Molecular Analysis of the Epiphyseal Growth Plate in Rachitic Broilers: Evidence for the Etilogy of the Condition

Home , Fibulin, Osteonectin

MOLECULAR ANALYSIS OF THE EPIPHYSEAL GROWTH PLATE IN RACHITIC BROILERS: EVIDENCE FOR THE ETILOGY OF THE CONDITION

MASTER’S THESIS

Presented in Partial Fulfillment of the Requirements for the Degree Doctor

of Philosophy in the Graduate School of The Ohio State University

Julianne Eileen Rutt, B.A.

*****

The Ohio State University

2008

Master’s Examination Committee: Approved by: Dr. David Latshaw, Advisor Dr. Kichoon Lee ______Dr. Pasha Lyvers-Peffer Dr. David Latshaw Animal Sciences Graduate Program

ABSTRACT

There is a lack of data in the literature concerning calcium-deficient rickets, which requires recognition due to to the economic and welfare concerns of leg weakness in broilers, as well as being an ideal disease model to study the effect of calcium on chondrocyte maturation. Broilers were raised on an adequate and calcium-deficient diet, and the rickets condition was confirmed using visual assessment, histology, and blood plasma analysis. The expression of known chondrogenic genes as well as genes from a previous rickets-based microarray was analyzed using real-time PCR with control and deficient growth plate chondrocytes. Indian hedgehog (Ihh) was decreased in rickets, parathyroid- hormone receptor (PTHR-1) was increased in rickets, and parathyroid hormone related- peptide (PTHrP) showed no difference. The calcium-sensing receptor had a 20-fold increased expression in rickets. Three of the four bone morphogenic proteins (Bmp) analyzed (-2, -4, -6) and both Bmp receptors were expressed lower in rickets. Eukaryotic elongation factor 1-δ showed a trend of being decreased in rachitic plates, and annexin-V and fibrillin-I were decreased in rickets. ATP analysis of the growth plates using a luciferase assay revealed a trend of ATP being increased in the rickets growth plates. An attempt at developing an in vivo chondrocyte cell culture model was unsuccessful primarily due to lack of cell proliferation and contamination.

ii3

ACKNOWLEDGEMENTS

I would like to thank Dr. Latshaw, for all of his help and support throughout my masters thesis. I had a lot of fun working with you, and I hope we keep in touch. I would also like to thank Dr. Lee for his use of the laboratory and for his daily technical advice….although it was not always the best news, you were always right. Also, thank you to Dr. Peffer, who helped me a lot with statistics and figures.

Thanks to Jonghun Shin, for his patience and laboratory help. Also, thanks to my

Pea (Jenny Campbell)…. we met on day one of our masters degree, and found a friend for life. No one else understood what I was going through like you did, and I could not have gotten through without you.

Thank you to my mom and grandma, who used their prayers to me through the tough times. Thank you to my dogs, Nova and Alaska, for showing me what really matters at the end of the day. A special thanks to my fiancé Kiel, who was there every step of the way, and both suffered and celebrated with me.

ii4i

VITA

March 16, 1984……………………………………Born-Cleveland, Ohio 2006………………………………………………B.A. Biochemistry, College of Wooster 2006……………………………………………….Research Assistant, Aquatic Ecology Laboratory, The Ohio State University 2006-2008………………………………………...Graduate Research Associate, The Ohio State University

FIELDS OF STUDY Major field: Animal Sciences Continuing field: Veterinary Medicine

iv5

TABLE OF CONTENTS

Abstract…………………………………………………………………………...ii Acknowledgements…………………………………………………………….…iii Vita………………………………………………………………………………..iv Table of Contents………………………………………………………………….v List of Figures……………………………………………………………………vii List of Tables………………………………………………………………..……iv

Chapters: 1. Introduction: Background and Significance…………………………...1 1.1 Introduction to the growth plate…………………………………...1 1.2 Molecular aspects of chondrocyte differentiation…………………3 1.3 Introduction to calcium……………………………………………9 1.4 Calcium and chondrogenesis……………………………………...12 1.5 Leg weakness in broiler chickens…………………………………15 1.6 Leg deformities: rickets and tibial dyschondroplasia……………..17 1.7 Broiler diets and mineral balance…………………………………18 1.8 Microarray analysis: Gene expression patterns in rickets………....22 1.9 Energy and the growth plate……………………………………….25 1.10 Chondrocyte cell culture…………………………………….……26 1.11 Research Significance and Project Objectives…………………....30

2. Materials and Methods…………………………………………………31 2.1 Materials……………………………………………………………31 2.2 Animals and Diets…………………………………………………..31 2.3 Growth plate analysis…………………………………………….…33 2.4 Blood samples………………………………………………………33 2.5 Histology……………………………………………………………34 2.6 Real-time PCR…………………………………………………...…34 2.7 ATP assay………………………………………………………..…37 2.8 Chondrocyte cell culture……………………………………………38 2.9 Alizarin red staining……………………………………………..…39 2.10 Statistical analysis…………………………………………………39

3. Results…………………………………………………….……………40 3.1 Growth plate observations and histology…………………………..40 3.2 Blood analysis………………………………………………………43 3.3 Quantitative real-time PCR………………………………………..44 3.4 ATP assay………………………………………………………….49 3.5 Cell culture…………………………………………………………50

4. Discussion 4.1 Validation of rickets and control growth plate phenotypes………...53 4.2 Quantitative real-time PCR………………………………………...56 4.3 Validation of microarray expression data…………………………..66 4.4 ATP assay…………………………………………………………..69 4.5 Cell culture………………………………………………………….71 4.6 Future work…………………………………………………………74

References…………………………………………………………………………..75

vi7

LIST OF FIGURES

Figure Page 1.1. Histological features of a human growth plate, showing the various stages of chondrocyte differentiation……………………... 2 1.2. Coordinated feedback mechanism and localization of chondrogenic genes in the growth plate……………………...... 8 1.3. Calcium stores and hormonal regulation of calcium and phosphate metabolism……………………...……………………... 10 1.4 Model for proposed role of CaR in growth plate chondrocyte differentiation……………………...…………………….. 14 1.5. Current industry usage levels of calcium and nonphytate phosphorus in broiler starter diets……………………...……………… 21 3.1 Relative numbers of broiler chickens with normal, TD, and rickets growth plates……………………...……………………...... 41 3.2 Effect of a control and calcium-deficient diet on growth plate histology in broiler chickens……………………...……………... 42 3.3. Concentration of calcium and the calcium: phosphorus ratio, in the plasma of broiler chickens fed control and calcium-deficient diets…… 43 3.4 Concentration of plasma bicarbonate in broilers fed control and calcium-deficient diets…………………………………………….. 44 3.5 Relative mRNA expression of three control genes known to be involved in chondrocyte differentiation in control and rickets growth plate samples of broiler chickens…………………. 45 3.6 Relative mRNA expression of various genes analyzed in this study in the proliferative and hypertrophic fractions in control and rickets growth plate samples of broiler chickens…………. 46 3.7 Relative mRNA expression of the genes involved in the growth plate feedback loop in control and rickets growth plate samples of 18-21-day old broiler chickens.…………………….... 47

vi8i

3.8 Relative mRNA expression of the various Bmps and BmpR genes in control and rickets growth plate sample 48 of broiler chickens.……………………...……………………...... 3.9 Relative mRNA expression of the genes detected in the microarray in control and rickets growth plate samples of 49 18-21-day old broiler chickens.……………………...………………… 3.10 Number of attached chondrocytes from control and rickets growth plates measured 24 hours after plating…………...... 51 3.11 Relative mRNA expression of type X collagen in chondrocyte cell culture over one sampling period.…………………... 52 4.1 Proposed model for the involvement of the chondrogenic genes in the development of rickets……………………. 66

viii9

LIST OF TABLES

Table Page 1.1 Proteins found in the various stages of differentiation in the growth plate…………………...…………………...……………. 4 1.2 Vitamin and mineral requirements of broilers…………………...... 19 1.3 Microarray genes of interest…………………...…………………...... 22 2.1 Composition (%) of the basal diets for control and calcium-deficient experiments…………………...…………………..... 32 2.2 Primers used in this study…………………...…………………...... 36 3.1 ATP assay sample and mean values…………………...……………… 50 4.1 Summary of real-time PCR results: Gene expression in growth plates from broilers fed adequate and 57 calcium-deficient diets. …………………...…………………......

i10v

CHAPTER 1

BACKGROUND AND SIGNIFICANCE

1.1 Introduction to the growth plate

Bone growth occurs at growth plates, regions of specialized cartilage at the ends of long bones. The growth plate is positioned between the epiphyseal bone crest and metaphyseal boundary, and is the region responsible for the formation of cartilage cells and subsequent bone formation. Growth plate cartilage is the determining factor in the bone length and the rate of longitudinal bone growth. The process by which this cartilage is converted into growing bone is known as endochondral ossification, and begins during fetal development. Bone formation is initiated with prechondrogenic condensation, in which mesenchymal cells aggregate and form clusters of cells. These aggregates differentiate and become chondrocytes, the primary cell type of cartilage.

Endochondral ossification is driven by the proliferation and differentiation of growth plate chondrocytes. This growth process can be divided into three phases: chondrogenesis, calcification, and osteogenesis. During chondrogenesis, cartilage cells are formed and mature in the growth plate. Chondrocytes in the growth plate exhibit a defined spatial and chronological organization in this phase, displaying a series of distinct maturational stages (Fig. 1.1). These include the resting, proliferation, prehypertrophic, and hypertrophic stages, and are characterized by different morphologies, biochemical changes, and proteins in the extracellular matrix. The cells then undergo calcification and

1 chondrocytes are removed from the growth plate, followed by the bone formation

(osteogenesis).

Figure 1.1. Histological features of a human growth plate, showing the various stages of chondrocyte differentiation. Van der Eerden et al., 2003.

Cells in the resting zone are in a quiescent state and have a relatively low density relative to the extracellular matrix. These cells subsequently enter the zone of proliferation, in which they exhibit a flattened appearance, organize into columns, and begin to divide. The proliferation of the cells is mainly unidirectional, which is responsible for the longitudinal growth of bones. Within the zone of maturation

(prehypertrophic chondrocytes), the extracellular matrix is synthesized and the cells separate from one another. Following maturation, cells enter the hypertrophic zone and cell division ceases. These cells undergo terminal differentiation and a five to tenfold increase in cell volume, acquiring a round appearance.

The chondrocytes subsequently undergo matrix calcification and apoptosis during the process of osteogenesis. Large amounts of matrix proteins are secreted, and there is a significant increase in intracellular calcium concentration. Chondrocytes within the upper hypertrophic zones take up calcium, which is subsequently released in the lower hypertrophic zone to sustain matrix mineralization (Iannotti et al., 1989; Wuthier, 1993). 2

The calcium is necessary for the production of matrix vesicles, which are small membrane-bound particles secreted from chondrocytes (Anderson, 2003). These vesicles contain large concentrations of annexins, which mediate uptake of calcium into the matrix vesicles (Kirsch et al., 2000; Wang et al., 2003).

The hypertrophic cells undergo apoptosis that is accompanied by vascular invasion and bone deposition (Erlebacher et al., 1995). Blood vessels subsequently penetrate the calcified matrix from the underlying primary spongiosum, drawn in via the mineralization process and low oxygen tension (Schipani et al., 2001). The mineralized chondrocytes undergo apoptosis and osteoblasts, which were brought in by the blood vessels, utilize the calcified cartilage to produce bone. The programmed cell death is regulated by a number of factors, including intracellular calcium levels (to activate proteases, lipases, nucleases), retinoic acids, and vitamin D (Wang et al., 2003;

Srinivasan et al., 1998; Boyan et al., 2001). The molecular mechanisms by which the various stages of chondrocyte differentiation are regulated is discussed in the next section.

1.2 Molecular aspects of chondrocyte differentiation

In addition to the morphological changes discussed previously, chondrocytes undergo a series of molecular and biochemical changes during the process of differentiation. These biochemical alterations in the chondrocytes and extracellular matrix (ECM) instigate the changes in morphology. The chondrocytes in the various zones of the growth plate produce matrix and differentiation proteins that are highly specific to that zone (Stevens et al., 1999; Table 1.1). Type II collagen and the cartilage- specific proteoglycan aggregan are highly expressed in early stages of chondrocyte resting and proliferation (Sandell et al., 1994; Mundlos et al., 1991). The expression of

3 these genes decreases as chondrocytes advance towards terminal differentiation in the lower hypertrophic zone (Mundlos et al., 1990). Within the hypertrophic zone, the terminally differentiated chondrocytes increase the expression of osteocalcin (OC), osteopontin (OP), osteonectin (ON) and type X collagen (Nakase et al., 1994; Leboy et al., 1989). These proteins are synthesized during growth plate differentiation, and can be used as markers for the various stages.

Table 1.1. Proteins found in the various stages of differentiation in the growth plate.

(Orth, 1999)

A number of proteins are known to help modulate the discrete stages of chondrocyte differentiation, including parathyroid hormone, parathyroid hormone-related peptide (PTHrP), bone morphogenic proteins (BMPs), and Indian hedgehog (Ihh;

Erlebacker et al., 1995; Mundos et al., 1997a, b). These proteins trigger intracellular signaling pathways to exert their effects, and their proposed effects on chondrogenic differentiation are discussed in detail below.

PTHR receptor, PTH, and PTHrP: PTH is the major hormone responsible for regulation of extracellular calcium concentrations. This hormone is activated by binding to a G- protein coupled receptor (PTHR1) located on the surface of target cells in bone, cartilage, and kidney. The PTH-related protein (PTHrP) belongs to the same family as PTH and also binds to the PTHR-1 receptor, activating the same intracellular effectors as PTH but also having unique functions (Juppner et al., 1991; Pines et al., 1996). PTHR-1 is highly expressed in the zone of prehypertrophy (Vortkamp et al., 1996; Lee et al., 1995, 1996).

PTHrP is expressed in the periarticular region of the growth plate, but is able to travel through the growth plate and act on its target cells expressing PTHR-1 (Tsukazaki et al.,

1995; Lee et al., 1996).

PTHR-1 knockout mice show accelerated chondrocyte differentiation, premature cartilage mineralization, and significantly shortened growth plates (Lanske et al., 1996).

PTHrP knockout mice demonstrate more advanced differentiation and a smaller proliferative zone, reflecting a more rapid exit of cells from the proliferative to hypertrophic stages. These mice also show a wider zone of mineralized matrix and high osteopontin gene expression, suggesting that the absence of PTHrP accelerates the terminal differentiation process (Lee et al., 1996). Previous studies also have found that

PTHrP delays apoptosis of chondrocytes (Henderson et al., 1995). PTHrP and its receptor likely delay bone growth development via activation of the cAMP signaling cascade, which has been shown to delay chondrocyte differentiation (Guo et al., 2002;

Ionescu et al., 2001).

Ihh: Ihh is a member of the hedgehog family of secreted signaling molecules, and is localized to prehypertrophic chondrocytes (Echelard et al., 1993; Bitgood and McMahon,

1995; Vortkamp et al., 1996; Lanske et al., 1996; St-Jacques et al., 1999). Ihh knockout

5 mice have short-limbed dwarfism, a condition caused by abnormal endochondral bone formation with decreased proliferation and extensive hypertrophy. This hedgehog protein has been shown to upregulate PTHrP expression in the periarticular region of the growth plate, which delays chondrocyte hypertrophy by maintaining cells in a proliferative state (Vortkamp et al., 1996; Lanske et al., 1996). This feedback mechanism is part of a model for chondrocyte differentiation that is discussed below. In addition, Ihh acts to maintain cells in a proliferative state in a pathway independent of PTHrP signaling

(Karp et al., 2000).

Bmps: Bmps are members of the TGF-β (Transforming Growth Factor) superfamily known to regulate endochondral bone formation, whose signaling is a part of the

Ihh/PTHrP feedback loop (Zou et al., 1997; Hogan, 1996). The various Bmps are found in distinct and overlapping expression patterns in the growth plate. Bmp2, Bmp4, and

Bmp5 are expressed in the perichondrium, Bmp7 is localized to the perichondrium and proliferating chondrocytes, and Bmp6 is expressed in both prehypertrophic and hypertrophic chondrocytes (Lyons et al., 1995; Pathi et al., 1999; Minina et al., 2001).

Bmps transduce signals via binding to heteromeric complexes of type I and II serine/threonine kinase receptors (Massague, 1998). These receptors also are found in distinct regions of the growth plate. BmpRIb is found throughout the growth plate,

BmpRIa is found in prehypertrophic and hypertrophic chondrocytes, BmpRII is expressed in prehypertrophic chondrocytes, and all the receptors are found in the perarticular region (Zou et al., 1997; Zhang et al., 2003; Yi et al., 2000; Haaijman et al.,

2000).

As these expression patterns suggest, the Bmps function at various stages of differentiation in the growth plate. BMP signaling promotes chondrocyte proliferation, acting in parallel to Ihh (Brunet et al., 1998). In addition, Bmps promote terminal

6 differentiation and increase the expression of type X collagen, the extracellular matrix marker for hypertrophic chondrocytes (Shukunami et al., 1998; Grimsrud et al., 1999).

Bmps also regulate hypertrophic differentiation by delaying the maturation of terminally hypertrophic cells, thus these proteins promote differentiation toward the initial hypertrophic state but inhibit the more terminal stages of differentiation (Minina et al.,

2001).

Coordinated feedback mechanism: A proposed mechanism for regulation of growth plate chondrocyte differentiation involves PTHrP, Indian hedgehog (Ihh), the bone morphogenic proteins (BMPs) and their receptors (Strewler, 2000; Fig. 1.2). In the lower proliferative and prehypertrophic zones, chondrocytes express the PTH/PTHrP receptor, which delays the process of maturation (Kronenberg et al., 1997). This region of the growth plate is the site primarily affected by PTHrP. This is also the region where Ihh is localized, which blocks hypertrophic differentiation and delays ossification (Vortkamp et al., 1996). Chondrocytes that are beginning to undergo hypertrophic differentiation secrete Ihh, which in turn blocks transcription of itself, promotes chondrocyte proliferation, and indirectly stimulates PTHrP production from the peri-articular region of the growth plate. In addition, Ihh induces the expression of several BMP genes in the periarticular region and proliferating chondrocytes. The secreted PTHrP acts on proliferative cells expressing its receptor, delaying the differentiation process and reducing secretion of Ihh. The range of PTHrP signaling keeps the chondrocytes in a proliferative state and determines the distance from the joint at which chondrocytes undergo hypertrophy. Thus, Ihh and PTHrP promote chondrocyte proliferation and delay hypertrophic differentiation. Ihh stimulates the perichondrial cells to secretes BMPs.

These BMPs provide a signal to pre-hypertrophic cells expressing the type IA BMP receptor, which delays differentiation. BMP signaling via its receptor also acts on the

7 peri-articular region to stimulate PTHrP secretion. BMP signaling modulates the expression of Ihh, coordinating the regulation of chondrocyte proliferation and hypertrophic differentiation (Minina et al., 2001).

Figure 1.2. Coordinated feedback mechanism and localization of chondrogenic genes in the growth plate. Ihh (blue) is expressed in the prehypertrophic chondrocytes that are committed to hypertrophy, and induces the expression of PTHrP (yellow) in the periarticular chondrocytes. PTHrP then diffuses through the proliferating cells and binds to the PTHR-1 (pink), which is expressed in prehypertrophic chondrocytes prior to their conversion to Ihh-expressing cells. This blocks further differentiation of these cells. Cells committed to hypertrophy continue to differentiate and stop producing Ihh, thus allowing further differentiation of uncommitted prehypertrophic cells. Ihh regulates the expression of the Bmp (red) genes in the perichondrium and the proliferating chondrocytes, and the Bmps induce Ihh expression in a negative feedback loop. Bmp and Ihh signaling also upregulates chondrocyte proliferation and push cells out of the PTHrP- signaling range independently of PTHrP.

Although the Ihh/PTHrP/Bmp feedback mechanism is known to slow chondrocyte differentiation, the factors that counteract these proteins and promote terminal differentiation remain unclear. Some candidate models include IFG-I and its receptor, vitamin D receptor, thyroid hormone, and calcium interactions with the calcium-sensing receptor (CaR, van der Eerden et al., 2003).

CaR: Another protein implicated in a role for chondrocyte differentiation is the extracellular calcium-sensing receptor (CaR). CaR is a G-protein coupled receptor that is able to sense extracellular calcium levels, and is expressed in a number of different

8 tissues, including the parathyroid, kidney, gastrointestinal tract, osteoblasts, and chondrocytes. Activation of CaR by extracellular calcium results in the activation of two major signaling pathways: activation of phospholipase C, which leads to the generation of second messengers diacylglycerol and inositol trisphosphate, and inhibition of adenylate cyclase, which lowers the intracellular concentration of cyclic AMP (cAMP).

CaR has a high expression level in growth plate chondrocytes, and studies in CaR knockout mice have shown that these receptors are essential in bone development (Chang et al., 1999; Garner et al., 2001). These knockout mice exhibit delayed cartilage and bone mineralization, and the rate of bone formation is reduced (Garnier et al., 2001). The receptor knockout mice develop expanded hypertrophic zones that resemble severe rickets, and CaR is thought to be a mechanism by which extracellular calcium within the bone can regulate the process of mineralization (Amling et al., 1999).

1.3 Introduction to calcium

Calcium is a mineral that has numerous functions in the body, including maintenance of the cell membrane, muscle contraction, blood clotting, nerve transmission, and bone and teeth formation. Many cellular reactions require calcium, as calcium acts as a second messenger and is a cofactor for many proteins. Most of the calcium in the body is complexed with phosphorus in the form hydroxyapatite, and the majority of calcium and phosphate are found in bone. Because many physiologic processes depend on these minerals, it is important that calcium and phosphorus concentrations and the Ca:P ratio in the blood are maintained within a normal range. The body acts to maintain serum calcium and phosphorus levels and the Ca:P ratio within tight limits and at supersaturated conditions relative to mineralized bone. Low serum

9 concentrations of these minerals may result in bone demineralization, failure of the bones to mineralize, hypocalcemia or hypophosphatemia.

There are three major pools of calcium within the body: intracellular, in the bone, and in extracellular pools and blood. There are fluxes between blood and other calcium stores to supply and remove calcium from the blood when necessary (Fig. 1.3). Calcium and phosphorus homeostasis is maintained by the coordinated actions of three systems: the small intestine, kidney, and bone. The small intestine is the site of calcium absorption, which can be controlled depending on calcium levels in the body. The kidney is able to regulate calcium homeostasis by resorption into the bloodstream to preserve blood calcium levels, or excreting calcium in the urine when calcium levels are high.

