Strain Characterization, Antimicrobial Susceptibility And

STRAIN CHARACTERIZATION, ANTIMICROBIAL SUSCEPTIBILITY AND

COLD-INDUCED GENES OF FLAVOBACTERIUMPSYCHROPHILUM

A Thesis

Presented to

The Faculty of Graduate Studies

The University of Guelph

SHOHREH HESAMI

In partial fulfillment of requirements

for the degree of

Doctor of Philosophy

December, 2009

395 Wellington Street 395, rue Wellington OttawaONK1A0N4 Ottawa ON K1A 0N4 Canada Canada

Your file Votre reference ISBN: 978-0-494-58289-3 Our file Notre reference ISBN: 978-0-494-58289-3

NOTICE: AVIS:

The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.

The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.

In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.

While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.

14-1 Canada ABSTRACT

STRAIN CHARACTERIZATION, ANTIMICROBIAL SUSCEPTIBILITY AND COLD-INDUCED GENES OF FLA VOBACTERIUMPSYCHROPHILUM

Shohreh Hesami, Advisors: University of Guelph, 2009 John S. Lumsden, DVM, PhD Janet I. Machines, PhD

Seventy-five isolates of Flavobacterium psychrophilum collected from salmonids with clinical signs of bacterial cold water disease (BCWD) were characterized morphologically, biochemically, serologically, and genotypically. Although the isolates were morphologically and serologically homogeneous, API-ZYM testing revealed two distinct biovars. Four restriction pattern types were detected by 16S rRNA PCR-RFLP analysis. There were significant correlations between biovar I and digestion with Maelll

(p<0.00\) and between biovar II and digestion with Mnll (p<0.05). Detection of nine genotypes within a 194 bp region of 16S sequence type revealed further heterogeneity of which type "a" was the predominant genotype. More than one biovar and genotype was identified among the strains recovered from a single BCWD outbreak, however, no association between genotype or biotype and clinical disease presentation was found.

Management of outbreaks of BCWD often requires the use of antibiotics. The minimal inhibitory concentrations (MICs) of 10 antimicrobial agents were determined by adapting a broth microdilution method, established by the Clinical and Laboratory

Standards Institute for aquatic bacteria with optimal growth temperature below 35 °C.

For most F. psychrophilum isolates there was a very high MIC for two of the four antibiotics licensed for use in Ontario (i.e., ormetoprim/sulfadimethoxine and trimethoprim/sulfamethoxazole). High MICs of florfenicol and oxytetracycline were obtained for 53% and 61% of isolates, respectively. For the majority of strains, the MICs for ampicillin, oxolinic acid and gentamicin were high, while for 83% of the strains tested the MICs for erythromycin were medium and low.

cDNA suppression subtractive hybridization (SSH) was used to identify cold- induced genes in a ulcerative dermatitis and necrotizing stomatitis isolate F. psychrophilum B382-90-4. Genes predicted to encode a two-component system sensor histidine kinase LytS, an ATP-dependent RNA helicase, a multidrug ABC transporter permease/ATPase, an outer membrane protein/protective antigen OMA87, an M43 cytophagalysin zinc-dependent metalloprotease, a hypothetical protein and four housekeeping genes, were up-regulated at 8 °C versus 20 °C. Since no reference gene of

F. psychrophilum was available as an internal standard for use in quantitative real-time

PCR (qPCR), the expression stability of 9 commonly used reference genes was evaluated at 8 °C and 20 °C. Expression of thel6S rRNA gene was equivalent at both temperatures and this gene was used in qPCR experiments to verify the SSH findings. DECLARATION OF WORK DONE

I hereby declare that all work presented in this thesis was performed or directed by myself except for the statistical analysis, which was done by William Sears (Chapter 2) and Dr. John Lumsden (Chapter 3). Jing Zhang provided advice regarding the experimental design of the quantitative real time PCR performed at the Genomics Facility at University of Guelph.

i ACKNOWLEDGEMENTS

I would like to express my sincere appreciation to my advisor Dr. John Lumsden for his dedication to assisting me in my graduate work and for providing valuable guidance and support throughout the duration of these studies.

