Molecular and Functional Evolution of Hemoglobin in Perissodactyl

Molecular and functional evolution of hemoglobin in perissodactyl

mammals (equids, tapirs, and rhinos)

Margaret Clapin

A thesis submitted to the Faculty of Graduate Studies of the University of Manitoba in partial fulfillment of the requirements for the degree of Master of Science

Department of Biological Sciences University of Manitoba Winnipeg, Manitoba Canada

In this thesis, the oxygen binding characteristics of recombinant hemoglobin (Hb) isoforms

(HbA [α2β2] and HbA2 [α2δ2]) from the extinct woolly rhinoceros (Coelodonta antiquitatis) are compared with Sumatran rhino (Dicerorhinus sumatrensis) and black rhino (Diceros bicornis) Hb.

The major Hb component (HbA) of horses (Equus caballus) was also examined, as its blood O2 affinity has a low thermal sensitivity. This trait is commonly associated with cold-adaptation as it permits O2 to be offloaded at the cool peripheral tissues of regionally endothermic mammals, though the mechanism(s) by which the oxygenation enthalpy is reduced in horse Hb is unknown.

It was hypothesized that the woolly rhino Hb isoforms would have similarly low thermal sensitivities to that of horses, either through enhanced effector binding or by altering the energetic transition from the tense to the relaxed state of hemoglobin. To test this hypothesis the hemoglobin coding sequences for each of the above species were determined and their Hb isoforms expressed using E. coli and purified. Oxygen equilibrium curves were then determined in the presence and absence of allosteric effectors at 25 and 37°C. Horse HbA had a low sensitivity to 2,3- diphosphoglycerate (DPG), though its low temperature sensitivity was primarily driven by increased DPG binding at the lower test temperature. By contrast, each of the extant rhino Hb isoforms was shown to be largely insensitive to DPG, and to have a lower sensitivity to Cl- than horse Hb; notably, effector binding wasn’t temperature sensitive. My results further demonstrated that the major HBA woolly rhino isoform possessed nearly identical inherent O2 affinities, allosteric effector sensitivities, and thermal sensitivities to those of the extant rhinoceros species.

Thus, the extinct woolly rhino did not evolve cold-adapted hemoglobin which argues against strong regional heterothermy in this species. The woolly rhino evolved a rare residue replacement at a highly conserved position of the δ globin chain (δ104Arg→Ser) which abolishes DPG binding

- to woolly rhino HbA2 while also dramatically reducing the effects of both pH and Cl on Hb–O2 affinity. It is postulated this seemingly maladaptive trait likely became fixed during a population bottleneck in this species.

iii

Acknowledgements:

I would like to thank my advisor Dr. Kevin Campbell for his support through this entire process including the development of this topic, advise on the methods used and revisions. I would also like to thank my committee, Dr. Jennifer van Wijngaarden and Dr. Kenneth Jeffries, for their helpful suggestions and revisions. Lastly, I would like to thank Anthony Signore, Michael Gaudry, and Diana Hanna for their instruction on the protocols used throughout the research.

Table of Contents:

Abstract: ...... ii Acknowledgements: ...... iv List of Tables ...... vii List of Figures ...... viii List of Abbreviations: ...... x Chapter 1: General Introduction ...... 1 Chapter 2: Temperature dependent DPG binding underlies thermal adaptation of horse hemoglobin ...... 8 2.1 Abstract ...... 8 2.2 Introduction ...... 9 2.3 Materials and Methods ...... 11 2.3.1 Horse Hb gene inserts ...... 11 2.3.2 Hemoglobin expression ...... 12 2.3.3 Hemoglobin purification ...... 15 2.3.4 Oxygen binding tests...... 15 2.4 Results ...... 16 2.5 Discussion ...... 23 2.6 Conclusions ...... 26 Chapter 3: Functional characterization of hemoglobin from the rhinoceros clade reveals a lack of temperature adaptation in the extinct woolly rhino...... 27 3.1 Abstract ...... 27 3.2 Introduction ...... 28 3.3 Materials and Methods ...... 30 3.3.1 Assembly and annotation ...... 31 3.3.2 Hemoglobin expression ...... 35 3.3.3 Hemoglobin purification ...... 35 3.3.4 Oxygen binding tests...... 35 3.4 Results ...... 36 3.5 Discussion ...... 49 3.6 Conclusions ...... 57 Literature Cited ...... 59

Appendices ...... 68

List of Tables

Table 2.1 PCR protocols used for filling in Hb gene gaps, Sanger sequencing, amplification of gene inserts, and colony screening………………………………………………………………..13

Table 2.2 Heterotropic binding characteristics of horse HbA at 37℃ and 25℃ and at pH 7.2....21

Table 2.3 Effect of temperature on oxygen binding in horse HbA……………………………...22

Table 3.1 Woolly rhino specimen information including lab ID, museum/sample ID, material, 14C date, latitude, and longitude………………………………………………………………………32

Table 3.2 Oxygen affinity and heterotropic effects of woolly, Sumatran, and black rhino major hemoglobin isoforms at 37 and 25℃ at pH 7.2. The oxygen affinity and Bohr effect of each isoform was measured under four conditions; stripped of cofactors, 0.1 M Cl-, 0.5 mM DPG, and 0.1 M Cl- + 0.5 mM DPG………………………………………………………………………...46

Table 3.3 Oxygen affinity and heterotropic effects of woolly and Sumatran minor hemoglobin isoforms at 37 and 25℃ at pH 7.2; data for a woolly rhino 104Ser→Arg mutant are also presented. The oxygen affinity and Bohr effect of each isoform was measured under four conditions; stripped of cofactors, 0.1 M Cl-, 0.5 mM DPG, and 0.1 M Cl- + 0.5 mM DPG……….47

Table 3.4 Enthalpy of oxygen binding of woolly rhinoceros, Sumatran rhinoceros, and black rhinoceros Hb isoforms at pH 7.2. Enthalpies were calculated under four conditions; stripped of cofactors, 0.1 M Cl-, 0.5 mM DPG, and 0.1 M Cl- + 0.5 mM DPG………………………………..48

vii

List of Figures

Figure 1.1 Phylogenetic tree of Perissodactyla (modified from Orlando et al. 2003, Gaudry 2017)………………………………………………………………………………………………6

Figure 2.1 Oxygen binding characteristics of 0.25 mM horse hemoglobin at 25℃ (closed symbols) and 37℃ (open symbols) as a function of pH. Data is presented for stripped hemoglobin (circles), and hemoglobin in the presence of 0.1 M chloride (squares), 0.5 mM DPG (triangles), and in the combined presence of these effectors (diamonds). Corresponding cooperativity coefficients (n50) are also presented for each experimental condition………………………………………………17

Figure 2.2 Half saturation O2 partial pressures (log P50) of horse HbA plotted over a DPG concentration gradient at 25℃ (closed symbols) and 37℃ (open symbols) and pH 7.2. Concentrations are plotted as a log ratio of DPG/Hb. Arrows denote the log P50 of stripped Hb (i.e. no DPG added) at 25℃ (bottom) and 37℃ (top), respectively. The slope of each line multiplied by 4 denotes the minimal number of DPG binding sites per hemoglobin tetramer………………19

Figure 2.3 Half saturation O2 partial pressures (log P50) of horse hemoglobin over a chloride concentration gradient at 25℃ (closed symbols) and 37 ℃ (open symbols) at pH 7.2. Arrows - denote the log P50 of stripped Hb (i.e. no Cl added) at 25℃ (bottom) and 37℃ (top), respectively. Maximum tangential slopes are indicated as dashed lines; this slope multiplied by 4 denotes the minimal number of Cl- binding sites per hemoglobin molecule………………………………….20

Figure 3.1 Graphical depiction of the alpha and beta globin clusters of the white rhinoceros. Open rectangles depict pseudogenes while closed rectangles depict intact loci. Symbols above each box refer to the Latin gene name, while the current gene nomenclature is listed below each locus. Light colored boxes denote prenatal expressed hemoglobin loci, while the black boxes denote post-natal expressed hemoglobin genes; the HBQ locus (dark grey) is not known to be incorporated into hemoglobin proteins. For each species investigated, the tandemly duplicated HBA-T1 and HBA- T2 loci encode for identical protein subunits within the Perissodactyla clade……………………37

Figure 3.2 Amino acid alignments comparing the a) HBA (α), b) HBD (δ), and c) HBB (β) chains of the horse with those of the Malaysian tapir, woolly rhinoceros, Sumatran rhinoceros, white rhinoceros, black rhinoceros, and Indian rhinoceros. Substitutions are indicated by the one letter amino acid code while conserved positions are represented by dots. Unique substitutions found in the woolly rhinoceros are highlighted……………………………………………………………40 Figure 3.3 Nucleotide alignment emphasizing non-synonymous substitutions (bold) in the woolly and Sumatran rhinoceros a) HBA and b) HBD globin genes. There are three woolly rhinoceros specimens with the sequence coverage depth not including duplicates indicated in brackets. Question marks denote a lack of sequence coverage……………………………………………..41

Figure 3.4 Ancestral reconstruction of the three globin genes encoding the hemoglobin isoforms of perissodactyl mammals: a) HBA, b) HBB, and c) HBD. Derived residue substitutions of each species for each branch are indicated by red rectangles. Numbers above each rectangle denote the residue position, with letters above the horizontal lines representing the ancestral amino acid and

viii those below the line representing the derived substitution; the confidence of each residue exchange is presented in brackets…………………………………………………………………………...43

Figure 3.5 Oxygen affinity curves (log P50) as a function of pH of the major (HbA; 0.25 mM) isoform of a) woolly rhinoceros, b) Sumatran rhinoceros, and c) black rhinoceros at 25℃ (closed) and 37℃ (open) under four conditions; stripped (circles), 0.1 M Cl- (squares), 0.5 mM DPG (triangles), and 0.1 M Cl- + 0.5 mM DPG (diamonds). Cooperativity coefficients are presented in the bottom panels…………………………………………………………………………………45

Figure 3.6 Oxygen affinity curves (log P50) and cooperativity coefficients (n50) for a) the minor (HbA2; 0.25 mM) hemoglobin component of the woolly rhinoceros and b) a woolly rhinoceros 104Ser→Arg HbA2 mutant as a function of pH at 25℃ (closed symbols) and 37℃ (open - symbols). Note that the inherent O2 affinity (circles), and effect of Cl (0.1 M; squares), 0.5 mM DPG (triangles), and 0.1 M Cl- + 0.5 mM DPG (diamonds) on woolly rhino HbA2 are all markedly reduced relative to the 104Ser→Arg mutant. …………………………………………………..53

Figure 3.7 Plot of log[DPG] vs. logP50 at 25℃ (closed symbols) and 37℃ (open symbols) of woolly rhino HbA (triangles, dashed line), woolly rhino HbA2 (circles, solid line), and horse HbA (diamonds, dotted line). Note the slope of the woolly rhino HbA line is lowered relative to that of the horse indicative of lower effector binding, while the woolly rhino HbA2 isoform is completely unresponsive to DPG……………………………………………………………………………..54

- Figure 3.8 Plot of log[Cl ] vs. logP50 at 25℃ (closed symbols) and 37℃ (open symbols) of woolly rhino HbA (triangle, dashed line), woolly rhino HbA2 (circle, solid line), and horse HbA (diamond, dotted line). Note the slope of the woolly rhino HbA line is lower relative to that of the horse HbA indicative of lower effector binding, while the woolly rhino HbA2 isoform is completely unresponsive to Cl-……………………………………………………………………………….55

List of Abbreviations:

∆H’ Overall enthalpy of oxygenation ∆HCl- Thermal contribution of chloride binding ∆HDPG Thermal contribution of 2,3-diphosphoglycerate binding ∆HH+ Thermal contribution of proton binding ∆HH2O Heat of solution of oxygen ∆HO2 Enthalpy of oxygenation ATP Adenosine triphosphate bp Base pairs BP Before present dNTP Deoxyribonucleotide triphosphate DPG 2,3-diphosphoglycerate DTT Dithiothreitol EDTA Ethylenediaminetetraacetic acid GTP Guanosine triphosphate Hb Hemoglobin HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid IPTG Isopropyl-beta-D-thiogalactopyranoside KYR Thousand years mm Hg Millimeters of mercury MUSCLE MUltiple Sequence Comparison by Log-Expectation MYR Million years O2 Molecular oxygen P50 Partial pressure of O2 needed for hemoglobin to reach the half saturation point PAML Phylogenetic Analysis by Maximum Likelihood PMSF Phenylmethylsulfonyl fluoride rcf Relative centrifugal force rpm Rotations per minute R-state Relaxed state SOC Super optimal broth with catabolite repression TETA Triethylenetetramine Tris Tris(hydroxymethyl) aminomethane T-state Tense state ΔHT→R Energetic transition between Tense and Relaxed states

Chapter 1: General Introduction

This research addresses the oxygen binding properties of hemoglobin (Hb) in the presence of naturally occurring effector molecules and at different experimental temperatures. Specifically, the Hb tested is from members of the order Perissodactyla, which includes rhinos, tapirs, and horses (Steiner and Ryder, 2011). While most species in this order are found in warm, (sub)tropical regions of the planet, select lineages evolved to exploit harsh, northern environments during the

Pleistocene Ice Ages (e.g., horses and the extinct woolly rhinoceros). The central hypothesis of the thesis is that these cold-tolerant species will possess Hb proteins whose O2 affinity are less affected by temperature than those of closely related (sub)tropical species, as this trait is accepted to facilitate O2 delivery to cool peripheral appendages (Weber and Campbell 2011).