Bone is the largest calcium reservoir, and stimulation of bone resorption releases calcium and phosphate into the blood, while suppressing resorption allows for the deposition of calcium into bone.

Figure 1.3. Calcium stores and hormonal regulation of calcium and phosphate metabolism (Micronutrient Information Center, Oregon State University).

Normal blood calcium and phosphorus concentrations are maintained via three hormones that control the fluxes between blood and calcium reservoirs The parathyroid hormone and vitamin D act to increase blood calcium levels, while calcitonin acts to decrease blood calcium concentrations. Low plasma calcium levels are detected by a calcium-sensor protein in the parathyroid glands that causes an increased secretion of parathyroid hormone (PTH) from the glands. The parathyroid hormones works via several different mechanisms: stimulation of the biologically-active form of vitamin D

(1,25-dihydroxyvitamin D, calcitriol) in the kidney, facilitating mobilization of calcium and phosphate from bone, and maximizing tubular reabsorption of calcium in the kidney.

Active vitamin D facilitates the absorption of calcium from the small intestine and works in concert with the parathyroid hormone to facilitate the movement of calcium and phosphorus out of the bone. When calcium levels are high, calcitonin works to suppress the renal tubular reabsorption of calcium, thus increasing calcium excretion in the urine.

Calcitonin also inhibits bone resorption.

Calcium can only be obtained from the diet, and maintaining calcium and phosphorus homeostasis during metabolic and daily intake changes is done via coordination of fluxes across the intestine, kidney, and bone. Net intestinal calcium absorption results from two different mechanisms: active vitamin D-dependent absorption and passive absorption dependent on the concentration gradient between blood and the intestinal lumen (Bronner and Pansu, 1999). Increasing plasma vitamin D increases calcium absorption, a saturable process that involves a receptor-mediated mechanism. Although vitamin D is required for calcium absorption, it has a limited effect on phosphorus absorption (Sallis and Holdsworth, 1962; Scott et al., 1969). The relative dietary ratio of calcium and phosphorus also is a factor in intestinal calcium absorption, as excess phosphate combines with calcium to form insoluble salts. Calcium absorption decreases with passage through the duodenum, jejunum, and ileum. In

11 addition, calcium absorption can be decreased in the presence of phytate, oxalate, fiber, uronic acid, and some fats (Pepper et al., 1955; Edwards, 1960).

1.4 Calcium and chondrogenesis

Extracellular calcium is necessary for development of the growth plate, and deposition of calcium into cartilage and bone matrix is a key step in the mineralization process (Li et al., 1998; Boskey, 1991). There is significant evidence indicating a role for calcium in chondrocyte maturation and function, as indicated in disease models such as rickets. When calcium concentrations are low, various etiologies of rickets exhibit abnormal, de-mineralized, and expanded growth plates. Several studies have shown that these defects are corrected by the addition of calcium (Bergstrom,1998; Clark et al.,

1987; Thacher, 2003). In addition, vitamin D receptor knockout mice growth plate abnormalities diminish with higher levels of dietary calcium (Amling et al., 1999 and Li et al., 1997).

Basal intracellular calcium increases from 50 nM to 100 nM as cells mature from proliferating chondrocytes to the hypertrophic stage (Gunter et al., 1990). As calcium is a potent intracellular signaling agent involved in the regulation of many cellular activities, it is logical that this dramatic increase in calcium concentration affects gene expression and protein composition in the growth plate. These alterations in matrix protein compositions are necessary to producing an environment conducive to bone mineralization. Control of gene expression by calcium occurs primarily by mechanisms that recognize the amplitude, duration, frequency, and spatial properties of calcium pulses that are initiated by extracellular stimuli (Mellstrom and Naranjo, 2001). Many of the

12 proteins involved in chondrocyte differentation and bone formation discussed previously are regulated by calcium.

One study showed that the rate of chondrocyte differentiation depends on a balance between extracellular calcium levels and PTHrP/PTHR-1 (Rodriguez et al.,

2005). PTHrP and PTHR-1 have been shown to retard chondrocyte differention by mechanisms involving cAMP signal transduction. Increases in calcium concentration suppress expression of PTHR-1 in culture, implying that at high calcium concentrations, the reduced number of receptors is involved in promoting differentiation. In addition, reduction of basal calcium to below 50 nM in culture down-regulated BMP-2, type X collagen, and Ihh in culture. This suppression of hypertrophic markers was found to be at least partially dependent on calcium-induced up-regulation of the PTHrP gene (Zuscik et al., 2002).

Extracellular calcium within the bone may be able to regulate the mineralization process through CaR (Amling et al., 1999). Overexpression of CaRs in culture produced markers of enhanced chondrocyte differentiation, supporting a role for these receptors in mediating calcium-induced differentiation in chondrocytes (Chang et al., 2002).

Additional evidence supporting this theory is the fact that changing the function or number of CaRs alters the cellular responses and sensitivity to changes in calcium concentrations. Furthermore, CaR mRNA transcripts and protein expressed in the growth plate are at low levels in maturing chondrocytes and higher levels in the differentiated hypertrophic cells (Chang et al., 1999). Changes in extracellular calcium concentrations are able to modulate chondrocytic gene expression and matrix production within an hour

(rapidly) and reversibly, which fits a model for membrane receptor-induced signaling

(Chang et al., 1999). Moreover, the calcium concentrations that affect the expression of matrix proteins and mineralization in chondrocytes are also within the range known to activate the CaRs, 1.0-4.0 mM (Chang et al., 1999).

From the available data, a model has been proposed for the role of CaR in growth plate chondrocyte differentiation (Chang et al., 2002; Fig. 1.4). In the zones of proliferation and maturation, pathways involving PTHrP, Ihh, and BMPs regulate the rate of chondrocyte maturation. Differentiation and maturation of the chondrocytes results in a higher expression of CaRs. Higher calcium concentrations activate the CaR receptors, which initiate a signaling cascade, ultimately resulting in counteraction of PTHrP, Ihh, and BMPs. These actions, in turn, promote differentiation of the hypertrophic chondrocytes. The progression of differentiation significantly increases the expression of

CaR within the upper hypertrophic zone and promotes the production of matrix constituents for mineral desposition (ALP, type X collagen). Terminal differentiation of chondrocytes due to increased CaR expression and a number of other factors results in increased expression of osteoclacin, osteopontin, and osteonectin, which promote mineral deposition in the calcified hypertrophic zone. The activity of CaRs in this zone also promote reduced expression of type II collagen and aggrecan by these cells, the early chondrogenic markers.

Figure 1.4. Model for proposed role of CaR in growth plate chondrocyte differentiation. Pro=proliferating zone, Mat=zone of maturation, Hyper=hypertrophic zone, Calcif Hyper=calcified hypertrophic zone, Miner=mineralization, ALP=alkaline phosphatase. Chang et al., 2002. 14

1.5 Leg weakness in broiler chickens

The continuing improvement in broiler growth rate is due to a variety of factors, the principal factor being genetic selection (Buyse et al., 1998; Havenstein et al., 2003).

Broilers are selected for rapid growth rate and increased meat production, which reduces the number of days to achieve market weight, but is also associated with metabolic disorders such as sudden death syndrome, ascites, and skeletal abnormalities (Sulistiyanto et al., 1999; Buyse et al., 1998; Garner et al., 2002; Scott, 2002; Morris, 1993). The rapid growth rate puts an increased weight load on the immature skeleton of the young broiler, resulting in a higher incidence of leg disorders (Julian, 1998).

Broiler chickens are selected for efficient feed utilization and rapid weight gain, and thus are often fed ad libitum to ensure they will rapidly reach market weight. These chickens are typically marketed from 4 to 6 weeks of age with weights around 1.8 to 3 kg. However, over the last decade there has been an increasing demand for more high- yielding broilers that have weights greater than 3.3 kg, up to 3.7 kg for some companies

(Dozier et al., 2006). One study showed that heavy broilers make up approximately 16% of the marketed broilers in the United States (Brister, 2004). Various studies have shown that there is a high correlation between body weight and the severity of the leg disorders

(Kestin et al., 1999; Morris, 1993; Su et al., 1999). Reducing the growth rate of broilers results in a decreased incidence of these problems (Cook et al., 1984; Julian, 1998; Scott,

2002).

Leg bone deformities are progressive disorders that occur between one and four weeks of age in broiler chickens (Julian, 1998a). The primary leg disorders found in broilers are valgus or varus deformities, tibial dyschondroplasia, ruptured gastrocnemius tendon, spondylolisthesis, and rotated tibia (Riddell, 1983; Riddell and Springer, 1985;

Pattison, 1992). These leg deformities can occur even when chickens are fed nutritionally adequate diets, and incidence may be influenced by genetics, nutrition,

15 physiology, or the environment. The specific causes of leg problems include nutritional disorders, infectious diseases, metabolic conditions, conformational problems and toxins

(Riddell et al., 1983; Thorp, 1994). The higher energy levels, lower physical activity, high growth rate and the large body weights of broilers may also contribute to the prevalence of leg deformities.

The literature reports a relatively high incidence of growth-related leg weakness in broilers (Cook et al., 1984; Wilson et al., 1984; Skinner et al., 1991; Kestin et al.,

1999; Su et al., 1999; Rath et al., 2000; Garner et al., 2002; Sanotra et al., 2002). A survey of commercially reared broilers revealed a remarkably high incidence of leg disorders, indicating that 90% had a detectable gait abnormality and 26% suffered from leg weakness severe enough to compromise their welfare (Kestin et al., 1992). Other studies have indicated that leg abnormalities can reach up to 40% in some flocks (Julian,

1998b; Siller, 1970) and that approximately between 9-11% of flock mortality is due to lameness (McNamee et al., 1998; Classen et al., 2004).

Leg weakness in broiler chickens is both an animal welfare and an economic concern (Venalainen et al., 2006; Waldenstedt, 2006). These chickens have welfare concerns because they may not be able to eat or drink or may be in pain due to the leg weakness (Garner et al., 2002; Sanotra et al., 2002). Broilers with leg weakness also may be culled on the farm or downgraded at processing, resulting in high economic costs of production. In the American market, it is estimated that economic losses due to broiler leg problems cause a loss of $80 to $120 million per year (Morris, 1993).

1.6 Leg deformities: rickets and tibial dyschondroplasia

Two of the most commonly studied leg disorders in broilers are rickets and tibial dyschondroplasia (TD). Rickets and TD occur when the growing bone fails to mineralize properly, and can occur in the growth plate of long bones in a number of avian species

(Leach and Nesheim, 1965; Steinke, 1971; Wise and Knott, 1975). Rickets is characterized by a widened and disorganized proliferation zone and derangement of the cell columns due to the decreased conversion of maturing chondrocytes to hypertrophic chondrocytes (Takechi and Itakura, 1995; Kato et al., 1990). TD is characterized by a mass of nonvascularized, nonmineralized white cartilage that extends from the epiphyseal growth plate into the metaphysis. In this condition, there is a widened pre-hypertrophic zone that suggests cells are arrested in this transitional state and do not achieve normal hypertrophy (Hargest et al., 1985b). Although there are many studies of the TD condition and its molecular etiology, very little has been investigated concerning the rickets condition.

The expanded and disorganized growth plate in nutritional rickets results from inadequate sunlight exposure, a deficiency of vitamin D, calcium, or phosphorus in the diet, or an imbalanced calcium-phosphorus ratio (Lacey and Huffer, 1982; Long et al.,

1984a,b,c; Amling et al., 1999; Bergstrom, 1998). An adequate supply of these nutrients is necessary for the normal development of the growth plate, especially because broilers are grown quickly and killed at six to seven weeks of age. In addition, chondrocytes move from the top to bottom of the growth plate in less than 24 hours in broiler chickens

(Sissons, 1953). Some animals have an underlying disease or genetic factor responsible for rickets, which usually results in abnormal metabolism of vitamin D, calcium, or phosphorus.

Matrix mineralization is delayed or absent in rickets, which causes the bone metaphyses to soften. In addition, the blood vessels that normally appear in the zone of

17 hypertrophy to remove cell debris appear blunted in rickets. It is thought that inadequate calcium for mineralization as well as deficient production of matrix proteins by hypertrophic chondrocytes causes these abnormalities (Klein et al., 1993). Calcium- deficiency causes an enlargement of the growth plate due to failure of the proliferative chondrocytes to mature (Long et al., 1984). The addition of dietary calcium to animals with nutritional rickets heals the defects in bone and cartilage characteristic of rickets and corrects growth retardation (Amling et al., 1999). Furthermore, observations that higher concentrations of calcium increase the expression of later differentiation markers such as type X collagen suggest that low levels of calcium contribute to the delay of hypertrophic chondrocyte differentiation in conditions like rickets (Rodriguez et al., 2005).

Abnormal bone development and rickets are also a concern for humans. Because vitamin D is produced from cholesterol in the skin with activation by sunlight, humans with low exposure to sunlight are at risk for the development of rickets. In addition, humans that have darker skin are at risk because they require more sunlight to produce the necessary amounts of vitamin D (Kreiter et al., 2000). Rickets can also be onset by a vegetarian diet, which often does not contain sufficient calcium and has high concentrations of phytate, an anti-nutrient that inhibits intestinal calcium absorption.

Thus, calcium deficiency is widely distributed throughout the world and the high-risk groups include people in poverty (UV light, limited food, vegetarian diets), of different races (UV light), and religious backgrounds (food choices, apparel and UV light).

1.7 Broiler diets and mineral balance

Although the growth performance of broiler chickens has improved considerably in recent years, not many changes have been made in the recommended mineral content of their diets. The requirements for dietary calcium and phosphorus broiler starter diets

18 are based on research done between 1952 and 1982 (NRC, 1994). Nutritional recommendations for broilers may vary depending on their age, sex, strain, and concentrations of other nutrients. However, the National Research Council has determined the minimum levels of nutrients for broilers required to prevent deficiency symptoms and for general maintenance for three age groups: 0-3 weeks, 3-6 weeks, 6-8 weeks (NRC, 1994; Table 1.2).

Table 1.2. Vitamin and mineral requirements of broilers

Nutrient 0-3 Weeks 3-6 Weeks 6-8 Weeks

Macrominerals Calcium (%) 1.00 0.90 0.80 Chlorine (%) 0.20 0.15 0.12 Magnesium 600 mg 600 mg 600 mg Nonphytate phosphorus (%) 0.45 0.35 0.30 Potassium (%) 0.30 0.30 0.30 Sodium (%) 0.20 0.15 0.12 Trace minerals Copper (mg) 8.0 8.0 8.0 Iodine (mg) 0.35 0.35 0.35 Iron (mg) 80.0 80.0 80.0 Manganese (mg) 60.0 60.0 60.0 Selenium (mg) 0.15 0.15 0.15 Zinc (mg) 40.0 40.0 40.0 Fat soluble vitamins A (IU) 1,500 1,500 1,500 D3 (ICU) 200 200 200 E (IU) 10 10 10 K (mg) 0.50 0.50 0.50 Water soluble vitamins B12 (mg) 0.01 0.01 0.01 Biotin (mg) 0.15 0.15 0.12 Choline (mg) 1,300 1,000 750 Folacin (mg) 0.55 0.55 0.50 Niacin (mg) 35.0 30.0 25.0 Pantothenic acid (mg) 10.0 10.0 10.0 Pyridoxine (mg) 3.5 3.5 3.0 Riboflavin (mg) 3.6 3.6 3.0 Thiamin (mg) 1.80 1.80 1.80

Broilers require 13 vitamins and 12 minerals in their diet that perform a wide array of functions (Table 1.2). Along with energy and amino acid requirements, mineral balance is an important factor to consider when formulating poultry diets, as broilers are prone to leg problems. Perhaps one of the most important considerations for mineral balance is the amount of calcium and phosphorus in the diet, as these are the primary constituents of bone. Bone mineralization requires calcium and phosphorus, and inadequate dietary concentrations of these minerals may result in reduced bone formation or increased bone resorption, both of which may increase bone porosity (Stevens and

Lowe, 1992). Both the quantity of calcium and phosphorus and the Ca:P ratio are important when determining feed formulations. A Ca:P ratio of 1:1 to 2:1 is acceptable for growing poultry, and increasing the calcium in the diet also increases the requirement for phosphorus.

The ratio of calcium to phosphorus is commonly referred to in terms of nonphytate phosphorus (nPP). The phytate molecule is the principal storage form of phosphorus in plant tissues, and is typically unavailable to nonruminant animals (such as poultry) because they lack the digestive enzyme phytase that removes phosphorus from the phytate molecule. Although phosphorus availability can vary among feed and birds, its availability in feedstuffs of plant origin is approximately 30% (Scott et al., 1982).

Thus, the Ca: nPP ratio is expressed in terms of nonphytate phosphorus so only the phosphorus that is bioavailable to the chicken will be accounted for.

An evaluation of current industry usage levels of calcium and nonphytate phosphorus revealed a broad diversity of concentrations in broiler starter diets (Fig. 1.5).

This may in part contribute to the high incidence of leg problems seen in broiler chickens.

Bones of 35-day-old modern broilers have been shown to have increased porosity and a higher Ca:P ratio than expected, both of which are thought to contribute to bone weakness (Thorp and Waddington, 1997). The authors proposed that these factors may

20 be attributable to insufficient concentrations of minerals, primarily calcium and phosphorus, in commercial diets.

Figure 1.5: Current industry usage levels of calcium and nonphytate phosphorus in broiler starter diets (Survey by Agri Stats, Fort Wayne, Indiana).

There is a considerable amount of literature concerning the calcium and phosphorus requirements of broiler chickens. The NRC recommends 1.0% calcium and

0.45% nPP in broiler starter diets. One study found that calcium levels and the Ca:nPP ratios should be higher than these recommendations for adequate bird performance (Coto et al., 2008). Increasing the calcium and phosphorus levels improved bone development, and increasing dietary calcium consistently reduced the incidence of leg abnormalities.

Another study showed that feeding broilers diets with a high calcium (1.1-1.3%) and low phosphorus (0.3-0.6) resulted in over 80% normal growth plate conditions, and that more intermediate conditions resulted in hypocalcaemic rickets and TD (Williams et al., 2000).

The authors proposed that broiler starter diets should be higher in calcium (1.1-1.3%) and lower in phosphorus (0.3%) than is currently recommended (1% Ca, 0.45% nPP). When calcium was decreased to 0.8% and the Ca:nPP ratio decreased, the incidence of calcium- deficient rickets was increased from approximately 4.6% to 10.5% (Cota et al., 2008).

Lower calcium concentrations and Ca:nPP ratios also result in an increased incidence of

TD (Coto et al., 2008; Ledwaba and Roberson, 2003).

1.8 Microarray analysis: Gene expression patterns in rickets

Although many of the molecular players involved in chondrocyte differentiation have been identified, a comprehensive understanding of the mechanisms involved has not been attained. Furthermore, the etiology of rickets has not been extensively studied and remains unclear. In order to investigate differences in the molecular factors involved in chondrocyte differentiation between control and rickets chondrocytes, a microarray was previously performed using growth plates from four rickets and four control broiler chickens. This study identified numerous genes that have different expression levels in rickets and control growth plate chondrocytes. Data from this microarray will further our understanding of normal chondrocyte differentiation by comparing it to an abnormal model, and may also elucidate the molecular mechanisms that cause the rickets condition.

Table 1.3 lists several genes of interest that showed differences in control and rickets growth plates (p<0.05). These genes were selected because of their implications in chondrocyte differentiation or calcium metabolism in the growth plate, and their known functions are discussed below.

Table 1.3. Microarray genes of interest

Gene Control mean Rickets mean P-value

Type X collagen alpha 1X chain 0.2872 -3.327 0.0001 Eukaryotic translation elongation -0.375 1.054 0.0260 factor 1 delta Annexin V (anchorin CII) 0.717 -0.438 0.0001 Fibrillin-1 1.215 -2.515 0.00001

Collagen X is the major extracellular protein synthesized by hypertrophic chondrocytes in growth plate cartilage that is destined for mineralization (Mayne and

Irwin, 1986; Schmid and Linsenmayer, 1987). This collagen associates with other matrix components, such as fibrils, annexin V, and proteoglycans (Chen et al., 1992). Collagen

X also binds calcium and matrix vesicles, the microstructures found in calcifying cartilage thought to be involved in mineral deposition (Anderson, 1989). Although there is a wealth of information on this protein, there are conflicting views on whether collagen

X is a solely structural molecule, or if it also has a role in the regulation of bone mineralization. Due to its localization to the hypertrophic chondrocytes, several functions of collagen X have been proposed, including providing an easily resorbed material for bone deposition, providing support as the cartilage matrix degrades, or regulating the calcification of the cartilage (Gibson et al., 1986; Schmid and

Linsenmayer, 1985; Bonen and Schmid, 1991; Schmid et al., 1991).

Eukaryotic elongation factor-1-delta (EEF-1δ) is a subunit of elongation factor-1

(EF-1), which is a protein complex that mediates the elongation of polypeptide chains during mRNA translation (Morales et al., 1992; Merrick, 1992). During translation,

EEF-1α transports aminoacyl tRNA to ribosomes with GTP hydrolysis, and EEF-1δ is a part of the EF-1βγδ complex responsible for the GDP-GTP exchange (Riis et al., 1990).

Translation factor activity plays an important role in regulating cell growth and cellular senescence (Sonenberg, 1993). Elevated expression levels of these factors have been found in various cancers. However, there are no data on the expression of this elongation factor in the growth plate.

Annexins are a family of proteins that are able to bind acidic phospholipids in the presence of calcium (Hickok et al., 1998; Gibson, 1998). Annexin V is one of a few annexins expressed in cartilage and bone, and is a major component of matrix vesicles.

These matrix vesicles are released from hypertrophic chondrocytes and have a critical

23 role in the cartilage mineralization process (Hoyland et al., 1991; Mundlos et al., 1997).

Various lines of evidence indicate that annexin V exhibits calcium-ion channel properties

(Otto et al., 1997; Komori et al., 1997; Iannotti and Brighton, 1989). Blocking annexin activities inhibited terminal differentiation events, and this calcium channel is likely the mechanism by which matrix vesicles uptake mineral ions across their membranes, and thus is crucial to the mineralization process (Kirsch et al., 2000). Furthermore, binding of collagen types II and X to annexin V stimulates its calcium channel activities, leading to the influx of calcium into matrix vesicles (Kirsch et al., 2000). This suggests that annexin V may not only form calcium channels in growth plate chondrocytes and matrix vesicles, but also may mediate cell/vesicle/matrix interactions.

