in the gain of

156 pro-inflammatory function upon oxidation. It was surprising that oxidation of tyrosine, tryptophan or methionine residues was not involved in the gain of function activity of oxidized HDL. However, there remain many alternate residues that are sensitive to MPO mediated oxidation, including lysine (apoA1 has 21 lysines). Lysine residues can be reductively methylated and nascent HDL that is generated with this apoA1 can be tested to determine if it is capable of increasing surface VCAM-1 protein level upon oxidation.

If this oxidized nascent HDL is unable to increase surface VCAM-1 protein level, each of the lysine residues can be mutated in turn and the activity of the various nascent HDL generated with such apoA1 can be examined upon oxidation. It is possible that oxidation of two or more residues is necessary for the gain of pro-inflammatory activity, in which case, mutation of each amino acid, in turn, will not identify the responsible residues. An alternate approach to identifying the amino acid residues could include generating nascent HDL with heavy-isotope (15 N) labeled apoA1 to use as an internal standard and monitoring the loss of amino acid residues in oxidized unlabeled nascent HDL using mass spectrometry. A significant loss of one or more amino acids upon oxidation may indicate that these residues are involved in the pro-inflammatory activity of oxidized

HDL. These findings can be confirmed by generating apoA1 with the identified residues mutated, incorporating the apoA1 into nascent HDL, oxidizing the nascent HDL and monitoring the ability of this oxidized HDL to upregulate surface VCAM-1 protein levels on endothelial cells.

Another question raised by the work presented in this thesis is the identity of the amino acids in apoA1 that are involved in binding to SR-B1 and how oxidation of these residues impairs binding between apoA1 and SR-B1. Hydrogen-deuterium exchange

157 mass spectrometry (H-D exchange MS) is an elegant method to identify sites of binding between interacting proteins and has been used successfully in our lab to map the binding regions between apoA1 and LCAT (88). H-D exchange MS takes advantage of the fact that amide hydrogens in a peptide bond will exchange protons readily with the solvent. If the solvent is deuterated, the amide hydrogens will be exchanged for deuterium.

Decreasing the pH of the solution quenches the exchange reaction after which the protein is cleaved by trypsin and the peptide fragments analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS). To characterize the binding regions between apoA1 and SR-B1, the exchange reaction of apoA1 is performed both in the absence and presence of SR-B1. The regions on apoA1 that bind to SR-B1 will be less solvent accessible and will therefore be “protected” from the exchange reaction. Once the binding site on apoA1 is identified, site directed mutagenesis can be used to mutate these amino acid residues. Nascent HDL can be generated with the mutant apoA1 and its capacity to bind to SR-B1 can be determined. If we observe a reduction in the binding between nascent HDL and SR-B1, this offers confirmation that the identified amino acids in apoA1 are truly involved in the binding interaction with SR-B1. SR-B1 is a membrane protein that is glycosylated and has six cysteine residues (46). Generating a fusion protein of the extracellular domain of SR-B1 (which is the domain involved in apoA1/HDL binding) that can bind to nascent HDL in solution is critical to conducting the H-D exchange MS experiment. Initial attempts to generate such a fusion protein “SR-B1-Fc”

(extracellular domain of SR-B1 fused to Fc region of IgG) in mammalian cells were successful but the yield of the fusion protein was very low and would have been difficult to produce in the quantities needed for structural and functional characterization. In an

158 effort to increase yield and circumvent any difficulty that glycosylation may pose during

H-D exchange MS, a second SR-B1 fusion protein with an N-terminal maltose binding protein (MBP) tag and a C-terminal 6x histidine tag (MBP-SR-B1-6x His) was produced in E.coli. Unfortunately, while this fusion protein was soluble and the yield was high, it failed to have any binding activity towards nascent HDL in solution. Native gel analysis indicated that the fusion protein aggregated substantially in solution. Future work will be directed towards producing a functional SR-B1 fusion protein in E.coli using various refolding strategies in vitro or by producing the fusion protein in the periplasm of E.coli, where the oxidized environment is more amenable to disulfide bond formation. If this fails, using the SR-B1-Fc fusion protein can be reconsidered. A combination of an adenovirus based expression vector to transform mammalian cells with the DNA of the

SR-B1-Fc fusion protein and hollow fiber technology to grow the mammalian cells may improve yield substantially. While these technologies were not readily available at the time this project was initiated, these technologies have now been established in our lab to produce protein.

The impact of oxidation of HDL on other non-cholesterol efflux activities of the lipoprotein remains to be determined. For example, platelet activation can be determined by measuring surface P-selectin expression level and agonist mediated aggregation after exposure to oxidized HDL (162). Animal models of thrombosis (ex: ferric chloride induced arterial thrombosis) can be used to compare the effects of native vs. oxidized

HDL on platelet function by injecting native HDL or oxidized HDL into apoA1 knock- out mice. If oxidized HDL is demonstrated to be less anti-thrombotic than native HDL, the mechanism of the loss of activity can be elucidated by examining the effect of

159 oxidized HDL on various aspects of the coagulation process, including its effects on coagulation factors in the clotting cascade, prostacyclin and thromboxane A2 synthesis

(the balance of these molecules is essential to thrombosis), expression of COX enzymes

(which regulate prostacyclin synthesis) and the signaling pathways that mediate COX expression. The effects of oxidized HDL on other non-cholesterol efflux HDL functions such as migration and proliferation of endothelial cells, anti-oxidant activity, inhibition of pro-inflammatory cytokine production, inhibition of monocyte migration and the impact that oxidized HDL has on the mechanism of action of these effects remains to be elucidated.

MPO mediated oxidation is one of the many factors that influence the function of

HDL. Not surprisingly, the apolipoprotein composition of HDL also influences the cholesterol efflux and non-efflux activities of the lipoprotein. Apolipoprotein A2 (apoA2) is the second most abundant apolipoprotein in HDL and spherical HDL that contains both apoA1 and apoA2 constitutes approximately 30% of the total HDL particles (32). The atheroprotective role of apoA2 is controversial. Clinical epidemiologic studies have failed to identify an unequivocal relationship between apoA2 levels and risk of atherosclerosis (123, 124). Animal and in vitro data is also inconclusive about the role that apoA2 plays in the reverse cholesterol transport pathway (37, 125, 127). The work described in the second part of this thesis provides evidence that apoA2 containing HDL is less effective at promoting RCT in vivo and is also less anti-apoptotic and anti- inflammatory in vitro. Further, we demonstrate that MPO mediated oxidation of apoA2 containing HDL generates a particle that is more pro-inflammatory, as monitored by

160 surface VCAM-1 protein levels and NF-ț%DFWLYDWLRQWKDQ+'/WKDWGRHVQRWFRQWDLQ apoA2.