Hb is a tetrameric protein composed of 2 α-type and 2 β-type globin chains with a heme group bound to each subunit, which is the site of reversible O2 binding (Wilkinson et al. 1998). Its primary function is to bind O2 at the respiratory surfaces, transport it through the body, and offload this O2 to metabolically active tissues (Schmidt-Nielsen and Larimer 1958). Hemoglobin is able to accomplish this by existing in two conformations, the high-affinity “relaxed” (or R-) state and the low affinity “tense” (or T) state. An important characteristic of Hb that contributes to the efficiency of this function is cooperative binding, as illustrated by the Monod-Wyman-Changeux model (Monod et al. 1965). Briefly, the binding of O2 to a single heme subunit shifts the remaining subunits to the R-state increasing their affinity for O2, and vice versa (Wilkinson et al. 1998).

Another important change occurring during Hb oxygenation is that multiple salt bridges in the T- state are broken during the transition to the R-state (Alcantara et al. 2007). Conversely, as Hb becomes deoxygenated, the protein adopts the T-state through a quaternary structure rearrangement which causes one dimer to rotate relative to the other by 15. Two important sites

1 for the above noted Hb conformational changes have been identified and are called the ‘hinge’ and the ‘switch’. The hinge and switch make up the α1β2 interface which holds the α1β1 and α2β2 dimers together. Both are located between the C-helix of the α-subunit and the FG corner of the other dimer’s β-subunit (Alcantara et al. 2007). The hinge orients the amino acid side chains and the switch alters an interlocking site (Alcantara et al. 2007). The T-state can be further stabilized by allosteric ligands binding to Hb (Alcantara et al. 2007), which will be described in more detail below.

The relationship between Hb–O2 saturation and O2 partial pressure provides information on both the subunit cooperativity and the relative O2 affinity of the protein, which can be illustrated graphically as an oxygen equilibrium curve (Schmidt-Nielsen and Larimer 1958). When Hb has a high oxygen affinity (in the R-state), O2 loading is facilitated at the respiratory surfaces, while a low O2 affinity (T-state) promotes offloading of O2 for cellular respiration. The O2 affinity of Hb varies among species and can be adjusted by altering the intrinsic O2 affinity of the protein, by increasing/decreasing interactions with the allosteric effector molecules, and by changing the concentration of allosteric effectors within the red blood cells (Petschow 1977).

Amino acid replacements at some residue positions of the protein result in an increase in the intrinsic O2 affinity of Hb while changes at other sites lower Hb–O2 affinity by altering the tertiary structure to stabilize either the R- or the T-state protein, respectively (Perutz and Imai 1980). Hb–

O2 affinity can be further regulated by allosteric effectors, such as organic phosphates, protons, and chloride. These effectors generally bind to and help stabilize the T-state protein, thereby lowering O2 affinity (Brunori 2014). For example, mammals typically use 2,3-diphosphoglycerate

(DPG) as their primary allosteric effector while fish generally use adenosine triphosphate (ATP) or guanosine triphosphate (GTP) (Perutz and Brunori 1982); these anionic molecules are able to

2 cross-link the two β-type chains and stabilize the T-state. It has also been shown that changes to physiological concentrations of effectors in the blood cells (especially DPG and H+) can further modulate Hb–O2 binding affinity in mammals (Weber et al. 2014; Bunn and Kitchen 1973).

The molecular mechanisms cited above allow for a range of physiological specializations of

Hb to suit specific environmental conditions, such as high-altitude hypoxia or hypoxic/hypercapnic conditions prevailing in subterranean habitats. An additional environmental challenge for many animals to overcome is changing ambient temperature. This is because the process of O2 binding to the heme iron is inherently exothermic and thus an increase in temperature decreases its affinity for O2 (Weber et al. 2014; Weber and Campbell 2011). This trait is considered beneficial in most cases because warm areas of the body are usually more metabolically active and need more O2 in comparison with less metabolically active areas of the body (Weber et al. 2014).

By contrast, cold blood temperatures result in a reduced ability to unload O2 (Weber et al. 2014) which may result in local hypoxia (Weber and Campbell 2011). The inherent thermal sensitivity of oxygen binding to the heme, or enthalpy of oxygenation (∆HO2), is generally accepted to be

-1 about -59 kJ mol O2 (Atha and Ackers, 1974; Weber and Campbell 2011). However, additional homotropic and heterotropic factors can play a role in reducing the overall thermal sensitivity of

O2 binding and release (termed the overall enthalpy of oxygenation or ∆H’). The ΔH of O2 binding

= -ΔH of O2 release. This latter value is calculated as:

-∆H’ = -∆HO2 - ∆HH2O - ∆HT→R - ∆HDPG - ∆HCl- - ∆HH+ - ∆HX-

H2O O2 While the heat of solution of O2 (∆H ) and ∆H are practically invariant; -12.6 and -59

-1 kJ mol O2, respectively (Weber and Campbell 2011), the other variables can be altered.

Consequently, one way to lower the overall change in enthalpy (∆H’) is to alter the energetic transition between the T- and R-state proteins by selecting for Hbs with a higher ΔHT→R, as is observed in bovine, shrew, deer mouse, and Steller’s sea cow Hbs (Weber et al. 2014; Campbell et al. 2012; Jensen et al. 2016; Signore 2016). Alternatively, an increase in allosteric effector binding (∆HDPG, ∆HCl-, ∆HH+, ∆HX-) to the deoxygenated Hb protein may also contribute to

X- lowering Hb–O2 thermal sensitivity (Campbell et al. 2010; Weber and Campbell 2011); ∆H refers to thermal contributions from other effectors in the red cell (e.g., CO2, lactate) though these are often considered to be negligible and hence generally excluded. Taken together, heat liberated by any of these processes contributes to reducing the ∆H’, thus making it easier to offload O2 at cool extremities (Weber and Campbell 2011).

The effect of temperature on Hb–O2 affinity is particularly important in animals with a significant body temperature gradient (regionally heterothermic organisms). In heterothermic mammals, the peripheral tissues are regulated at a cooler temperature compared to the rest of the body, an effect which lowers the thermal gradient for heat loss to the environment. The strategy of regional heterothermy is often seen in endotherms adapted to cold environments since such environments are usually characterized by limited quantities of nutritionally depleted food (i.e. during winter). Since regional heterothermic animals need to maintain O2 delivery at the site of cold tissues, a reduced temperature sensitivity of their Hb appears to universally accompany this adaptation (Weber and Campbell 2011). However, little is known regarding hemoglobin thermal sensitivity in perissodactyl mammals (horses, tapirs, and rhinos), particularly those that evolved to exploit the harsh northern climates that prevailed during the Pleistocene Ice Ages.

The second chapter of this thesis therefore focuses on domestic horses as their blood is already known to possess a relatively low effect of temperature on O2 binding (Cambier et al.

2004; Clerbeaux et al. 1993; Bunn and Kitchen 1973; Di Bella et al. 1996; Giardina et al. 1990).

However, the molecular mechanisms underlying this low temperature sensitivity phenotype have not been examined. This question was addressed by conducting O2 binding curves on recombinant horse HbA at 25 and 37°C and over a range of pH values in the presence and absence of various

- + allosteric effectors (DPG, Cl , H ).

The rhinoceros clade also provides an intriguing study group to examine the evolution of temperature insensitive Hb, as it has been postulated that the Rhinocerotidae originated in the sub- tropical environments of Asia and Africa where the five extant taxa still live (Orlando et al. 2002).

The rhino genus Coelodonta is thought to have arisen in Tibet by 3.7 million years ago (Yuan et al. 2014) with the woolly rhinoceros (Coelodonta antiquitatis) subsequently evolving to exploit high-latitude environments of Eurasia during the Pleistocene (Boeskorov 2012). Therefore, woolly rhino Hb may be expected to possess specializations that lowered the thermal sensitivity of O2 binding and release in order to maintain efficient oxygenation of tissues in cold extremities

(Campbell and Hofreiter 2015).

Rhinos are placed in the order Perissodactyla, together with tapirs and horses, with rhinos and tapirs forming sister taxa within this clade (Fig. 1.1). There are five species of rhinoceros

(white, black, Sumatran, Indian, and Javan) that still have living members (Orlando et al. 2002).

The Sumatran rhinoceros (Dicerorhinus sumatrensis) is accepted to be the closest living relative to the woolly rhinoceros within the Dicerorhine group (Yuan et al. 2014, Gaudry 2017). The Indian

(Rhinoceros unicornis) and Javan (Rhinoceros sondaicus) rhinos are a part of the

Rhinocerotinines, while the black (Diceros bicornis) and white (Ceratotherium simum) rhinos are included in the Dicerotines (Steiner and Ryder, 2011). Although the woolly rhinoceros is extinct, unanalyzed globin gene sequences encoding its two primary Hb isoforms (HbA [α2β2] and HbA2

Figure 1.1 Phylogenetic tree of Perissodactyla (modified from Orlando et al. 2003, Gaudry 2017).

[α2δ2]) have been collected from three permafrost preserved members of this species, together with those of four extant rhino species and the Malaysian tapir (Gaudry and Campbell, unpublished data). This dataset provides a great opportunity to compare the hemoglobin sequences and Hb–O2 binding properties within this group to extend the comparison back in time for an extinct species that lived in a distinctly contrasting climate.

The third chapter of this thesis thus addresses potential thermal specializations of the Hb isoforms (HbA [α2β2; major isoform] and HbA2 [α2δ2; minor isoform]) of the extinct, cold-adapted woolly rhinoceros relative to those of two extant, sub-tropical species of rhinos; specifically, O2 binding data was collected for both Hb isoforms of the Sumatran rhinoceros—the closest living relative to the woolly rhinoceros (Yuan et al. 2014)—and the HbA isoform of the black rhinoceros, which served as an outgroup. The hypothesis tested is that woolly rhino Hb evolved amino acid changes which reduced the overall enthalpy of oxygenation of its Hb isoforms. As a highly unusual amino acid replacement (δ104Arg→Ser) was discovered in the woolly rhinoceros HbA2 isoform that is known to markedly alter effector binding to a human Hb variant (Hb Camperdown) carrying this same substitution, additional experiments were conducted to characterize the O2 binding attributes of this isoform relative to other rhinos Hbs and a woolly rhino HbA2 mutant carrying the ancestral δ104Arg residue.

Chapter 2: Temperature dependent DPG binding underlies thermal adaptation of horse hemoglobin

2.1 Abstract

Wild horses thrived in northern climates during the Pleistocene Ice Ages (2.5 million to

10,000 years ago) and were thereby periodically challenged by extremely cold temperatures over this phase of their evolution. Consistent with this evolutionary history, the O2 affinity of domestic horse blood is known to possess a relatively low sensitivity to temperature change, which may assist with maintaining sufficient O2 delivery to cold peripheral tissues. By contrast, horses are also a highly athletic species that may additionally be expected to benefit from a high blood thermal sensitivity to augment O2 offloading and heat dissipation during exercise. However, potential molecular mechanism(s) that mitigate this tradeoff have not been explored. To address these shortcomings, I recombinantly expressed the major Hb isoform of the horse and measured its O2 binding characteristics at two temperatures (25 and 37C) in the absence and presence of physiologically relevant effector molecule levels. My results confirm previous studies that indicated horse Hb has: a) a lower intrinsic O2 affinity, b) similar Bohr effects, but c) reduced sensitivity to anions (DPG and Cl-) than does human HbA. Surprisingly, DPG was found to have a very small effect on Hb–O2 affinity (comparable to that found for ‘DPG insensitive’ bovine Hb) yet was the dominant effector lowering the thermal sensitivity of horse Hb. The thermal sensitivity of recombinant horse Hb in the presence of DPG and Cl- (0.21 mm Hg/°C) was higher than values previously obtained from whole blood studies (0.16-0.19 mm Hg/°C), presumably due to differences in DPG levels among these studies. Importantly, horses are known to lower intracellular DPG levels in response to training, which may represent a mechanism to adaptively modulate the thermal sensitivity of their blood O2 binding and release.

2.2 Introduction

The Family Equidae is comprised of horses, asses, and zebras (Steiner and Ryder, 2011).

This family was both abundant and diverse during the Pliocene and Miocene (20.45 to 2.58 million years ago; MYA), being represented by over a dozen fossil genera (Orlando et al. 2009). Currently, extant equids are now only represented by the genus Equus, which are classified into caballines

(horses) and non-caballines (asses and zebras). A key demarcation between these groups is that horses are more cold tolerant than non-caballines (Osthaus et al. 2018), and in fact were well adapted to the prevailing harsh conditions of the Mammoth Steppe steps where they were abundant during the Pleistocene Ice Ages (Guthrie 2003).

However, there is interspecies variation among horses with regards to cold tolerance. One way in which the northern breeds of horses maintain their body temperature is through darker coloured coats to increase light absorption (Langlois 1994). Horses have also been found to develop winter coats which are longer and thicker and therefore afford better insulation during cold weather (Osathus et al. 2018). Another way in which northern breeds differ from southern breeds is their general body build. Cold-adapted horses tend to be larger, have reduced surface area to volume ratios, and possess shorter and stouter limbs, tails, and ears to minimize heat loss

(Langlois 1994). The adaptation of short limbs and thick hair is demonstrated in Yakutian horses which have adapted to one of the coldest climates in the northern hemisphere (Librado et al. 2015).