Many proteins in the extracellular space are able to bind calcium, and the tight binding of calcium is thought to stabilize proteins, while weak binding may be involved in sensing variations in extracellular calcium levels (Maurer et al., 1996; Koch et al.,

1997). Fibrillin-1 is a thread-like glycoprotein, and is the major component of the microfibrils in the extracellular matrix. This protein contains 43 epidermal growth factor-like motifs that bind calcium, which is thought to be important for protein-protein interactions, stabilization of microfibril packing, and protection against proteolysis

(Reinhardt et al., 1996, 1997; Kielty and Shuttleworth, 1993). Mutations in fibrillin-1 result in Marfan’s syndrome, a connective tissue disorder that affects the skeletal, cardiovascular, and ocular systems. Although the localization and structure of this protein has been well studied, its specific function remains unknown.

1.9 Energy and the growth plate

ATP is the universal energy carrier in cells that provides high levels of free energy during hydrolysis and also acts as an allosteric effector. ATP is also now recognized as an important local messenger for cell-cell communication, and there is growing evidence that it may serve this role in bone and cartilage (Burnstock, 1997;

Hoebertz et al., 2000). Extracellular ATP exerts its effects by a family of receptors called the P2 purinoceptors, which are made up of ligand-gated ion channels and G- protein coupled receptors (North and Barnard, 1997).

Calcium and ATP concentrations are linked by a number of mechanisms within the cell. For example, the non-selective cation channels are permeable to calcium, and the G-coupled protein receptors stimulate phospholipases and activate the inositol 1,4,5- triphosphate pathway to release calcium from intracellular stores. Calcium is also an important regulator of mitochondrial function, and acts at several levels to stimulate ATP synthesis. Mitochondrial oxidative phosphorylation is the major pathway responsible for

ATP synthesis in the cell, and calcium accumulation in the mitochondria increases mitochondrial ATP production and ATP levels in the cytosol (Jouaville et al., 1998). The activity of three hydrogenases of the Krebs cycle are known to be modulated by calcium concentrations, indicating a possible mechanism for the increased metabolic activity at high calcium concentrations (Hansford, 1980; Denton et al., 1980). In addition to higher calcium levels inducing ATP production, extracellular ATP has also been shown to elevate intracellular calcium concentrations (Barry and Cheek, 1994). One study found that ATP increased calcium as well as DNA synthesis and proliferation in mouse osteoblast-like cells (Shimegi, 1996).

There are a number of studies concerning the effects of ATP on chondrocyte differentiation and bone formation. Growth plate chondrocytes have been shown to continually export ATP, which has putative roles in cell maturation, energy metabolism,

25 and matrix mineralization (Hatori et al., 1995; Hung et al., 1997; Lyoyd et al., 1999).

Extracellular ATP has a physiological role in bone formation and is persistently present in the calcifying environment. The addition of exogenous ATP to cultured growth plate chondrocytes has been shown to cause slight alterations in alkaline phosphatase activity and stimulated formation of poorly mineralized calcium phosphate crystals, indicating that ATP level may have a role in regulating mineral formation (Hatori et al., 1995). Data also indicate that ATP can initiate calcification initiated by matrix vesicles, providing pyrophosphate for the mineralization process (Ali and Evans, 1973; Hsu and Anderson,

1977, 1978). Exogenous ATP has been shown to transiently increase the cytosolic free calcium concentration and has a mitogenic effect on osteoclast bone cultures (Kumagai et al., 1989, 1991; Shimegi et al., 1996). However ATP also has been shown to act as a strong inhibitor of bone formation (Hoebertz et al., 2002). ATP also has the ability to be cytotoxic at certain concentrations, causing cell death by both necrosis and apoptosis.

1.10 Chondrocyte cell culture

Chondrocytes have been successfully cultured in a number of species, including chickens, mice, and humans. Studies have indicated that chondrocytes grown in vitro retain the ability to undergo differentiation as they would in vivo. These in vitro cells undergo the same morphological and biochemical changes that occur as cells go through the distinct maturational stages in the growth plate. Research has also shown that environmental factors and culture conditions can affect the differentiation process, and alter the in vitro chondrocyte phenotype. Factors that can affect differentiation include culture type, culture media, cell density at plating, and the presence or absence of certain vitamins and minerals.

Several in vitro models have been developed to study chondrocyte differentiation

(Cancedda et al., 1995). Chondrocytes that are utilized to study differentiation in culture can either be primary cells or obtained from a cell line. Primary cells are taken directly from the animal and plated, while cell lines are established cells from a manufacturer that are manipulated and able to grow for long periods of time in culture. In addition, there are two basic culture systems that can be used for growing cells: in monolayer culture systems, cells grow adhered to a surface, and in suspension systems, cells are floating in culture medium. There are also many options for the medium used to supply the essential nutrients to the cells for survival and growth. These include the type and concentration of carbohydrates, presence or absence and type of serum which contains albumin and growth factors, and the presence or absence of certain vitamins and minerals. The characteristics of cells in culture can be manipulated by these factors, and there are both advantages and disadvantages to each system.

Primary cultures can only be maintained in vitro for a limited period of time, and are often heterogeneous cultures that become dominated by fibroblasts, a type of cell involved in synthesizing the extracellular matrix in animal tissues. However, these primary cells usually retain many of the differentiation characteristics of the in vivo cell

(ECACC, 2008). Continuous cell lines can be maintained for long periods of time and are readily available, but retain very little of their in vivo characteristics.

The morphology of cells in culture is greatly affected by the type of culture system and conditions. In general, there are three basic morphologies seen in cell culture: epithelial-like, in which cells are attached and appear flattened and polygonal; lymphoblast-like, in which cells retain a spherical shape, often in suspension cultures; and fibroblast-like, in which cells are attached and appear elongated and bipolar (Ryan,

2008). Culture conditions may also affect proliferation rates and biochemistry of the cells.

Some studies have cultured prehypertrophic chondrocytes in gels or suspension cultures to promote a round (lymphoblast) cell shape that maintains the chondrocyte phenotype (Gibson et al., 1984; Solursh et al., 1986; Iwamoto et al., 1989; Adams et al.,

1991), while others use long-term culture that promotes a fibroblast appearance in monolayer (Bohme et al., 1992; Quarto et al., 1992). One of the challenges with culturing chondrocytes is to obtain high levels of proliferation without losing the cell phenotype.

Chondrocytes that are cultured in three dimensional (3D) gels are able to maintain the chondrocyte phenotype, but cell division rates are lower (Kimura et al., 1984; Kolettas et al., 1995; Tamponnet et al., 1992; Hauselmann et al., 1994). These 3D gels are also inconsistent in that the cells are exposed to different microenvironment conditions depending on their position in the gel. Conversely, when human chondrocytes are grown in monolayer culture, proliferation is high (Aulthouse et al., 1989). During chondrogenesis, distinct changes in gene expression result in the production of different collagens and proteoglycans that are exported into the extracellular matrix (ECM; Von der Mark, 1980).

In monolayer culture, chondrocytes dedifferentiate, reducing the expression of cartilage-specific proteins such as type II collagen and chondroitin sulfate (ChS) proteoglycan while increasing the production of collagen types I and III (Benya and

Brown, 1986; Archer et al., 1990; Bonaventure et al., 1994). These dedifferentiated cells in monolayer culture are able to reexpress the differentiated chondrocyte phenotype when culture conditions are properly manipulated (Benya and Shaffer, 1982; Benya et al.,

1988). The dedifferentiation is accompanied by a gradual change in morphology from round cells into fibroblast-like cells (Elima and Vuorio, 1989). Suspension cultures have been shown to promote re-expression of the chondrocyte phenotype (Bassleer et al.,

1986; Delbruch et al., 1986; Aulthouse et al., 1989; Archer et al., 1990; Bonaventure et al., 1994). Under suspension conditions, cell proliferation ceases, there is an increase in

28 expression of cartilage-specific proteins, and chondrocytes form aggregates of rounded cells, suggesting that cell shape plays an important role in the in vitro chondrocyte phenotype (Benya et al., 1978; Benya and Shaffer, 1982; Glowacki et al., 1983; Watt and

Dudhia, 1988; Aulthouse et al., 1989; Archer et al., 1990; Hauselmann et al., 1994;

Bonaventure et al., 1994).

Adding vitamins such as ascorbic acid or retinoic acid is known to induce differentiation in cultured chondrocytes (Habuchi et al., 1985; Tacchetti et al., 1987;

Leboy et al., 1989; Pacifici et al., 1991; Iwamoto et al., 1993; Lian et al., 1993). One study showed that chick embryo sternae cultured in the presence of ascorbic acid produced increased levels of type X collagen, alkaline phosphatase activity, and calcium deposition compared to control cells (Leboy et al., 1989). In addition, the concentration of minerals such as calcium and phosphorus or certain proteins such as BMP6 can affect chondrocyte differentiation in culture (Boskey et al., 1992; Bonen et al., 1991; Grimsrud et al., 1999).

Previous studies have indicated that changes in calcium concentration can directly modulate critical aspects of chondrocyte differentiation, such as matrix and proteoglycan accumulation, gene expression, and mineralization (Bonen et al., 1991; Chang et al.,

2002; Change et al., 1999; Wu et al., 2004). Studies in chondrogenic C5.18 cells have shown that cells grown at high extracellular calcium concentrations have reduced expression of early chondrocyte differentiation markers (aggrecan, type II collagen) and proteoglycan synthesis is decreased (Chang et al., 1999). In addition, high calcium also enhances mineral deposition and the expression of terminal differentiation markers, such as type II and type X collagen (Chang et al., 2002; Bonen et al., 1991). These observations support a role for calcium in enhancing chondrocyte differentiation.

1.11 Research Significance and Project Objectives

Much research has been done on the various factors involved in chondrocyte differentiation in the growth plate. These studies used immunocytochemistry, real-time

PCR, and cell culture systems to analyze the numerous genes and proteins involved in this complex process. However, there have not been many studies using disease models to study abnormal differentiation and its molecular foundations. Rickets is an ideal model for studying abnormal differentiation, as the growth plate in this condition is severely enlarged and chondrocytes do not progress normally through the differentiation stages. In addition, the only change in the diet between control and rickets chickens was the calcium level, which is critical for normal bone formation. Furthermore, leg weakness in broiler chickens is both an economic and a welfare concern in the poultry industry, and little work has been done to elucidate the molecular events that result in this debilitating condition. Thus, the first goal of this research was to analyze the expression of genes in the rickets growth plate that are known to be involved in normal chondrocyte differentiation. A second goal was to use data from the microarray to analyze various genes that have shown differences in the control and rickets growth plates, and which may be of interest for the etiology of the condition.

ATP and calcium metabolism are interrelated and ATP is known to be an important regulator of chondrocyte maturation and mineralization, although the exact role of ATP in bone formation is not known. A third goal for this research was to compare the concentration of ATP in control and rickets growth plates, in order to determine if the level of this energy molecule plays a role in the development of the rickets condition.

These data may also elucidate the effect of calcium concentration on ATP level in the growth plate, and the role of ATP in bone formation. A final goal for this project was to develop a chondrocyte cell culture system using low-calcium media to provide an in vitro model of the rickets condition.

CHAPTER 2

MATERIALS AND METHODS

2.1 Materials

Materials were purchased from Invitrogen, Sigma, Phenix Research Products, and

Applied Biosciences. Cell culture supplies included dialyzed Fetal Bovine Serum (FBS,

Invitrogen), Dulbecco’s Modified Eagle’s Medium (DMEM, Invitrogen), Penicillin-

Streptomycin (Invitrogen), Collagenase (Sigma), Hyaluronidase (Sigma), alizarin red stain (Sigma), and plastic tissue culture plates (Phenix). Materials for real-time PCR analysis included TRIzol reagent (Invitrogen), M-MLV reverse transcriptase (Invitrogen),

RNase OUT (Invitrogen), Amplitaq gold DNA polymerase (Applied Biosystems), and custom primers (Invitrogen).

2.2 Animals and Diets

All procedures used for this study were approved by The Ohio State University

Institutional Animal Care and Use committee. Broilers were obtained either from

Hoover’s Hatchery in Iowa at one day of age, or were hatched at the Ohio State

University. Broilers were housed in battery pens at approximately 10 birds per pen, and were randomly allotted to one of two ad libitum dietary treatments immediately after hatching: a control diet with normal calcium (1%) and a calcium-deficient diet (0.41%).

With the exception of calcium-deficient diet, broiler chickens were raised on a diet formulated to exceed many of the current NRC (1994) U.S. poultry industry requirements

(Table 2.1). In addition, the vitamin D in the deficient diet was lowered from 600

ICU/kg to 0 ICU/kg between 3 and 5 days before birds were sacrificed for chickens that did not seem to be developing a leg disorder based on their gait. Broilers were exposed to fluorescent lighting inside the pen for 9 days after hatching, then incandescent lighting was used on the ceiling of the room, so that most vitamin D would be obtained from the diet.

Table 2.1. Composition (%) of the basal diets for control and calcium-deficient experiments Ingredient Control diet Deficient diet

Corn 57.29 58.84 Soybean meal 32.7 32.7 Corn gluten meal 3.00 3.00 Dicalcium phosphate 1.52 1.52 Sodium phosphate 0.19 0.19 Limestone 1.55 0.00 Soybean oil 3.00 3.00 Salt 0.35 0.35 DL-methionine 0.20 0.20 Vitamin and mineral mix* 0.20 0.20

Calculated content (%) Calcium 1.00 0.41 nPP 0.45 0.45 Ca:nPP 2.2 0.9 *Includes per kg diet: 6000 IU retinyl palmitate, 600 ICU cholecalciferol, 10 IU D, L-α- tocopherol acetate, 1 mg menadione sodium bisulfite, 1.8 mg thiamin, 3.6 mg riboflavin, 25 mg niacin, 10.0 mg pantothenic acid, 3.5 mg pyridoxine, 0.5 mg folacin, 0.15 mg biotin, 500 mg choline, 50 mg ethoxyquin, 8 mg copper, 80 mg iron, 60 mg manganese, 0.1 mg selenium, and 40 mg zinc.

2.3 Growth plate analysis

The broiler chickens in this study were characterized as having rickets, TD, or control growth plates based on the size, color, and distal edge of the cartilage in the growth plate. The proximal tibiotarsus for each bird was isolated and the epiphyseal growth plate was longitudinally sliced for visual assessment. Control plates were identified by having a thin, pink growth plate with a straight red border at the distal end of the cartilage. Rickets was characterized by a large cartilage growth plate that was gray and pink in color and had a straight, prominent red border at the distal end of the cartilage. Tibial dyschondroplasia (TD) growth plates were white, enlarged cartilage growth plates that contained a layer of pink blood vessels within the cartilage and had an irregular, prominent red border at the distal end of the cartilage. The relative sizes of the growth plates were observed when taking samples. For birds fed the control 1.0% calcium diet, growth plates approximately 1.0-2.0 mm in length were characterized as normal, greater than 2.0 mm were called slightly enlarged, and enlarged growth plates with an irregular border were characterized as TD. For birds fed the 0.41% calcium diet, growth plates greater than approximately 3.0 mm were identified as rickets, and TD was characterized as stated above. Among the rickets growth plates, slightly enlarged was less than 3.0 mm, average enlarged was approximately 3.0-4.0 mm in length, and greatly enlarged was 4.0-7.0 mm.

2.4 Blood samples

Blood samples were taken from 20-day-old broiler chickens fed control and deficient diets. The samples were analyzed by The Ohio State University College of

Veterinary Medicine for a complete blood profile. Samples were run on a Roche Hitachi

911 chemistry analyzer (Indianapolis, IN).

2.5 Histology

Growth plate tissue from 21-day-old broiler chickens was fixed in 10% buffered formalin for 24 hours. These tissues were then embedded in paraffin, sliced into 5 µm- thick sections, and stained with hematoxylin and eosin (H&E) for histological analysis.

2.6 Real-time PCR

Epiphyseal growth plates of the tibia were isolated from 18-22 day old broiler chickens fed the control and deficient diets following cervical dislocation. For the proliferative and hypertrophic samples, the top one-third and bottom two-thirds of the growth plate were sliced and stored separately. Growth plates were taken over at least three sampling periods for each gene analyzed, and were preserved in liquid nitrogen with storage at -80°C. Total RNA was isolated from the growth plate tissues using Trizol

(Invitrogen) reagent according to the manufacturer’s protocol. In order to obtain homogenous samples of growth plate, the tissue was obtained by homogenizing half of a vertically-sliced rickets growth plate and the entire control growth plate, and taking a small sample of the homogenate for RNA isolation. RNA integrity was assessed using gel electrophoresis with ethidium bromide staining, and the RNA was quantified using

UV spectrophotometric analysis at 260 nm (A260).

Primers were designed to span an intron whenever possible to eliminate DNA contamination (Table 2.2). For primers that did not span an intron, RNA was treated with

DNase (Sigma) according to the manufacturer’s protocol. For reverse transcription PCR

(RT-PCR), 500 ng to 1 µg of total RNA was transcribed into cDNA with oligo(dT) primers and Moloney murine leukemia virus (M-MLV) reverse transcriptase (Invitrogen) in a 20 µL reaction according to the manufacturer’s specifications using an AMJ

Research PTC-200 thermal cycler. One µL of the resulting cDNA was used for the real- time PCR reaction with Amplitaq gold DNA polymerase (Applied Biosystems) and

SYBR green detection dye on the Applied Biosystems 7500 Real-Time PCR System

(1997). The conditions for this reaction included 10 minutes of initial denaturation at

95°C followed by 40 cycles of denaturation at 95°C for 15 seconds, annealing at 56.5-

58°C for 40 seconds, extension at 72°C for 30 seconds, and detection at 82°C for 32 seconds. To confirm the production of one major product, dissociation curves for each gene were performed and a random selection of real-time PCR products were resolved by agarose gel electrophoresis. The target genes were normalized with GAPDH and shown as relative fold-change compared to the control plates.

Table 2.2. Primers used in this study

Gene Sequence (5’-3’) Product Spans Tm Primer size (bp) intron (°C) design

GAPDH CTCTGTTGTTGACCTGACCTG 262 yes 58.0 Lee CAAGTCCACAACACGGTTGCT Collagen GCAGAGACCATCAACGGCGGT 333 no 58.0 Houston et type II CAGGAGCGAGGTCTTCTGCGA al., 1999 Collagen GAAACAGTCCAGCATCAAGGG 201 yes 58.0 T. Porter, type X TCTTGGTCCAATAGGGCCTG Uni. of (alpha 1) Maryland ALP CAAGAACACCAGCGATGTGGAGTA 230 yes 58.0 Rutt TCTCGTTGTTCCTGTCCAGCTCAT CaR TGGATGTTTGGTTCCTGTAGGC 197 no 59.0 Rutt GTGCGCAGTCAGGAGCACTTAT Ihh TCAAGGACGAGGAGAACACC 201 no 58.0 Rutt TGTCTGACGTCGTGATGTCC PthR ACCCTCGTCCTTATGCCTCT 206 yes 58.0 Rutt GTCCACCTGCTCCATGACTT PthrP CGTTTGGCAGTGAAGATGAGG 216 yes 58.0 Rutt GTTGTCCAAGACTGGGCTCTCA Bmp-2 GGTGCACGAAGCCTTTGAGA 324 no 56.0 Onagbesan AACAACGGCCTGAGCTGAGA et al., 2003 Bmp-4 GACCGGCAGGAAGAAAGTCG 359 no 56.0 Onagbesan GCACGCTGCTGAGGTTGAAG et al., 2003 Bmp-6 CACGCCATCGTCCAAACTCT 368 no 56.0 Onagbesan CTGCAGCATAGGGTCGCATT et al., 2003 Bmp-7 ACCCACAGCTATGACAACTGCTGA 294 no 58.0 Rutt ACCACCAACACAGAAACAGTTGCG BmpR-Ib GAAGCCAGTTGGTTCCGAGA 211 no 56.0 Onagbesan CACAGACCACATGCAGCAGA et al., 2003 BmpR-2 GGAATCAGCGAGAGCCGAAT 279 no 56.0 Onagbesan TGGGTCAGGAGGTGGGAAGT et al., 2003 EEF1δ AGCTGCTGCAGAGGAAGATGATGA 247 yes 58.0 Rutt AACGAGCCCATCCATTTGGACAGA Annexin-V CTGGCACTGATGATGATACCCTGA 241 yes 58.0 Rutt ATGCTAACTGAAGGGCTGCAAAGC Fibrillin CCTAACATCTGTGTCTATGG 450 yes 58.0 Rutt AACTGTAATAGGGTTTGGTC

2.7 ATP assay

The ATP assay protocol utilized is a procedure for analysis of ATP in small tissue samples adapted from Khan et al. (2003). Briefly, growth plates (20-30 mg) were weighed and homogenized in pre-cooled perchloric acid (HClO4, 10% v/v). The homogenate was centrifuged at 4500 rpm for 10 minutes at 4°C. Five-hundred µL of supernatent was neutralized with 200 µL of 2.5 M KOH. This solution was centrifuged at 4500 rpm for 5 minutes at 4°C. An aliquot from the supernatant was diluted 5-, 20-, and 40-fold with Tris-EDTA (Tris-acetate buffer containing 2 mM EDTA, pH 7.8) to determine the linear range of the samples.

For ATP analysis, a Bioluminescent Somatic Cell Assay kit was utilized (Sigma).

A mix of 100 µL somatic cell releasing agent, 50 µL sterile water, and 50 µL cell sample was added to 100 µL of ATP assay mix (diluted 20-fold) in a microplate well. The luminescence signal was measured with a Packard LumiCount Luminometer (#AL10000) with an integration time of 1 minute (signal intensity) and a lag time of 1 second (delay in reading signal). A duplicate trial was performed, and two readings of each sample were recorded. Ten concentrations of an ATP standard were analyzed and were used to compare the two trials.

The relative light units (RLU) for each sample were normalized for DNA concentration for the various samples. DNA was isolated from each sample using the following procedure. Briefly, 0.8 mL 0.5% SDS extraction buffer was added to the remaining homogenate from the first step in the ATP assay. Fifty µL of proteinase K solution (10 mg/mL) was added, and tubes were incubated at 55 °C for 24 hours. Eight- hundred µL of phenol:chloroform: isoamyl alcohol was added, the solution was centrifuged for 5 minutes at 12,000 rpm, and 500 µL of supernatent was transferred to a new tube. Fifty µL of 3 M NaAC (pH 5.3) and 1 mL 100% ethanol were added, the tubes were inverted, and DNA was precipitated for 1 hour at -20 °C and centrifuged at 12,000

37 rpm for 20 minutes at 4 °C. The pellet was washed with 75% ethanol, and resuspended in TE buffer. DNA concentration was measured at 260 nm using a NanoDrop spectrophotometer (Thermo Scientific).