Future work will focus on the mechanism of the decreased anti-apoptotic and anti- inflammatory activity of apoA2 containing HDL. Both the anti-apoptotic and anti- inflammatory activity of HDL are mediated by the HDL receptor, SR-B1. We hypothesize that apoA2 containing HDL is less efficient at binding to SR-B1 and thus, less effective in its anti-apoptotic and anti-inflammatory activity. This hypothesis can be tested by determining the binding of labeled spherical HDL containing only apoA1 vs. spherical HDL containing both apoA1 and apoA2 to cells transfected with SR-B1. Other future directions include delineating the mechanism of reduced RCT activity in apoA2 transgenic mice compared to control mice. The percent fecal cholesterol excretion (a measure of RCT) was significantly lower in mice overexpressing human apoA2 even though a higher proportion of the injected cholesterol was transferred into plasma from the cholesterol loaded macrophages. In vitro analysis similarly demonstrated that apoA2 containing HDL was equally effective as HDL containing only apoA1 in transferring cholesterol from cholesterol loaded macrophages. We also assessed the effect of apoA2 on the later steps of the RCT pathway involving hepatic [3H] cholesterol uptake and flux of cholesterol from the liver to bile, ultimately to be excreted in the feces. Analysis of hepatic radioactivity counts revealed a significant reduction in counts in the apoA2 transgenic mice, suggesting that hepatic uptake of cholesterol was reduced. The receptor primarily responsible for hepatic uptake of cholesterol is SR-B1 and there are three possible explanations (or a combination of these) for the lowered hepatic cholesterol uptake in apoA2 transgenic mice. The first possibility is that apoA2 containing HDL

161 binds less efficiently to SR-B1 (which would also explain the reduction in anti-apoptotic and anti-inflammatory activity of apoA2 containing HDL). The second possibility is that apoA2 containing HDL is less efficient at transferring cholesterol through SR-B1 into the liver. A third possibility is that apoA2 transgenic mice have lower hepatic expression of

SR-B1. Each of these possibilities can be easily tested. Binding studies between labeled

[125I] HDL containing apoA2 and labeled [125I] HDL containing only apoA1 can be performed in cells transfected with SR-B1 or Fu5AH rat liver hepatoma cells that express high levels of SR-B1. Cholesterol transfer activity of apoA2 containing HDL vs. HDL containing only apoA1 can be determined using [3H] cholesterol ester labeled lipoproteins incubated with cells at 37°C, subsequently dissolving the cells with sodium hydroxide and counting the cell associated radioactivity. Alternatively, serum samples from the 48-hour time point of the reverse cholesterol transport experiment, which contain [3H] cholesterol and [3H] cholesterol ester, can be applied to Fu5AH rat liver hepatoma cells, the lipids extracted and level of tritium label determined to measure SR-

B1 mediated cholesterol uptake activity. Finally, hepatic SR-B1 mRNA levels can be measured in apoA2 transgenic mice and controls using real time polymerase chain reaction (RT-PCR) and SR-B1 protein level can be determined using western blotting.

The final step in the RCT pathway is the movement of cholesterol from the liver to the bile for excretion in the feces. We also measured counts in the bile to determine if there was a change in the flux of cholesterol through this pathway in apoA2 transgenic mice compared to controls. As expected, the counts in the bile were lower in the apoA2 transgenic mice. Future work will examine hepatic mRNA levels of the bile transporters

ABCG5 and ABCG8 as well as protein level of ABCG5/ABCG8 heterodimer to

162 determine if there is any difference between the apoA2 transgenic mice and control mice.

Other steps of the reverse cholesterol transport pathway mediated in plasma such as esterification of HDL cholesterol by lecithin cholesterol acyl transferase (LCAT) could also be affected in the apoA2 transgenic mice. The LCAT cholesterol esterification rate in whole plasma can be measured by incubating non-radioactive plasma with a BSA solution containing [3H] cholesterol and extracting lipids by thin layer chromatography

(TLC) to measure the conversion rate of [3H] cholesterol to [3H] cholesterol ester.

In conclusion, the work presented in this thesis describes two conditions under which HDL loses some of its atheroprotective functions. This research is novel in that few studies have looked at the role of oxidative modification and apolipoprotein composition in modulating the non-cholesterol efflux activities of HDL. Further elucidation of the mechanisms involved in the loss of non-cholesterol efflux activities of

HDL can not only provide insights into the initiation and progression of CVD but also suggest new diagnostic and therapeutic targets.

163 REFERENCES

1. Murray, C. J., and A. D. Lopez. 1997. Global mortality, disability, and the

contribution of risk factors: Global burden of disease study. Lancet 349:1436-

1442.

2. Ross, R. 1999. Atherosclerosis -- An Inflammatory Disease. N Engl J Med

340:115-126.

3. Lakatta, E. G., M. Wang, and S. S. Najjar. 2009. Arterial Aging and Subclinical

Arterial Disease are Fundamentally Intertwined at Macroscopic and Molecular

Levels. Medical Clinics of North America 93:583.

4. Hansson, G. K. 2005. Inflammation, Atherosclerosis and Coronary Artery Disease.

N Engl J Med 352:1685-1695.

5. Valgimigli, M., E. Merli, P. Malagutti, O. Soukhomovskaia, C. Giordano, G.

Macri, and R. Ferrari. 2003. Endothelial dysfunction in acute and chronic

coronary syndromes: evidence for a pathogenetic role of oxidative stress.

Archives of Biochemistry and Biophysics 420:255-261.

6. Ignarro, L. J., G. M. Buga, K. S. Wood, G. Byrns, and G. Chaudhuri. 1987.

Endothelium-derived relaxing factor produced and released from artery and vein

is nitric oxide. Proceedings of the National Academy of Sciences 84:9265-9269.

7. Galkina, E., and K. Ley. 2007. Vascular adhesion molecules in atherosclerosis.

Arterioscler Thromb Vasc Biol 27:2292-2301.

8. Cybulsky, M. I., K. Iiyama, H. Li, S. Zhu, M. Chen, M. Iiyama, V. Davis, J. C.

Gutierrez-Ramos, P. W. Connelly, and D. S. Milstone. 2001. A major role for

164 VCAM-1, but not ICAM-1, in early atherosclerosis. J. Clin. Investig. 107:1255-

1262.

9. Blankenberg, S., S. Barbaux, and L. Tiret. 2003. Adhesion molecules and

atherosclerosis. Atherosclerosis 170:191.

10. Niu, J., and P. E. Kolattukudy. 2009. Role of MCP-1 in cardiovascular disease:

molecular mechanisms and clinical implications. Clin Sci (Lond) 117:95-109.

11. Febbraio, M., D. P. Hajjar, and R. Silverstein. 2001. CD36: a class B scavenger

receptor involved in angiogenesis, atherosclerosis, inflammation, and lipid

metabolism. J. Clin. Investig. 108:785-791.

12. Woollard, K. J., and F. Geissmann. 2010. Monocytes in atherosclerosis: subsets

and functions. Nat Rev Cardiol 7:77-86.

13. Orsini, E. a., and G. B. b. Zito. Matching pathophysiology and evidence-based

medicine for optimal management of ischemic heart disease. [Miscellaneous

Article]. Journal of Cardiovascular Medicine June 2010;11(6):469-476.

14. Mathiesen, E. B., K. H. Bonaa, and O. Joakimsen. 2001. Echolucent Plaques Are

Associated With High Risk of Ischemic Cerebrovascular Events in Carotid

Stenosis : The Tromso Study. Circulation 103:2171-2175.

15. Kofoed, S. C., M.-L. M. Grønholdt, J. Bismuth, J. E. Wilhjelm, H. Sillesen, and B.

G. Nordestgaard. 2002. Echolucent, rupture-prone carotid plaques associated with

elevated triglyceride-rich lipoproteins, particularly in women. J. Vasc. Surg.

36:783.