Additionally, horse breeds that are adapted to colder climates have thicker skin, fat reserves close to the surface, and the ability to vasoconstrict surface blood vessels such that less heat is lost

(Langlois 1994). The effectiveness of this insulation can be seen by how easily snow can pile up on their backs without melting (Langlois 1994).

In addition to these kinds of morphological strategies for cold hardiness, a number of cold- adapted mammalian species possess hemoglobin (Hb) proteins with a reduced overall enthalpy of oxygenation (ΔH’) to maintain appropriate O2 delivery to tissues that may markedly vary in temperature and hence metabolic requirements (Weber and Campbell 2011). Reductions in the thermal sensitivity of Hb–O2 affinity can be achieved by altering the energetic transition from the

T- to the R-state protein or by a progressive increase in allosteric effector binding as temperature decreases; heat released from these exothermic processes contribute to the free energy needed for heme deoxygenation (Signore 2016). There are several variations on this latter strategy found in different species indicating convergent adaptation, with variations involving different effector molecules and different binding sites (Weber and Campbell 2011). For example, bovine Hb has a cluster of three cationic amino acid residues at positions 8, 76, and 77 that have been suggested to increase the thermal contribution of Cl- binding (i.e. increase ΔHCl-), though their Hb also has an elevated ΔHT→R relative to human HbA (Weber et al. 2014). The woolly mammoth (Mammuthus primigenius) has substitutions at positions 12 and 101 on the beta type chain that increases the thermal contribution of both DPG (ΔHDPG) and Cl- (ΔHCl-) binding relative to Asian elephant Hb

(Campbell et al. 2010). The Hb of other animals, such as coast and eastern moles, and tuna have heightened Bohr effects (ΔHH+) that contribute to their numerically low (and even positive) ΔH’ values (Weber and Campbell 2011).

Studies conducted on horse whole blood have revealed temperature sensitivities ranging from 0.016 to 0.019 mm Hg/C, which is similar to cattle and other cold adapted mammals but below that (0.024 mm Hg/C) of human blood (Cambier et al. 2004; Clerbeaux et al. 1993; Smale and Butler 1994). While this trait may be beneficial for augmenting O2 offloading to cool peripheral tissues, it would also be expected to put restraints on maximal O2 delivery to warm

10 working muscles—and heat release at the lungs—during vigorous exercise. Previous studies have

- demonstrated that the effects of Cl and (especially) DPG on horse Hb–O2 affinity are reduced relative to human HbA (Cambier et al. 2005; Di Bella et al. 1996; Giardina et al. 1990), and that red cell DPG levels drop following chronic exercise training (Lykkeboe et al 1977), though it remains unknown if (and how) these attributes contribute to the thermal sensitivity phenotype of horse blood.

2.3 Materials and Methods

2.3.1 Horse Hb gene inserts

Previous studies have indicated that while horse blood may possess one or more Hb components encoded by different globin paralogs, the O2 binding properties and sensitivities of these isoforms are indistinguishable from one another (Pellegrini et al. 2001). Consequently, only the major horse Hb isoform (HbA) was examined in this study. The coding sequences for this tetrameric protein were taken from the National Center for Biotechnology Information’s

Nucleotide Collection (GenBank accession numbers: NM_001085432 [HBA] and

NM_001164018 [HBB]) to design a horse HbA DNA cassette for E. coli expression following the procedure of Natarajan et al. (2011). Briefly, the E. coli optimized HBA (α globin) and HBB (β globin) gene sequences were first flanked by restriction sites (HBA: 5’ NcoI, 3’ XhoI; HBB: 5’

NdeI, 3’ SacI) and the resulting sequences separated by a Shine-Dalgarno sequence. Binding sites for M13 primers were then incorporated on either end of the strand, and the resulting sequences synthesized in vitro by Invitrogen ThermoFisher Scientific (Pleasanton, CA).

The insert was amplified (30 cycles) using 32.5 μl of Hyclone molecular grade water, 10 μl of 5x Phusion buffer, 1 μl of dNTP’s, 2.5 μl of the M13 forward and reverse primers, 0.5 μl of

Phusion polymerase, and 1 μl of 2 μM template. The amplification conditions are given in Table

2.1. The amplified insert (~1000 bp) was electrophoresed, visualized with a Molecular Imager

VersaDoc MP 4000 system (Bio-Rad Laboratories, Mississauga, Ontario, Canada), and then purified with a GeneJet Gel Extraction Kit (Thermo Scientific). To prepare the horse HbA insert for ligation into a pGM plasmid, the purified PCR product was cut at the NcoI and SacI restriction sites. This was achieved by mixing 1.5 μl of each restriction enzyme with 5 μl of Cut smart buffer,

22 μl of Hyclone molecular grade water, and 20 μl of purified DNA. The mixture was incubated at 37C for 2 hours, electrophoresed, excised, and purified using the GeneJet Gel Extraction Kit.

The globin inserts were then ligated to the expression plasmid using the Quick Ligation Kit from

New England Biolabs.

Once the ligation was complete, the Hb expression plasmid was inserted into JM109 (DE3)

E. coli (Promega) using the ‘Mix and Go’ fast transformation protocol (Zymo Research), and plated on lysogeny broth (LB) agar with 50 μg/ml ampicillin. After 16 hours, preparations were purified using the GeneJet Plasmid Miniprep Kit (Thermo Scientific) and then sequenced to ensure the globin genes were inserted properly and free of errors.

2.3.2 Hemoglobin expression

The expression of recombinant horse Hb followed an established laboratory protocol

(Natarajan et al. 2011; Signore 2016). First, the expression plasmid and a plasmid that expresses methionine aminopeptidase (pCO-Map) were double transformed into JM109 (DE3) E. coli as above, but with an added outgrowth step in 400 μl of super optimal broth with catabolite repression

(SOC) media for 1 hour at 37ºC shaking at 300 rpm. The transformed E. coli were plated on LB agar along with

Table 2.1 PCR protocols used for filling in Hb gene gaps, Sanger sequencing, amplification of gene inserts, and colony screening.

Parameters Gaps Big Dye Amplification Colony

Screening

Initial 94℃ - 5 min 96℃ - 1 min 98℃ - 30 98℃ - 30 sec

denaturation ramp 1℃ /sec sec

Denaturation 94℃ - 30 sec 96℃ - 10 sec 98℃ - 5 sec 98℃ - 5 sec

ramp 1℃/sec

Annealing 48-58℃ - 30 50℃ - 5 sec 58℃ - 10 56℃ - 10 sec

sec ramp 1℃ /sec sec

Extension 68℃ - 15 sec 40℃ - 4 min 72℃ - 20 72℃ - 10 sec

ramp 1℃/sec sec

Final extension 68℃ - 5 min 72℃ - 5 72℃ - 5 min

min

Hold 4℃ 4℃ 4℃ 4℃

100 µg/ml of ampicillin and kanamycin and incubated overnight at 37ºC. A single colony was selected and grown in 2xYT media that was inoculated with ampicillin and kanamycin, and then incubated for 12 to 16 hours in a shaker set to 200 rpm. Autoclaved glycerol was added to the culture until a final concentration of 10% was reached and was then frozen at -80 ºC (Natarajan et al. 2011).

After the above culture was prepared, 50 ml of bacteria were grown at 37ºC in 2.5 L of TB media containing ampicillin and kanamycin until the culture had reached an absorbance of 0.6-0.8 at a wavelength of 600 nm (Biochrom Ultraspec 70). Expression was then induced by adding 0.2 mM isopropyl-beta-D-thiogalactopyranoside (IPTG), 50 μg/ml hemin, 50 g glucose, and 2.5 ml antifoam agent at 30ºC for 4 hours. Following incubation, 5 g of sodium hydrosulfite was added, the culture was infused with carbon monoxide for 15 minutes, and the cells pelleted via centrifugation at 5,000 rcf for 10 minutes (Natarajan et al. 2011).

Pelleted cells were lysed using a buffer containing 50 mM tris(hydroxymethyl) aminomethane (Tris), 1 mM ethylenediaminetetraacetic acid (EDTA), 0.5 mM dithiothreitol

(DTT), 1 mM phenylmethylsulfonyl fluoride (PMSF), pure water, and lysozyme (Natarajan et al.

2011). For each gram of cell paste, 3 ml of lysis buffer and 1 mg of lysozyme was added. The cells were sonicated for 15 minutes cycling between 40% amplitude for 10 seconds and a pause for 20 seconds and was then shaken at 4ºC for 1 hour. To precipitate the nucleic acids, 25% polyethyleneimine solution was added to the crude lysate to a final concentration of 1% polyethyleneimine, and the tubes thoroughly vortexed. Samples were then centrifuged at 20,000 rcf for 30 minutes and dialysed in four changes of cold 20 mM Tris and 0.1 mM

Triethylenetetramine (TETA) buffer adjusted to a pH of 8.3 using HCl. Once the dialysis was completed, the sample was centrifuged and the supernatant was collected (Natarajan et al. 2011).

2.3.3 Hemoglobin purification

Hemoglobin purification was initiated via anion exchange chromatography at 10ºC following Natarajan et al. (2011) and Signore (2016). The columns were pretreated with starting buffer (20 mM Tris- 0.1 mM Teta pH 8.3) to remove preservatives and then an elution buffer (20 mM Tris- 0.1 mM Teta with 250 mM NaCl) was used to remove contaminants. Starting buffer was then applied to equilibrate the columns. After the sample was added, the column was washed with starting buffer for 10 minutes and the hemoglobin solute eluted using a linear gradient from 0-250 mM NaCl and collected in 5 ml fractions. The absorbance of each fraction at 280 nm and 431 nm was measured using a spectrophotometer. The retained fractions were pooled and dialysed in three changes of 10 mM sodium phosphate buffer pH 6.5. The sample was then purified by cation exchange chromatography and the fractions separated using the method described above with an elution buffer of 10 mM sodium phosphate buffer at pH 8. The final fractions were concentrated using an Amicon Ultra-15 centrifugal filter unit, diluted in 10 mM HEPES at a pH of 7.4, and stored at -80 ºC until testing.

2.3.4 Oxygen binding tests

The oxygen binding characteristics of recombinant horse HbA (0.25 mM Hb4) samples in

0.1 M HEPES buffer and in the absence and presence of allosteric effector molecules were evaluated over a range of pH values (~6.0 to 8.5) at 25 and 37°C using a Blood Oxygen Binding

System (BOBSTM) and Gas Mixing System (Loligo Systems; Viborg, Denmark). Final effector molecule concentrations were 0.1 M Cl-, 0.5 mM DPG, and 0.1 M Cl- + 0.5 mM DPG. Oxygen equilibrium curves were determined from 1.5 μl samples via absorbance changes at 436 nm. P50

(partial pressure of O2 needed for hemoglobin to reach the half saturation point) and n50 (Hill’s

15 cooperativity coefficients at 50% saturation) values were obtained from Hill plots (log (fractional saturation/(1-fractional saturation)) vs. log PO2) constructed from three or more measurements collected between 20% and 80% Hb saturation. Once the oxygen affinity measurements were completed, the pH of each preparation was determined at both 25 and 37℃ using a Fisherbrand accumet AB15 basic pH meter and Thermo Scientific Orion Perphect Ross micro pH eletrode.

Bohr coefficients (Δlog P50/ΔpH) were calculated from P50 measurements obtained within the pH range ~7.0 to 7.5. The thermal sensitivity of O2 binding (Δlog P50/ΔT) was calculated and oxygenation enthalpies determined using the van’t Hoff isochore:

-1 H= 2.303R × log P50 × (1/T1 – 1/T2) ,

where R is the universal gas constant and the temperatures are in ºK.

Dose-response curves of horse Hb were also determined using graded concentrations of DPG and Cl-: DPG concentration range (0.25 mM, 0.5 mM, 1.25 mM, 2.5 mM, 5 mM, 12.5 mM); chloride concentration range (0.01 M, 0.025 M, 0.1 M, 0.25 M, 1M). Since a higher concentration of DPG or chloride solute can alter the pH, all P50 values were corrected to pH 7.2 using Bohr coefficient values previously established between the pH range 7.0 and 7.4.

2.4 Results

The n50 values of horse HbA consistently were ~2.0 to 2.5 under all experimental conditions, demonstrating that the recombinant expressed proteins exhibited cooperative O2 binding (Figure

2.1). The O2 affinity of stripped horse HbA was higher at 25℃ and pH 7.2 (P50 = 2.11 mm Hg)

n50

- than at 37℃ (P50 = 5.52 mm Hg), with both values being increased in the presence of DPG and Cl

(Figs. 2.1-2.3). The sensitivity of horse HbA to saturating concentrations of each of these effector molecules was similar (e.g. Δlog P50 = 0.79 at 25°C; Figs. 2.2, 2.3), though 0.5 mM DPG exhibited a slightly stronger effect than 0.1 M Cl- (Table 2.2). The combined presence of these anions revealed competitive binding for the same allosteric sites, as O2 affinity only exhibited small incremental changes (Δlog P50 = -0.03 to 0.12) following addition of the second effector molecule

(Table 2.2). The Bohr effect of stripped Hb was relatively low (-0.25 to -0.35), though markedly increased in the presence of DPG and Cl- (-0.56 to -0.81).