2.8 Chondrocyte cell culture

The original protocol for growth plate isolation and digestion was obtained from

Colin Farquharson of the Roslin Institute. Epiphyseal growth plates of the tibia were isolated from 18-22 day old broiler chickens following cervical dislocation. The growth plate cartilage was finely chopped and digested in a mixture of collagenase (0.4% wt/vol) and hyaluronidase (0.2% wt/vol) in DMEM for 3.0 hours at 37°C with shaking.

Undigested cartilage was removed with a 70 µm sieve and pelleted by centrifugation at

1100 rpm for five minutes, followed by a brief washing in 5 mL DMEM at 1100 rpm for three minutes. Cells were resuspended in culture medium consisting of DMEM (lacking

L-glutamine, sodium pyruvate, CaCl2) supplemented with dialyzed fetal bovine serum

(10% v/v), penicillin (100 U/mL) and streptomycin (100 µg/mL) solution (1% v/v), sodium pyruvate (10 mM), and fungigen (3% v/v). Cell cultures were grown at 37°C at an atmosphere of 95% air and 5% CO2. The culture medium was changed every three days for the duration of the experiments. Cell morphology and confluence were observed daily, and cell counts were completed using a hemocytometer.

2.9 Alizarin red staining

The cultures were fixed using 0.5 mL formalin for 20 minutes followed by a rinse using sterile water, and then were stained for 10 minutes with 40 mM Alizarin red.

Stained cultures were then rinsed three times with water followed by a 15-minute wash with PBS with rotation to reduce non-specific staining.

2.10 Statistical analysis

Data are expressed as the mean ± standard error of the mean (SEM). The statistical significance of the differences in mean values for two groups was assessed using the two-sample t-test assuming unequal variances. For comparisons of four groups, a one-way ANOVA followed by Tukey’s post hoc multiple comparison test was performed. The minimum significance level was set at P < 0.05.

CHAPTER 3

RESULTS

3.1 Growth plate observations and histology

The broiler chickens in this study were identified as having rickets, TD, or control growth plates based on observations of the growth plate and the criteria in material and methods. On the control diet, 60.9% of the birds had normal growth plates, 26.1% had slightly enlarged growth plates, and 13.0% had TD (n=46, Fig. 3.1A). On the deficient diet, 23.9% of the broilers had TD and 76.1% had rickets, composed of 10.9% slightly enlarged, 43.5% average, and 21.7% greatly enlarged growth plates (n=46, Fig. 3.1B).

Rickets growth plates had a mean weight of 0.29 grams each, which is significantly higher than the mean control weight of 0.17g (P=0.0003, n=53, two-tailed t-test assuming unequal variances).

Control diet Calcium-deficient diet

A B

Figure 3.1. Relative numbers of broiler chickens with normal, TD, and rickets growth plates. A) Relative growth plate type percentages for broilers fed a control 1.0% calcium diet, n=46 B) Relative growth plate type percentages for broilers fed a deficient 0.41% calcium diet, n=46. Conditions for each grouping are described in the text.

Samples of growth plates from birds on control and calcium-deficient diets were visually assessed for enlargement and stained with hematoxylin and eosin (H&E). Both control and rachitic growth plates showed changes in chondrocyte morphology throughout the plate. A region of flattened cells oriented in columns was closest to the articular cartilage, followed by a gradual increase in cell size, a region of round chondrocytes with a large cytoplasm, and mineralization with the introduction of blood vessels. Enlarged growth plates from broilers on the calcium-deficient diet had a considerably larger proliferative region compared to the smaller growth plates from birds on the control diet (Fig. 3.2). In addition, the length of the perforating epiphyseal blood vessels seemed to be longer in the deficient growth plate, the concentration of blood cells in the marrow spaces was lower, and the vessels show portions of thin, non-functional remains.

3.2 Blood analysis

Plasma calcium (mg/dL) was found to be greater in control chickens compared to birds fed deficient diets (p=0.0002, n=10; Fig. 3.3A). Calcium concentrations of birds fed control diets ranged from 10.9 to 12.7 mg/dL (mean=11.68 ± 0.14), while birds fed deficient diets showed a range of 5.5 to 8.6 mg/dL (mean=6.90 ± 0.13). No significant differences in blood phosphorus levels were found (p=0.64, n=10) and a direct relationship between calcium and phosphorus levels was not seen (R2=0.075). The blood calcium: phosphorus ratio was greater in birds fed the control diet compared to the deficient diet (p=0.005, n=10; Fig. 3.3B). Control birds had ratios ranging between 1.4 and 2.1 (mean=1.69 ± 0.14), while calcium-deficient birds had ratios between 0.6 and 1.3

(mean=0.96 ± 0.13). The only other serum values that were significantly different between birds fed control and deficient diets were for bicarbonate, which was 1.17-fold higher in birds on the control diet (p=0.014, control mean=24.36 ± 0.89; rickets mean=20.76 ± 0.39; Fig. 3.4).

A B

Figure 3.3. Concentration of calcium, the calcium: phosphorus ratio, and bicarbonate in the plasma of 18 to 21-day-old broiler chickens fed control and calcium-deficient diets. Bars represent the mean and standard error for each group (n=10), and the asterisk denotes that the rickets group was significantly different from the control group (p < 0.05, two-tailed t-test assuming unequal variances). A) Concentration of serum calcium, p = 0.0002. B) Serum Ca:P ratio, p = 0.005.

Figure 3.4. Concentration of bicarbonate in the plasma of 18 to 21-day-old broiler chickens fed control and calcium-deficient diets. Bars represent the mean and standard error for each group (n=10), and the asterisk denotes that the rickets group was significantly different from the control group (p < 0.05, two-tailed t-test assuming unequal variances).

3.3 Quantitative real-time PCR

Collagen type II, collagen type X, and alkaline phosphatase (ALP) were genes used as controls in this study (Fig. 3.5). Type X collagen was increased about 2.2-fold

(p=0.035) and ALP increased 4.3-fold (p=0.011) in control growth plates compared to rickets growth plates. There was no difference in type II collagen expression between the two groups (p=0.481). A selection of genes from this study were analyzed for their presence in the proliferative and hypertrophic fractions of control and rickets growth plates (Fig. 3.6). Based on Tukey’s multiple comparison analysis, only Type X collagen was found to be significantly different between the fractions. This gene was expressed significantly higher in the hypertrophic region compared to the proliferative region of both control and rickets growth plates.

Figure 3.5. Relative mRNA expression of three control genes known to be involved in chondrocyte differentiation in control and rickets growth plate samples of 18-21-day old broiler chickens. The mRNA levels for control plates were set as 100%. Values were corrected for changes in GAPDH reference gene expression. Bars represent the mean and standard error for each group, and the asterisk denotes that the rickets group is significantly different from the control group (p < 0.05, two-tailed t-test assuming unequal variances). Values are as follows: Collagen type II, p=0.481; Collagen type X, p=0.035; ALP (alkaline phosphatase), p=0.011.

Figure 3.6. Relative mRNA expression of various genes analyzed in this study in the proliferative and hypertrophic fractions in control and rickets growth plate samples of 18-21-day old broiler chickens. The mRNA levels for the hypertrophic zone of the control plates were set as 100%. Values were corrected for changes in GAPDH reference gene expression. Bars represent the mean and standard error for each group, and the asterisk denotes a difference in the means of the groups (p < 0.05, ANOVA, Tukey’s multiple comparison test). ANOVA values are as follows: Collagen type X, p<0.001; EEF-1δ, p=0.768; Annexin-V, p=0.045; Fibrillin, p=0.199; Bmp-2, p=0.013; Bmp-6, p=0.098; Bmp-7, p=0.563, BmpR-Ib, p=0.243.

The parathyroid hormone receptor (PTHR) was approximately 2.3-fold increased in rickets growth plates compared to control (p=0.024; Fig. 3.7). Ihh was decreased 1.7- fold in rachitic compared to control growth plates (p=0.047). PTHrP did not show a significant difference in mean values between the two groups (p=0.610). CaR was increased almost 20-fold in rachitic plates compared to controls, the greatest difference seen in this study (p=0.038).

Figure 3.7. Relative mRNA expression of the genes involved in the growth plate feedback loop in control and rickets growth plate samples of 18-21-day old broiler chickens. The mRNA levels for control plates were set as 100%. Values were corrected for changes in GAPDH reference gene expression. Bars represent the mean and standard error for each group, and the asterisk denotes that the rickets group is significantly different from the control group (p < 0.05, two- tailed t-test assuming unequal variances). Values are as follows: Ihh, p=0.047; PTHR, p=0.024; PTHrP, p=0.610; CaR, p=0.038.

Three of the four Bmps and both BmpRs analyzed were expressed lesser in rickets compared to control samples (p < 0.05, Fig. 3.8). Bmp-7 showed similar mRNA expression levels in control and rickets growth plates (p=0.911). Bmp-2 (p<0.001),

Bmp-4 (p=0.042), and Bmp-6 (p=0.001) were 4.2-, 3.4-, and 5.0-fold decreased in the rickets plates, respectively. BmpR-1b (p=0.025) showed a 9.7-fold decrease in rickets plates, which was the largest difference seen, and BmpR-2 (p=0.004) was decreased 3.2- fold in rickets compared to normal growth plates. Bmp-2, Bmp-4, and BmpR-Ib were increased in the control hypertrophic zone, and Bmp-7 was increased in the proliferative zone of rickets and the hypertrophic zone of control plates (Fig. 3.6).

Figure 3.8. Relative mRNA expression of the various Bmps and BmpR genes in control and rickets growth plate samples of 18-21-day old broiler chickens. The mRNA levels for control plates were set as 100%. Values were corrected for changes in GAPDH reference gene expression. Bars represent the mean and standard error for each group, and the asterisk denotes that the rickets group is significantly different from the control group (p < 0.05, two-tailed t-test assuming unequal variances). Values are as follows: Bmp-2, p=0.00005; Bmp-4, p=0.042; Bmp- 6, p=0.001; Bmp-7, p=0.911; BmpR-1B, p=0.025 and BmpR-2, p=0.004.

EEF-1δ was not significant between control and rickets growth plates but the mean expression level was 2-fold higher in control plates (p=0.068; Fig. 3.9). This gene did not show a trend of being localized to the proliferative or hypertrophic zone of the growth plate (Fig. 3.6). Annexin-V was found to be 5.7-fold lower in rickets plates compared to control (p=0.001; Fig. 3.9). The highest expression level of annexin-V was found in the hypertrophic zone of the control plates, and the lowest expression levels was found in both the proliferative and hypertrophic zone of the rickets growth plate.

Fibrillin mRNA expression was over 3-fold lower in rickets plates (p=0.030), and showed a trend of being higher in the proliferative zone of both types of growth plates.

Figure 3.9. Relative mRNA expression of the genes detected in the microarray in control and rickets growth plate samples of 18-21-day old broiler chickens. The mRNA levels for the hypertrophic zone of the control plates were set as 100%. Values were corrected for changes in GAPDH reference gene expression. Bars represent the mean and standard error for each group, and the asterisk denotes that the rickets group is significantly different from the control group (p < 0.05, two-tailed t-test assuming unequal variances). Values are as follows: EEF-1δ, p=0.068; Annexin-V, p=0.001; Fibrillin, p=0.030.

3.4 ATP assay

The µg DNA per milligram of growth plate were not found to be significantly different between control (57.5 µg DNA/mg) and rickets (46.2 µg DNA/mg) growth plates (p=0.440, n=16, two-tailed t-test assuming unequal variances). The ATP assay results also showed no significant difference between the control and rickets groups, however the rickets chondrocytes showed a slightly higher value (p=0.444, n=16, two- tailed t-test assuming unequal variances; Table 3.1). The italic values in the table show the mean and standard error of the mean values, respectively. Removal of the one highest control value (starred in table) results in a significant difference between the two

49 groups, with rickets being 1.6-fold higher compared to control (p=0.055, n=15, two-tailed t-test assuming unequal variances).

Table 3.1. ATP assay sample and mean values

Control Rickets RLU/µg DNA RLU/µg DNA 0.2473* 0.1700 0.1324 0.1452 0.1190 0.1344 0.1124 0.1334 0.0619 0.1179 0.0504 0.1130 0.0372 0.0903 0.0221 0.0597 Mean 0.0979 0.1205 SEM 0.0053 0.0012 Mean* 0.0765 SEM* 0.0019

3.5 Cell culture

The chondrocytes in cell culture were not able to achieve proliferation and differentiation as expected. The reason for the lack of proliferation remains unclear, while the lack of differentiation is likely a result of the cells not reaching confluence.

Cell counts after 24 hours revealed a steady increase in the number of attached cells, with the greatest concentration of cells plated at 60 x 104 cells per mL (Fig. 3.10). Increasing the number of plated cells resulted in an increase in the number of attached cells. Plated concentrations above this value resulted in cell clumping and loss of the monolayer

50 phenotypes. The number of attached cells from rickets growth plates was slightly higher than that from control plates when plated at 60 x 104 cells/mL, and was similar for all other concentrations of plated cells.

Figure 3.10. Number of attached chondrocytes from the control and rickets growth plates of 18 to 21 day old broiler chickens measured 24 hours after plating. Counts are the average taken from two culturing periods.

Cells appeared to attach within 24 hours and remained attached for weeks, but never proliferated to achieve confluence. Cells had a rounded morphology during the first week, but often became fibroblastic in appearance during the second or third week, or following treatment with trypsin. No difference in cell morphology was seen between control and rickets cultures over the 22-day trial period. The chondrocyte cultures became contaminated during half the trials, as evidenced by discoloration of the media and the presence of fungal or bacterial cells in the culture dishes.

Alizarin red staining showed a gradual accumulation of calcium in the cultures containing 1.8 mM calcium, with the darkest staining at day 22. For cultures that did not have calcium, the staining was slightly darker on day four compared to day two, and the following days in culture showed no change in calcium concentration. No difference in staining was seen between rickets and control cultures.

The relative mRNA expression of type X collagen was variable between control and rickets growth plates at two different calcium concentrations (0 and 1.8 mM) and throughout the six sampling periods over 22 days in culture (Fig. 3.11). All four culture conditions had similar values for time 0, had various expression patterns for the 12 hour and 24 hour time periods, and generally showed gradual increases in type X from day 16 to day 22. Type X expression was highest for three of the four culture conditions at day

22, and for the fourth culture condition this day was the second highest value.

Figure 3.11. Relative mRNA expression of type X collagen in chondrocyte cell culture over one sampling period. Values were corrected for changes in GAPDH reference gene expression.

CHAPTER 4

DISCUSSION

4.1 Validation of rickets and control growth plate phenotypes

Broilers were identified as having control or rickets growth plates based on visual assessment, H&E staining, and blood analysis. Broilers on each diet showed a range of growth plate sizes even though they were fed the same two diets and kept in the same environment, indicating that genetics may play a large role in determining the incidence of leg weakness. Specifically, these data seem to imply that broilers display diverse genetic backgrounds, even though they were the same strain, that cause them to be affected differently by the calcium deficiency. One study showed that chickens selected for different aspects of body fatness had genetic variations in calcium metabolism

(Shafey et al., 1990).

Based on visual assessment of the growth plate, the majority of broilers fed the control diet had normal growth plates (60.9%), while over a quarter had slightly enlarged growth plates (26.1%) and 13% displayed characteristics of TD (Fig. 3.1). The slightly enlarged and TD growth plates likely contribute to the relatively high incidence of leg weakness seen in broiler flocks, although TD may be more likely to cause leg concerns due to its comparably more expanded growth plate. The incidence of TD seen in this study is comparable to that reported in the literature, which shows a range of 13.0% to

48.6% in studies using control diets (Garner et al., 2002; Havenstein et al., 1994). By two weeks of age, a number of chickens on the calcium deficient diet showed an

53 abnormal gait. Broiler chickens on this diet all had enlarged growth plates, displaying plates that were either slightly enlarged (10.0%), TD (23.9%) or rickets (65.2%).

Samples of growth plates that were taken from broilers fed control and deficient diets were stained with H&E and exhibited characteristics of normal and rachitic growth plates that have previously been described (Fig. 3.2). The histology of normal growth plates has been well known for many years and been extensively studied in a variety of species (Becks et al., 1945; Engfeldt et al., 1969; Brighton, 1978). The various horizontal zones of differentiation in the growth plate were apparent in the control plates analyzed in this study: the zones of proliferation, pre-hypertrophy, hypertrophy, and mineralization show morphology patterns similar to those that have been previously described. Growth plates that were visually assessed as rickets have a lengthened, disorganized proliferative zone, and elongated epiphyseal vessels with a lower blood concentration that are characteristic of this condition (Long et al., 1984).

Blood plasma calcium concentrations for broilers fed the deficient diet were decreased compared to broilers on the control diet (Fig. 3.3A). This is expected because birds on the deficient diet are not taking as much calcium into their bloodstream from the digestive tract. No significant differences in blood phosphorus levels were found, and decreasing calcium concentrations did not decrease the phosphorus concentrations in the serum. Because the nonphytate phosphorus concentration was the same for both diets, the similar serum phosphorus levels for birds on both diets seems logical. Blood calcium has previously been shown to be lower in birds fed diets with high phosphorus, and excess phosphorus may reduce calcium availability by forming insoluble calcium phosphate in the intestine (Shafey et al., 1990). However, it is somewhat surprising that the phosphorus level did not vary with the calcium concentrations, as the metabolism of these two minerals is interrelated. Typically, a rise in serum phosphorus upsets the ordinary balance between calcium and phosphorus in the body, and activates a hormonal

54 cascade to correct the imbalance, including resorption of minerals from bone. There was no evidence for the correction of the Ca:P imbalance in this study.

The lower calcium:phosphorus ratio was decreased in birds fed the control diet

(Fig. 3.3B), and this was due to the increased serum calcium concentrations on the control diet and a nPP level that remained the same for both diets. A previous study found that the incidence of TD was also high when chicks were fed diets containing high phosphorus and low calcium (Edwards and Veltman, 1983). Both the low serum calcium concentration and the low serum Ca:P ratio on the deficient diet may have contributed to the high incidence of abnormal growth plates in broilers fed this diet. A study where broilers were fed a diet deficient in both minerals and were able to partially adapt to the deficiency suggests that chicken may be able to better adjust to deficiencies in both calcium and phosphorus while maintaining a steady Ca:P ratio, rather than deficiencies in calcium alone (Yan et al., 2005).

The decreased serum bicarbonate concentration resulting from the deficient diets was an unexpected result that has not been previously associated with the rachitic condition in broilers (Fig. 3.4). Calcium is related to bicarbonate in that it forms ionized calcium bicarbonate in the serum and acts as one of the major blood buffering systems in the body. A number of studies have related increases in PTH with a significant decrease in plasma bicarbonate (Muther et al., 1982). PTH is a known major regulator of tubular transport of bicarbonate in the kidney, and has been shown to enhance bicarbonate excretion (Even et al., 1996; Coleman et al., 1994). Although not determined in the current study, broilers on the deficient diet likely experienced increases in PTH expression in an attempt to counter the low serum calcium, which in turn lowered the concentration of bicarbonate in the serum.

The results from both the histology and blood analysis confirm the accuracy of the growth plate visual assessments.

4.2 Quantitative real-time PCR

Calcium is critical to the morphological and biochemical events of endochondral ossification, in particular to the transitions to hypertrophic cartilage and bone. Thus, it is not surprising that many of the genes involved in chondrocyte differentiation are different between control and rickets growth plates, the latter which results from abnormal differentiation due to calcium deficiency in this study. These differences indicate which chondrogenic genes are affected by calcium deficiency as well as elucidate some of the molecular factors involved in the development of the rickets condition. Furthermore, the results will help increase our understanding of normal growth plate differentiation.

However, it is unknown whether these genes are directly affected by calcium or whether a signal upstream is affected by the calcium deficiency and triggers changes in gene expression. In addition, it is not known if the level of protein corresponds to the mRNA levels seen in this study.

Marker genes: The RT-PCR results from this study are summarized in Table 4.1.

Collagen type II is a known marker of chondrocyte proliferation, and it was thought that this gene would be expressed significantly higher in rickets due to the extended proliferative zone characteristic of this condition (Castagnola et al., 1988). However, there were no differences seen between control and rickets growth plates (Fig. 3.5). This may be due to abnormal expression of collagen type II in the zone of proliferation in the rickets plate, or collagen II may not be expressed throughout the entire elongated zone.

Another possibility is that other zones in the rickets growth plate are somewhat extended due to the elongated proliferation zone, and thus type II collagen expression in rickets is proportional to the control plate. Although not obvious from the histology in this study, previous studies have reported that the hypertrophic zone of calcium-deficient rickets is also enlarged along with the proliferative zone (Long et al., 1984b). This would cause

56 the relative collagen type II expression in the rickets growth plate to be lower than expected due to the expression level of the housekeeper gene in the longer-than-expected hypertrophic zone.

Table 4.1. Summary of real-time PCR results: Gene expression in growth plates from broilers fed adequate and calcium-deficient diets. Gene Result P-value Type II collagen 1.2-fold lower in rickets 0.481 Type X collagen 2.2-fold lower in rickets 0.035* Alkaline phosphatase 4.3-fold lower in rickets 0.011*

PTHR 2.3-fold higher in rickets 0.024* PTHrP 1.8-fold higher in rickets 0.610 Ihh 1.7-fold lower in rickets 0.047* CaR 20-fold higher in rickets 0.038*

Bmp-2 4.2-fold lower in rickets 0.00005* Bmp-4 3.4-fold lower in rickets 0.042* Bmp-6 5.0-fold lower in rickets 0.001* Bmp-7 No difference 0.911 BmpR-1b 9.7-fold lower in rickets 0.025* BmpR-2 3.2-fold lower in rickets 0.004*

EEF-1δ 2.0-fold lower in rickets 0.068 Annexin-V 5.7-fold lower in rickets 0.001* Fibrillin 3.1-fold lower in rickets 0.015* * Denotes significant P-values.

Previous studies on growth plate cartilage from broiler chickens with TD have shown that these plates contain significantly more type X collagen (25% compared to

11%) than normal growth plates (Wardale et al., 1996). However, type X collagen analysis using growth plate cartilage from rachitic broiler growth plates has shown contradictory results. One study showed that type X collagen has a 10-fold increase in the relative proportion of type X collagen in rachitic compared to normal growth plates 57

(Reginato et al., 1988), while another indicated an 80% reduction in calcium-induced rickets (Kwan et al., 1989). Data from this research support the latter study, as type X collagen is expressed 2.2-fold higher in control growth plates compared to rickets (Fig.