16. Back, M., D. F. Ketelhuth, and S. Agewall. 2010. Matrix metalloproteinases in

atherothrombosis. Prog Cardiovasc Dis 52:410-428.

165 17. Farb, A., A. P. Burke, A. L. Tang, Y. Liang, P. Mannan, J. Smialek, and R.

Virmani. 1996. Coronary Plaque Erosion Without Rupture Into a Lipid Core : A

Frequent Cause of Coronary Thrombosis in Sudden Coronary Death. Circulation

93:1354-1363.

18. Kavurma, M. M., R. Bhindi, H. C. Lowe, C. Chesterman, and L. M. Khachigian.

2005. Vessel wall apoptosis and atherosclerotic plaque instability. Journal of

Thrombosis and Haemostasis 3:465-472.

19. Beisiegel, U. 1998. Lipoprotein metabolism. Eur. Heart. J 19:A20-23.

20. Eisenberg, S., and R. I. Levy. 1975. Lipoprotein metabolism. Advances in Lipid

Research 13:1-89.

21. Chen, Z., R. Peto, R. Collins, S. MacMahon, J. Lu, and W. Li. 1991. Serum

cholesterol concentration and coronary heart disease in population with low

cholesterol concentrations. British Medical Journal 303:276-282.

22. Stamler, J., O. Vaccaro, J. D. Neaton, and D. Wentworth. 1993. Diabetes, other

risk factors, and 12 year cardiovascular mortality for men screened in the Multiple

Risk Factor Intervention Trial. Diabetes Care 16:434-444.

23. Calabresi, L., M. Gomaraschi, and G. Franceschini. 2003. Endothelial Protection

by High Density Lipoproteins: From Bench to Bedside. Arterioscler Thromb Vasc

Biol 23:1724-1731.

24. Von Eckardstein, A., M. Hersberger, and L. Rohrer. 2005. Current understanding

of metabolism and biological actions of HDL. Curr. Opin. Clin. Nutr. Metab.

Care 8:147-152.

166 25. Castelli, W. P., R. J. Garrison, P. W. Wilson, R. D. Abbott, S. Kalousdian, and W.

B. Kannel. 1986. Incidence of coronary heart disease and lipoprotein cholesterol

levels. The Framingham Study. JAMA 256:2835-2838.

26. Ameli, S., A. Hultgardh Nilsson, B. Cercek, P. K. Shah, J. S. Forrester, H.

Ageland, and J. Nilsson. 1994. Recombinant apolipoprotein A-I milano reduces

intimal thickening after balloon injury in hypercholesterolemic rabbits.

Circulation 90:1935-1941.

27. Shah, P. K., J. Nilsson, S. Kaul, M. C. Fishbein, H. Ageland, A. Hamsten, J.

Johansson, F. Karpe, and B. Cercek. 1998. Effects of recombinant apolipoprotein

A-I milano on aortic atherosclerosis in apolipoprotein E deficient mice.

Circulation 97:780-785.

28. Shah, P. K., J. Yano, O. Reyes, K. Y. Chyu, S. Kaul, C. L. Bisgaier, S. Drake, and

B. Cercek. 2001. High dose recombinant apolipoprotein A1 milano mobilizes

tissue cholesterol and rapidly reduces plaque lipid and macrophage content in

apolipoprotein E deficient mice: potential implications for acute plaque

stabilization Circulation 103:3047-3050.

29. Chiesa, G., E. Monteggia, M. Marchesi, P. Lorenzon, M. Laucello, V. Lorusso, C.

Di Mario, E. Karvouni, R. S. Newton, C. L. Bisgaier, G. Franceschini, and C. R.

Sirtori. 2002. Recombinant apolipoprotein A-I milano infusion into rabbit carotid

artery rapidly removes lipid from fatty streaks. Circulation Research 90:974-980.

30. Boisvert, W. A., A. S. Black, and L. K. Curtiss. 1999. ApoA1 Reduces Free

Cholesterol Accumulation in Atherosclerotic Lesions of ApoE–Deficient Mice

167 Transplanted With ApoE–Expressing Macrophages Arteriosclerosis, Thrombosis,

and Vascular Biology 19:525-530.

31. Wu, Z., V. Gogonea, X. Lee, M. A. Wagner, X.-M. Li, Y. Huang, A. Undurti, R.

P. May, M. Haertlein, M. Moulin, I. Gutsche, G. Zaccai, J. A. DiDonato, and S. L.

Hazen. 2009. Double Superhelix Model of High Density Lipoprotein. Journal of

Biological Chemistry 284:36605-36619.

32. Tailleux, A., P. Duriez, J. C. Fruchart, and V. Clavey. 2002. Apolipoprotein A-II,

HDL metabolism and atherosclerosis. Atherosclerosis 164:1-13.

33. Warden, C. H., C. C. Herdrick, J. H. Qiao, L. W. Castellani, and A. J. Lusis. 1993.

Atherosclerosis in transgenic mice overexpressing apolipoprotein A-II. Science

261:469-472.

34. Tailleux, A., M. Bouly, G. Luc, G. Castro, J. M. Caillaud, N. Hennuyer, P.

Poulain, J. C. Fruchart, N. Duverger, and C. Fievet. 2000. Decreased

susceptibility to diet induced atherosclerosis in human apolipoprotein A-II

transgenic mice. 20:2453-2458.

35. Lagrost, L., C. Dengremont, A. Athias, C. de Geitere, J. C. Fruchart, C. Lallemant,

P. Gambert, and G. Castro. 1995. Modulation of cholesterol efflux from Fu5AH

hepatoma cells by the apolipoprotein content of high density lipoprotein particles.

Particles containing various proportions of apolipoproteins A-I and A-II. J. Biol.

Chem. 270:13004-13009.

36. Stein, O., Y. Dabach, G. Hollander, M. Ben-Naim, K. Oette, and Y. Stein. 1995.

Effects of interactions of apolipoprotein A-II with apolipoproteins A-I or A-IV on

168 [3H]cholesterol efflux and uptake in cell culture. Biochim. Biophys. Acta.

1257:174-180.

37. Hedrick, C. C., and A. J. Lusis. 1994. Apolipoprotein A-II: a protein in search of

a function. Canadian Journal of Cardiology 10:453-459.

38. Fielding, C. J., and P. E. Fielding. 1995. Molecular physiology of reverse

cholesterol transport. J. Lipid Res. 36:211-228.

39. Khera, A. V., and D. J. Rader. 2010. Future Therapeutic Directions in Reverse

Cholesterol Transport. Curr. Atheroscler. Rep. 12:73-81.

40. Tall, A. 1998. An overview of reverse cholesterol transport. Eur. Heart. J

19:A31-35.

41. Calvo, D., and M. A. Vega. 1993. Identification, primary structure, and

distribution of CLA-1, a novel member of the CD36/LIMPII gene family. J. Biol.

Chem. 268:18929-18935.

42. Calvo, D., J. Dopazo, and M. A. Vega. 1995. The CD36, CLA-1 and LIMPII gene

family: cellular distribution, chormosomal location and genetic evolution.

Genomics 25:100-106.

43. Ji, Y., N. Wang, R. Ramakrishnan, E. Sehayek, D. Huszar, J. L. Breslow, and A.

R. Tall. 1999. Hepatic scavenger receptor BI promotes rapid clearance of high

density lipoprotein free cholesterol and its transport into bile. Journal of

Biological Chemistry 274:33398-33402.