The binding of each of the effector molecules was differentially affected by temperature,

- with the effects of DPG and Cl on P50 being higher at 25℃ (Δlog P50 = 0.54 and 0.40, respectively) than 37℃ (0.27 and 0.23, respectively; Table 2.2). Dose-response curves of log P50 vs. log [DPG] showed nearly identical slopes at 37 and 25℃ (0.1410 and 0.1412 respectively), indicating the presence of only a single DPG binding site (Figure 2.3). By contrast, Cl- titration curves revealed a steeper tangential maximum slope at 25℃ than at 37℃ (0.4398 vs. 0.2544, respectively; Figure

2.4). Consequently, at 25℃ horse Hb has a minimum of two chloride ion (0.4398 × 4 = 1.76) binding sites versus only one (0.2544 × 4 = 1.02) at 37℃.

The inherent enthalpy of oxygenation for stripped horse HbA at pH 8.3, where proton binding is expected to be minimal, was -51.14 kJ/mol O2. This value was numerically reduced in the presence of allosteric effectors at pH 7.2, with the enthalpy of proton binding (ΔHH+) being

2.18 kJ/mol, the enthalpy of chloride binding (ΔHCl-) being 23.89 kJ/mol, and the enthalpy of DPG binding (ΔHDPG) being 39.22 kJ/mol. In the combined presence of these effector molecules the

ΔH’ was -23.83 kJ/mol, which corresponds to a log P50 thermal sensitivity of 0.21 mm Hg/°C

(Table 2.3).

y = 0.1410x + 1.0661 R² = 0.9731 1.2

1.0

0.8 y = 0.1412x + 0.7956 R² = 0.999

0.6 log P50 (mm Hg) (mm log P50 0.4

0.2

0.0 -0.2 0.3 0.8 1.3 1.8 log (DPG/Hb4)

1.4

1.2

0.8

0.6 y = 0.2544x + 1.2463 log P50 mmHg

0.4

0.2 y = 0.4398x + 1.1469

0 -3.10 -2.60 -2.10 -1.60 -1.10 -0.60 -0.10 0.40

log [Cl]

Table 2.2 Heterotropic binding characteristics of horse HbA at 37℃ and 25℃ and at pH 7.2.

25℃ 37℃

P50 (mm Hg)

Stripped 2.11 ± 0.08 5.52 ± 0.19

0.5 mM DPG 7.34 ± 0.51 10.39 ± 0.24

0.1 M Cl- 5.25 ± 0.12 9.45 ± 0.22

0.5 mM DPG + 0.1 M Cl- 6.81 ± 0.16 12.01 ± 0.28

- Chloride effect (logP50 +/- 0.1M Cl )

[DPG]=0 0.40 0.23

[DPG]=0.5 mM -0.03 0.06

DPG effect (logP50 +/- 0.5mM DPG)

[Cl-]=0 0.54 0.27

[Cl-]=0.1 M 0.11 0.10

Bohr effect (logP50/pH)

Stripped -0.350 -0.245

0.5 mM DPG -0.799 -0.809

0.1 M Cl- -0.563 -0.777

0.5 mM DPG + 0.1 M Cl- -0.566 -0.594

P50 ± S.E.

Table 2.3 Effect of temperature on oxygen binding in horse HbA.

Enthalpy of oxygenation (kJ/mol O2)

Stripped -48.96

0.5 mM DPG -9.74

0.1 M Cl- -25.07

0.5 mM DPG + 0.1 M Cl- -23.83

Effect of temperature (log P50/T)

Stripped -0.035

0.5 mM DPG -0.013 0.1 M Cl- -0.021

0.5 mM DPG + 0.1 M Cl -0.021

2.5 Discussion

The O2 affinity, cooperativity coefficients, Bohr effects, and sensitivity of recombinant

Horse HbA to Cl-, DPG, and temperature were broadly comparable to values previously obtained from whole blood and purified hemoglobin components from this species (McLean and Lewis

1975; Giardina et al. 1990; Pellegrini et al. 2001; Clerbaux et al. 1986; Cambier et al. 2005). These studies further demonstrated that the similar whole blood O2 affinities of horses and humans (~24-

26 mm Hg vs. 27-28 mm Hg, respectively; Cambier et al. 2005, Clerbaux et al. 1986, Lykkeboe et al 1977) are achieved by different means, in that horse Hb has a relatively low intrinsic O2 affinity (P50 = 1.78 mm Hg at 20℃ and pH 7.6) that is only moderately reduced by DPG, whereas human HbA has both an elevated inherent O2 affinity (1.05 mm Hg) and a high sensitivity to DPG

(Giardina et al. 1990; Pellegrini et al. 2001). My results confirm and extend these findings to provide key insights into the molecular mechanisms contributing to the low temperature sensitivity of horse blood.

Bunn (1971) broadly divided mammalian Hbs into two categories based on their DPG sensitivity: species with a high DPG sensitivity (e.g. human, horse, dog, rabbit, guinea pig, and rat), and those with little to no sensitivity to this red cell effector molecule (e.g. ruminants and feloids). Since mammalian Hbs can only bind a single DPG molecule, the sensitivity of Hb to DPG is dictated by the number of electrostatic interactions formed between this polyanion and Hb

(Arnone 1972). Human Hb has a high DPG sensitivity (Δlog P50 = 0.85 at pH 7.4 and 20C and

0.95 at pH 7.2 and 25C; Giardina et al. 1990; Perutz et al. 1993) facilitated by electrostatic inactions with DPG at four residue positions (1Val, 2His, 82Lys, and 143His) per dimer.

Species that exhibit low DPG sensitivity have substitutions that perturb binding at one or more of these docking sites. For example, 4Thr→Ser and 5Pro→Gly replacements, which are adjacent

23 to the DPG binding pocket, have been implicated in impeding DPG binding to mole and bat Hbs by displacing the α-helix of the β chain (Jelkmann et al. 1981; Giardina et al. 1990). Replacements that delete or replace ionizable residues at 1 and/or 2, such as those found in bovine and feline

Hbs (Perutz 1983), further interfere with DPG binding by lowering the number of chemical bonds possible between this organic phosphate and Hb.

Although Bunn (1971) placed horse Hb into the ‘high DPG sensitivity’ category, subsequent studies have commented on the low DPG sensitivity of horse Hb, which was calculated to be about

60% lower than that of human HbA at 20°C and in the presence of 0.1 M Cl- (Giardina et al. 1990;

Pellegrini et al. 2001). My results, indicate that the DPG sensitivity of horse Hb at 25°C is even

- lower, being about 56% of that of human HbA (Δ log P50 = 0.54 vs. 0.95) in the absence of Cl , and nearly 75% lower than human HbA (0.11 vs. 0.42; Perutz et al. 1994) when Cl- is present. In fact, the DPG sensitivity of horse Hb in 0.1 M Cl- media is nearly identical to that of bovine Hb

(0.08)—which is widely considered to possess a ‘DPG insensitive’ phenotype—under the same conditions (Perutz et al. 1994). Taken together, my results argue that substitutions at positions 2

(His→Gln), 4 (Thr→Ser), and 5 (Pro→Gly) are responsible for the very low response of horse

Hb to DPG.

A commonly accepted tenet is that cold-adapted mammals have ‘additional’ effector binding sites relative to non-cold tolerant species to help lower their enthalpy of oxygenation (Weber and

Campbell 2011). More recently, it was proposed that numerically low ΔH’ Hb phenotypes are not necessarily correlated with the number of effector binding sites but rather by the temperature dependence of effector binding to these sites (Signore 2016). Accordingly, Hbs that exhibit the largest increases in effector sensitivity with declining temperature possess the lowest thermal sensitivities. In support of this latter hypothesis, my results revealed sharp increases in Cl- and

DPG sensitivities as temperature declined from 37 to 25°C (Δ log P50 = 0.23 and 0.40, respectively, and 0.27 to 0.54, respectively) that correspond to ΔH values of -25.07 kJ/mol O2 and -9.74 kJ/mol

- O2 in the presence of 0.1 M Cl and 0.5 mM DPG, respectively. The thermal sensitivity of horse

Hb in the presence of both effectors (H’ = -23.83 kJ/mol O2) is between values obtained for each effector individually, presumably due to competitive binding for the same docking sites.

A curious observation is that horses and cows have similarly low DPG sensitivities, yet red cell DPG levels in horse blood (16.9 mol/g Hb; Clerbeaux et al. 1993) are much higher than those found in cattle (<1.5 mol/g Hb; Clerbeaux et al. 1993). DPG concentrations found in horse blood is also higher than humans (13.4 mol/g Hb; Clerbeaux et al. 1993), whose Hb has a distinctly higher DPG sensitivity. Notably, trained thoroughbred horses have lower concentrations of DPG then untrained horses (12.9 ± 0.3 mol/g Hb vs. 17.2 ± 0.5 mol/g Hb, respectively), which was found to increase their blood O2 affinity by ~2 mm Hg (Lykkeboe et al. 1977). At face value, this response is perplexing as a lower P50 would be expected to hinder O2 release at metabolically active tissues during exercise, and it has been suggested that trained horses compensate by increasing hemoglobin concentration and blood flow to maintain sufficient O2 delivery (Smale and

Butler 1994). However, my results suggest that erythrocytic reductions in DPG levels should increase the thermal sensitivity of horse blood, thereby facilitating O2 release to warm exercising muscles. Importantly, this shift in thermal sensitivity would increase the heat carrying capacity of horse blood and aid heat dissipation during strenuous running (i.e. horse RBCs with lower DPG concentrations would absorb more heat upon deoxygenation at the tissues and release more heat upon oxygenation at the lungs). In contrast, elevated red cell DPG levels during winter would be expected to lower the temperature sensitivity of horse blood, allowing them to more efficiently exploit regional heterothermy to conserve energy when exposed to cold environments.

2.6 Conclusions

In conclusion, recombinant horse Hb was found to exhibit a very low sensitivity to DPG, rivaling that of cattle Hb which is considered to be a ‘DPG insensitive’ phenotype. This trait presumably arises from amino acid exchanges near the β-chain N-termini of horse Hb that alters the stereochemistry of the DPG binding pocket and removes two DPG binding sites. Intriguingly, and despite having relatively low effector binding compared to most mammals, horse Hb exhibits a lower temperature sensitivity when compared to human Hb which is achieved via increased temperature dependent DPG and Cl- binding. The ability of horses to modulate red cell DPG levels moreover provides a mechanism that appears to allow this species to adaptively alter the thermal dependence of O2 binding, and presumably underlies the variations in the thermal sensitivity of blood O2-affinity determined in previous studies. To my knowledge, the ability of an animal to adaptively modulate the thermal sensitivity of its blood O2 binding has not previously been described.

Chapter 3: Functional characterization of hemoglobin from the rhinoceros clade reveals a lack of temperature adaptation in the extinct woolly rhino

3.1 Abstract

The extinct woolly rhinoceros (Coelodonta antiquitatis) persisted in substantially harsher climates during the Pleistocene Ice Ages than experienced by extant rhino species. To minimize heat lost in cold environments, many large bodied, cold-tolerant mammals employ regional heterothermy. However, this strategy may negatively impact O2 delivery to cool peripheral tissues because of the inverse relationship between hemoglobin O2–affinity and temperature. To counteract this phenomenon, numerous species that co-habited the woolly rhino’s north Eurasian habitat evolved hemoglobin (Hb) molecules that are less sensitive to temperature changes. To test if the woolly rhinoceros similarly evolved Hb proteins with low thermal sensitivities, I first determined the coding sequences of the - and -type globin chains relative to those of their extant relatives and the Malaysian tapir (Tapirus indicus), and conducted a series of O2 binding curves on recombinant Hb isoforms from the woolly rhino together with those from the black (Diceros bicornis) and Sumatran rhinoceros (Dicerorhinus sumatrensis). The major Hb isoforms (HbA) from each of these species were found to possess nearly identical Hb–O2 affinities and effector sensitivities. Additionally, none of the three residue replacements evolved by the woolly rhino - and -type globin chains were found to alter the energetic transition of O2 binding and release by their major and minor Hb isoforms. Consequently, the overall oxygenation enthalpies of the woolly rhino major and minor Hb isoforms (-42 and -46 kJ/mol, respectively) were thus numerically high and indistinguishable from those of black and Sumatran rhinos, which argues against strong regional heterothermy in any member of this lineage. Of note, the -type () chain encoding the

27 woolly rhino minor Hb isoform (HbA2) was found to harbor a single, rare amino acid substitution

(104Arg→Ser) previously characterized in humans as Hb Camperdown. Remarkably, this substitution almost completely eradicated effector binding and hence the ability to meaningfully modulate Hb–O2 affinity by this protein. Presence of this seemingly maladaptive phenotype in both woolly rhino specimens for which I have sequence coverage of this region is thus surprising and suggests it may have been genetically fixed during an ancient population bottleneck event.

3.2 Introduction

The cyclical climate of the Pleistocene included a series of rising and falling temperatures that presumably exerted strong selection pressures on the woolly rhinoceros (Coelodonta antiquitatis) lineage until their extinction ~12,000 years ago (Markova et al. 2013). Fossil evidence, however, suggests that members of the genus Coelodonta first initiated the development of cold adaptations in the Tibetan Plateau earlier in the Cenozoic era, during the Pliocene (Wang et al. 2015). The Tibetan Plateau is the highest and largest plateau in the world with a seasonally cold and arid climate (Wang et al. 2015). Once the Pleistocene Ice Ages began, members of this lineage were presumably sufficiently adapted to disperse west across Eurasia over the newly established cold and dry open grasslands (Wang et al. 2015). Under the prevailing cycles of change, whenever the climate grew cooler Coelodonta was predisposed to become a dominant population while conversely populations of another extinct rhino species, Stephanorhinus hemitoechus, would tend to outnumber Coelodonta during the warmer phases (Kahlke and

Lacombat 2008). This enhanced cold hardiness by Coelodonta was likely enabled by the evolution of a number of morphological features to minimize heat loss such as small ears, a short tail, long guard hairs, and thick underwool, when compared to their extant relatives (Boeskorov 2012).