3.5). This result is expected because elevated extracellular calcium has been shown to directly induce hypertrophy and type X collagen in culture (Bonen and Schmid, 1991).

Calcium may act both as a signaling molecule for type X collagen production, as well as provide the appropriate microenvironment for hypertrophy and the induction of collagen

X expression.

Alkaline phosphatase (ALP) in the bone is a membrane-bound enzyme that plays a role in extracellular hydroxyapatite mineralization, and its presence marks the onset of hypertrophy in chondrocytes (Althoff et al., 1982; Habuchi et al., 1985; Hui et al., 1997).

This enzyme dephosphorylates a number of molecules, and is rich in matrix vesicles, which bud from the plasma membranes of chondrocytes and are involved in mineralization (Ali, 1992; Anderson, 1995; Boskey, 1996). Alkaline phosphatase provides inorganic phosphate from various substrates for mineralization, hydrolyzes mineralization-inhibitor inorganic pyrophosphate (Meyer, 1984; Johnson et al., 1999), and plays a role in the bridging of matrix vesicles to matrix collagen (Hessle et al., 2002;

Mornet et al., 2001). The fact that this phosphatase was present 4.3-fold higher in control growth plates agrees with the type X collagen results, showing that genes involved in hypertrophy are present at higher levels in the control plates (Fig. 3.5). This indicates that rickets growth plates are not able to express these genes at the proper level, and could play a role in the delayed hypertrophy seen in this condition. Type X collagen, type II collagen, and ALP are genes known to be involved in chondrocyte differentiation and commonly used as markers for specific regions of the growth plate. The expression of type II collagen was not different between the two groups, although type X collagen

58 and ALP were expressed lower in rickets growth plates, and thus can be used as molecular indicators of the rickets condition in broilers.

In order to ensure that the differences in expression that were seen between the control and rickets growth plates were accurate and not due to differences in the length of the growth plate zones, various genes in this study were analyzed using proliferative and hypertrophic fractions of the growth plate (Fig. 3.6). Furthermore, comparing the expression patterns between the regions of the growth plate provided a clearer picture of the molecular differences between control and rickets plates. Type X collagen had an increased expression level in the hypertrophic region compared to the proliferative region of both rickets and control growth plates. This was expected, because this collagen is synthesized exclusively in the hypertrophic chondrocytes destined for mineralization

(Schmid and Linsenmayer, 1985). In addition, type X was found to be over 2-fold higher in the hypertrophic region of control plates compared to rickets, which was a strong trend and likely would have been significant with the addition of more samples. This 2-fold difference is similar to the 2.2-fold difference seen in the evaluation of the entire growth plates. This indicates that the extended proliferative region of the rickets growth plates did not affect the results, and that the difference in type X collagen expression was entirely due to differences in hypertrophic regions of the growth plate. The expression of type X collagen in the hypertrophic region and low expression in the proliferative region also confirms the accuracy of the growth plate fractions, which were used to compare other genes in this study. Some fractions of the growth plate likely had some contamination with cells from the other fraction, but this was minimal as indicated by the higher type X collagen in the hypertrophic region. Significant differences were not seen very often in this study between the proliferative and hypertrophic samples, but that is believed to be due to the sample size rather than lack of trends.

The Feedback loop: The various genes known to be involved in growth plate chondrocyte differentiation include PTHR-1, PTHrP, Ihh, and the Bmps and their receptors. A number of these genes show differences in expression between the control and rickets growth plates, indicating that they are affected by the calcium deficiency and may be involved in causing the abnormal differentiation characteristic of rickets (Fig.

3.7). The expression levels may also provide some indication of the signals that respond to the calcium deficiency and cause the delayed hypertrophy.

The expression of Ihh, PTHrP, and the PTHR-1 are known to be interrelated in the growth plate. The major roles of Ihh are to stimulate PTHrP expression and PTHrP- independent chondrocyte proliferation (Karp et al., 2000). The 1.7-fold decreased expression of Ihh in the rickets plates in this study indicates that Ihh expression is not the cause of the delayed maturation seen in these abnormal growth plates. The down- regulation of this gene in rickets may in fact reflect an attempt to allow cells to progress to the prehypertrophic stage.

Both PTHrP and PTHR-1 are involved in growth plate chondrocyte maturation by delaying terminal differentiation. PTHrP was not found to be different between control and rickets growth plate, although the mean for rachitic plates was increased 1.8-fold

(Fig. 3.7). The fact that there was no significant difference between control and rickets plates implies that a PTHrP-mediated mechanism is likely not responsible for the increased proliferation characteristics of rickets. The slightly higher mean value in rickets may reflect the longer distance that PTHrP must travel to reach PTHR-1 in the hypertrophic chondrocytes.

Control growth plate chondrocytes express PTHR-1 in the lower proliferative and upper hypertrophic zones and surrounding the blood vessels in the hypertrophic zone.

Previous studies using in-situ hybridization have shown that PTH/PTHrP receptor mRNA expression is undetectable in vitamin D-deficient rickets after 8 days post-hatch (Ben-

Bassat et al., 1999). Results from this study contradict this data, indicating that the

PTHR-1 was 2.3-fold higher in rickets growth plates compared to control (Fig. 3.7). The reason for this disparity is not clear, as the only apparent difference between the studies is that broilers in this study were fed a calcium-deficient diet as opposed to a vitamin-D deficient diet. Calcium and vitamin-D deficiency produce similar gross lesions in young chicks, as their metabolism is interrelated and both deficiencies result in hypocalcemia in the chicken (Long et al., 1984b,c.; Bisaz et al., 1975; Lacey and Huffer, 1982; Itakura et al., 1978).

The increase in PTHR-1 found in rickets may be due to decreased levels of

PTHrP reaching the receptor through the long proliferative zone, and the receptor increasing its expression to raise the chances of binding to PTHrP. Alternatively, PTHrP may be in part responsible for the elongated proliferative zone of rickets, as its increased expression functions to keep the cells in a proliferative state. The signaling mechanisms involved downstream of PTHrP and its receptor in the delay of chondrocyte maturation are unknown.

The calcium-sensing receptor (CaR) is expressed in both the proliferative and hypertrophic zones of the growth plate and is known to stimulate chondrocyte proliferation and hypertrophy. CaR requires calcium binding in order to initate the signaling pathways involved in chondrocyte maturation. Downstream signaling mechanisms of CaR include activation of phospholipase C, mobilization of intracellular calcium, inhibition of cAMP formation, and cation influx (Chang et al., 1998; Kifor et al.,

1997; Brown, 1991). The effect of this pathway is thought to be due to increased calcium influx into the cells and thus an increase in the intracellular calcium level (Wu et al.,

2004). However, the exact role of CaR in chondrogenesis is unknown. One proposed role for this protein is as the signal to proceed from the proliferative stage to the later stages of differentiation.

In this study CaR was found to be almost 20-fold higher in the rachitic growth plates compared to control (Fig. 3.7). This dramatic increase in expression indicates that this sensor may not be the signal for maturation, as chondrocyte hypertrophy and mineralization are delayed in the rickets growth plate. Perhaps a more likely option is that CaR is upregulated in an attempt to promote cell maturation. Previous studies have shown that activation of CaR signaling pathways promote chondrocyte maturation, and this gene may be upregulated in rickets to increase the likelihood of binding calcium and promoting calcium uptake and later stages in differentiation. This is the first study to show that the expression of the calcium receptor is affected by changes in calcium concentration in an in vivo model.

The Bmps: As their various levels of expression and localizations in the growth plate would suggest, the Bmps have assorted functions in the growth plate, although they do exhibit some functional redundancy. The presence of Bmp antagonist Noggin results in the inhibition of bone growth, chondrocyte proliferation, and chondrocyte hypertrophy, suggesting a stimulatory role for the Bmps on chondrogenesis (De Luca et al., 2001).

Three of the four Bmps and both BmpRs analyzed in this study exhibited a higher expression in control plates compared to rickets, indicating a possible molecular mechanism for the impaired chondrogenesis seen in rickets (Fig. 3.8). The various implications for each Bmp gene are discussed below.

Bmp-2, Bmp-4, and Bmp-7 are expressed in the perichondrium, which is a layer of cells surrounding the growth plate involved in regulating cartilage differentiation

(Kingsley, 1994; Zou et al., 1997; Pathi et al., 1999). Bmp-7 has also been shown to be expressed in the proliferating chondrocytes (Haaijman et al., 2000). Bmp-6 is expressed in the prehypertrophic and hypertrophic chondrocytes, thus having overlapping expression patterns with Ihh. Both BmpR-1B and BmpR-2 are expressed in the

62 perichondrium, and BmpR-2 is also expressed in prehypertrophic chondrocytes (Zou et al., 1997; Yi et al., 2000; Haaijman et al., 2000).

The major functions of Bmp-2 in the growth plate are to stimulate chondrocyte proliferation and hypertrophy (Yazaki et al., 1998; DeLuca et al., 2001). This Bmp may affect chondrogenesis directly or indirectly through other paracrine factors in the growth plate. In this study, Bmp-2 was found approximately 4.2-fold higher in control growth plates, likely promoting normal chondrocyte maturation in control plates and contributing to the abnormal maturation in rickets (Fig. 3.8). This Bmp was also expressed at least 6- fold higher in the control hypertrophic zone compared to the control proliferative zone and both rickets zones (Fig 3.6). This suggests that Bmp-2 is able to promote proliferation in both groups, but is only able to promote hypertrophy in the control group.

Bmp-2 expression may be directly affected by the low calcium concentrations or may receive an upstream signal that calcium levels are too low to promote hypertrophy.

Bmp-4 promotes chondrocyte proliferation and hypertrophy (Shum et al., 2003), and may have a similar role to Bmp-2 in the growth plate. Bmp-6 stimulates hypertrophy, although does not significantly affect proliferation in chick epiphyseal chondrocytes (Mayer et al., 1996). This gene was decreased in rickets compared to control growth plates, and was expressed at least 5-fold higher in the control hypertrophic zone compared to the other three groups (Fig. 3.6). This is in agreement with the previous data showing that Bmp-6 is involved in hypertrophy, and its low expression in the rachitic plate indicates this gene may have a role in preventing the proliferative and pre-hypertrophic cells from undergoing hypertrophy in the absence of adequate calcium.

Bmp-7 inhibits the initiation of chondrocyte differentiation in vitro, although it also has the ability to promote bone formation and induce hypertrophy (Haaijman et al.,

1997’ Reddi, 1992; Rosen and Thies, 1992). The localization of Bmp-7 to the proliferating chondrocytes as well as the perichondrium may reflect the dual role of this

63 gene in chondrocyte maturation. Bmp-7 was not expressed differently in control and rickets plates, which may be due to its involvement in delaying maturation. Bmp-7 was not expressed lower in the rickets plate as other Bmps were in this study, implying that

Bmp-7 may be involved in keeping the cells in the proliferative state. This is supported by the fact that this gene is higher in the proliferative zone of rickets but the hypertrophic zone of control plates.

The different effects of the Bmps on the growth plate are also affected by the existence of multiple Bmp receptors, which have distinct roles in chondrogenesis. These receptors exhibit various spatial expression patterns throughout the growth plate and bind to the various Bmps with differing affinities (Liu et al., 1995; ten Dijke et al., 1994;

Nishitoh et al., 1996). Constitutive expression of BmpR-1b promotes chondrogenesis, and a truncated version of this gene results in inhibition of bone matrix formation

(Kawakami, 1996; Zou et al., 1997; Enomoto-Iwamoto et al., 1998; Chen et al., 1998).

The decreased expression of both BmpR-Ib and BmpR-2 in the rickets growth plate indicates that these receptors likely act in concert with the Bmps in contributing to the abnormal differentiation of rickets.

Proposed rachitic model: There are a number of observations that the patterns of gene expression are interrelated in the growth plate. Bmp-4 and Bmp-2 signaling act in parallel with Ihh independent of PTHrP to promote normal chondrocyte proliferation during postnatal limb development, which is supported by the observation in this study that Bmps and Ihh were downregulated in the rachitic growth plates (Johnson and Tabin,

1995; Venkatesh et al., 2001). Bmp-2 down-regulates PTHrP and PTHR-1 expression in cultured chondrocytes, which may explain the stimulatory effect of Bmp-2 on chondrocyte differentiation as PTHrP and PTHR-1 inhibit hypertrophy (Terkeltaub et al.,

1998; Shukunami et al., 1998; Vortkamp et al., 1996). Results from this study support

64 this observation, as control growth plates demonstrated a higher Bmp-2 expression level, lower PTHR-1 expression, and a lower mean value for PTHrP. In addition, CaR promotes the inhibition of cAMP, which is a signaling mechanism for the Bmps, and CaR and the Bmps exhibit opposite expression patterns in the control and rickets plates.

Based on data from this and previous studies, a model can be proposed for the role of these genes in chondrocyte maturation in the rachitic chicken (Fig. 4.1). In the control chicken, the natural expression levels of the Bmps and Ihh promote normal chondrocyte proliferation. PTHrP diffuses through the proliferation zone and acts with

PTHR-1 to keep cells in the proliferating state. These cells are eventually moved out of reach of PTHrP and start the maturation process by expressing Ihh in the prehypertrophic chondrocytes. In contrast, levels of Ihh and Bmps are downregulated in the rachitic model, either affected directly or indirectly by the low calcium level. These lower expressions of Ihh and Bmp do not promote proliferation at the same level as in normal plates, and Ihh would not increase the expression of PTHrP to the same level. PTHrP attempts to promote proliferation and travels through the zone of proliferation to reach the up-regulated PTHR-1. PTHR-1 could be upregulated due to a lack of activation by

PTHrP or may be the mechanism responsible for the increased proliferation in rickets.

CaR acts as a detector of calcium levels in the cells, and its upregulation in rickets may reflect an attempt to bind and take up more calcium, resulting in downstream signaling for maturation.

Figure 4.1. Proposed model for the involvement of the chondrogenic genes in the development of rickets. Arrow intensity represents relative increases or decreases in expression between control and rickets growth plates seen in this study. Schematic is discussed in text.

4.3 Validation of microarray expression data

The microarray data were validated using independent methods, and both established and novel genes were selected for analysis of gene expression using RT-PCR.

Three of the four genes analyzed showed expression patterns consistent with the microarray data, while one gene showed a trend opposite of the microarray and was not significant between control and rickets growth plates (Fig. 3.9). Possible reasons for the disparity may include molecular variations in the original growth plates sampled and the small number of samples used in the microarray. A microarray of control and rickets growth plates may provide more accurate results by analyzing additional growth plate chondrocyte samples. Furthermore, the genes known to be involved in growth plate

66 maturation discussed above were not detected as being significantly different by the microarray, indicating that the microarray is useful but should not be thought of as conclusive. Although the microarray did provide some indication of genes that are expressed differently between control and rickets, the data require confirmation by RT-

PCR as indicated by the results of this study.

Type X collagen expression levels have been discussed earlier, and were in agreement with the microarray data (Fig. 3.5). Eukaryotic translation elongation factor-1δ

(EEF-1δ) had a significant difference in mRNA expression based on the microarray data, which showed that this gene was expressed higher in rickets than control. However, RT-

PCR did not confirm this conclusion, and in fact showed a 2-fold higher value for control plates, which was not significant but did indicate a trend towards being expressed lower in rachitic plates (Fig. 3.9). No difference was seen between the proliferative and hypertrophic zones (Fig. 3.6). Although EEF-1δ is not typically used as a marker for protein synthesis, it is reasonable to assume that EEF-1δ expression levels reflect changes in translational activity in the growth plate. The maturation of growth plate cartilage includes a phase of rapid maturation and intense matrix protein synthesis followed by hypertrophy and growth arrest. Although no previous data could be found, it seems likely that protein synthesis would be higher in the proliferation and prehypertrophic zones and lower in the zones of hypertrophy and mineralization. The lower expression of

EEF-1δ in rachitic plates may reflect a decreased synthesis of matrix proteins for mineralization in these calcium-deficient plates. These data are also in agreement with a previous study, which showed that the synthetic activity in the proliferating zone of rachitic growth plates was reduced compared to control plates (Brighton and Hunt, 1978). The previous microarray showed that annexin V was expressed higher in control growth plates compared to rickets, and quantitative RT-PCR data from this study confirmed these data. Annexin V mRNA expression was 5.7-fold higher in control plates and showed

67 a trend of being highest in control hypertrophic chondrocytes (Fig. 3.9). This protein is likely a calcium channel that is involved in mineralization. This indicates that annexin V may be able to sense and respond to calcium concentrations in the chondrocytes, either directly or indirectly through an unknown signaling mechanism. The presence of annexin V at higher concentrations in control plates may reflect the increased need for matrix vesicles to take up calcium at the higher calcium concentrations seen in control plates compared to the lower calcium seen in rickets. The expression of annexin V was also higher in the proliferative region of control compared to the same region of rickets, implying that the response of annexin V to calcium may start in the proliferative region and continue into the hypertrophic region (Fig. 3.6). It is somewhat surprising that annexin V expression was not higher in the rickets growth plates, demonstrating an increased attempt to take up calcium into matrix vesicles under low calcium conditions. However, the fact that annexin V mRNA increases in response to calcium in order to uptake more of this mineral for mineralization may indicate a signaling role for this molecule. Higher expression levels may indicate to other extracellular matrix factors that calcium levels are suitable and the chondrocytes can enter the hypertrophic and mineralization stages. Although annexin V has known interactions with calcium, this is the first study to show a direct response of mRNA expression to calcium concentration.

The RT-PCR data confirmed the microarray data for fibrillin-1, showing that its mRNA expression was over 3-fold higher in control growth plates (Fig. 3.9). This indicates that fibrillin-1 is able to respond to changes in calcium concentration in the growth plate. No significant difference was seen between the proliferative and hypertrophic zones in both types of plates, although the mean for the proliferative region was at least 3-fold higher in both rickets and control (Fig. 3.6). Fibrillin-1 may contribute to the variations in composition of the extracellular matrix between control and rickets growth plates, and it is possible that this protein helps provide the proper environment for hypertrophy and mineralization. A higher expression level in the zone of proliferation may reflect a role for this calcium-binding protein in the onset of calcium accumulation and mineralization in the

68 matrix. Although it has been recognized that this is a calcium-binding protein, it was not known that fibrillin-1 mRNA responds to changes in calcium concentration.

4.4 ATP assay

The precise role of ATP in growth plate maturation remains ambiguous.

However, this energy molecule is known to play roles in calcium metabolism and the mineralization process in osteoblasts. On the contrary, ATP at physiological concentrations has also been shown to inhibit bone formation. The addition of ascorbic acid, an inducer of differentiation, to osteoblasts results in a 3-4-fold increase in mitochodrial ATP production and a 5-fold increase in cellular ATP content (Komarovae et al., 2000). This implies that ATP production increases during differentiation, possibly escalating the cytosolic calcium content and promoting differentiation. Although not demonstrated in chondrocytes, ATP can be cytotoxic and its concentration may have a role in the apoptosis of maturing chondrocytes that results in bone formation.

Previous studies have shown that although there is expansion of the growth plate in rickets, the number of cells or DNA per unit volume of the cartilage is the same as in normal plates (Brighton and Hunt, 1974). This is in agreement with the results from this study, which showed that there was no significant difference in DNA concentration between control and rickets plates. The ATP concentration in rickets growth plate chondrocytes showed a trend of being higher compared to control cells (Fig. 3.10). This implies that ATP production may not have been impaired by the lower calcium concentrations in the rickets cells, and it is possible that ATP production was a priority for the cell rather than calcium accumulation. In addition, the increased ATP seen in rickets cells may have demonstrated an attempt at increasing the cytosolic calcium

69 concentration, as ATP has been shown to increase calcium mobilization (Kumagai et al.,

1989). The different lengths of the growth plate zones was not believed to affect the ATP assay data, as DNA concentration and the RT-PCR data from the whole growth plate revealed consistent results. In addition, ATP is found to be higher in the proliferating and prehypertrophic zones in comparison to the hypertrophic and mineralization zones

(Shapiro et al., 1983).

Increasing intracellular calcium concentration has positive effects on mineralization, as calcium concentration has been shown to increase matrix vesicle formation (Rosier, 1984). Matrix vesicles, which originate from chondrocytes, have a 2- fold increase in concentration from the proliferative to the prehypertrophic zone. These vesicles contain 20-50-times higher concentrations of calcium than adjacent chondrocytes. Matrix vesicles from the zone of hypertrophy contained twice as much calcium as from the zone of proliferation, indicating that calcium is concentrated in matrix vesicles during formation but mineral uptake continues in the matrix (Wuthier,

1977). Mitochondria are able to accumulate and concentrate calcium, and mitochondrial calcium concentration is highest in the resting zone, then decreases in the proliferative zone, increases in the prehypertrophic zone, and decreases in the lower hypertrophic zone

(Brighton and Hunt, 1976, 1978). In the normal growth plate, matrix calcification begins when the mitochondria begin to lose calcium. In the rickets growth plate, the mitochondrion does not lose calcium until the cells reach the lower hypertrophic zone, where calcification then occurs (Brighton and Hunt, 1978).

Based on these data, it is possible that the ATP level in the normal growth plate causes the chondrocytes to release calcium from intracellular pools, including the mitochondria. The increase in cytosolic calcium would then result in an increased number of matrix vesicles being released into the extracellular matrix, promoting normal mineralization. During the calcium deficiency of rickets, the increased level of ATP may

70 demonstrate an increased, unsuccessful attempt for the cell to mobilize intracellular calcium for matrix vesicles. Due to the lower concentration of ATP in the hypertrophic zone and the observation that ATP inhibits bone formation, it is unlikely that ATP plays a role in chondrocyte apoptosis and the later stages of differentiation.