44. Hirano, K., S. Yamashita, Y. Nakagawa, T. Ohya, F. Matsuura, K. Tsukamoto, Y.

Okamoto, A. Matsuyama, K. Matsumoto, J. Miyagawa, and Y. Matsuzawa. 1999.

Expression of human scavenger receptor class B type I in cultured human

169 monocyte-derived macrophages and atherosclerotic lesions. Circulation Research

85:108-116.

45. Yeh, Y. C., G. Y. Hwang, I. P. Liu, and V. C. Yang. 2002. Identification and

expression of scavenger receptor SR-BI in endothelial cells and smooth muscle

cells of rat aorta in vitro and in vivo. Atherosclerosis 161:95-103.

46. Rigotti, A., S. L. Acton, and M. Krieger. 1995. The Class B Scavenger Receptors

SR-BI and CD36 Are Receptors for Anionic Phospholipids. Journal of Biological

Chemistry 270:16221-16224.

47. Ohgami, N., R. Nagai, A. Miyazaki, M. Ikemoto, H. Arai, S. Horiuchi, and H.

Nakayama. 2001. Scavenger Receptor Class B Type I-mediated Reverse

Cholesterol Transport Is Inhibited by Advanced Glycation End Products. Journal

of Biological Chemistry 276:13348-13355.

48. Acton, S., A. Rigotti, K. T. Landschulz, S. Xu, H. H. Hobbs, and M. Krieger.

1996. Identification of scavenger receptor SR-B1 as a high density lipoprotein

receptor. Science 271:518-520.

49. Xiangju, G., B. Trigatti, X. Shangzhe, S. Acton, J. Babitt, and M. Krieger. 1998.

The efficient cellular uptake of high density lipoprotein lipids via scavenger

receptor Class B Type I requires not only receptor mediated surface binding but

also receptor specific lipid transfer mediated by its extracellular domain. J. Biol.

Chem. 273:26338-26348.

50. Rigotti, A., H. E. Miettinen, and M. Krieger. 2003. The Role of the High-Density

Lipoprotein Receptor SR-BI in the Lipid Metabolism of Endocrine and Other

Tissues. Endocr Rev 24:357-387.

170 51. Kozarsky, K. F., M. H. Donahee, A. Rigotti, S. N. Iqbal, E. R. Edelman, and M.

Krieger. 1997. Overexpression of the HDL receptor SR-B1 alters plasma HDL

and bile cholesterol levels. Nature 387:414-417.

52. Huszar, D., M. L. Varban, F. Rinninger, R. Feeley, T. Arai, V. Fairchild-Huntress,

M. J. Donovan, and A. R. Tall. 2000. Increased LDL Cholesterol and

Atherosclerosis in LDL Receptor-Deficient Mice With Attenuated Expression of

Scavenger Receptor B1. Arterioscler Thromb Vasc Biol 20:1068-1073.

53. Arai, T., N. Wang, M. Bezouevski, C. Welch, and A. R. Tall. 1999. Decreased

Atherosclerosis in Heterozygous Low Density Lipoprotein Receptor-deficient

Mice Expressing the Scavenger Receptor BI Transgene. Journal of Biological

Chemistry 274:2366-2371.

54. Mineo, C., I. S. Yuhanna, M. J. Quon, and P. W. Shaul. 2003. High density

lipoprotein-induced endothelial nitric-oxide synthase activation is mediated by

Akt and MAP kinases. J. Biol. Chem. 278:9142-9149.

55. Li, X.-A., L. Guo, J. L. Dressman, R. Asmis, and E. J. Smart. 2005. A Novel

Ligand-independent Apoptotic Pathway Induced by Scavenger Receptor Class B,

Type I and Suppressed by Endothelial Nitric-oxide Synthase and High Density

Lipoprotein. J. Biol. Chem. 280:19087-19096.

56. Clay, M. A., D. H. Pyle, K.-A. Rye, and P. J. Barter. 2000. Formation of

Spherical, Reconstituted High Density Lipoproteins Containing Both

Apolipoproteins A-I and A-II Is Mediated by Lecithin:Cholesterol

Acyltransferase. Journal of Biological Chemistry 275:9019-9025.

171 57. Barter, P. J., S. Nicholls, K.-A. Rye, G. M. Anantharamaiah, M. Navab, and A. M.

Fogelman. 2004. Antiinflammatory Properties of HDL. Circ Res 95:764-772.

58. Navab, M., G. M. Ananthramaiah, S. T. Reddy, B. J. Van Lenten, B. J. Ansell, G.

C. Fonarow, K. Vahabzadeh, S. Hama, G. Hough, N. Kamranpour, J. A. Berliner,

A. J. Lusis, and A. M. Fogelman. 2004. Thematic review series: The Pathogenesis

of Atherosclerosis The oxidation hypothesis of atherogenesis: the role of oxidized

phospholipids and HDL. J. Lipid Res. 45:993-1007.

59. Getz, G. S., and C. A. Reardon. 2004. Paraoxonase, a cardioprotective enzyme:

continuing issues. Current opinion in lipidology 15:261-267.

60. Cockerill, G. W., K.-A. Rye, J. R. Gamble, M. A. Vadas, and P. J. Barter. 1995.

High-Density Lipoproteins Inhibit Cytokine-Induced Expression of Endothelial

Cell Adhesion Molecules. Arterioscler. Thromb. Vasc. Biol. 15:1987-1994.

61. Baker, P. W., K.-A. Rye, J. R. Gamble, M. A. Vadas, and P. J. Barter. 1999.

Ability of reconstituted high density lipoproteins to inhibit cytokine-induced

expression of vascular cell adhesion molecule-1 in human umbilical vein

endothelial cells. J. Lipid Res. 40:345-353.

62. Dimayuga, P., J. Zhu, S. Oguchi, K.-Y. Chyu, X.-O. H. Xu, J. Yano, P. K. Shah, J.

Nilsson, and B. Cercek. 1999. Reconstituted HDL Containing Human

Apolipoprotein A-1 Reduces VCAM-1 Expression and Neointima Formation

Following Periadventitial Cuff-Induced Carotid Injury in apoE Null Mice.

Biochemical and Biophysical Research Communications 264:465-468.

63. Zhang, R., M.-L. Brennan, Z. Shen, J. C. MacPherson, D. Schmitt, C. E. Molenda,

and S. L. Hazen. 2002. Myeloperoxidase Functions as a Major Enzymatic

172 Catalyst for Initiation of Lipid Peroxidation at Sites of Inflammation. Journal of

Biological Chemistry 277:46116-46122.

64. Podrez, E. A., H. M. Abu-Soud, and S. L. Hazen. 2000. Myeloperoxidase-

generated oxidants and atherosclerosis. Free Radical Biology and Medicine

28:1717-1725.

65. Shultz, J., and K. Kaminker. 1962. Myeloperoxidase of the leucocyte of normal

human blood. Arch Biochem Biophys 96:465-467.

66. Klebanoff, S. J. 1967. A peroxidase mediated anti-microbial system in leukocytes.

Journal of Clinical Investigation 46:1078-1085.

67. Klebanoff, S. J. 1970. Myeloperoxidase: contribution to the microbicidal activity

of intact leukocytes. Science 169:1095-1097.