However, deep snow posed an obstacle for woolly rhinos given their short legs and small bearing surface area; their build was similarly not well suited to soft uneven ground of mesic environments which would additionally impair the insulative capacity of their fur (Boeskorov 2012). Thus, as the Pleistocene progressed, woolly rhinos adapted to cool arid environments and became specialized grazers with a lowered head and neck position, and advantageous changes in the shape of their skull and teeth (Kahlke and Lacombat 2008).

In certain conditions such as when temperature is low, and food is scarce, the costs of homeothermy outweigh the benefits and lead to the strategy of regional heterothermy, whereby the limbs and extremities are maintained at lower temperatures than the core via countercurrent heat exchangers. Regional heterothermy is suggested to enhance survival by lowering energy intake requirements via strongly reduced thermal gradients for heat loss to the environment (Weber and Campbell 2011; Campbell and Hofreiter 2015). Presumably to match O2 supply with the metabolic needs of tissues in this state, the Hb of regional endotherms appear to universally exhibit numerically low oxygenation enthalpies (Weber and Campbell 2011). While it remains unknown whether or not woolly rhinos similarly possessed counter current heat exchangers in their extremities, the Hb of two other extinct Arctic mammals—woolly mammoths and Steller’s sea cows—were recently shown to have evolved a low thermal sensitivity phenotype consistent with this blood vessel arrangement (Campbell et al. 2010a; Signore 2016), and it is reasonable to assume woolly rhino Hb would exhibit similar attributes. In contrast, extant species of rhinoceros (and closely related tapirs) are adapted to warm climates of Asia and Africa. Since these taxa have a large body mass, they have a relatively low surface area to dissipate metabolic heat. Presumably to compensate, these species possess thick skin folds on their neck, hips, and shoulders which contain a multitude of blood vessels and capillaries and can retain water, thereby playing a crucial

29 role in thermoregulation through dissipating heat (Endo et al. 2009). Blood with a high thermal sensitivity may also be advantageous for these species as it would increase the heat carrying capacity of the blood and promote its dissipation at the lungs.

Previous studies that characterized some physiological properties of Hb from members of the Perissodactyla clade provide hints that the blood of extant rhino and tapir species—which are restricted to warm equatorial climates—may indeed exhibit higher thermal sensitivities than more cold-tolerant horses. Equids, for example, have a 2His→Gln replacement that deletes two potential electrostatic interactions with DPG and contributes to their relatively low sensitivity for

DPG; nonetheless this organic phosphate was found to strongly reduce the thermal sensitivity of

O2 binding and release (Chapter 2). Brazilian tapir, Indian rhinoceros, and white rhinoceros Hbs all possess a more radical 2His→Glu substitution that introduces an anionic residue into the DPG binding cleft that nearly abolish its responsiveness to this polyanionic allosteric effector (Baumann et al. 1984; Abassi et al. 1987). Additionally, the enthalpy of oxygenation of Indian rhinoceros Hb

- isoform A (-46 kJ/mol O2) and isoform B (-42 kJ/mol O2) in 0.1 M Cl (Abassi et al. 1987) are well above those of horse Hb (-25 kJ/mol O2) under similar conditions (Chapter 2). Taken together, these findings suggest that blood with a high thermal sensitivity is ancestral for the tapir/rhino clade. Given the long evolutionary association of the woolly rhinoceros clade with cold northern climates I accordingly hypothesized that their Hb would have evolved a reduced enthalpy of oxygenation compared to the non-cold adapted rhinos.

3.3 Materials and Methods

This study focused on the Hbs of the white, black, Indian, Javan, Sumatran, and woolly rhinos as well as the Malaysian tapir. The coding sequences of the complete alpha- and beta globin

30 gene clusters were targeted (together with ~45 other nuclear genes) from DNA libraries constructed for each of these extant species (except the white rhino, for which a high coverage genome is publicly available) and three woolly rhinos as part of another study (Table 3.1; Gaudry

2017). Briefly, this study employed in-solution hybridization capture (using Mybaits RNA probes) followed by next-generation sequencing with an Ion-Torrent Personal Genome Machine next- generation sequencer to generate ~5.7 million raw sequence reads with an average length of 152 bp (Gaudry 2017).

3.3.1 Assembly and annotation

I used the program Geneious (version 7.1.9) to assemble raw sequence reads from each of the above species to the alpha- and beta- globin clusters of the white rhinoceros (GenBank accession numbers: AKZM01040736.1 and AKZM01032442.1 respectively).

The raw Ion-Torrent reads for each rhino species were initially aligned to the annotated white rhino gene clusters with the sequence mismatch limit set to 5%. The alignments were then manually examined to look for sequence gaps (gene regions with no sequence coverage) or sequence mis-alignments. In cases where there was more than one sequence aligned to a gene, a determination was made about which sequence was correctly aligned by extending both sequences through a self-alignment in a targeted area. Following this step, a comparison of regions of the sequences up or downstream of the target gene was generated with reference to the corresponding gene sequences of the white rhinoceros. The Malaysian tapir sequences were aligned to the white rhino globin clusters using a maximum mismatch of 10%. Using these procedures, complete coverage for the four adult-expressed loci were obtained for most species, though gaps were

Table 3.1 Woolly rhino specimen information including lab ID, museum/sample ID, material,

14C date, latitude, and longitude.

Lab ID Museum/sample ID Material 14C date Latitude Longitude

WR055 IEM 198-2/ASH9- Tooth 46, 500 73.30 143.40

OBL

WR068 PIN 3914-5 Bone 24, 860 68.19 146.60

WR070 PIN COEL 3342-101 Bone 25, 550 67.58 160.78

32 detected in the woolly, black, and Indian rhino assemblies; low sequence coverage (<50%) was obtained for the Javan rhino assembly, which was thus omitted from the study.

Coding sequence gaps were filled following established polymerase chain reaction (PCR) and Sanger sequencing procedures (Table 2.1) and employed custom designed primers to specifically target the missing gene regions (Appendix 1). The sequence gaps in the woolly rhino

HBA-T1 and HBA-T2 exon 2 (10 bp), were filled using an amplified DNA library, which was diluted 1:2 with Hyclone molecular grade water. To fill the black rhino sequence gaps in exons 2

(80 bp) and 3 (15 bp) of HBA, a whole genome amplification was first performed using the REPLI- g mini kit from Qiagen and was diluted 1:10. For both species, the PCR mix was composed of 1

μl of template, 4 μl of GC rich One Taq buffer, 0.4 μl dNTP’s, 0.4 μl of forward and reverse primers (Appendix 1), 0.2 μl of One Taq, and 13.6 μl of Hyclone molecular grade water. The amplicon length (minus primers) of the targeted woolly rhino HBA-T1 and HBA-T2 exon 2 region was 93 bp, while the amplicon sizes (minus primers) for the exon 2 and exon 3 targeted regions were 343 and 267 bp, respectively. The cycling protocols are shown in Table 2.1. A MJ Mini

Gradient Thermal Cycler from BioRad was used to cycle through the denaturation, annealing, and extension phases 35 times. A subset of each sample was electrophoresed and the strongest band was chosen for gel extraction using the GeneJet gel extraction kit from Thermo Fisher Scientific.

The amplicons were sequenced using the dye terminator Sanger sequencing method. The sequencing reaction was performed using 1 μl of template DNA, 3.5 μl of 5x Big Dye buffer, 0.32

μl of primer, 1 μl of Big Dye, and 14.18 μl of Hyclone molecular grade water. The Big Dye program parameters were cycled 24 times using a thermocycler (Table 2.1). Sequencing clean-up was performed using the ZR DNA sequencing clean-up kit (Zymo Research). The resulting

33 sequences were then aligned with the original assemblies using Sequencher (version 5.1, Gene codes corporation, Ann Arbor, MI) to fill the sequence gap.

While complete HBA-T1 and HBA-T2 coding sequences were obtained for the Indian rhino, both the HBD and HBB coding sequences were incomplete in that exon 2 sequences were partial for both loci, while no coverage was obtained for exon 3 of either gene. Previous work revealed that these two protein chains differ at three residue positions (β2 Asp →δ2 Glu, β6 Gly→δ6 Gly, and β120 Gln→δ120Lys; Abbasi et al. 1987), the first two of which were confirmed by my HBD and HBB assemblies (data not shown). Hence, the published δ and β chain sequences of this species were used for subsequent analyses.

An ancestral sequence reconstruction was then conducted for each loci to trace the evolutionary history of amino acid replacements in the perissodactyl clade. Prior to conducting this analysis, multiple sequence alignments for conceptually translated HBA, HBD, and HBB sequences were constructed using MUSCLE (Chojnacki et al. 2017). These alignments included the horse (see Chapter 2), Malaysian tapir, Indian rhino, white rhino, black rhino, Sumatran rhino, and woolly rhino. This alignment and a treefile were processed by the PAML protocol

(Phylogenetic Analysis by Maximum Likelihood) yielding a file that included all ancestral sequences to each branch as well as the confidence level for each substitution. The data were transferred into Figtree version 1.3.1 to visualize a phylogenetic tree showing the evolutionary relationships between species. Since there are two competing evolutionary hypotheses regarding the phylogeny of rhinos (Gaudry 2017), two input treefiles were made. The first place the black and white rhinos as a sister group to Sumatran and woolly rhinos, while the second placed the

Indian rhino as the sister group to the Sumatran and woolly rhinos. Changing the treefile did not

34 alter the ancestral sequence reconstructions for the Sumatran and woolly rhinos or the confidence levels of each substitution.

Once all annotations and data collection were completed, the translated coding sequences of the adult-expressed alpha- (HBA-T1/HBA-T2) and beta-like (HBD and HBB) globin sequences of the Malaysian tapir and black, Sumatran, and woolly rhino were optimized for E.coli expression and then synthesized (Natarajan et al. 2011; Signore 2019). The Hb inserts were amplified, digested, ligated into expression vectors, and inserted into E.coli following an established laboratory protocol (Natarajan et al. 2011; Signore 2019) as detailed in section 2.3.1.

3.3.2 Hemoglobin expression

The expression of recombinant Hb isoforms for each species from the synthesized genes followed an established laboratory protocol (Signore 2019; Natarajan et al., 2011). This protocol can be found in section 2.3.2.

3.3.3 Hemoglobin purification

Hemoglobin purification was conducted following an established laboratory protocol

(Signore 2019, Natarajan et al., 2011). This protocol can be found in section 2.3.3.

3.3.4 Oxygen binding tests

The oxygen binding characteristics and temperature sensitivities of the different hemoglobin isoforms from each species were tested following the protocol described in section 2.3.4.

3.4 Results

My annotation of the alpha globin gene cluster of the white rhinoceros revealed that it is composed of five genes (from 5’ to 3’): HBZ (ζ), HBK (κ), HBA-T1 and HBA-T2 (α1 and α2, respectively), and HBQ (θ) (Figure 3.1). Among these genes, HBA-T1 and HBA-T2 are expressed in adult hemoglobin and encode for the identical protein in each of the rhinoceros species. The white rhino beta globin cluster was found to be is composed of four functional loci and one pseudogene (from 5’ to 3’): HBE (ε), HBG (γ), HBHps (η pseudogene), HBD (δ), and HBB (β)

(Figure 3.1). The HBB and HBD genes are expressed in adult hemoglobin (Gaudry et al. 2014) to form the major (HbA) and minor (HbA2) Hb isoforms; the major Hb component accounts for

~60% and 81% of circulating Hb in the blood of the white and Indian rhinoceros, respectively

(Baumann et al. 1984, Abassi et al. 1987).

My ancestral sequence reconstructions show that the woolly rhino lineage has evolved three amino acid replacements following its divergence from Sumatran rhinos (Figs. 3.2, 3.3, and 3.4).

Two exchanges are found on the α subunit (α12Thr→Ser and α19 Ala→Thr) and the other is on the δ subunit (δ104 Arg→Ser). Both of the alpha chain replacements are located on the outside of the protein, while the δ104 Arg→Ser substitution extends into the internal cavity between the alpha and beta subunits. This δ chain replacement, which has been described previously in humans as

HbA2 Capri (Angioletti et al. 2002), removes a positive charge from this position. Because an identical replacement on the β chain of a human Hb variant (Hb Camperdown) was shown to markedly affect both the inherent O2 affinity of the protein and its sensitivity to allosteric effectors

(Kister et al. 1989), I additionally synthesized a woolly rhino HbA2 δ104Ser→Arg variant to study the effects of this replacement on the woolly rhino HbA2 background.

    

10 kb HBZ HBMps HBA-T1 HBA-T2 HBQ

b)     

HBE HBH-T1ps HBH-T2 HBD HBB

Figure 3.1 Graphical depiction of the a) alpha and b) beta globin clusters of the white rhinoceros. Open rectangles depict pseudogenes while closed rectangles depict intact loci. Symbols above each box refer to the Latin gene name, while the current gene nomenclature is listed below each locus. Light colored boxes denote prenatal expressed hemoglobin loci, while the black boxes denote post-natal expressed hemoglobin genes; the HBQ locus (dark grey) is not known to be incorporated into hemoglobin proteins. For each species investigated, the tandemly duplicated HBA-T1 and HBA-T2 loci encode for identical protein subunits within the Perissodactyla clade.