I would also like to thank my other advisor, Dr. Janet Maclnnes for her support and encouragement throughout my research.

I was fortunate enough to have a great advisory committee members Dr. Carlton Gyles and Dr. Laura Brown who provided me with many helpful suggestions and sound advice.

A particular thanks goes to Devon Metcalf a PhD student of Dr. Weese lab for her guidance and her friendship during this sometimes overwhelming experience. I would also like to thank the members of the fish Pathology lab department of Pathobiology for their technical assistance, friendship and making my time spend during this work enjoyable.

I wish to give a special thank you to my family for their support and for being so patient and understanding.

Financial support for this project was provided by the OMAFRA, ACRDP and NSERC. I was supported in part by Ministry of Science, Research & Technology of Iran.

ii TABLE OF CONTENTS

DECLARATION OF WORK DONE i

ACKNOWLEDGEMENTS ii

TABLE OF CONTENTS iii

LIST OF TABLES vii

LIST OF FIGURES viii

LIST OF ABBREVATIONS ix

CHAPTER 1. REVIEW OF THE LITERATURE 1.1. Introduction 1 1.2. The microbiology of Flavobacterium psychrophilum 1 1.2.1. Taxonomy and isolation 1 1.2.2. Identification : 3 1.3. Diseases caused by Flavobacterium psychrophilum 4 1.3.1. Clinical signs and pathology 4 1.4. Transmission 7 1.5. Putative virulence factors 8 1.5.1. Extracellular protease 8 1.5.2. Bacterial adhesions 10 1.5.3. Cell envelope 11 1.5.3.1. Lipopolysaccharide and outer membrane proteins 11 1.5.3.2. Glycocalyx 13 1.5.3.3. Biofilm formation 14 1.6. Typing schemes 15 1.6.1. Serotyping 15 1.6.2. Molecular typing 16 1.7. Control and treatment 18

iii 1.7.1 Antimicrobial therapy 19 1.7.2.Vaccination 21 1.8. Research proposal 23

CHAPTER 2. PHENOTYPIC AND GENOTYPIC ANALYSIS OF Flavobacterium psychrophilum ISOLATES FROM ONTARIO SALMONIDS WITH COLDWATER DISEASE 2.1. Introduction 27 2.2. Materials and Methods 29 2.2.1. Bacterial strains and growth conditions 29 2.2.2. Biochemical testing 30 2.2.3. API-ZYM profiles 31 2.2.4. Slide agglutination tests 32 2.2.5. DNA extraction and PCR amplification 32 2.2.5. PCR-restriction fragment length polymorphism 33 2.2.6. Sequencing of 16S rRNA gene PCR products 34 2.2.7. Statistical analysis 35 2.3. Results 35 2.3.1. Strain characterization 35 2.3.2. API-ZYM profiles 36 2.3.3. Slide agglutination tests 36 2.3.4. PCR amplification 36 2.3.5. PCR-RFLP 37 2.3.6. Sequencing of 16S rRNA gene PCR products 37 2.3.7. Association between biovars, sequence types and mortality events.. .* 38 2.4. Discussion 46

iv CHAPTER 3. ANTIMICROBIAL SUSCEPTIBILITY OF ONTARIO FLAVOBACTERIUM PSYCHROPHILUM 3.1. Introduction 50 3.2. Materials and Methods 53 3.2.1. Bacterial strains and growth conditions 53 3.2.2. Antimicrobial susceptibility testing 54 3.2.3. Statistical methods 56 3.3. Results and Discussion 56 3.3.1. Strain characterization 56 3.3.2. Antimicrobial susceptibility testing 57 3.3.3. Ormetoprim/sulfadimethoxine and trimethoprim/ sulfamethoxazole 69 3.3.4. Oxytetracycline 69 3.3.5. Florfenicol 70 3.3.6. Erythromycin 71 3.3.7. Oxolinic acid, flumequine and enrofloxacin 71 3.3.8. Gentamicin 72 3.3.9. Ampicillin 73