68. Daugherty, A., J. L. Dunn, D. L. Rateri, and J. W. Heinecke. 1994.

Myeloperoxidase, a catalyst for lipoprotein oxidation, is expressed in human

atherosclerotic lesions. The Journal of Clinical Investigation 94:437-444.

69. Hazen, S. L., and J. W. Heinecke. 1997. 3-Chlorotyrosine, a specific marker of

myeloperoxidase-catalyzed oxidation, is markedly elevated in low density

lipoprotein isolated from human atherosclerotic intima. The Journal of Clinical

Investigation 99:2075.

70. Kutter, D., P. Devaquet, G. Vanderstocken, J. M. Paulus, V. Marchal, and A.

Gothot. 2000. Consequences of total and sub-total myeloperoxidase deficiency:

risk or benefit? Acta Haematol 104:10-15.

71. Brennan, M.-L., M. S. Penn, F. Van Lente, V. Nambi, M. H. Shishehbor, R. J.

Aviles, M. Goormastic, M. L. Pepoy, E. S. McErlean, E. J. Topol, S. E. Nissen,

173 and S. L. Hazen. 2003. Prognostic Value of Myeloperoxidase in Patients with

Chest Pain. N Engl J Med 349:1595-1604.

72. Marie-Luise Brennan, M. M. A., Diana M. Shih, Xiao-Dan Qu, Xuping Wang,

Asha C. Mehta, Lesley L. Lim, Weibin Shi, Stanley L. Hazen, Jason S. Jacob, Jan

R. Crowley, Jay W. Heinecke and Aldons J. Lusis. 2001. Increased

atherosclerosis in myeloperoxidase-deficient mice. J Clin Invest 107:419-430.

73. Brennan, M.-L., W. Wu, X. Fu, Z. Shen, W. Song, H. Frost, C. Vadseth, L.

Narine, E. Lenkiewicz, M. T. Borchers, A. J. Lusis, J. J. Lee, N. A. Lee, H. M.

Abu-Soud, H. Ischiropoulos, and S. L. Hazen. 2002. A Tale of Two

Controversies.Defining both the role of peroxidases in nitrotyrosine formation in

vivo using eosinophil peroxidase and myeloperoxidase-deficient mice, and the

nature of peroxidase-generated reactive nitrogen species. J. Biol. Chem.

277:17415-17427.

74. Podrez, E. A., D. Schmitt, H. F. Hoff, and S. L. Hazen. 1999. Myeloperoxidase-

generated reactive nitrogen species convert LDL into an atherogenic form in vitro.

J. Clin. Invest. 103:1547-1560.

75. Podrez, E. A., E. Poliakov, Z. Shen, R. Zhang, Y. Deng, M. Sun, P. J. Finton, L.

Shan, B. Gugiu, P. L. Fox, H. F. Hoff, R. G. Salomon, and S. L. Hazen. 2002.

Identification of a Novel Family of Oxidized Phospholipids That Serve as

Ligands for the Macrophage Scavenger Receptor CD36. J. Biol. Chem.

277:38503-38516.

76. Zheng, L., B. Nukuna, M.-L. Brennan, S. Mingjiang, M. Goormastic, M. Settle, D.

Schmitt, X. Fu, L. Thomson, P. L. Fox, H. Ischiropoulos, J. D. Smith, M. Kinter,

174 and S. L. Hazen. 2004. Apolipoprotein A1 is a selective target for

myeloperoxidase-catalyzed oxidation and functional impairment in subjects with

cardiovascular disease. J. Clin. Investig. 114:529-541.

77. Zheng, L., M. Settle, G. Brubaker, D. Schmitt, S. L. Hazen, J. D. Smith, and M.

Kinter. 2005. Localization of Nitration and Chlorination Sites on Apolipoprotein

A-I Catalyzed by Myeloperoxidase in Human Atheroma and Associated

Oxidative Impairment in ABCA1-dependent Cholesterol Efflux from

Macrophages. J. Biol. Chem. 280:38-47.

78. Hessler, J. R., A. L. J. Robertson , and G. M. r. Chisolm. 1979. LDL-induced

cytotoxicity and its inhibition by HDL in human vascular smooth muscle and

endothelial cells in culture. Atherosclerosis 32:213-229.

79. Van Lenten, B. J., S. Y. Hama, F. C. de Beer, D. M. Stafforini, T. M. McIntyre, S.

M. Prescott, B. N. La Du, A. M. Fogelman, and M. Navab. 1995. Anti-

inflammatory HDL becomes pro-inflammatory during the acute phase response.

Loss of protective effect of HDL against LDL oxidation in aortic wall cell

cocultures. J Clin Invest 96:2758-2767.

80. Van Lenten, B. J., A. C. Wagner, D. P. Nayak, S. Hama, M. Navab, and A. M.

Fogelman. 2001. High-density lipoprotein loses its anti-inflammatory properties

during acute influenza a infection. Circulation 103:2283-2288.

81. Cockerill, G. W., T. Y. Huehns, A. Weerasinghe, C. Stocker, P. G. Lerch, N. E.

Miller, and D. O. Haskard. 2001. Elevation of Plasma High-Density Lipoprotein

Concentration Reduces Interleukin-1-Induced Expression of E-Selectin in an In

Vivo Model of Acute Inflammation. Circulation 103:108-112.

175 82. Nicholls, S. J., L. Zheng, and S. L. Hazen. 2005. Formation of Dysfunctional

High-Density Lipoprotein by Myeloperoxidase. Trends Cardiovasc. Med. 15:212.

83. Navab, M., S. T. Reddy, B. J. Van Lenten, G. M. Anantharamaiah, and A. M.

Fogelman. 2009. The role of dysfunctional HDL in atherosclerosis. J. Lipid Res.

50:S145-149.

84. Ansell, B. J., M. Navab, S. Hama, N. Kamranpour, G. C. Fonarow, G. Hough, S.

Rahmani, R. Mottahedeh, R. Dave, S. T. Reddy, and A. M. Fogelman. 2003.

Inflammatory/anti-inflammatory properties of high density lipoprotein distinguish

patients from control subjects better than high density lipoprotein cholesterol

levels and are favorably affected by simvastatin treatment. Circulation 108:2751-

2756.

85. McGillicuddy, F. C., M. de la Llera Moya, C. C. Hinkle, M. R. Joshi, E. H.

Chiquoine, J. T. Billheimer, G. H. Rothblat, and M. P. Reilly. 2009. Inflammation

Impairs Reverse Cholesterol Transport In Vivo. Circulation 119:1135-1145.

86. Bergt, C., S. Pennathur, X. Fu, J. Byun, K. O'Brien, T. O. McDonald, P. Singh, G.

M. Anantharamaiah, A. Chait, J. Brunzell, R. L. Geary, J. F. Oram, and J. W.

Heinecke. 2004. The myeloperoxidase product hypochlorous acid oxidizes HDL

in the human artery wall and impairs ABCA1-dependent cholesterol transport.

Proceedings of the National Academy of Sciences of the United States of America

101:13032-13037.

87. Shao, B., M. N. Oda, C. Bergt, X. Fu, P. S. Green, N. Brot, J. F. Oram, and J. W.

Heinecke. 2006. Myeloperoxidase Impairs ABCA1-dependent Cholesterol Efflux

176 through Methionine Oxidation and Site-specific Tyrosine Chlorination of

Apolipoprotein A-I. J. Biol. Chem. 281:9001-9004.