38 b)

39 c)

HBA (alpha globin chain) Nucleotide position 31 60 Residue position | 12 19 | C.antiquitatis translation ValLysSerAlaTrpSerHisValGlyThrHisAla WR055(2) GTCAAGAGCGCCTGGAGCCACGTTGGCACCCACGCT WR068 (4) GTCAAGAGCGCCTGGAGCCACGTTGGCACCCACGCT WR070 (3) GTCAAGAGCGCCTGGAGCCACGTTGGCACCCACGCT D. sumatrensis (10) GTCAAGACCGCCTGGAGTCACGTTGGTCCCCACGCT D. sumatrensis translation ValLysThrAlaTrpSerHisValGlyProHisAla

HBD (delta globin chain) Nucleotide position 301 314 Residue position | 104| C. antiquitatis translation ProGluAsnPheSerIVS2→ WR055(3) CCTGAGAATTTCAGCGTGAGTCTAG WR068 (0) ????????????????????????? WR070 (2) CCTGAGAATTTCAGCGTGAGTCTAG D. sumatrensis (8) CCTGAGAATTTCAGGGTGAGTCTAG D. sumatrensis translation ProGluAsnPheArgIVS2→

Figure 3.3 Nucleotide alignment emphasizing non-synonymous substitutions (bold) in the woolly and Sumatran rhinoceros a) HBA and b) HBD globin genes. There are three woolly rhinoceros specimens with the sequence coverage depth not including duplicates indicated in brackets. Question marks denote a lack of sequence coverage.

42 c)

With one exception, the O2 binding characteristics, effector sensitivities, and cooperativity coefficients of the major and minor Hb components from woolly, Sumatran, and black rhinos were found to be highly similar to one another (Figure 3.5; Tables 3.2 and 3.3). The notable exception is that the ‘stripped’ (co-factor free) woolly rhino HbA2 isoform has a much lower oxygen affinity compared to the other rhinoceros isoforms at both 37 (P50 = 17.05 mm Hg vs. 9.97 to 11.55 mm

Hg; Tables 3.2 and 3.3) and 25℃ (6.44 mm Hg vs. 3.79 to 4.50 mm Hg; Tables 3.2 and 3.3). This isoform was further found to have strongly suppressed Bohr and Cl- effects, and to be completely insensitive to DPG (cf. Fig. 3.6 a, b). In stark contrast to results obtained from purified Brazilian tapir Hb (Baumann et al. 1984), both Hb isoforms of the Malaysian tapir exhibited cooperativity coefficients less than one, indicative of non-cooperative O2 binding. This finding suggests that potential misfolding (or other) problems may have occurred during expression or purification, and hence the O2 binding characteristics of these proteins will not be discussed further here (though the results of these experiments can be found in Appendix 2).

- Sensitivities to chloride (assessed as logP50 (0.1 M Cl ) - logP50 (stripped): 0.16 to 0.22 at

37℃ and 0.23 to 0.27 at 25℃) and DPG (logP50 (0.5 mM DPG) - logP50 (stripped): 0.04 to 0.13 at 37℃ and 0.11 to 0.17 at 25℃) were low for each of the major Hb isoforms at both temperatures

(Table 3.2). The Bohr effects of these isoforms ranged between 0.25 and 0.60 (Table 3.2). The enthalpies of oxygenation of the woolly, Sumatran, and black rhino Hb isoforms in the absence of cofactors was ca. -50 kJ/mol O2 at pH 7.2, and only minimally affected by the addition of 0.5 mM

DPG, 0.1 M Cl-, and 0.5 mM DPG + 0.1 M Cl- (Table 3.4), with the woolly rhino HbA2 isoform generally exhibiting the greatest temperature sensitivity of Hb–O2 binding.

a) b) c)

n50 n50 n50

37℃ Species Woolly Sumatran Black Isoform HbA HbA HbA Oxygen affinitya P50 ‘stripped’ 11.31 ± 0.26 9.97 ± 0.55 11.55 ± 0.19 - P50 (0.1 M Cl ) 16.49 ± 0.11 16.68 ± 0.15 18.64 ± 0.17 P50 (0.5 mM DPG) 12.47 ± 0.57 13.32 ± 0.21 14.10 ± 0.03 - P50 (Cl + DPG) 16.75 ± 0.08 17.92 ± 1.57 19.38 ± 0.04 Chloride effect b [DPG]=0 0.16 0.22 0.21 [DPG]=0.5 mM 0.13 0.13 0.14 DPG effect c [Cl-]=0 0.04 0.13 0.09 [Cl-]=0.1 M 0.01 0.03 0.02 Bohr effect d ‘stripped’ -0.31 -0.42 -0.25 0.1 M Cl- -0.49 -0.60 -0.43 0.5 mM DPG -0.52 -0.42 -0.53 Cl- + DPG -0.51 -0.54 -0.52 25℃ Oxygen affinitya P50 ‘stripped’ 3.79 ± 0.09 3.86 ± 0.27 4.50 ± 0.04 - P50 (0.1 M Cl ) 6.51 ± 0.06 7.24 ± 0.03 7.63 ± 0.18 P50 (0.5 mM DPG) 5.12 ± 0.12 5.70 ± 0.13 5.82 ± 0.27 - P50 (Cl + DPG) 7.03 ± 0.06 7.71 ± 0.07 8.12 ± 0.26 Chloride effectb [DPG]=0 0.23 0.27 0.23 [DPG]=0.5 mM 0.14 0.13 0.14 DPG effectc [Cl-]=0 0.13 0.17 0.11 [Cl-]=0.1 M 0.03 0.03 0.03 Bohr effectd ‘stripped’ -0.42 -0.38 -0.31 0.1 M Cl- -0.44 -0.41 -0.45 0.5 mM DPG -0.54 -0.50 -0.42 Cl- + DPG -0.50 -0.53 -0.53 a(mmHg), b(logP50 +/- 0.1M Cl-), c(logP50 +/- 0.5mM DPG), d(logP50/pH) P50 ± S.E.

37℃ Species Woolly Sumatran Isoform HbA2 HbA2 HbA2 104Ser→Arg Oxygen affinitya P50 ‘stripped’ 17.05 ± 0.51 11.52 ± 0.24 11.59 ± 0.19 - P50 (0.1 M Cl ) 18.13 ± 0.50 18.94 ± 0.31 19.84 ± 0.91 P50 (0.5 mM DPG) 16.63 ± 0.65 13.61 ± 0.03 13.99 ± 0.32 - P50 (Cl + DPG) 17.49 ± 0.40 19.75 ± 0.41 20.09 ± 0.88 Chloride effect b [DPG]=0 0.03 0.22 0.24 [DPG]=0.5 mM 0.02 0.16 0.16 DPG effect c [Cl-]=0 -0.01 0.07 0.08 [Cl-]=0.1 M -0.02 0.02 0.00 Bohr effect d ‘stripped’ -0.25 -0.32 -0.23 0.1 M Cl- -0.35 -0.49 -0.47 0.5 mM DPG -0.22 -0.57 -0.55 Cl- + DPG -0.38 -0.55 -0.50 25℃ Oxygen affinitya P50 ‘stripped’ 6.44 ± 0.04 4.73 ± 0.02 4.40 ± 0.03 - P50 (0.1 M Cl ) 6.77 ± 0.16 7.91 ± 0.04 7.42 ± 0.05 P50 (0.5 mM DPG) 6.11 ± 0.14 6.02 ± 0.28 5.71 ± 0.13 - P50 (Cl + DPG) 7.04 ± 0.16 8.40 ± 0.06 7.57 ± 0.02 Chloride effectb [DPG]=0 0.02 0.22 0.23 [DPG]=0.5 mM 0.06 0.14 0.12 DPG effectc [Cl-]=0 -0.02 0.10 0.11 [Cl-]=0.1 M 0.02 0.03 0.01 Bohr effectd ‘stripped’ -0.35 -0.32 -0.42 0.1 M Cl- -0.35 -0.46 -0.44 0.5 mM DPG -0.28 -0.47 -0.48 Cl- + DPG -0.42 -0.47 -0.51 a(mmHg), b(logP50 +/- 0.1M Cl-), c(logP50 +/- 0.5mM DPG), d(logP50/pH) P50 ± S.E.

ΔH kJ/mol Woolly Woolly Woolly HbA2 Sumatran Sumatran Black HbA HbA HbA2 104Ser→Arg HbA HbA2 Stripped -57.5 -49.8 -44.4 -48.3 -49.5 -47.8 0.1 M Cl- -47.0 -50.5 -43.4 -41.0 -50.4 -44.6 0.5 mM DPG -44.5 -51.6 -39.7 -41.8 -44.8 -44.1 Cl- + DPG -43.0 -45.7 -42.2 -41.5 -50.0 -43.1 Stripped* -59.9 -50.7 -55.4 -60.6 -58.5 -41.9

*measured at pH >8, where the Bohr effect contribution is expected to be minimal (Weber et al. 2014)

3.5 Discussion

Relative to the majority of mammalian species, the major Hb isoforms of the woolly rhinoceros, Sumatran rhinoceros, and black rhinoceros have low oxygen affinities at 37 and 25℃

(Figure 3.5). These results mirror findings of previous studies conducted on purified Hbs of the

Indian rhinoceros, white rhinoceros, and Brazilian tapir (Baumann et al. 1984; Abbasi et al. 1987).

Consistent with results of these earlier studies, the DPG and Cl- sensitivities of woolly, black, and

Sumatran rhino Hbs were also relatively low. The low anion sensitivities of rhinoceros and tapir

Hb indicates that blood O2 affinity is predominantly modulated by blood pH.

The reduced chloride sensitivities exhibited by the rhino Hb isoforms relative to horses

(Figure 3.8) is likely due to a α131Ser→Asn substitution which removes a Cl- binding site (Weber et al. 2002). This suggestion is consistent with my Cl- dose response curves, which indicated that horse HbA has two chloride binding sites while woolly rhino HbA was found to have only a single chloride binding site (Figure 3.8). A similar α131Ser→Ala substitution in the frog species

Telmatobius peruvianus was found to confer a 7.3-fold reduction in chloride binding compared to a closely related species (Xenopus laevis) with the Cl- binding site intact (Weber 2010).

Bunn (1971) separated mammalian Hbs into two categories based upon their DPG sensitivity; species with high DPG sensitivity (e.g. humans, dogs, rats) and those with low sensitivity to this polyanionic effector (e.g. ruminants, feloids). The Hb isoforms of the rhinoceros species all exhibit extremely low responses to DPG (essentially zero in the presence of 0.1 M Cl-) and hence should be placed into the low DPG sensitivity category. Notably, I found the DPG sensitivity of rhino Hbs to be noticeably less than those of cattle and other ruminants (Baudin-

Creuza et al. 2002), which are widely considered to be the archetypical ‘DPG insensitive’ phenotype, though similar to feline (Janecka et al 2015), eastern mole (Campbell et al. 2010b), and

Steller’s sea cow Hb (Signore 2016). Interestingly, this phenotype arose via convergent mechanisms in all five species. Briefly, the β2His binding site is deleted in ruminant Hbs (Perutz and Imai 1980) while it is replaced by Phe in feloids or Glu in tapirs and rhinos. The latter exchange swaps the cationic His residue (when protonated) of most mammalian Hbs with a negative charge that is expected to repel strongly polyanionic DPG molecules while the former replacement introduces a bulky hydrophobic residue into the DPG binding cleft; both appear to perturb the stereochemistry of the DPG binding site to a greater degree than the simple deletion of this residue position in ruminants. By contrast, the DPG insensitive phenotype of eastern mole and Steller’s sea cow Hb arises from exchanges that eliminate the DPG binding site at β82Lys (Campbell et al.

2010b, Signore 2016). Taken together, these results suggest that residue exchanges (or deletions) at positions β2 and β82 affect DPG binding to a greater degree than at the other two positions (β1 and β143) implicated in DPG binding.

A surprising finding was that both the major and minor Hb isoforms of the woolly rhinoceros exhibited oxygenation enthalpies and corresponding temperature sensitivities that were indistinguishable from those of other extant rhinos (-40 to -50 kJ/mol O2; -0.031 mm Hg/°C; Table

3.4). These oxygenation enthalpies are well above those of other cold adapted species including musk-ox, reindeer, woolly mammoths, and Steller’s sea cows (-14 to -18 kJ/mol O2; Brix et al.

1989; Giardina et al. 1989; Campbell et al. 2010a; Signore 2016). A major consideration for all extant rhinoceros species is overheating since they live in hot climates and have large bodies. One way in which they dissipate heat is via the thick, highly vascularized skin folds located on their hips, neck, and shoulders. This allows them to increase their surface area to volume ratio and hold on to water over a longer duration leading to further evaporative heat loss (Endo et al. 2009).

Hemoglobin with a numerically high oxygenation enthalpy would also be advantageous for these

50 species as it would increase the heat carrying capacity of the blood and promote its dissipation at the lungs. Over the course of the Pleistocene, woolly rhinos persisted in a cyclical climate that had both warm and cold periods (Markova et al. 2013). As the short ears and tail, stout limbs, and thick woolly coat would presumably impede the ability of this species to efficiently dissipate heat during milder summer months or warm interglacial intervals, the possession of blood with a relatively high thermal sensitivity may have similarly assisted with heat loss. However, a numerically high enthalpy of oxygenation argues against the occurrence of regional heterothermy in this lineage.

The absence of countercurrent heat exchangers in the appendages would likely have had important energetic implications for this high Arctic species during the winter months. This is because regional heterothermy is known to dramatically lower the thermal gradient for heat loss to the environment, thereby lowering daily energy requirements when thermal costs are at their highest and when forage quality and forage availability are often at their lowest (Campbell and Hofreiter

2015).