4.5 Cell culture There were a number of problems encountered when trying to culture growth plate chondrocytes from 18 to 21-day old broilers in monolayer. The original protocol that was followed for cell digestion and plating was obtained from Colin Farquharson of the Roslin Institute, and this protocol had success in allowing the cells to attach to the plate. In culture, cells attach to the plate and proliferate, and after the cells reach confluence they undergo differentiation. Cells usually attached within 24 hours of plating and were visually assessed for confluence daily. After 24 hours, cells generally attached at 60-70% confluence, and leaving the cells to attach for over 24 hours did not increase in confluence to more than 70 or 80%, even when left to proliferate in culture for over a week (Fig. 3.11). This percent confluence is normal for chondrocyte attachment, although cells typically should reach confluence within a week of plating. This implies that the conditions were appropriate for attachment, but the conditions were not optimal for chondrocyte proliferation in this study. The culture conditions were varied throughout this study in an attempt to promote proliferation of the chondrocytes. One factor that was varied was trypsanizing the cells following attachment. Most protocols involve trypsanizing and re-plating the cells following attachment, allowing only the viable cells to be transferred to a new plate as a second generation and used for analysis. In the current study, primary and secondary chondrocyte cultures were utilized, although no differences in proliferation were observed based on confluence level. Using secondary cultures did promote a fibroblast phenotype, while using the primary cultures resulted in a more rounded, chondrocyte phenotype. Another factor that was varied was the presence or absence of ascorbic acid in the culture. The addition of ascorbic acid has been shown to promote differentiation in the culture, and

71 adding this vitamin to the media at 24 hours did not facilitate proliferation of the chondrocytes (Kivirikko and Myllyla, 1987; Pacifici and Iozzo, 1988). Other attempts at stimulating cell proliferation included using collagen-coated plates, varying the concentration of plated cells, using trypsin in the digestion solution, the presence or absence of fungigen (an anti-fungal solution), and varying the well sizes. One of the major problems encountered throughout the course of the cell culture experiments was contamination of the cultures. Both bacterial and fungal contamination were observed in the cultures, and usually appeared during the second week after plating. This contamination can reach high densities and alter the growth, morphology, metabolism, and other characteristics of the cultures, making any experimental results unreliable. The contamination in this study was thought to have originated from the poultry barn while taking the growth plate samples; however, it may have come from another source based on the inconsistency of the contamination in the culture samples. Other possible sources of contamination include the media used for culture, the lab hood, nonsterile supplies, or the incubator. Cells from rickets and control plates were digested and plated in two separate mixtures, and if the contamination originated from the farm or the media, all the plates from one mixture would be expected to be infected. There is a possibility that some contaminants remained undetected throughout the study, and one factor that may have contributed to this is dilution of the impurities when the media was changed. In addition, although some biological contaminants are easy to detect such as bacteria and yeast, others are more difficult to detect, such as viruses, protozoa, and mycoplasmas. The presence of an undetected biological contaminant may have affected the proliferation of the chondrocytes and caused the lack of confluence in the cultures. The use of penicillin-streptomycin and fungigen in the culture media did not prevent contamination of the cells, implying that the biological impurities were resistant to these antibiotics. Calcium was gradually accumulated in cultures that contained 1.8 mM calcium and did not accumulate in the 0 mM calcium cultures, as indicated by the alizarin red staining. This indicates that the cultures may have been able to differentiate to some degree even though they were not confluent, because chondrocytes accumulate calcium as they progress

72 through the stages of differentiation. Because there was no difference in alizarin red staining between the control and rickets growth plate cultures, it is possible that the chondrocytes dedifferentiate after being plated. The calcium-deficient rickets cells may be expected to have a different pattern of calcium uptake due to their altered calcium metabolism, or alternatively it is possible that these cells can adjust well to the higher calcium concentrations. Type X collagen is a known marker of chondrocyte hypertrophy and maturation and has been shown to progressively increase in culture over a period of 3-4 weeks (Castagnola et al., 1988). Certain substances, such as calcium chloride, have been shown to induce differentiation and increase the expression of type X collagen in culture (Bonen and Schmid, 1991; Chang et al., 2002). Thus, the chondrocyte cultures with 1.8 mM calcium would be expected to undergo terminal differentiation earlier than cultures containing 0 mM calcium, if the latter cultures are even able to differentiate without calcium. The type X collagen data from culture did show gradual increases in expression from day 16 to day 22, although no obvious differences between 0 and 1.8 mM calcium cultures were seen (Fig. 3.12). In addition, no apparent differences between cells from control or rickets growth plates were seen. This is somewhat surprising because primary cultures are likely to maintain their original phenotype, and rickets cells displayed symptoms of calcium deficiency and abnormal differentiation in the chicken. However, this data may be unreliable for a number of reasons. Only one set of mRNA values could be obtained and only from the first 24 hours and last 3 days in culture; using more samples may have reduced some of the variability seen. In addition, cells throughout this sampling period were only at 70% confluence, which may have prevented them from having cell-cell interactions and undergoing normal differentiation. Thirdly, although no contamination was seen in this particular trial, it is possible that some undetected biological impurities were present and affected the chondrocytes, as contamination was a common problem in this study.

4.6 Future work In many aspects, this study was a pilot study concerning the molecular etiology of rickets and the effect of low calcium on chondrocyte maturation in an in vivo model. There is a paucity of data in the literature concerning the rickets condition, which requires recognition due to the economic and welfare concerns of leg weakness in broilers as well as being an ideal disease model to study the effect of calcium on chondrocyte maturation. This study identified genes that showed variations in expression between control and rickets growth plates based on known chondrogenic genes and previous microarray data. Although the difference in calcium concentration was the only change between the two groups, it is not known if the calcium levels affected the genes directly or if there was a signalling pathway involved that resulted in the changes in gene expression. Investigation of some of the known signalling mechanisms for calcium, the Bmps, and ATP will help elucidate the factors involved in calcium-mediated changes in gene expression. Analysis of ATP in the various zones of the rickets and control growth plates as well as the effect of ATP on matrix vesicle formation is also of interest to clarify the role of ATP in chondrocyte maturation. In addition, the microarray results showed that many of the genes that had significant differences between control and rickets were unknown, and their function may help explicate the molecular mechanisms of growth plate maturation. Additionally, an in vitro model of growth plate maturation would be helpful to study the effects of calcium on chondrocyte maturation, and the development of an epiphyseal growth plate cell culture model is an ideal system. The identification and removal of the biological or chemical impurity that was present in the cultures in this study is crucial to developing this valuable model.

LIST OF REFERENCES

Adams, S.L., Pallante, K.M., Niu, Z., Leboy, P.S., Golden, E.B., and Pacifici, M. (1991). Rapid induction of type X collagen gene expression in cultured chick vertebral chondrocytes. Exp. Cell Res. 193: 190-197.

Ali, S. Y. (1992) in Bone Biology and Skeletal Disorders (Whitehead, C. C., ed) pp. 19-38, Carfax/Abingdon, London.

Ali, S. Y., Evans, L. (1973) The uptake of [Ca]calcium ions by matrix vesicles isolated from calcifying cartilage (Short Communication). Biochem. J. 134, 647-650.

Althoff, J., Quint, P., Krefting, E.R., and Hohling, H.J. (1982). Morphological studies on the epiphyseal growth plate combined with biochemical and X-ray microprobe analyses. Histochem. Cell Biol. 74, 541-552.

Amling, M., Priemel, M., Holzmann, T., Chapin, K., Rueger, J.M., Baron, R., Demay, M.B. (1999). Rescue of the skeletal phenotype of vitamin D-receptor ablated mice in the setting of normal mineral ion homeostasis: formal histomorphometric and biomechanical analyses. Endocrinology 140: 4982-4987.

Anderson, H.C. (2003). Matrix vesicles and calcification. Curr. Rhematol. Rep. 5: 222-226.

Anderson, H. C. (1995) Molecular biology of matrix vesicles. Clin. Orthop. Relat. Res. 314, 266- 280.

Anderson, H.C. (1989) Biology of disease. Mechanism of mineral formation in bone. Lab. Invest. 60, 320-33.

Ballock, R.T., and O’Keefe, R.J. (2003). The biology of the growth plate. J. Bone Joint Surg. Am. 85: 715-726.

Bar, A., Shinder, D., Yosefi, S., Vax, E., and Plavnik, I. (2003). Metabolism and requirements for calcium and phosphorus in the fast-growing chicken as affected by age. Br. J. of Nutr. 89, 51-61.

Barry, V.A., and Cheek, T.R. (1994) Extracellular ATP triggers two functionally distinct calcium signaling pathways in PC12 cells. J. Cell Sci. 107, 451-462.

Becks, H., Simpson, M.E., and Evans, H.M. (1945). Ossification at the proximal tibial epiphysis in the rat. I. Changes in females with increasing age. Anatomy Rec. 92, 109-119.

Benya, P.D., Brown, P.D., and Padilla, S.R. (1988). Microfilament modification by dihydrocytochalasin B causes retinoic acid-modulated chondrocytes to reexpress the differentiated collagen phenotype without a change in shape. J. Cell Biol. 106, 161-170.

Benya P.D., Brown P.D. Modulation of the chondrocyte phenotype in vitro. In: Kuettner KE, Schleyerbach R, Hascall VC, ed. Articular Cartilage Biochemistry. New York: Raven Press, 1986, 219–33.

Benya, P.D. and Shaffer, J.D. (1982). Dedifferentiated chondrocytes reexpress the differentiated collagen phenotype when cultured in agarose gels. Cell 30, 215-224.

Benya, P. D., Brown, P. D., and Padilla, S. R. (1988). Microfilament modification by dihydrocytochalasin B causes retinoic acid-modulated chondrocytes to reexpress the differentiated collagen phenotype without a change in shape. J. Cell Biol. 106, 161-170.

Bergstrom, W.H. (1998). When you see rickets, consider calcium deficiency. J. Pediatr. 133: 722-724.

Bisaz, S., Schenk, R., Kunin, A.S., Rassel, R.G.G., Mahlbauer, R., and Fleisch, H. (1975). The comparative effect of vitamin D deficiency and ethane-1-hydroxyl-l, 1-diphosphonate administration on the histology and glycolysis of chick epiphyseal and articular cartilage. Calcif. Tissue Res. 19, 139-152.

Bitgood, M.J., and McMahon, A.P. (1995). Hedgehog and BMP genes are coexpressed at many diverse sites of cell-cell interaction in the mouse embryo. Dev. Biol. 172, 126-138.

Bohme, K., Conscience-Egli, M., Tschan, T., Winterhalter, K.H., and Bruckner, P. (1992). Induction of proliferation or hypertrophy of chondrocytes in serum-free culture: the role of insulin-like growth factor-I, insulin, or thyroxine. J. Cell Biol. 116: 1035-1042.

Bonaventure, J., Kadhom, N., Cohen-Solal, L., Ng, K.H., Bourguignon, J., and Lasselin, C. (1994). Reexpression of cartilage-specific genes by dedifferentiated human articular chondrocytes cultured in alginate beads. Exp. Cell Res. 212, 97-104.

Bonen, D.K, and Schmid, T.M. (1991). Elevated extracellular calcium concentrations induce type X collagen synthesis in chondrocyte cultures. J. Cell Biol. 115: 1171-1178.

Boskey, A. L. (1996) Matrix proteins and mineralization: an overview. Connect. Tissue Res. 35, 357-36.

Boskey, A.L. (1992). Mineral-matrix interactions in bone and cartilage. Clin. Ortho. Relat. R. 281: 244-274.

Boskey, A.L., Stiner, D., Leboy, P., Doty, S., and Binderman, I. (1992). Optimal conditions for cartilage calcification in differentiating chick limb-bud mesenchymal cells. J. Bone Miner. Res. 16, 11-37.

Boyan, B.D., Sylvia, V.L., Dean, D.D., and Schwarz, Z. (2001). 24,25-OH(2)D(3) regulates cartilage and bone via autocrine and endocrine mechanisms. Steroids 66, 363-374.

Brighton, C.T., and Hunt, R.M. (1978) Electron microscopic pyroantimonate studies of matrix vesicles and mitochondria in the rachitic growth plate. Metab. Bone Dis. Rel. R. 1, 1999-204.

Brighton, C.T., and Hunt, R.M. (1976). Histochemical localization of calcium in growth plate mitochondria and matrix vesicles. Fed. Proc. 35, 143-147.

Brighton, C.T. (1978). Structure and function of the growth plate. Clin. Orthop. Relat. R. 136, 22-32.

Brighton, C.T., and Hunt, R.M. (1974) Mitochondrial calcium and its role in calcification. Histochemical localization of calcium in electron micrographs of the epiphyseal growth plate with K-pyroantimonate. Clin. Orthop. Relat. R. 100, 406-416.

Brister, R. (2004). United States broiler nutritional strategies. Arkansas Nutrition Conference, Springdale, AR.

Bronner, F., and Pansu, D. (1999). Nutritional aspects of calcium absorption. J.Nutr. 129, 9-12.

Brown, E.M. (1991) Extracellular Ca2+ sensing, regulation of parathyroid cell function, and role of Ca2+ and other ions as extracellular (first) messengers. Physiol. Rev. 71, 371–41.

Brunet, L.J., McMahon, J.A., McMahon, A.P., and Harland, R.M. (1998). Noggin, cartilage morphogenesis, and joint formation in the mammalian skeleton. Science 280, 1455-1457.

Burnstock, G. (1997) The past, present and future of purine nucleotides as signaling molecules. Neuropharmacology 36, 1127–1139.

Buyse, J., Michels, H., Vloeberghs, P., Saevels, J.M., Aerts, B., Ducro, D., Berckmans, and Decuypere, E. (1998). Energy and protein metabolism between 3 and 6 weeks of age of male broiler chickens selected for growth rate or for improved food efficiency. Br. Poult. Sci. 39, 264-272.

Candia, A.F., Hu, J., Crosby, J., Lalley, P.A., Noden, D., Nadeau, J.H., and Wright, C.V.E. (1992) Mox-1 and Mox-2 define a novel homeobox gene subfamily and are differentially expressed during early mesodermal patterning in mouse embryos. Development 116, 1123- 1136.

Capasso, O, Gionti, E., Pontarelli, G., Ambesi-Impiombato, F.S., Nitsch, L., Tajana, G., and Cancedda, R. (1982). The culture of chick embryo chondrocytes and the control of their differentiated functions in vitro. I. Characterization of the chondrocyte-specific phenotypes. Exp. Cell Res. 142, 197-206.

Castagnola, P., Dozin, B., Moro, G., and Cancedda, R. (1988). Changes in the expression of collagen genes show two stages in chondrocyte differentiation in vitro. J. Cell Biol. 106, 461-467.

Chang, W., Tu, C., Pratt, S., Chen, T.H., and Shoback, D. (2002). Extracellular Ca(2+)-sensing receptors modulate matrix production and mineralization in chondrogenic RCJ3.1C5.18 cells. Endocrinology 143: 1467-1474.

Chang, W, Tu, C., Bajra, R., Komuves, L., Miller, S., Strewler, G., and Shoback, D. (1999). Calcium sensing in cultured chondrogenic RCJ3.1C5.18 cells. Endocrinology 140: 1911- 1919.

Chang, W., Tu, C., Chen, T.H., Komuves, L, Oda, Y., Pratt, S.A., Miller, S., and Shoback, D. (1999). Expression and signal transduction of calcium-sensing receptors in cartilage and bone. Endocrinology 140: 5883-5893.

Chang, W., Tu, C., Pratt, S., Chen, T., and Shoback, D. (2002). Extracellular Ca(2+) sensing receptors modulate matrix production and mineralization in chondrogenic RCJ3.1C5.18 cells. Endocrinology 143: 1467-1474.

Chang, W., Pratt, S., Chen, T-H., Nemeth, E., Huang, Z., and Shoback, D. (1998) Coupling of calcium receptors to inositol phosphate and cyclic AMP generation in mammalian cells and Xenopus laevis oocytes and immunodetection of receptor protein by region-specific antipeptide antisera. J. Bone Miner. Res. 13, 570–580.

Chen, D., Ji, X., Harris, M. A., Feng, J. Q., Karsenty, G., Celeste, A. J., Rosen, V., Mundy, G. R. and Harris, S. E. (1998). Differential roles for Bone Morphogenetic Protein (BMP) Receptor type IB and IA in differentiation and specification of mesenchymal precursor cells to osteoblast and adipocyte lineages. J. Cell Biol. 142, 295-305.

Chen, Q., Linsenmayer, C., Gu, H., Schmid, T.M., and Linsenmayer, T.F. (1992) Domains of type X collagen: alteration of cartilage matrix by fibril association and proteoglycan accumulation. J. Cell Biol. 117, 687-69.

Clark, S.A., Boass, A, and Toverud, S.U. (1987). Effects of high dietary contents of calcium and phosphorus on mineral metabolism and growth of vitamin D-deficient suckling and weaned rats. Bone Mineralization 2: 257-270.

Classen, H.L., Annett, C.B., Schwean-Lardner, K.V., Gonda, R., and Derow, D. (2004). The effects of lighting programs with twelve hour of darkness per day provided in one, six, or twelve hour intervals on the productivity and health of broiler chickens. Br. J. Poult. Sci. 24, S31-S32.

Coleman, D.T., Fitzpatrick, L.A., and Bilezikian, J.P. (1994). Biochemical mechanisms of parathyroid hormone action. In: Bilezkian JP, Marcus R, Levine MA, eds. The parathyroids basic and clinical concepts. New York: Raven Press; 240-241.

Cook, M.E. (2000). Skeletal deformities and their causes: introduction. Poult. Sci. 79, 982-984.

Cook, M.E., Patterson, P.H., and Sundle, M.L. (1984). Leg deformities: inability to increase severity by increasing body weight of chicks and poults. Poult. Sci. 63, 620-627.

Coto, C., Yan, F., Cerrate, S., Wang, Z., Sacakli, P., Waldroup, P.W., Halley, J.T., Wiernusz, C.J., and Martinez, A. (2008). Effects of dietary levels of calcium and nonphytate phosphorus in broiler starter diets on live performance, bone development and growth plate conditions in male chicks fed a wheat based diet. Int. J. Poult. Sci. 7, 101-109.

De Luca, F., Barnes, K. M., Uyeda, J. A., De-Levi, S., Abad, V., Palese, T., Mericq, V., and Baron, J. (2001). Regulation of growth plate chondrogenesis by bone morphogenetic protein- 2. Endocrinology 142, 430–436.

Denton R.M., McCormack J.G., and Edgell, N.J. (1980) Role of calcium ions in the regulation of intramitochondrial metabolism. Effects of Na+, Mg2+ and ruthenium red on the Ca2+- stimulated oxidation of oxoglutarate and on pyruvate dehydrogenase activity in intact rat heart mitochondria. Biochem. J. 190, 107–117.

Desplan, C., Theis, J., and O’Farrell, P.H. (1988) The sequence specificity of homeodomain- DNA interaction. Cell 54, 1081–1090.

Dozier, W.A. III, Kidd, M.T., Corzo, A., Anderson, J., and Branton, S.L. (2006). Growth performance, meat yield, and economic responses of broilers provided diets varying in amino acid density from thirty-six to fifty-nine days of age. J. Appl. Poult. Res. 15: 383-393.

ECACC [European Collection of Cell Cultures]. (2008). Fundamental Techniques in Cell Culture: A Laboratory Handbook. Sigma-Aldrich.

Echelard, Y., Epstein, D.J., St-Jacques, B., Shen, L., Mohler, J., McMahon, J.A., and McMahon, A.P. (1993). Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 75, 1417-1430.

Edwards, H.M. Jr. (1960). Effects of proteins, energy, and fat content of the ration on calcium utilization. Poult. Sci. 39, 1380-1394.

Edwards, H.M., Jr., and Veltmann, J.R., Jr. (1983). The role of calcium and phosphorus in the etiology of tibial dyschondroplasia in young chicks. J. Nutr. 113, 1568-1575.

Elima, K., and Vuorio, E. (1989). Expression of mRNAs for collagens and other matrix components in dedifferentiating and redifferentiating human chondrocytes in culture. FEBS Letters 258, 195-198.

Engfeldt, B. (1969). Studies on the epiphyseal growth zone. Electron microscopic studies on the normal epiphyseal growth zone. Acta. Pathol. Microbiol. Scandinavica 75, 201-219

Enomoto-Iwamoto, M., Iwamoto, M., Mukudai, Y., Kawakami, Y., Nohno, T., Higuchi, Y., Takemoto, S., Ohuchi, H., Noji, S. and Kurisu, K. (1998). Bone Morphogenetic Protein signaling is required for maintenance of the differentiated phenotype, control of proliferation, and hypertrophy in chondrocytes. J. Cell Biol. 140, 409-418.

Erlebacker, A, Filvaroff, E.H., Gitelman, S.E., and Derynck, R. (1995). Toward a molecular understanding of skeletal development. Cell 80: 271-278.

Even, L., Weisman, Y., Goldray, D., and Hochberg, Z. (1996). Selective modulation by vitamin D of renal response to parathyroid hormone: a study in calcitriol-resistant rickets. J. Clin. Endocr. Metab. 81, 2836-2840.

Gagnemo-Persson, R., Samuelsson, A., Hakanson, R., and Persson, P. (1997). Chicken parathyroid hormone gene expression in response to gastrin, omeprazole, ergocalciferol, and restricted food intake. Cacif. Tissue Int. 61, 210-215.

Garner, J.P., Falcone, C., Wakenell, P., Martin, M., and Mench, J.A. (2002). Reliability and validity of a modified gait scoring system and is use in assessing tibial dyschondroplasia in broilers. Br. J. Poult. Sci. 43, 355-363.

Garner, S.C., Pi, M., Tu, Q., Quarles, L.D. (2001). Rickets in cation-sensing receptor-deficient mice: an unexpected skeletal phenotype. Endocrinology 142: 3996-4005.

Gibson, G. Active role of chondrocyte apoptosis in endochondral ossification. Microsc. Res. Techniq. 43, 174-190.

Gibson, G.J., Bearman, C.H., and Flint, M.H. (1986) The immunoperoxidase localization of type X collagen in chick cartilage and lung. Coll. Rel. Res. 6, 163-184.

Gigout, A., Jolicoeur, M., and Buschmann, M.D. (2005). Low calcium levels in serum-free media maintain chondrocyte phenotype in monolayer culture and reduce chondrocyte aggregation in suspension culture. Osteoarthr. Cartilage 13, 1012-1024.

Grimsrud, C.D., Romano, P.R., D’Souza, M., Puzas, J.E., Reynolds, P.R., Rosier, R.N., and O’Keefe, R.J. (1999). BMP-6 is an autocrine stimulator of chondrocyte differentiation. J. Bone Min. Res. 14, 475-482.

Gunter, T.E., Zuscik, M.J., Puzas, J.E., Gunter, K.K., and Rosier, R.N. (1990). Cytosolic free calcium concentrations in avian growth plate chondrocytes. Cell Calcium 11, 445-457.

Guo, J., Chung, U.I., Kondo, H., Bringhurst, F.R., and Kronenberg, H.M. (2002). The PTH/PTHrP receptor can delay chondrocyte hypertrophy in vivo without activating phospholipase C. Dev. Cell 3: 183-194.

Gibson, G.J., Beaumont, B.W., and Flint, M.H. (1984). Synthesis of a low molecular weight collagen by chondrocytes from the presumptive calcification region of the embryonic chick sterna: the influence of culture with collagen gels. J. Cell Biol. 99: 208-216.

Gorski, D.H., and Leal, A.J. (2003) Inhibition of endothelial cell activation by the homeobox gene Gax. J. Surg. Res. 111, 91-99.