88. Wu, Z., M. A. Wagner, L. Zheng, J. S. Parks, J. M. Shy, J. D. Smith, V. Gogonea,

and S. L. Hazen. 2007. The refined structure of nascent HDL reveals a key

functional domain for particle maturation and dysfunction. Nat. Struct. Mol. Biol.

14:861.

89. Shao, B., G. Cavigiolio, N. Brot, M. N. Oda, and J. W. Heinecke. 2008.

Methionine oxidation impairs reverse cholesterol transport by apolipoprotein A-I.

Proceedings of the National Academy of Sciences 105:12224-12229.

90. Paromov, V. M., and R. E. Morton. 2003. Lipid Transfer Inhibitor Protein Defines

the Participation of High Density Lipoprotein Subfractions in Lipid Transfer

Reactions Mediated by Cholesterol Ester Transfer Protein (CETP). J. Biol. Chem.

278:40859-40866.

91. Osborne, J. C. J. 1968. Delipidation of plasma lipoproteins. Methods Enzymol.

128A:213-222.

92. Rye, K.-A., K. H. Garrety, and P. J. Barter. 1992. Changes in the size of

reconstituted high density lipoproteins during incubation with cholesteryl ester

transfer protein: the role of apolipoproteins. J. Lipid Res. 33:215-224.

93. Matz, C. E., and A. Jonas. 1982. Micellar complexes of human apolipoprotein A-I

with phosphatidylcholines and cholesterol prepared from cholate-lipid dispersions.

J. Biol. Chem. 257:4535-4540.

177 94. Park, Y. M., M. Febbraio, and R. Silverstein. 2009. CD36 modulates migration of

mouse and human macrophages in response to oxidized LDL and may contribute

to macrophage trapping in the arterial intima. J. Clin. Investig. 119:136-145.

95. Peng, D.-Q., Z. Wu, G. Brubaker, L. Zheng, M. Settle, E. Gross, M. Kinter, S. L.

Hazen, and J. D. Smith. 2005. Tyrosine Modification Is Not Required for

Myeloperoxidase-induced Loss of Apolipoprotein A-I Functional Activities. J.

Biol. Chem. 280:33775-33784.

96. Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extraction and

purification. Can. J. Biochem. Physiol. 37:911-917.

97. Bauer, J. A., J. A. Lupica, H. Schmidt, B. H. Morrison, R. M. Haney, R. K. Masci,

R. M. Lee, J. A. DiDonato, and D. J. Lindner. 2007. Nitrosylcobalamin

Potentiates the Anti-Neoplastic Effects of Chemotherapeutic Agents via

Suppression of Survival Signaling. PLoS ONE 2:e1313.

98. DiDonato, J. A., M. Hayakawa, D. M. Rothwarf, E. Zandi, and M. Karin. 1997. A

cytokine responsive IkappaB kinase that activates the transcription factor NF-

kappaB. Nature 388:548-554.

99. Greenberg, M. E., M. Sun, R. Zhang, M. Febbraio, R. Silverstein, and S. L. Hazen.

2006. Oxidized phosphatidylserine-CD36 interactions play an essential role in

macrophage-dependent phagocytosis of apoptotic cells. J. Exp. Med. 203:2613-

2625.

100. Hazen, S. L., and J. W. Heinecke. 1997. 3-Chlorotyrosine, a specific marker of

myeloperoxidase-catalyzed oxidation, is markedly elevated in low density

178 lipoprotein isolated from human atherosclerotic intima J. Clin. Investig. 99:2075-

2081.

101. Wang, Z., S. J. Nicholls, E. R. Rodriguez, O. Kummu, S. Horkko, J. Barnard, W.

F. Reynolds, E. J. Topol, J. A. DiDonato, and S. L. Hazen. 2007. Protein

carbamylation links inflammation, smoking, uremia and atherogenesis. Nat Med

13:1176.

102. Rosen, H., J. R. Crowley, and J. W. Heinecke. 2002. Human neutrophils use the

myeloperoxidase-hydrogen peroxide-chloride system to chlorinate but not nitrate

bacterial proteins during phagocytosis. J. Biol. Chem.:M202331200.

103. Nofer, J.-R., B. Levkau, I. Wolinska, R. Junker, M. Fobker, A. von Eckardstein,

U. Seedorf, and G. Assmann. 2001. Suppression of Endothelial Cell Apoptosis by

High Density Lipoproteins (HDL) and HDL-associated Lysosphingolipids. J. Biol.

Chem. 276:34480-34485.

104. Blanche, P. J., E. L. Gong, T. M. Forte, and A. V. Nichols. 1981. Characterization

of human high-density lipoproteins by gradient gel electrophoresis. Biochim.

Biophys. Acta. 665:408-419.

105. Cybulsky, M. I., and M. A. J. Gimbrone. 1991. Endothelial expression of a

mononuclear leukocyte adhesion molecule during atherogenesis. Science

251:788-791.

106. Nakashima, Y., E. W. Raines, A. S. Plump, J. L. Breslow, and R. Ross. 1998.

Upregulation of VCAM-1 and ICAM-1 at Atherosclerosis-Prone Sites on the

Endothelium in the ApoE-Deficient Mouse. Arterioscler Thromb Vasc Biol

18:842-851.

179 107. Kimura, T., C. Mogi, H. Tomura, A. Kuwabara, D.-S. Im, K. Sato, H. Kurose, M.

Murakami, and F. Okajima. 2008. Induction of Scavenger Receptor Class B Type

I Is Critical for Simvastatin Enhancement of High-Density Lipoprotein-Induced

Anti-Inflammatory Actions in Endothelial Cells. J Immunol 181:7332-7340.

108. Iademarco, M. F., J. J. McQuillan, G. D. Rosen, and D. C. Dean. 1992.

Characterization of the promoter for vascular cell adhesion molecule-1 (VCAM-

1). J. Biol. Chem. 267:16323-16329.

109. DiDonato, J. A., F. Mercurio, C. Rosette, J. Wu-Li, H. Suyang, S. Ghosh, and M.

Karin. 1996. Mapping the inducible IKB phosphorylation sites that signal its

ubiquitination and degradation. Mol. Cell. Biol. 16:1295-1304.

110. Tolle, M., A. Pawlak, M. Schuchardt, A. Kawamura, U. J. Tietge, S. Lorkowski,

P. Keul, G. Assmann, J. Chun, B. Levkau, M. van der Giet, and J.-R. Nofer. 2008.

HDL-Associated Lysosphingolipids Inhibit NAD(P)H Oxidase-Dependent

Monocyte Chemoattractant Protein-1 Production. Arterioscler Thromb Vasc Biol

28:1542-1548.

111. de Winther, M. P. J., K. W. van Dijk, L. M. Havekes, and M. H. Hofker. 2000.

Macrophage Scavenger Receptor Class A : A Multifunctional Receptor in

Atherosclerosis. Arterioscler Thromb Vasc Biol 20:290-297.

112. Peng, D.-Q., G. Brubaker, Z. Wu, L. Zheng, B. Willard, M. Kinter, S. L. Hazen,

and J. D. Smith. 2008. Apolipoprotein A-I Tryptophan Substitution Leads to

Resistance to Myeloperoxidase-Mediated Loss of Function. Arterioscler Thromb

Vasc Biol 28:2063-2070.