A second notable finding of this study was that the minor Hb isoform of the woolly rhinoceros possesses a single, extremely rare substitution (104Arg→Ser) that has, to my knowledge, only been previously characterized in humans as Hb Camperdown (104Arg→Ser) and Hb Capri (104Arg→Ser) (Kister et al. 1989; Wilkinson et al. 1975; De Anglioletti 2002). In other mammalian Hbs, this position is inhabited by a strongly cationic amino acid (Lys or Arg), indicating that it is a highly conserved position with physiological importance (Kister et al. 1989;

Wilkinson et al. 1975). When Hb is deoxygenated, the side chain of 104Arg extends into the internal water filled cavity between the beta chains where it contributes to the hydrophilic environment of the cavity and also contributes to the α1β2 contact by binding to α296Val; when the

Hb transitions to the oxygenated state, 104Arg is located at the α1β1 contact where it binds

α136Phe and α199Lys (Kister et al. 1989; Wilkinson et al. 1975). The 104Arg→Ser mutation also results in a loss of a cationic charge between the beta chains which is expected to reduce the repulsion between these subunits and shift the T→R equilibrium towards the T-state (Kister et al.

1989). Accordingly, the Hb Camperdown variant has been shown to exhibit reduced sensitivities

- to protons, Cl , and DPG, as well as a lower intrinsic O2 affinity than human HbA (Kister et al.

1989). Presumably owing to the already low DPG and Cl- sensitivities of the rhino Hb background relative to human HbA, the addition of 104Arg→Ser completely abolishes the binding of these effector molecules to the woolly rhino HbA2 isoform (Figs. 3.6, 3.7, and 3.8). I am unaware of any other mammalian Hb with even a remotely similar phenotype. As expected, replacement of

104Ser with the ancestral 104Arg residue restores the inherent O2 affinity and effector sensitivities of the mutant protein to levels commensurate with other rhino Hb isoforms (Tables

3.2 and 3.3).

Interestingly, woolly mammoths that existed in the same period and climate as woolly rhinos exhibited a substitution on its beta-type chain (/101Glu→Gln) that conferred precisely the opposite effects as does the woolly rhino 104Arg→Ser replacement (Campbell et al. 2010a). The mammoth /δ101 Glu→Gln exchange causes the T-state to be destabilized since /δ104Arg is no longer restricted by /δ101 Glu, and thus can enter the central cavity (Noguchi et al. 2012). This increases the oxygen affinity and effector sensitivities of the protein. As a result, the woolly mammoth Hb has an increased regulation of oxygen affinity through effectors and a reduced temperature sensitivity (Campbell et al. 2010a).

a) b) c)

Figure 3.6 Oxygen affinity curves (log P50) and cooperativity coefficients (n50) for a) the minor (HbA2; 0.25 mM) hemoglobin component of the woolly rhinoceros b) a woolly rhinoceros 104Ser→Arg HbA2 mutant and c) the minor (HbA2; 0.25 mM) hemoglobin component of the sumatran rhinoceros as a function of pH at 25℃ (closed symbols) and 37℃ (open symbols). Note - that the inherent O2 affinity (circles), and effect of Cl (0.1 M; squares), 0.5 mM DPG (triangles), and 0.1 M Cl- + 0.5 mM DPG (diamonds) on woolly rhino HbA2 are all markedly reduced relative to the 104Ser→Arg mutant.

1.3

1.2

1.1

1.0

0.9

log log P50 (mm Hg) 0.8

0.7

0.6

0.5 -0.2 0.3 0.8 1.3 1.8 log (DPG/Hb4)

1.4

1.2

1.0

0.8 log log P50 (mm Hg)

0.6

0.4

0.2 -2.5 -2.0 -1.5 -1.0 -0.5 0.0 0.5 log [Cl]

The evolution and apparent genetic fixation of 104Ser (it is homozygous in both individuals—which lived >20,000 years and >1000 km apart (see Table 3.1)—for which I have sequence coverage of this region) in the woolly rhino HbA2 isoform is puzzling as this Hb variant has a minimal ability to adaptively modulate Hb oxygen affinity. Another side effect found in human carriers of the Hb Camperdown variant (which constitutes ~50% of circulating Hb in the blood) is that they present with erythrocytosis (Kister et al. 1989), a physiological response to impaired oxygen delivery. Although HbA2 levels in the blood of woolly rhino are unknown, this isoform constitutes between 19 and 40% of total circulating Hb in the blood of white and Indian rhinos (Baumann et al. 1984, Abbasi et al. 1987), and hence it is possible woolly rhinos were similarly affected. Taken together, these findings beg the question: why is this apparently maladaptive trait present in the woolly rhino population? One possibility is that this substitution, which increases the Hb–O2 affinity of this isoform, evolved in response to hypoxic selection during the Tibetan stage of evolution of this genus in the Pliocene. However, this contention is unlikely as the impaired O2 offloading potential of this phenotype, as evidenced by an elevated hematocrit in Hb Camperdown carriers (Kister et al. 1989), would have been selected against in the lowland

Pleistocene history of this species. Consequently, the most likely explanation for the presence of

104Ser in woolly rhinos is that it arose and became fixed during an ancient population bottleneck event (i.e. small population size). Although no genomic data is currently available for woolly rhinos, genetic signatures of a catastrophic bottleneck event have been discovered in the genomes of the last surviving population of mammoths on Wrangel Island (Pecnerova et al. 2017; Rogers and Slatkin 2017; Palkopoulou et al. 2015). Woolly mammoths regularly migrated to Wrangel

Island though were eventually trapped there for six thousand years during the Holocene due to rising sea levels (Pecnerova et al. 2017; Rogers and Slatkin 2017; Palkopoulou et al. 2015). At the

56 time of their isolation, there were very few female mammoths as evidenced by a single mitochondrial haplotype among the population (Pecnerova et al. 2017). A high percentage of runs of homozygosity (20% of the genome) with lengths of a few million base pairs was found in the

Wrangel Island population which is often seen in animals within low population sizes over a long duration (Palkopoulou et al. 2015). The population also accumulated mutations rapidly as a result of genetic drift and low purifying selection due to low population sizes (Pecnerova et al. 2017;

Rogers and Slatkin 2017; Palkopoulou et al. 2015). Some of these mutations included impeded growth of medullae in its hair, pseudogenized olfactory receptors and urinary protein deletions

(Rogers and Slatkin 2017). The high rate of mutation found in the Wrangel Island mammoths was a potential cause of their extinction. Potential support for a genetic population bottleneck in woolly rhinos (and woolly mammoths) is evidenced through a high percentage of cervical ribs in a Late

Pleistocene population from the North Sea and the Netherlands (van der Geer and Galis 2017).

Large cervical ribs are highly selected against in most mammalian species as other congenital abnormalities typically accompany this defect (van der Geer and Galis 2017). The causes of cervical ribs are either inbreeding or harsh conditions during pregnancy including cold weather or famine. These same factors could have played a role in the demise and eventual extinction of the woolly rhinoceros some 12,000 years ago.

3.6 Conclusions

The Hb–O2 affinities, effector sensitivities, and overall oxygenation enthalpies of the major

Hb (HbA) isoform of the woolly rhino are nearly identical to those of Sumatran and black rhino

Hb. The overall oxygenation enthalpies of both woolly rhino Hb isoforms are much higher than cold-adapted species’ Hb, which argues against strong regional heterothermy in members of this

57 lineage. This finding suggests that the woolly rhino was unable to reduce energetic requirements through regional heterothermy during harsh winter conditions which possibly contributed to their eventual extinction. Additionally, the woolly rhino minor Hb isoform (HbA2) was found to harbor a rare amino acid substitution (104Arg→Ser) previously characterized in humans as Hb

Camperdown. This substitution caused the rhino HbA2 isoform to have almost no effector sensitivity and therefore a minimal ability to modulate Hb–O2 affinity. Both woolly rhino specimens I have sequenced were homozygous for this substitution which suggests that this trait may have been genetically fixed during an ancient population bottleneck event.

Literature Cited

Abbasi A, Weber RE, Braunitzer G and Goltenboth R. (1987). Molecular basis for ATP/2,3-

bisphosphoglycerate control switch-over (poikilotherm/homeotherm) an intermediate

amino-acid sequence in the hemoglobin of the Great Indian Rhinoceros (Rhinoceros

unicornis, Perissodactyla). Biol. Chem. Hoppe-Seyler 368: 323-332.

Alcantara RE, Xu C, Spiro TG, and Guallar V. (2007). A quantum-chemical picture of

hemoglobin affinity. Proc. Natl. Acad. Sci. U. S. A. 104:18451- 18455.

Angilletta MJ, Cooper BS, Schuler MS, and Boyles JG. (2010). The evolution of thermal

physiology in endotherms. Front. Biosci. 2: 861-881.

Arnold W, Ruf T, and Kuntz R. (2006). Seasonal adjustment of energy budget in a large wild

mammal, the Przewalski horse (Equus ferus przewalskii) II. Energy expenditure. J. Exp.

Biol. 209: 4566-4573.

Arnon A. (1972). X-ray diffraction study of binding of 2,3-diphosphoglycerate to human

deoxyhaemoglobin. Nature. 237: 146-149.

Atha DH and Ackers GK. (1974). Calorimetric determination of the heat of oxygenation of

human hemoglobin as a function of pH and the extent of reaction. Biochemistry-US. 13:

2376-2382.

Baudin-Creuza V, Vasseur-Godbillon C, Kister J, Domingues E, Poyart C, Marden M, and

Pagnier J. (2002). Importance of helices A and H in oxygen binding differences between

bovine and human hemoglobins. Hemoglobin. 26: 373-384.

Baumann R, Mazur G, and Braunitzer G. (1984). Oxygen binding properties of hemoglobin from

the white rhinoceros (|β2-GLU|) and the tapir. Resp. Physiol. 56: 1-9.

Boeskorov GG. (2012). Some specific morphological and ecological features of the fossil woolly

rhinoceros (Coelodonta antiquitatis Blumenbach 1799). Biol. Bull. 39: 692-707.

Brix O, Bardgard A, Mathisen S, Elsherbini S, Condo SG, and Giardina B. (1989). Arctic life

adaptation. 2. The function of Musk Ox (Ovibos-Muschatos) hemoglobin. Comp.

Biochem. Phys. B. 94: 135-138.

Brunori M. (2014). Variations on the theme: allosteric control in hemoglobin. FEBS journal.

281: 633-643.

Bunn HF. (1971). Difference in the interaction of 2,3-diphosphoglycerate with certain

mammalian hemoglobins. Science. 172: 1049.

Bunn HF. (1980). Regulation of hemoglobin function in mammals. Am. Zool. 20: 199-211.

Cambier C, Di Passio N, Clerbaux T, Amory H, Marville V, Detry B, Frans A, and Gustin P.

(2005). Blood-oxygen binding in healthy Standardbred horses. Vet. J. 169: 251-256.

Campbell KL and Hofreiter M. (2015). Resurrecting phenotypes from ancient DNA sequences:

promises and perspectives. Can. J. Zool. 93: 701-710.

Campbell KL, Roberts JE, Watson LN, Stetefeld J, Sloan AM, Signore AV, Howatt JW, Tame

JRH, Rohland N, Shen TJ, Austin JJ, Hofreiter M, Ho C, Weber RE, and Cooper A.

(2010a). Substitutions in woolly mammoth hemoglobin confer biochemical properties

adaptive for cold tolerance. Nat. Genet. 42: 536-540.

Campbell, KL, Storz JF, Signore AV, Moriyama H, Catania KC, Payson A, Bonaventura J,

Stetefeld J, and Weber RE. (2010b). Molecular basis of a novel adaptation to hypoxic-

hypercapnia in a strictly fossorial mole. BMC Evol. Biol. 10: 214.

Chojnacki S, Cowley A, Lee J, Foix A, and Lopez R. (2017). Programmatic access to

bioinformatic tools from EMBL-EBI update: 2017. Nucleic Acids Res. 45: W550-W553.

Crocker B and Elias S. (2008). The Bering Land Bridge: a moisture barrier to the dispersal of

steppe-tundra biota? Quaternary Sci. Rev. 27: 2473-2483.

De Anglioletti M, Lacerra G, Gaudiano C, Mastrolonardo G, Pagano L, Mastrullo L,

Masciandaro S, and Carestia C. (2002). Epidemiology of the delta globin alleles in

Southern Italy shows complex molecular, genetic, and phenotypic features. Hum. Mutat.

20: 358-367.

Di Bella G, Scandariato G, Suriano O, and Rizzo A. (1996). Oxygen affinity and Bohr effect

responses to 2,3-diphosphoglycerate in equine and human blood. Res. Vet. Sci. 60: 272-

275.

Endo H, Kobayashi H, Koyabu, D, Hayashida A, Jogahara T, Taru H, Oishi M, Itou T, Koie H,

and Sakai T. (2009). The morphological basis of the armor-like folded skin of the greater

Indian rhinoceros as a thermoregulator. Mammal study. 34: 195-200.

Gaudry MJ, Storz JF, Butts GT, Campbell KL, and Hoffmann FG. (2014). Repeated evolution of

chimeric fusion genes in the -globin gene family of Laurasiatherian mammals. Genome

Biol. Evol. 6: 1219-1234.

Giardina B, Brix O, Colosimo A, Petruzzelli R, Cerroni L, and Condo SG. (1990). Interaction of

hemoglobin with chloride and 2,3-bisphosphoglycerate- A comparative approach. Eur. J.