Habuchi, H., Conrad, H.E., and Glaser, J.H. (1985). Coordinate regulation of collagen and alkaline phosphatase levels in chick embryo chondrocytes. J. Biol. Chem. 260: 13029-13034.

Haaijman, A., Burger, E.H., Goei, S.W., Nelles, L., ten Dijke, P., Huylebroeck, D., and Bronckers, A.L. (2000). Correlation between ALK6 (BMPR-IB) distribution and responsiveness to osteogenic protein-1 (BMP7) in embryonic mouse bone rudiments. Growth Factors 17, 177-192.

Haaijman, A., D’Souza, R.N., Bronckers, A.L.J.J., Goei, S.W., and Burger, E.H. (1997) OP-1 (BMP-7) affects mRNA expression of type I, II, X collagen, and matrix Gla protein in ossifying long bones in vitro. J. Bone Miner. Res. 12, 1815-1823.

Hall, B.K. (1981). Modulation of chondrocyte activity in vitro in response to ascorbic acid. Acta. Anat. 109, 51-63.

Hansford, R.G. (1980) Control of mitochondrial substrate oxidation. Curr. Top. Bioenerg. 10, 217–277.

Hargest, T.E., Gay, C.V., Schraer, H., and Wasserman, A.J. (1985a). Vertical distribution of elements in cells and matrix of epiphyseal growth plate cartilage determined by quantitative electron probe analysis. J. Histochem. Cytochem. 33, 275-286.

Hargest, T.E., Leach, R.M., and Gay, C.V. (1985b). Avian tibial dyschondroplasia. I. Ultrastructure. Am. J. Pathol. 119, 175-190.

Hatori, M., Teixeira, C.C., Debolt, K., Pacifici, M., and Shapiro, I.M. (1995) Adenine nucleotide metabolism by chondrocyte in vitro: role of ATP in chondrocyte maturation and matrix mineralization. J. Cell Physiol. 165, 468-474.

Hattersley, G., Nove, J., Hewick, R., and Rosen, V. (1996) Bone morphogenic protein-2 regulates parathyroid hormone related peptide signaling in chondroprogenitor mesenchymal cells. J. Bone Miner. Res. 11, S117.

Hauselmann, H.J., Fernandes, R.J., Mok, S.S., Schmid, T.M., Block, J.A., and Aydelotte, MB. (1994). Phenotypic stability of bovine articular chondrocytes after long-term culture in alginate beads. J. Cell Sci. 107, 17-27.

Havenstein, G.B., Ferket, P.R., and Qureshi, M.A. (2003). Growth, livability, and feed conversion of 1957 versus 2001 broilers when fed representative 1957 and 2001 broiler diets. Poult. Sci. 82, 1500-1508.

Havenstein, G.B., Ferket, P.R., Scheideler, S.E., and Larson, B.T. (1994). Growth, livability, and feed conversion of 1957 vs. 1991 broilers when fed “typical” 1957 and 1991 broiler diets. Poult. Sci. 73, 1785-1794.

Helder, J.F. (1974). Battery broilers. Ind. Poult. Review 6, 86-89.

Henderson, J.E., Amizuka, N., Warshawsky, H., Biasotto, D., Lanske, B.M., Goltzman, D., and Karaplis, A.C. (1995). Nucleolar localization of parathyroid hormone-related peptide enhances survival of chondrocytes under conditions that promote apoptotic cell death. Mol. Cell Biol. 15: 4064-4075.

Hessle, H., Johnson, K. A., Anderson, H. C., Narisawa, S., Sali, A., Goding, J. W., Terkeltaub, R., and Millan, J. L. (2002) Tissue-nonspecific alkaline phosphatase and plasma cell membrane glycoprotein-1 are central antagonistic regulators of bone mineralization. Proc. Natl. Acad. Sci. USA. 99, 9445-9445.

Hickok, N.J., Haas, A.R., Tuan, R.S. (1998). Regulation of chondrocyte differentiation and maturation. Microsc. Res. Techniq. 43:174-190.

Hoebertz, A., Mahendran, S., Burnstock, G., and Arnett, T.R. (2002) ATP and UTP at low concentrations strongly inhibit bone formation by osteoblasts: a novel role for the P2Y2 receptor in bone remodeling. J. Cell. Biochem. 86, 413-419.

Hoebertz, A., Townsend-Nicholson, A., Glass, R., Burnstock, G., and Arnett, T.R. (2000) Expression of P2 receptors in bone and cultured bone cells. Bone 27, 503-510.

Hogan, B.L.M. (1996). Bone morphogenic proteins: multifunctional regulators of vertebrate development. Gene Dev. 10, 1580-1594.

Houston, B., Seawright, E., Jeffries, D., Hoogland, E., Lester, D., Whitehead, C., and Farquharson, C. (1999) Identification and cloning of a novel phosphatase expressed at high levels in differentiating growth plate chondrocytes. BBA: Mol. Cell. Res. 1448, 500-506.

Hoyland, J.A., Thomas, J.T., Donn, R., Marriott, A., Ayad, S., Boot-Handford, R.P., Grant, M.E., Freemont, A.J. (1991). Distribution of type X collagen mRNA in normal and osteoarthritic human cartilage. Bone Mineral Res. 15, 151-163.

Hsu, H. H. T., and Anderson, H. C. (1978) Calcification of isolated matrix vesicles and reconstituted vesicles from fetal bovine cartilage. Proc. Natl. Acad. Sci. USA 75, 3805-3808.

Hsu, H. H. T., Anderson, H. C. (1977) A simple and defined method to study calcification by isolated matrix vesicles. Effect of ATP and vesicle phosphatase. Biochim. Biophys. Acta 500, 162-172.

Hubbard, H.L. (1984). Characterization of the extracellular fluid of chicken epiphyseal growth plate cartilage: studies on metabolites and electrolytes. Doctoral thesis, University of South Carolina, Columbia, S.C.: 1-125.

Hui, M., Li, S.Q., Holmyard, D., and Cheng, P. (1997). Stable transfection of nonsteogenic cel lines with tissue nonspecific alkaline phosphatase enhances mineral deposition both in the presence and absence of beta-glycerophosphate: possible role for alkaline phosphatase in pathological mineralization. Calcif. Tissue Int. 60, 467-472.

Hung, C.T., Allen, F.D., Mansfield, K.D., and Shapiro, I.M. (1997) Extracellular ATP modulates [Ca2+] in retinoic acid-treated embryonic chondrocytes. Am. J. Physiol. 272, 1611-1617.

Iannotti, J.P., and Brighton, C.T. (1989). Cytosolic ionized calcium concentration in isolated chondrocytes from each zone of the growth plate. J. Orthop. Res 7: 511-518.

Ionescu, A.M., Schwarz, E.M., Vinson, C., Puzas, J.E., Rosier, R., Reynolds, P.R., and O’Keefe, R.J. (2001). PTHrP modulates chondrocyte differentiation through AP-1 and CREB signaling. J. Biol. Chem. 276: 11639-11647.

Itakura, C., Yamasaki, K., Goto, M., and Takahashi, M. (1978) Pathology of experimental vitamin D deficieny rickets in growing chickens. I. Bone Avian Pathol. 7, 491-513.

Iwamoto, M., Shapiro, I.M., Yagami, K., Boskey, A.L., Leboy, P.S., Adams, S.L., and Pacifici, M. (1993). Retinoic acid induces rapid mineralization and expression of mineralization- related genes in chondrocytes. Exp. Cell R. 207: 413-420.

Iwamoto, M., Sato, K., Nakashima, K., Shimazu, A., and Kato, Y. (1989). Hypertrophy and calcification of rabbit permanent chondrocytes in pelleted cultures: synthesis of alkaline phosphatase and 1,25-dihydroxycholecalciferol receptor. Dev. Biol. 136: 500-507.

Johnson, K., Vaingankar, S., Chen, Y., Moffa, A., Goldring, M. B., Sano, K., Jin-Hua, P., Sali, A., Goding, J., and Terkeltaub, R. (1999) Differential mechanisms of inorganic pyrophosphate production by plasma cell membrane glycoprotein-1 and B10 in chondrocytes. Arthritis Rheum. 42, 1986-1997.

Johnson, R.L., and Tabin, C. (1995) The long and short of hedgehog signaling. Cell 81, 313–316. Jouaville, L.S., Pinton, P., Bastianutoo, C., Rutter, G.A., and Rizzuto, R. (1998). Regulation of mitochondrial ATP synthesis by calcium: evidence for a long-term metabolic priming. PNAS 96, 13807-13812.

Julian, R.J. (1998a). Valgus-varus deformity of the intertarsal joint in broiler chickens. Can. Vet. J. 25, 254-258.

Julian, R.J. (1998b). Rapid growth problems: ascites and skeletal deformities in broilers. Poult. Sci. 77, 1772-1780.

Juppner, H., Abou-Samra, A-B., Freeman, M., Kong, X.F., Schipani, E., Richards, J., Kolakowski, L.F., Jr., Hock, J., Potts, J.T., Jr., Kronenberg, H.M., and Segre, G.V. (1991). A G protein-linked receptor for parathyroid hormone and parathyroid hormone-related peptide. Science 254, 1024-1026.

Karp, S.J., Schipani, E., St-Jacques, B., Hunzelman, J., Kronenberg, H., and McMahon, A.P. (2000). Indian hedgehog coordinates endochondral bone growth and morphogenesis via parathyroid hormone related-protein-dependent and –independent pathways. Development 127, 543-548.

Kato, Y., Shimaza, A., Iwamoto, M., Nakashima, K., Koike, T., Suzuki, F., Nishii, Y., and Sato, K. (1990). Role of 1,25-dihydroxycholecalciferol in growth-plate cartilage: Inhibition of terminal differentiation of chondrocytes in vitro and in vivo. Proc. Nat. Ac. Sciences USA 87, 6522-6526.

Kawakami, Y., Ishikawa, T., Shimabara, M., Tanda, N., Enomoto- Iwamoto, Iwamoto, M., Kuwana, T., Ueki, A., Noji, S. and Nohno, T. (1996). BMP signaling during bone pattern determination in the developing limb. Development 122, 3557-3566.

Kestin, S.C., Su, G., and Sorensen, P. (1999). Different commercial broiler crosses have different susceptibilities to leg weakness. Poult. Sci. 78, 1085-1090.

Kestin, S.C., Knowles, T.G., Tinch, A.E., and Gregory, N.G. (1992). Prevalence of leg weakness in broiler chickens and its relationship with genotype. Vet. Rec. 131, 190-194.

Khan, H.A. (2003). Bioluminometric assay of ATP in mouse brain: determinant factors for enhanced test sensitivity. J. Biosciences (brief comm.) 28, 379-382.

Kielty, C. M., and Shuttleworth, C. A. (1993) The role of calcium in the organization of fibrillin microfibrils. FEBS Lett. 336, 323-326.

Kifor, O., Diaz, R., Butters, R., and Brown, E. (1997) The Ca2+-sensing receptor (CaR) activates phospholipases C, A(2), and D in bovine parathyroid and CaR-transfected, human embryonic kidney (HEK293) cells. J. Bone Miner. Res. 12, 715–725.

Kimura, T., Yasui, N., Ohsawa, S., and Ono, K. (1984). Chondrocytes embedded in collagen gels maintain cartilage phenotype during long-term cultures. Clin. Orthop. Rel. Res. 186, 231- 239.

Kingsley, D.M. (1994) What do Bmps do in mammals? Clues form the mouse short-ear mutation. Trends Genet. 10, 16-21.

Kirsch, T., Harrison, G., Golub, E.E., Nah, H.D. (2000). The roles of annexins and types II and X collagen in matrix vesicle-mediated mineralization of growth plate cartilage. J. Biol. Chem. 275: 35577-35583.

Kivirikko, K.I. and Myllyla, R. (1987). Recent developments in posttranslational modification: intracellular processing. Method Enzymol. 144, 96-114.

Klein, G.L., and Simmons, D.J. (1993). Nutritional rickets: thoughts about pathogenesis. Annu. Rev. Med. 25: 379-384.

Koch, A.W., Pokutta, S., Lustig, A., and Engel, J. (1997) Calcium binding and homoassociation of E-cadherin domains. Biochemistry 36, 7697-7705.

Kolettas, E., Buluwela, L., Bayliss, M.T., and Muir, H.I. (1995). Expression of cartilage-specific molecules is retained on long-term culture of human articular chondrocytes. J. Cell. Sci. 108, 1991-1999.

Komarova, S.V., Ataullakhanov, F.L., Globus, R.K. (2000) Bioenergetics and mitochondrial transmembrane potential during differentiation of cultured osteoblasts. Am. J. Physiol.: Cell Ph. 279, C1220-C1229.

Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu, Y., Bronson, R.T., Gao, Y.H., Inada, M., Sato, M., Okamoto, R., Kitamura, Y., Yoshiki, S., and Kishimoto, T. (1997). Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89, 755-764.

Koyano, Y., Hejna, M., Flechtenmacher, J., Schmid, T.M., Thonar, E.J., and Mollenhauer, J. (1996). Collagen and proteoglycan production by bovine fetal and adult chondrocytes under low levels of calcium and zinc ions. Connect. Tissue Res. 34, 213-225.

Kreiter, S.R., Swartsz, R.P., Kirkman, H.N., Charlton, P.A., Calikoglu, A.S., and Davenport, M.L. (2000). Nutritional rickets in African American breast-fed infants. J. Pediat. 137: 153- 157.

Krishnan, V., Ma, Y.L., Moseley, J.M., Geiser, A.G., Friant, S., and Frolik, C.A. (2001) Bone anabolic effects of Sonic/Indian Hedgehog are mediated by BMP-2/4-dependent pathways in the neonatal rat metatarsal model. Endocrinology 142, 940-947.

Kronenberg, H.M., Lee, K., Lanske, B., and Segre, G.V. (1997). Parathyroid hormone-related protein and Indian hedgehog control the pace of cartilage differentiation. J. Endocrinology 154: S39-S45.

Kuettner, K.W., Memoli, V.A., Pauli, B.U., Wrobel, N.C., Thonar, E.J., and Daniel, J.C. (1982). Synthesis of cartilage matrix by mammalian chondrocytes in vitro. II. Maintenance of collagen and proteoglycan phenotype. J. Cell. Biol. 93, 751-757.

Kumagai, H., Saktor. B., and Filburn, C. R. (1991) Purinergic regulation of cytosolic calcium and phosphoinositide metabolism in rat osteoblast-like osteosarcoma cells. J. Bone Miner. Res. 7, 697-707.

Kumagai, H., Sakamoto, H., Guggino, S., Filburn, C.R., and Sacktor, B. (1989) Neurotransmitter regulation of cytosolic calcium in osteoblast-like bone cells. Calcif. Tissue Int. 45, 251-254.

Kumagai, H., Sakamoto, H., Guggino. S., Filburn. C. R., and Saktor, B. (1989) Neurotransmitter regulation of cytosolic calcium in osteoblast like bone cells. Calcif. Tissue lnt. 45, 251-254.

Kwan, A.P.L., Dickson, I.R., Freemont, A.J., and Grant, M.E. (1989). Comparative studies of type X collagen expression in normal and rachitic chicken epiphyseal cartilage. J. Biol. Chem. 109, 1849-1856.

Lacey, D.L., and Huffer, W.E. (1982). Studies in the pathogenicity of avian rickets. I. Changes in epiphyseal and metaphyseal vessels in hypocalcemic and hypophosphatemic rickets. Am. J. Pathol. 109, 266-301.

Lanske, B., Karaplis, A.C., Lee, K., Luz, A., Vortkamp, A., Pirro, A., Karperien, M., Defize, L.H.K., Ho, C., Mulligan, R.C., Abou-Samra, A.B., Juppner, H., Segre, G.V., and Kronenberg, H.M. (1996). PTH/PTHrP receptor in early development and Indian hedgehog-related bone growth. Science 273: 663-666.

Leach, R.M. Jr., and Nesheim, M.C. (1965). Nutritional, genetic, and morphological studies of abnormal cartilage formation in young chicks. J. Nutr. 86, 236-244.

Leboy, P.S., Vaias, L., Uschmann, B., Golub, E., Adams, S.L., and Pacifici, M. (1989). Ascorbic acid induces alkaline phosphatase, type X collagen, and calcium deposition in cultured chick chondrocytes. J. Biol. Chem. 264, 17281-17286.

Ledwaba, M.F., and Roberson, K.D. (2003). Effectiveness of 25-hydroxycholecalciferol in the prevention of tibial dyschondroplasia in Ross cockerels depends on dietary calcium level. Poult. Sci. 82, 1769-1777.

Lee, K., Lanske, B., Karaplis, A., Deeds, J.D., Kohno, H., Nissenson, R.A., Kronenberg, H.M., and Segre, G.V. (1996). Parathyroid hormone-related peptide delays terminal differentiation of chondrocytes during endochrondral bone development. Endocrinology 137: 5109-5118.

Lee, K., Deeds, J.D., and Segre, G.V. (1995). Expression of parathyroid hormone-related peptide and its receptor messenger ribonucleic acids during fetal development of rats. Endocrinology 136, 453-463.

Li, Y.C., Amling, M., Pirro, A.E., Priemel, M., Meuse, J., Baron, R., Delling, G., and Demay, M.B. (1998). Normalization of mineral ion homeostasis by dietary means prevents hyperparathyroidism, rickets, and osteomalacia, but not alopecia in vitamin D receptor-ablated mice. Endocrinology 139: 4391-4396.

Li, B., Zerby, H.N., and Lee, K. (2007). Heart fatty acid binding protein is upregulated during porcine adipocyte development. J. Anim. Sci., accepted.

Li, Y.C., Pirro, A.E., Amling, M., Delling, G., Baron, R., Bronson, R., and Demay, M.B. (1997). Targeted ablation of the vitamin D receptor: an animal model of vitamin D-dependent rickets type II with alopecia. Proclamations of the National Academy of Science USA 94: 9831-9835.

Lian, J.B., McKee, M.D., Todd, A.M., and Gerstenfeld, L.C. (1993). Induction of bone-related proteins, osteocalcin and osteopontin, and their matrix ultrastructural localization with development of chondrocyte hypertrophy in vitro. J. Cell Biochem. 52: 206-219.

Liu, F., Ventura, F., Doody, J. and Massagué, J. (1995). Human type II receptor for bone morphogenic protein (BMPs): extension of the two-kinase receptor model to the BMPs. Mol. Cell Biol. 15, 3479-3486.

Lloyd, D.K., Golding, S.L., Bowler, W.B., Dixon, C.J., Dillon, J.P., and Gallagher, J.A. (1999) Phosphodiesterase Activity of Alkaline Phosphatase in ATP-initiated Ca2+ and Phosphate Deposition in Isolated Chicken Matrix Vesicles. Calcif. Tissue Int. 64, 58.

Long, P.H., Lee, S.R., Rowland, G.N., and Britton, W.M. (1984a). Experimental rickets in broilers: gross, microscopic and radiographic lesions. I. Phosphorus deficiency and calcium excess. Avian Dis. 28, 460-474.

Long, P.H., Lee, S.R., Rowland, G.N., and Britton, W.M. (1984b). Experimental rickets in broilers: gross, microscopic, and radiographic lesions II: calcium deficiency. Avian Dis. 28: 921-932.

Long, P.H., and Lee, S.R., Rowland, G.N., and Britton, W.M. (1984c). Experimental rickets in broilers: gross, microscopic and radiographic lesions. III. Vitamin D deficiency. Avian Dis. 28, 933-943.

Lyons, K.M., Hogan, B.L.M., and Robertson, E.J. (1995). Colocalization of BMP7 and BMP2 RNAs suggests that these factors cooperatively mediate tissue interactions during murine development. Mech. Develop. 50, 71-83.

Mallein-Gerin, F., Garrone, R., and van der Rest, M. (1991). Proteoglycan and collagen synthesis are correlated with actin organization in dedifferentiating chondrocytes. Eur. J. Cell Biol. 56, 364-373.

Marchini, A., Marttila, T., Winter, A., Caldeira, S., Malanchi, I., Blaschke, R.J., Hacker, B., Rao, E., Karperien, M., Wit, J.M., Richter, W., Tommasino, M., and Rappold, G.A. (2004) The short stature of homeodomain protein SHOX induces cellular growth arrest and apoptosis and is expressed in human growth plate chondrocytes. J. Biol. Chem. 279, 37103-37114.

Massague, J. (1998). TGF-beta signal transduction. Annu. Rev. Biochem. 67, 753-791.

Matthews, J.L., and Martin, J.H. (1970). Mitochondrial granules in chondrocytes, osteoblasts, and osteocytes. Clin. Orthop. Relat. Res. 68: 273-278.

Mayne, R., and Irwin, M.H. (1986) Collagen types in cartilage. In Articular Cartilage Biochemistry. K.E. Kuettner, R. Schleyerbach, and V.C. Hascall, editors. Raven Press, New York. 23-35.

Maurer, P., Hohenester, E., and Engel, J. (1996) Extracellular calcium-binding proteins. Curr. Opin. Cell Biol. 8, 609-617.

Mayer, H., Scutt, A.M., and Ankenbauer, T. (1996) Subtle differences in the mitogenic effects of recombinant human bone morphogenic proteins-2 to -7 on DNA synthesis on primary bone- forming cells and identification of BMP-2/4 receptor. Calcif. Tissue Int. 58, 249-255.

McNamee, P.T., McCullagh, J.J., Thorp, B.H., Ball, H.J., Graham, D., McCullough, S.J., McConaghy, D., and Smyth, J.A. (1998). Study of leg weakness in two commercial broiler flocks. Vet. Rec. 143, 131-135.

Mellstrom, B., and Naranjo, J.R. (2001). Mechanisms of calcium-dependent transcription. Curr. Opin. Cell Biol. 11, 312-319.

Mermelstein, C.S., Rebello, M.I., Amaral, L.M., and Costa, M.L. (2003). Changes in cell shape, cytoskeletal proteins and adhesion sites of cultured cells after extracellular calcium chelation. Braz. J. Med. Biol. Res. 36, 1111-1116.

Merrick, W. C. (1992) Mechanism and regulation of eukaryotic protein synthesis. Microbiol.. Rev. 56, 291-315.

Meyer, J. L. (1984) Can biological calcification occur in the presence of pyrophosphate? Arch. Biochem. Biophys. 231, 1-8.

Micronutrient Information Center. Oregon State University. Linus Pauling Institute. Website: [http://lpi.oregonstate.edu/infocenter/minerals/phosphorus/phospth.html [2008].

Minina, E., Wenzel, H.M., Kreschel, C., Karp, S., Gaffield, W., McMahon, A.P., and Vortkamp, A. (2001). BMP and Ihh/PTHrP signaling interact to coordinate chondrocyte proliferation and differentiation. Development 128, 4523-4534.