180 113. Tang, W. H. W., W. Tong, R. W. Troughton, M. G. Martin, K. Shrestha, A.

Borowski, S. Jasper, S. L. Hazen, and A. L. Klein. 2007. Prognostic Value and

Echocardiographic Determinants of Plasma Myeloperoxidase Levels in Chronic

Heart Failure. J. Am. Coll. Cardiol. 49:2364-2370.

114. Stelmaszynska, T., and M. Zgliczynski. 1978. N-(2-Oxoacyl)amino acids and

nitriles as final products of dipeptide chlorination mediated by the

myeloperoxidase/H2O2/Cl- system. European Journal of Biochemistry 92:301-

308.

115. Baldus, S., C. Heeschen, T. Meinertz, A. M. Zeiher, J. P. Eiserich, T. Munzel, M.

L. Simoons, C. W. Hamm, and C. I. on behalf of the. 2003. Myeloperoxidase

Serum Levels Predict Risk in Patients With Acute Coronary Syndromes.

Circulation 108:1440-1445.

116. Marijn, C. M., S. G. S. Erik, L. H. Stanley, N. v. M. Joram, K. Jan Albert, G. S.

Robert, J. W. Nicholas, L. Robert, J. P. K. John, K. Kay-Tee, and S. M.

Boekholdt. 2007. Serum Myeloperoxidase Levels Are Associated With the Future

Risk of Coronary Artery Disease in Apparently Healthy Individuals: The EPIC-

Norfolk Prospective Population Study. Journal of the American College of

Cardiology 50:159.

117. Gordon, T., W. P. Castelli, M. C. Hjortland, W. B. Kannel, and T. R. Dawber.

1977. High density lipoprotein as a protective factor against coronary heart

disease. The Framingham Study. The American Journal of Medicine 62:707-714.

181 118. Undurti, A., Y. Huang, J. A. Lupica, J. D. Smith, J. A. DiDonato, and S. L. Hazen.

2009. Modification of High Density Lipoprotein by Myeloperoxidase Generates a

Pro-inflammatory Particle. Journal of Biological Chemistry 284:30825-30835.

119. Eggerman, T. L., J. M. Hoeg, M. S. Meng, A. Tombragel, D. Bojanovski, and H.

B. Brewer, Jr. 1991. Differential tissue-specific expression of human apoA-I and

apoA-II. J. Lipid Res. 32:821-828.

120. Cheung, M. C., and J. J. Albers. 1984. Characterization of lipoprotein particles

isolated by immunoaffinity chromatography. Particles containing A-I and A-II

and particles containing A-I but no A-II. Journal of Biological Chemistry

259:12201-12209.

121. Brewer, H. B., S. E. Lux, R. Ronan, and K. M. John. 1972. Amino acid sequence

of human apoLp-Gln-II (apoA-II), an apolipoprotein isolated from the high-

density lipoprotein complex. Proc. Natl. Acad. Sci. 69.

122. Brewer, H. B., R. Ronan, M. Meng, and C. Bishop. 1986. Isolation and

characterization of apolipoproteins A-I, A-II, and A-IV. Methods Enzymol

128:223-246.

123. Deeb, S. S., K. Takata, R. L. Peng, G. Kajiyama, and J. J. Albers. 1990. A splice

junction mutation responsible for familial apolipoprotein A-II deficiency.

American Journal of Human Genetics 46:822-827.

124. Shadrina, M. I., P. A. Slominskii, N. A. Perova, and S. A. Limborskaia. 1997. The

apolipoprotein AII gene is not a risk factor for development of ischemic heart

disease in the Moscow population. Genetika 33:1316-1318.

182 125. Warden, C. H., C. C. Hedrick, J. H. Qiao, L. W. Castellani, and A. J. Lusis. 1993.

Atherosclerosis in transgenic mice overexpressing apolipoprotein A-II. Science

261:469-472.

126. Weng, W., and J. L. Breslow. 1996. Dramatically decreased high density

lipoprotein cholesterol, increased remnant clearance, and insulin hypersensitivity

in apolipoprotein A-II knockout mice suggest a complex role for apolipoprotein

A-II in atherosclerosis susceptibility. Proceedings of the National Academy of

Sciences of the United States of America 93:14788-14794.

127. Escola-Gil, J. C., A. Marzal-Casacuberta, J. Julve-Gil, B. Y. Ishida, J. Ordonez-

Llanos, L. Chan, F. Gonzalez-Sastre, and F. Blanco-Vaca. 1998. Human

apolipoprotein A-II is a pro-atherogenic molecule when it is expressed in

transgenic mice at a level similar to that in humans: evidence of a potentially

relevant species-specific interaction with diet. J. Lipid Res. 39:457-462.

128. Schultz, J. R., J. G. Verstuyft, E. L. Gong, A. V. Nichols, and E. M. Rubin. 1993.

Protein composition determines the anti-atherogenic properties of HDL in

transgenic mice. 365:762-764.

129. Barbaras, R., P. Puchois, J. Fruchart, and G. Ailhaud. 1987. Cholesterol efflux

from cultured adipose cells is mediated by LpAI particles but not by LpAI:AII

particles. Biochem. Biophys. Res. Commun. 142:63-69.

130. Lagrost, L., C. Dengremont, A. Athias, C. de Geitere, J.-C. Fruchart, C. Lallemant,

P. Gambert, and G. Castro. 1995. Modulation of Cholesterol Efflux from Fu5AH

Hepatoma Cells by the Apolipoprotein Content of High Density Lipoprotein

Particles. Journal of Biological Chemistry 270:13004-13009.

183 131. Johnson, W. J., E. P. Kilsdonk, A. van Tol, M. C. Phillips, and G. H. Rothblat.

1991. Cholesterol efflux from cells to immunopurified subfractions of human

high density lipoprotein: LP-AI and LP-AI/AII. J. Lipid Res. 32:1993-2000.

132. von Hodenberg, E., S. Heinen, K. E. Howell, C. Luley, W. Kübler, and H. M.

Bond. 1991. Cholesterol efflux from macrophages mediated by high-density

lipoprotein subfractions, which differ principally in apolipoprotein A-I and

apolipoprotein A-II ratios. Biochimica et Biophysica Acta (BBA) - Lipids and

Lipid Metabolism 1086:173-184.

133. Mahlberg, F. H., and G. H. Rothblat. 1992. Cellular cholesterol efflux. Role of

cell membrane kinetic pools and interaction with apolipoproteins AI, AII, and Cs.

Journal of Biological Chemistry 267:4541-4550.

134. Greenberg, M. E., J. D. Smith, and E. Sehayek. 2009. Moderately decreased

cholesterol absorption rates are associated with a large atheroprotective effect.

Arterioscler Thromb Vasc Biol 29:1745-1750.

135. Labeur, C., G. Lambert, T. Van Cauteren, N. Duverger, B. Vanloo, J. Chambaz, J.

Vandekerckhove, G. Castro, and M. Rosseneu. 1998. Displacement of apo A-I

from HDL by apo A-II or its C-terminal helix promotes the formation of pre-

[beta]1 migrating particles and decreases LCAT activation. Atherosclerosis

139:351-362.

136. Modur, V., G. A. Zimmerman, S. M. Prescott, and T. M. McIntyre. 1996.

Endothelial Cell Inflammatory Responses to Tumor Necrosis Factor alpha .