Biochem. 194: 61-65.

Giardina B, Brix O, Clementi ME, Scatena R, Nicoletti B, Cicchetti R, Argentin G, and Condo

SG. (1990). Differences between horse and human haemoglobins in effects of organic and

inorganic anions on oxygen binding. Biochem.J. 266: 897-900.

Giardina B, Brix O, Nuutinen M, Elsherbini S, Bardgard A, Lazzarino G, and Condo SG. (1989).

Arctic adaptation in reindeer- the energy saving of a hemoglobin. FEBS Lett. 247: 135-138

Guthrie RD. (2003). Rapid body size decline in Alaskan Pleistocene horses before extinction.

Nature. 426: 169-171.

França LTC, Carrilho E, and Kist TBL. (2002). A review of DNA sequencing techniques. Q.

Rev. Biophys. 35: 169-200.

Janecka JE, Nielsen SSE, Andersen SD, Hoffman FG, Weber RE, Anderson T, Storz JF, and

Fago A. (2015). Genetically based low oxygen affinities of felid hemoglobins: lack of

biochemical adaptation to high-altitude hypoxia in the snow leopard. J. Exp. Biol. 218:

2402-2409.

Jelkmann W, Oberthür W, Kleinschmidt T, and Braunitzer G. (1981). Adaptation of hemoglobin

function to subterranean life in the mole, Talpa europaea. Respir. Physiol. 46:7-16.

Jensen FB. (2004). Red blood cell pH, the Bohr effect, and other oxygenation-linked phenomena

in blood O2 and CO2 transport. Acta Physiol Scand 182: 215–227.

Kahlke RD and Lacombat F. (2008). The earliest immigration of woolly rhinoceros (Coelodonta

tologoijensis, Rhinocerotidae, Mammalia) into Europe and its adaptive evolution in

Palaearctic cold stage mammal faunas. Quaternary Sci. Rev. 27: 1951-1961.

Kister J, Barbadjian J, Blouquit Y, Bohn B, Galacteros F, and Poyart C. (1989). Inhibition of

oxygen linked anion binding in Hb Camperdown [Alpha-2-Beta-2104(G6) Arg-Ser].

Hemoglobin. 13: 567-578.

Langlois B. (1994). Inter-breed variation in the Horse with regard to cold adaptation- A review.

Livest. Prod. Sci. 40: 1-7.

Librado P, Fages A, Gaunitz C, Leonardi M, Wagner S, Khan N, Hanghoj K, Alquraishi SA,

Alfarhan AH, Al-Rasheid KA, Sarkissian CD, Schubert M, and Orlando L. (2016). The

evolutionary origin and genetic makeup of domestic horses. Genetics. 204: 423-434.

Librado P, Sarkissian CD, Ermini L, Schubert M, Jonsson H, Albrechtsen A, Fumagalli M, Yand

MA, Gambo C, Seguin-Orlando A, Mortensen CD, Petersen B, Hoover CA, Lorente-

Galdos B, Nedoluzhko A, Boulygina E, Tsygankova S, Neuditschko M, Jagannathan

V, Theves C, Alfarhan AH, Alquraishi SA, Al-Rasheid KAS, Sicheritz-Ponten T, Popov R,

Grigoriev S, Alekseev AN, Rubin EM, McCue M, Rieder S, Leeb T, Tikhonov A, Crubezy

E, Slatkin M, Marques-Bonet T, Nielsen R, Willerslev E, Kantanen J, Prokhortchouk E,

and Orlando L . (2015). Tracking the origins of Yakutian horses and the genetic basis for

their fast adaptation to subarctic environments. P. Natl. Acad. Sci. USA. 112: 6889-6897.

Lykkboe G, Schougaard H, and Johansen K. (1977). Training and exercise change respiratory

properties of blood in race horses. Resp. Physiol. 29: 315-325.

Markova AK, Puzachenko AY, van Kolfschoten T, van der Plicht J and Ponomarev DV. (2013).

New data on changes in the European distribution of the mammoth and the woolly

rhinoceros during the second half of the Late Pleistocene and the early Holocene. Quatern.

Int. 292: 4-14.

Marta M, Patamia M, Colella A, Sacchi S, Pomponi M, Kovacs KM, Lydersen C, and Giardina

B.(1998). Anionic binding site and 2,3-DPG effect in bovine hemoglobin. Biochemistry

US. 37: 14024-14029.

Monod J, Wyman J, and Changeux J-P. (1965). On nature of allosteric transitions- a plausible

model. J. Mol. Biol. 12: 88-118.

Natarajan C, Jiang X, Fago A, Weber R-E, Moriyama H, and Storz J-F. (2011). Expression and

purification of recombinant hemoglobin in Escherichia coli. PLoS ONE. 6: e20176.

Orlando L. (2015). Equids. Curr. Biol. 25: 973-978.

Orlando L, Leonard JA, Thenot A, Laudet V, Guerin C and Hanni C. (2002). Ancient DNA

analysis reveals woolly rhino evolutionary relationships. Mol. Phylogenet. Evol. 28: 485-

499.

Orlando L, Metcalf JL, Alberdi MT, Telles-Antunes M, Bonjean D, Otte M, Martin F,

Eisenmann V, Mashkour M, Morello F, Prado JL, Salas-Gismondi R, Shockey BJ, Wrinn

PJ, Vasil’ev SK, Ovodov ND, Cherry MI, Hopwood B, Male D, Austin JJ, Hanna C, and

Cooper A. (2009). Revising the recent evolutionary history of equids using ancient DNA.

Proc. Natl. Acad. Sci. U. S. A. 106: 21754-21759.

Osthaus B, Proops L, Long S, Bell N, Hayday K and Burden F. (2018). Hair coat properties of

donkeys, mules and horses in a temperate climate. Equine Vet. J. 50: 339-342.

Palkopoulou E, Mallick S, Skoglund P, Enk J, Rohland N, Li H, Omrak A, Vartanyan S, Poinar

H, Gotherstrom A, Reich D, and Dalen L. (2015). Complete genomes reveal signatures of

demographic and genetic declines in the woolly mammoth. Curr. Biol. 25:1395-1400.

Pecnerova P, Palkopoulou E, Wheat C, Skoglund P, Vartanyan S, Tikhonov A, Nikolskiy P, van

der Plicht J, Diez-del-Molino D, and Dalen L. (2017). Mitogenome evolution in the last

surviving woolly mammoth population reveals neutral and functional consequences of

small population size. Evol. Lett. 1: 292-303.

Pellegrini M, Corda M, Manca L, Olianas A, Sanna MT, Fais A, De Rosa MC, Bertonati C,

Masala B, and Giardina B. (2001). Functional and computer modelling studies of

haemoglobin from horse. The haemoglobin system of the Sardinian wild dwarf horse. Eur.

J. Biochem. 268: 3313-3320.

Pellegrini M, Giardina B, Castagnola M, Olianas A, Sanna MT, Fais A, Messana I, and Corda M.

(1999). Low temperature sensitivity and enhanced Bohr effect in red deer (cervus elaphus)

haemoglobin: a molecular adaptive strategy to life at high altitude and low temperature.

Eur. J. Biochem. 260: 667-671.

Perutz MF and Brunori M. (1982). Sterochemistry of cooperative effects in fish and amphibian

hemoglobins. Nature (London) 229: 421-426.

Perutz MF and Imai K. (1980). Regulation of oxygen affinity of mammalian hemoglobins. J.

Mol. Biol. 136: 183-191.

Perutz MF, Wilkinson AJ, Paoli M and Dodson GG. (1998). The stereochemical mechanism of

the cooperative effects in hemoglobin revisited. Annu. Rev. Biophys. Biomol. Struct. 27:

1-34.

Petschow D, Würdinger I, Baumann R, Duhm J, Braunitzer G and Bauer C. (1977). Causes of

high blood O2 affinity of animals living at high altitude. J. Appl. Physiol. 42: 139-143.

Prado JL and Alberdi MT. (2017). Ancient feeding ecology and niche differentiation of

Pleistocene horses. Fossil horses of South America: Phylogeny, systematics, and ecology.

Pgs 101-118.

Rivals F and Alvarez-Lao DJ. (2018). Ungulate dietary traits and plasticity in zones of ecological

transition inferred from late Pleistocene assemblages at Jou Puerta and Rexidora in the

Cantabrian Region of northern Spain. Palaeogeogr. Palaeocl. 499:123-130.

Rogers RL and Slatkin M. (2017). Excess of genomic defects in a woolly mammoth on Wrangel

Island. PLOS Genet. 13: e1006601. DOI: 10.1371/journal.pgen.1006601.

Schmidt-Nielsen K and Larimer JL. (1958). Oxygen dissociation curves in mammalian blood in

relation to body size. Am. J. Physiol. 195: 424-428.

Signore A. (2016). Paleophysiology of oxygen delivery in the extinct Steller’s sea cow,

Hydrodamalis gigas. Ph.D. thesis, University of Manitoba, Winnipeg.

Signore, AV, Paijmans JLA, Hofreiter M, Fago A, Weber RE, Springer MS and Campbell KL.

(2019). Emergence of a chimeric pseudogene and increased hemoglobin oxygen affinity

underlie the evolution of aquatic specializations Sirenia. Mol. Biol. Evol. DOI:

10.1093/molbev/msz044.

Smale K and Butler PJ. (1994). Temperature and pH effects on the oxygen equilibrium curve of

the thoroughbred horse. Resp. Physiol. 97: 293-300.

Steiner CC and Ryder OA. (2011). Molecular phylogeny and evolution of the Perissodactyla.

Zool. J. Linn. Soc-Lond. 163: 1289-1303. van der Geer, AA and Galis F. (2017). High incidence of cervical ribs indicates vulnerable

condition in Late Pleistocene woolly rhinoceroses. PeerJ 5: e3684.

Wang Y, Li Q, Tseng ZJ, Takeuchi GT, Wang X, Deng T, Xie G, Chang M, and Wang N.

(2015). Cenozoic vertebrate evolution and paleoenvironment in Tibetan Plateau: Progress

and prospects. Gondwana Res. 27: 1335-1354.

Weber RE. (2014). Enthalpic consequences of reduced chloride binding in Andean

frog (Telmatobius peruvianus) hemoglobin. J Comp Physiol B 184:613–621.

Weber RE and Campbell KL. (2011). Temperature dependence of haemoglobin-oxygen affinity

in heterothermic vertebrates: mechanisms and biological significance. Acta. Physiol. 202:

549-562.

Weber RE, Fago A and Campbell KL. (2014). Enthalpic partitioning of the reduced temperature

sensitivity of O-2 binding in bovine hemoglobin. Comp. Biochem. Physiol. 176: 20-25.

Weber RE, Ostojic H, Fago A, Dewilde S, Van Hauwaert ML, Moens L, and Monge C. (2002).

Novel mechanism for high-altitude adaptation in hemoglobin of the Andean frog

Telmatobius peruvianus. Am. J. Physiol. – Reg. I. 283: R1052-R1060.

Welker F, Smith GM, Hutson JM, Kindler L, Garcia-Moreno A, Villaluenga A, Turner E, and

Gaudzinski-Windheuser S. (2017). Middle Pleistocene protein sequences from the

rhinoceros genus Stephanorhinus and the phylogeny of extant and extinct middle/late

Pleistocene Rhinocerotidae. PeerJ 5:e3033.

Wilkinson T, Chua CG, Carrell RW, Robin H, Exner T, Lee KM, and Kronenberg H. (1975).

Hemoglobin Camperdown Beta-104 (G6) arginine-serine. Biochim. Biophys. Acta. 393:

195-200.

Yuan JX, Sheng GL, Hou XD, Shuang XY, Yi J, Yang H, and Lai XL. (2014). Ancient DNA

sequences from Coelodonta antiquitatis in China reveal its divergence and phylogeny. Sci.

China. Ser. D. 57: 388-396.

Appendix 1. Primers used to fill in sequence gaps of the woolly rhino HBA gene and black rhino HBA gene.

Species Gene Exon Forward or Reverse Primer sequence

Woolly Rhino HBA 2 Forward ACCTGCACGCCTACAAGCT

Woolly Rhino HBA 2 Reverse GGCAGAGAATCCCGTGG

Black Rhino HBA 2 Forward AGGAGCCTGCCAATAACACC

Black Rhino HBA 2 Reverse CTACAAGCTGCGTGTGGAC

Black Rhino HBA 3 Forward ACCTGCACGCCTACAAGCT

Black Rhino HBA 3 Reverse AGCAATGTGAGCACCGTG

Appendix 2. Oxygen binding characteristics of Tapir HbA measured at 37℃ and pH 7.2

P50 ‘stripped’ 14.21 mmHg (n50=0.50)

- P50 (0.1 M Cl ) 17.74 mmHg (n50=0.56)

P50 (0.5 mM DPG) 13.37 mmHg (n50=0.54)

- P50 (0.1 M Cl + 0.5 mM DPG) 19.67 mmHg (n50=0.53)

- Chloride effect (logP50 +/- 0.1 M Cl )

[DPG]=0 0.10

[DPG]=0.5 mM 0.17

DPG effect (logP50 +/- 0.5 mM DPG)

[Cl-]=0 -0.02

[Cl-]=0.1 M 0.05

Bohr effect (logP50/pH)

‘stripped’ -0.48

0.1 M Cl- -0.45

0.5 mM DPG -0.13

0.1 M Cl- + 0.5 mM DPG -0.36