Morales, J., Cormier, P., Mulner-Lorillon, O., Poulhe, R., and Belle, R. (1992) Molecular cloning of a new guanine-nucleotide exchange protein, EF-1. Nucleic Acids Res.. 20, 4091.

Mornet, E., Stura, E., Lia-Baldini, A. S., Stigbrand, T., Menez, A., and Le Du, M.-H. (2001) Structural Evidence for a Functional Role of Human Tissue Nonspecific Alkaline Phosphatase in Bone Mineralization. J. Biol. Chem. 276, 31171-31178.

Morris, M.P. (1993). National survey of leg problems. Broiler Industry., 20-24.

Mundlos, S., Engel, H., Michel-Behnke, I., and Zabel, B. (1990). Distribution of type I and type II collagen gene expression during the development of human long bones. Bone 11: 275-279.

Mundlos, S., Meyer, R., Yamanda, Y., and Zabel, B. (1991). Distribution of cartilage proteoglycan (aggrecan) core protein and link protein gene expression during human skeletal development. Matrix 11: 339-346.

Mundlos, S., Olsen, B.R. (1997a). Heritable diseases of the skeleton. Part I: molecular insights into skeletal development-transcription factors and signaling pathways. FASEB Journal 11: 125-132.

Mundlos, S., Olsen, B.R. (1997b). Heritable diseases of the skeleton. Part II: molecular insights into skeletal development-matrix components and their homeostasis. FASEB Journal 11: 125- 132.

Mundlos, S., Otto, F., Mundlos, C., Mulliken, J.B., Aylsworth, A.S., Albright, S., Lindhout, D., Cole, W.G., Henn, W., Knoll, J.H., Owen, M.J., Mertelsmann, R., Zabel, B.U., and Olsen, B.R. (1997). Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell 89(5), 773–779.

Muther, R.S., McCarron, D.A., and Bennett, W.M. (1982). Change in serum bicarbonate during actue EDTA infusions in post-transplant hyperparathyroidism. Nephron. 30, 36-38.

Nakase, T., Takaoka, K., Hirakawa, K., Hirota, S., Takemura, T, Onoue, H., Takebayashi, K., Kitamura, Y., and Nomura, S. (1994). Alterations in the expression of osteonectin, osteopontin, and osteocalcin mRNAs during the development of skeletal tissues in vivo. Bone Mineralization 26: 109-122.

Nishitoh, H., Ichijo, H., Kimura, M., Matsumoto, T., Makishima, F., Yamaguchi, A., Yamashita, H., Enomoto, S. and Miyazono, K. (1996). Identification of type I and type II serine/threonine kinase receptor for growth/differentiation factor-5. J. Biol. Chem. 271, 21345-21352.

North, R.A., and Barnard, E.A. (1997) Nucleotide receptors. Curr. Opin. Neurobiol. 7, 346-357.

Nutrient Requirements of Poultry. (1994). National Academy Press, 2101 Constitution Avenue, NW, Lockbox 285, Washington, DC 20055.

Onagbesan, O.M., Bruggeman, V., Van As, P., Tona, K., Williams, J., and Decuypere, E. (2003). BMPs and BMPRs in chicken ovary and effects of BMP-4 and -7 on granulose cell proliferation and progesterone production in vitro. Am. J. Endocrinol. Metab. 285, E793- E983.

Orth, M.W. (1999) The regulation of growth plate cartilage turnover. J. Anim. Sci. 77, 183-189.

Otto, F., Thornell, A.P., Crompton, T., Denzel, A., Gilmour, K.C., Rosewell, I.R., Stamp, G.W.H., Beddington, R.S.P., Mundlos, S., Olsen, B.R., Selby, P.B., and Owen, M.J. (1997). Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89, 765-771.

Pacifici, M., Golden, E.B., Iwamoto, M., and Adams, S.L. (1991). Retinoic acid treatment induces type X collagen gene expression in cultured chick chondrocytes. Exp. Cell Res.195, 38-46.

Pacifici, M., and Iozzo, R.V. (1988). Remodeling of the rough endoplasmic reticulum during stimulation of procollagen secretion by ascorbic acid in cultured chondrocytes. A biochemical and morphological study. J. Biol. Chem. 263, 2483-2492.

Pathi, S., Rutenberg, J.B., Johnson, R.L., and Vortkamp, A. (1999). Interaction of Ihh and BMP/Noggin signaling during cartilage differentiation. Dev.l Biol. 209, 239-253.

Pattison, M. (1992). Impacts of bone problems on the poultry meat industry. Pages 329-338 in Bone Biology and Skeletal Disorders in Poultry. C.C. Whitehead, ed. Carfax Publishing Company, Abingdon, UK.

Pellegrino, E.D., and Biltz, R.M. (1968). Bone carbonate and the Ca to P molar ratio. Nature 219, 1261-1262.

Pepper, W.F., Slinger, S.J., and Matzok, P. (1955). Effect of animal fat on the calcium and phosphorus requirement of chicks. Poult. Sci. 34, 1216.

Pines, M., Fukayama, S., Costas, K., Meurer, E., Goldsmith, P.K., Xu, X., Muallem, S., Behar, V, Chorev, M., Rosenblatt, M., Tashuian, Jr., and Suva, L.J. (1996). Inositol 1-,4-,5- triphosphate-dependent calcium signaling by the recombinant human PTH/PTHrP receptor stably expressed in a human kidney cell line. Bone 18, 381-389.

Pollesello, P, de Bernard, B., Grandolfo, M, Paoletti, S., Vittur, F., and Kvam, B.J. (1991). Energy state of chondrocyte assessed by P-NMR studies of preosseous cartilage. Biochem. Biophys. Res. Commun. 180: 216-222.

Posner, A.S. (1978). Intramitochondrial storage of stable amorphous calcium phosphate. Ann. NY Acad. Sci. 307: 248-249.

Quarto, R., Campanile, G., Candedda, R., Dozin, B. (1992). Thyroid hormone, insulin, and glucocordicoids are sufficient to support chondrocyte differentiation to hypertrophy: a serum- free analysis. J. Cell Biol. 119: 989-995.

Rath, N.C., Huff, G.R., Huff, W.E., and Balog, J.M. (2000). Factors regulating bone maturity and strength in poultry. Poult. Sci. 79, 1024-1032.

Reddi, A.H. (1992) Regulation of cartilage and bone differentiation by bone morphogenetic proteins. Curr. Opin. Cell Biol. 4, 850855.

Reginato, A.M., Sharpiro, I.M., Lash, J.W., and Jimenez, S.A. (1988). Type X collagen alterations in rachitic chick epiphyseal growth plate cartilage. J. Biol. Chem. 263, 9938-9945.

Reinhardt, D. P., Ono, R. N., and Sakai, L. Y. (1997) Calcium stabilizes fibrillin-1 against proteolytic degradation. J. Biol. Chem. 272, 1231-1236.

Reinhardt, D. P., Sasaki, T., Dzamba, B. J., Keene, D. R., Chu, M.-L., Göhring, W., Timpl, R., and Sakai, L. Y. (1996) Fibrillin-1 and fibulin-2 interact and are colocalized in some tissues. J. Biol. Chem. 271, 19489-19496.

Riddell, C., King, M.W., and Gunasekera, K.R. (1983). Pathology of the skeleton and tendons of broiler chickens reared to roaster weight. II. Normal chicken. Avian Diseases 27, 980-991.

Riddell, C. (1983). Pathology of the skeleton and tendons of broiler chickens reared to roaster weights. I. Crippled chickens. Avian Dis. 27, 950-962.

Riddell, C., and Springer, R. (1985). An epizootiological study of acute death syndrome and leg weakness in broiler chickens in western Canada. Avian Dis. 29, 90-102.

Riis, B., Rattan, S.I.S., Clark, B.F.C., and Merrick, W.C. (1990) Eukaryotic protein elongation factors. Trends Biochem. Sci. 15, 420-424.

Rosen, V., and Thies, R.S. (1992) The BMP proteins in bone formation and repair. Trends Genet. 8, 97102.

Rosier, R.N. (1984) The role of intracellular calcium in matrix vesicle biogenesis. Ortho. Trans. 8, 238-239.

Ryan, J.A. (2008). Introduction to Animal Cell Culture: Technical Bulletin. Corning Incorporated, Life Sciences.

Sailor, L.Z., Hewick, R.M., and Morris, E.A. (1996). Recombinant human bone morphogenetic protein-2 maintains the articular chondrocyte phenotype in long-term culture. J. Orthop.Res. 14, 937-945.

Sallis, J.D., and Holdsworth, E.S. (1962). Influence of vitamin D on calcium absorption in the chick. Am. J. Physiol. 293, 497-505.

Sandell, L.J., Sugai, J.V., and Trippel, S.B. (1994). Expression of collagens I, II. X, and XI and aggrecan mRNAs by bovine growth plate chondrocytes in situ. J.Orthop. Res 12: 1-14.

Sanotra, G.S., Damkjer Lund, J., and Vestergaard, K.S. (2002). Influence of light-dark schedules and stocking density on behaviour, risk of leg problems and occurrence of chronic fear in broilers. Br. Poult. Sci. 43, 344-354.

Schipani, E., Ryan, H.E., Didrickson, S., Kobayashi, T., Knight, M., and Johnson, R.S. (2001). Hypoxia in cartilage: HIF-1α is essential for chondrocyte growth arrest and survival. Gene Dev. 15: 2865-2876.

Schmid, T.M., Bonen, D.K., Luchene, L., and Linsenmayer, T.F. (1991) Late events in chondrocyte differentiation: hypertrophy, type X collagen synthesis and matrix calcification. In Vivo. 5, 533-540.

Schmid, T.M., and Linsenmayer, T.F. (1987) Type X collagen. In Structure and Function of Collagen Types. R. Mayne, and R.E. Burgeson, editors. Academic Press, Orlando, FL. 223- 259.

Schmid, T.M., and Linsenmayer, T.F. (1985). Type X collagen within the embryonic chick sternum: immunohistochemical localization with a monoclonal antibody. Annual N.Y. Academy of Sciences 460, 497-499.

Schwartz, M.A. (1993). Spreading of human endothelial cells on fibronectin or vitronectin triggers elevation of intracellular free calcium. J. Cell Biol. 120, 1003-1010.

Scott, T.A. (2002). Evaluation of lighting programs, diet density, and short-term use of mash as compared to crumbled starter to reduce incidence of sudden death syndrome in broiler chicks to 35 days of age. Can. J. Ani. Sci.e 82, 375-383.

Scott, M.L., Nesheim, M.C., and Young, R.J. (1982). Nutrition of the Chicken. M.L. Scott & Associates, Ithaca, NY.

Scott, M.L., Nesheim, M.C., and Young, R.J. (1969). Nutrition of the chicken. Ithica, NY.

Shafey, T.M. (1993). Calcium tolerance of growing chickens: effect of ratio of dietary calcium to nonphytate phosphorus. World Poult. Sci. J. 49, 5-18.

Shafey, T.M., McDonald, M.W., and Pym, R.A.E. (1990). The effect of dietary calcium upon growth rate, food utilisation and plasma constituents in lines of chickens selected for aspects of growth or body composition. Br. Poult. Sci. 31, 577–586.

Shapiro, I.M., Golub, E.E., May, M., and Rabinowitz, J.L. (1983) Studies of nucleotides of growth-plate cartilage: evidence linking changes in cellular metabolism with cartilage calcification. Bioscience Rep. 3, 345-351.

Shimegi, S. (1996) ATP and adenosine act as a mitogen for osteoblast-like cells (MC3T3-E1). Calcif. Tissue Int. 58, 109-113.

Shukunami, C., Ohta, Y., Sakuda, M., and Hiraki, Y. (1998). Sequential progression of the differentiation program by bone morphogenic protein-2 in chondrogenic cell line ATDC5. Exp. Cell Res. 241, 1-11.

Shum, L., Zibin, W., Kane, A.A., and Nuckolls, G.H. (2003). Bmp4 promotes chondrocyte proliferation and hypertrophy in endochondral cranial base. Int. J. Dev. Biol. 47, 423-431.

Sigurdson, S.L., and Lwebuga-Mukasa, J.S. (1994). Divalent cation-dependent regulation of rat aveolar epithelial cell adhesion and spreading. Exp. Cell Res. 213, 71-79.

Siller, W.G. (1970). Tibial dyschondroplasia in the fowl. J. Pathol. 101, 39-46.

Sissons, H.A. (1953). Experimental determination of rate of longitudinal bone growth. J. Anatomy 87: 228-237.

Skinner, J.T., Beasley, J.N., and Waldroup, P.W. (1991). Effects of dietary amino acid levels on bone development in broiler chickens. Poult. Sci. 70, 941-946.

Smith, R.C., Branellec, D., Gorski, D.H., Guo, K., Perlman, H., Dedieu, J.F., Pastore, C., Mahfoudi, A., Denefle, P., Isner, J.M., and Walsh, K. (1997) p21CIP1-mediated inhibition of cell proliferation by overexpression of gax homeodomain gene. Gene Dev. 11, 1674.

Solursh, M., Jensen, K.L., Reiter, R.S., Schmid, T.M., and Linsenmayer, T.F. (1986). Environmental regulation of type X collagen production by cultures of limb mesenchyme, mesectoderm and sternal chondrocytes. Dev. Biol. 117: 90-101.

Solursh, T.M., Jensen, K.L., Singley, C.T., Linsenmayer, T.F., and Reiter, R.S. (1982). Two distinct regulatory steps in cartilage differentiation. Dev. Biol. 94: 311-325.

Sonenberg N. (1993) Translation factors as effectors of cell growth and tumorigenesis. Curr. Opin. Cell Biol. 5, 955−960.

Srinivasan, S., Stevens, M.J., Sheng, H., Hall, K.E., Wiley, J.W. (1998). Serum from patients with type II diabetes with neuropathy induces complement-independent, calcium-dependent apoptosis in cultured neuronal cells. J.Clin. Invest. 102: 1454-1462.

Steinke, F.H. (1971). Osteodystrophy-nutritional and related factors. In The Proceddings of the Symposium on Leg Weakness in Turkeys, page 30. Ames, Iowa.

Stevens, A., and Lowe, J.S. (1992) Histology. Gower Medial Publishing. London, U.K., 283- 245.

Stevens, D.A., and Williams, G.R. (1999). Hormone regulation of chondrocyte differentiation and endochondral bone formation. Mol. Cell Endocrinol. 151: 195-204.

St-Jacques, B., Hammerschmidt, M., and McMahon, A.P. (1999). Indian hedgehog signaling regulates proliferation and differentiation of the chondrocytes and is essential for osteoblast differentiation during skeletal development. Gene Dev. 13, 2072-2086.

Strewler, G.J. (2000). The physiology of parathyroid hormone-related protein. New Engl. J. Med. 342: 177-185.

Su, G., Sorensen, G.P., and Kestin, S.C. (1999). Meal feeding is more effective than early feed restriction at reducing the prevalence of leg weakness in broiler chickens. Poult. Sci. 78, 949- 955.

Sullivan, T.W. (1994). Skeletal problems in poultry: estimated annual cost and descriptions. Poult. Sci. 73, 879-882.

Tacchetti, C., Quarto, R., Nitsch, L., Hartmann, D.J., and Cancedda, R. (1987). In vitro morphogenesis of chick embryo hypertrophic cartilage. J. Cell Biol 105, 999-1006.

Takechi, M., and Itakura, C. (1995). Ultrastructural studies of the epiphyseal plate of chicks fed a vitamin D-deficient and low-calcium diet. J. Comp. Pathol. 113, 101-111.

Tamponnet, C., Ramdi, H., Guyot, J.B., and Lievremont, M. (1992). Rabbit articular chondrocytes in alginate gel: characterization of immobilized preparations and potential applications. Appl. Microbiol. Biotech. 37, 311-315.

ten Dijke, P., Yamashita, H., Sampath, T. K., Reddi, A. H., Estevez, M., Riddle, D. L., Ichijo, H., Heldin, C.-H. and Miyazono, K. (1994). Identification of type I receptors for osteogenic protein-1 and bone morphogenetic protein-4. J. Biol. Chem. 269, 16985-16988.

Tavella, S., Bellese, G., Castagnola, P., Martin, I., Piccini, D., and Doliana, R. (1997). Regulated expression of fibronectin, laminin and related integrin receptors during he early chondrocyte differentiation. J. Cell Sci. 110, 2261-2270.

Terkeltaub, R.A., Johnson, K., Rohnow, D., Goomer, R., Burton, D., and Deftos, L.J. (1998). Bone morphogenic proteins and bFGF exert opposing regulatory effects on PTHrP expression and inorganic pyrophosphate elaboration in immortalized murine endochondral hypertrophic chondrocytes (MCT cells). J. Bone Mineral Res. 13, 931-941.

Thacher, T.D. (2003). Calcium-deficiency rickets. Endocrine Dev. 6: 105-125.

Thorp, B.H., and Waddington, D. (1997). Relationships between the bone pathologies, ash and mineral content of long bones in 35-d-old broiler chickens. Res. Vet. Sci. 62, 67-73.

Thorp, B.H. (1994). Skeletal disorders in the fowl: a review. Avian Pathol. 23, 203-236.

Tzukazaki, T., Ohtsuru, A., Enomoto, H., Yano, H., Motomura, K., Ito., M., Namba, H., Iwasaki, K., and Yamashita, S. (1995). Expression of parathyroid hormone-related protein in rat articular cartilage. Calcif. Tissue Int. 57, 196-200.

Van der Eerden, B.C.J., Karperien, M., and Wit, J.M. (2003). Systemic and local regulation of the growth plate. Endocrine Rev. 24: 782-801.

Veltmann, J.R., Jr., and Jensen, L.S. (1981). Tibial dyschondroplasia in broilers: comparison of dietary additives and strains. Poult. Sci. 60, 1473-1478.

Veltmann, J.R., Jr., and Jensen, L.S. (1980). Variations in the incidence of tibial dyschondroplasia with different environmental conditions. Avian Dis. 24, 625-630.

Venalainen, E., Valaja, J., and Jalava, T. (2006). Effects of dietary metabolisable energy, c calcium and phosphorus on mineral utilization and serum enzyme activies in broiler chicks fed different levels of phosphorus. Poult. Sci. 81, 1172-1183.

Von der Mark, K. (1980). Immunological studies on collagen type transition in chondrogenesis. Curr. Top. Develop. Biol. 14, 199-225.

Vortkamp, A., Lee, K., Lanske, B., Segre, G.V., Kronenberg, H.M., and Tabin, C.J. (1996). Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science 273: 613-622.

Waldenstedt, L. (2006). Nutritional factors of importance for optimal leg health in broilers. A review of animal feed science and technology 126, 291-307.

Wang, W., Xu, J., and Kirsch, T. (2003). Annexin-mediated Ca(2+) influx regulates growth plate chondrocyte maturation and apoptosis. J. Biol. Chem. 278: 3762-3769.

Watt, F.M. and Dudhia, J. (1988). Prolonged expression of differentiated phenotype by chondrocytes cultured at low density on a composite substrate of collagen and agarose that restricts cell spreading. Differentiation 38, 140-147.

Weiss, K.M., Bollekens, J., Ruddle, F.H., and Takashita, K.J. (1994) Distal-less and other homeobox genes in the development of dentition. Exp. Zool. 270, 273–284.

Whitehead, C.C., McCormack, H.A., McTeir, L., and Fleming, R.H. (2004). High vitamin D3 requirements in broilers for bone quality and prevention of tibial dyschondroplasia and interactions with dietary calcium, nonphytate phosphorus and vitamin A. Br. J. Poult. Sci. 45, 425-436.

Williams, B., Waddinton, D., Soloman, S., and Farquharson, C. (2000). Dietary effects on bone quality and turnover and Ca and P metabolism in chickens. Res. Vet. Sci. 69, 81-87.

Wilson, J.L., Weaver, W.D., Beane, W.L., and Cherry, J.A. (1984). Effects of light and feeding space on leg abnormalities in broilers. Poult. Sci. 63, 565-567.

Wise, D.R., and Knott, H. (1975). Studies on tibial dyschondroplasia in ducks. Res. Vet. Sci. 18, 193-197.

Wuthier, R.E. (1977). Electrolytes of isolated epiphyseal chondrocytes, matrix vesicles, and extracellular fluid. Calcif. Tissue Res. 23: 125-133.

Wuthier, R.E. (1982). A review of the primary mechanism of endochondral calcification with special emphasis on the role of cells, mitochondria, and matrix vesicles. Clin. Orthop. Relat. Res. 169: 219-242.

Wuthier, R.E. (1993). Involvement of cellular metabolism of calcium and phosphate in calcification of avian growth plate cartilage. J. Nutr. 123: 301-309.

Wu, S., Palese, T., Mishra, O.P., Delivoria-Papadopoulos, M., De Luca, F. (2004). Effects of Ca(2+) sensing receptor activation in the growth plate. FASEB Journal 18: 143-145.

Yan, F., Angel, R., Ashwell, C., Mitchell, A., and Christman, M. (2005). Evaluation of the broiler’s ability to adapt to an early moderate deficiency of phosphorus and calcium. J. Poult. Sci. 84, 1232-1241.

Yazaki, Y., Matsunaga, S., Onishi, T., Nagamine, T., Origuchi, N., Yamamoto, T., Ishidou, Y., Imamura, T., and Sakou, T. (1998). Immunohistochemical localization of bone morphogenetic proteins and the receptors in epiphyseal growth plate. Antocancer Res. 18, 2339–2344.

Yi, S.E., Daluiski, A., Pederson, R., Rosen, V., and Lyons, K.M. (2000). The type I BMP receptor BMPRIB is required for chondrogenesis in the mouse limb. Development 127, 621- 630.

Zhang, D., Schwarz, E.M., Rosier, R.N., Zuscik, M.J., Puzas, J.E., and O’Keefe, R.J. (2003). ALK2 functions as a BMP type I receptor and induces Indian hedgehog in chondrocytes during skeletal development. J. Bone Mineral Res. 18, 1593-1604.

Zou, H., Wieser, R., Massague, J., and Niswander, L. (1997). Distinct roles of type I bone morphogenetic protein receptors in the formation and differentiation of cartilage. Gene Dev. 11: 2191-2203.

Zuscik, M.J., D’Souza, M.D., Gunter, K.K., Gunter, T.E., O’Keefe, R.J., Schwarz, E.M., Puzas, J.E., and Rosier, R.N. (2002). Growth plate chondrocyte maturation is regulated by basal intracellular calcium. Exp. Cell Res. 276, 310-319.

100