CERAMIDE-DEPENDENT AND -INDEPENDENT MITOGEN-ACTIVATED

PROTEIN KINASE CASCADES. J. Biol. Chem. 271:13094-13102.

184 137. Babitt, J., B. Trigatti, A. Rigotti, E. J. Smart, R. J. Anderson, S. Xu, and M.

Krieger. 1997. Murine SR-BI, a high density lipoprotein receptor that mediates

selective lipid uptake, is N-glycosylated and fatty acylated and colocalizes with

plasma membrane caveolae. Journal of Biological Chemistry 272:13242-13249.

138. Trigatti, B., H. Rayburn, M. Viñals, A. Braun, H. Miettinen, M. Penman, M.

Hertz, M. Schrenzel, L. Amigo, A. Rigotti, and M. Krieger. 1999. Influence of the

high density lipoprotein receptor SR-BI on reproductive and cardiovascular

pathophysiology. Proceedings of the National Academy of Sciences of the United

States of America 96:9322-9327.

139. de Beer, M. C., D. M. Durbin, L. Cai, A. Jonas, F. C. de Beer, and D. R. van der

Westhuyzen. 2001. Apolipoprotein A-I conformation markedly influences HDL

interaction with scavenger receptor BI. J. Lipid Res. 42:309-313.

140. Williams, D. L., M. de La Llera-Moya, S. T. Thuahnai, S. Lund-Katz, M. A.

Connelly, S. Azhar, G. M. Ananthramaiah, and M. C. Phillips. 2000. Binding and

cross-linking studies show that scavenger receptor BI interacts with multiple sites

in apolipoprotein A-I and identify the class A amphipathic alpha-helix as a

recognition motif. Journal of Biological Chemistry 275:18897-18904.

141. Gu, X., R. Lawrence, and M. Krieger. 2000. Dissociation of the high density

lipoprotein and low density lipoprotein binding activities of murine scavenger

receptor class B type I (mSR-BI) using retrovirus library-based activity dissection.

Journal of Biological Chemistry 275:9120-9130.

142. Andersen, C. L., A. Dupraz-Matthey, D. Missiakas, and S. Raina. 1997. A new

Escherichia coli gene, dsbG, encodes a periplasmic protein involved in disulphide

185 bond formation, required for recycling DsbA/DsbB and DsbC redox proteins.

Molecular Microbiology 26:121-132.

143. Liu, X., and C. C. Wang. 2001. Disulfide dependent folding and export of

Escherichia coli DsbC. Journal of Biological Chemistry 276:1146-1151.

144. Bessette, P. H., F. Aslund, J. Beckwith, and G. Georgiou. 1999. Efficient folding

of proteins with multiple disulfide bonds in the Escherichia coli cytoplasm.

Proceedings of the National Academy of Sciences of the United States of America

96:13703-13708.

145. Levy, R., R. Weiss, G. Chen, B. L. Iverson, and G. Georgiou. 2001. Production of

Correctly Folded Fab Antibody Fragment in the Cytoplasm of Escherichia coli

trxB gor Mutants via the Coexpression of Molecular Chaperones. Protein

Expression and Purification 23:338-347.

146. Jurado, P., V. de Lorenzo, and L. A. Fernández. 2006. Thioredoxin Fusions

Increase Folding of Single Chain Fv Antibodies in the Cytoplasm of Escherichia

coli: Evidence that Chaperone Activity is the Prime Effect of Thioredoxin.

Journal of Molecular Biology 357:49-61.

147. Ahmed, A. K., S. W. Schaffer, and D. B. Wetlaufer. 1975. Nonenzymic

reactivation of reduced bovine pancreatic ribonuclease by air oxidation and by

glutathione oxidoreduction buffers. Journal of Biological Chemistry 250:8477-

8482.

148. Wetlaufer, D. B., P. A. Branca, and G.-X. Chen. 1987. The oxidative folding of

proteins by disulfide plus thiol does not correlate with redox potential. Protein

Eng. 1:141-146.

186 149. Gough, J. D., J. M. Gargano, A. E. Donofrio, and W. J. Lees. 2003. Aromatic

Thiol pKa Effects on the Folding Rate of a Disulfide Containing

Protein†Biochemistry 42:11787-11797.

150. DeCollo, T. V., and W. J. Lees. 2001. Effects of Aromatic Thiols on Thiol-

Disulfide Interchange Reactions That Occur during Protein Folding. The Journal

of Organic Chemistry 66:4244-4249.

151. Terashima, M., K. Suzuki, and S. Katoh. 1996. Effective refolding of fully

reduced lysozyme with a flow-type reactor. Process Biochem 31:341-345.

152. Batas, B., and J. B. Chaudhuri. 1996. Protein refolding at high concentration

using size-exclusion chromatography. Biotechnol Bioeng 50:16-23.

153. Schlegl, R., G. Iberer, and C. Machold. 2003. Continuous matrix assisted

refolding of proteins. J Chromatogr A 1009:119-132.

154. Ohashi, R., H. Mu, X. Wang, Q. Yao, and C. Chen. 2005. Reverse cholesterol

transport and cholesterol efflux in atherosclerosis. QJM 98:845-856.

155. Ansell, B. J., G. C. Fonarow, and A. M. Fogelman. 2007. The paradox of

dysfunctional high-density lipoprotein. Curr. Opin. Lipidol. 18:427-434.

156. Ogura, S., A. Kakino, Y. Sato, Y. Fujita, S. Iwamoto, K. Otsui, R. Yoshimoto,

and T. Sawamura. 2009. LOX-1-The Multifunctional Receptor Underlying

Cardiovascular Dysfunction. Circulation Journal 73:1993-1999.

157. Dunn, S., R. S. Vohra, J. E. Murphy, S. Homer-Vanniasinkam, J. H. Walker, and

S. Ponnambalam. 2008. The lectin-like oxidized low-density-lipoprotein receptor:

a pro-inflammatory factor in vascular disease. The Biochemical Journal 409:349-

355.

187 158. Reiss, A. B., K. Anwar, and P. Wirkowski. 2009. Lectin-like oxidized low density

lipoprotein receptor 1 (LOX-1) in atherogenesis: a brief review. Current

Medicinal Chemistry 16:2641-2652.

159. Marsche, G., S. Levak-Frank, O. Quehenberger, R. Heller, W. Sattler, and E.

Malle. 2001. Identification of the human analog of SR-BI and LOX-1 as receptors

for hypochlorite-modified high-density lipoprotein on human umbilical venous

endothelial cells. FASEB J.:00-0532fje.

160. Chen, X. P., T. T. Zhang, and G. H. Du. 2007. Lectin-like oxidized low-density

lipoprotein receptor-1, a new promising target for the therapy of atherosclerosis?

Cardiovascular Drug Reviews 25:146-161.

161. Daniel, T. O., W. J. Schneider, J. L. Goldstein, and M. S. Brown. 1983.

Visualization of lipoprotein receptors by ligand blotting. Journal of Biological

Chemistry 258:4606-4611.

162. Valiyaveettil, M., N. Kar, M. Z. Ashraf, T. V. Byzova, M. Febbraio, and E. A.

Podrez. 2008. Oxidized high-density lipoprotein inhibits platelet activation and

aggregation via scavenger receptor BI. Blood 111:1962-1971.

188