CHAPTER 4. IDENTIFICATION OF COLD TEMPERATURE REGULATED GENES IN FLA VOBACTERIUMPSYCHROPHILUM 4.1. Introduction 78 4.2. Materials and Methods 80 4.2.1. Bacterial strain and growth conditions 80 4.2.2. RNA isolation 80 4.2.3. mRNA isolation 80 4.2.4. Suppression subtractive hybridization 81 4.2.5. Cloning of PCR products 83 4.2.6. Rapid screening of clones 83 4.2.7. Sequencing 84 4.2.8. Expression analysis of reference gene candidates 84

v 4.2.9. Quantitative real-time PCR (qPCR) amplification of cold-induced genes 85 4.3. Results 86 4.3.1. Suppression subtractive hybridization 86 4.3.2. Quantitative real-time PCR of differentially expressed gene 87 4.4. Discussion 93

CHAPTER 5. GENERAL DISCUSSION 103 REFERENCES 114 APPENDIX 141 A. Nucleotide sequences of the longest insert sequence obtained from subtracted library for each identified gene 141

vi LIST OF TABLES

2.1 Flavobacterium psychrophilum strains used in this study 40

2.2 Sequence of 16S rRNA, gyrase A and gyrase B primers 44

2.3 16S rRNA PCR-RFLP cut-site and sequence type of F. psychrophilum

isolates 45

3.1a F. psychrophilum antimicrobial susceptibility studies using broth

microdilution and agar dilution methods 58

3.1b F. psychrophilum antimicrobial susceptibility studies used agar disk

diffusion agar 60

3.2 MIC (ug/mL) ranges of 10 antimicrobial compounds for

Aeromonas salmonicida ATCC 33658 and Escherichia coli ATCC 25922

atl8°Cand22°C/48h 61

3.3 Minimal inhibition concentration of 10 antimicrobial agents for 72

F. psychrophilum isolates 62

4.1 Primers used in quantitative real-time PCR study 88

4.2 Low temperature induced F. psychrophilum B382-90-4

genes identified by subtractive hybridization 89

4. 3 Quantitative real-time PCR results for target and reference genes 92

vii LIST OF FIGURES

2.1 16S rRNA/gyrA gene duplex PCR of Flavobacterium psychrophilum

isolates, F. aquatile ATCC11947, F. branchiophilum ATCC 35035,

F. columnar is ATCC 49513 and F.johnsoniae ATCC 17061 39

2.2a 194 bp PCR-RFLP products before digestion 39

2.2b 194 bp PCR-RFLP products digestion patterns of F. psychrophilum

isolates with Maelll or with Mnll 39

3.1 Minimum inhibition concentration values ((ig/mL) of 10 antimicrobial

agents for biovar I and biovar II isolates of F. psychrophilum.. 63

3.1a ormetoprim/sulfadimethoxine... 64

3.1b trimethoprim/sulfamethoxazole 64

3.1c oxytetracycline 65

3. Id florfenicol 65

3.1 e erythromycin 66

3.1 f oxolinic acid 66

3.1 g flumequine 67

3.1 h enrofloxacin oxolinic acid 67

3.1i gentamicin 68

3. lj ampicillin , 68

viii LIST OF ABBREVATIONS

ATCC American type culture collection BCWD bacterial cold water disease °C degree Celsius CA cytophaga agar CAMHB cation-adjusted Muller Hinton broth CLS clinical and laboratory standards institute CPS capsular polysaccharide DNA deoxyribonucleic acid dNTP deoxyribonucleotide triphosphate(s) F forward h hour(s) IFAT immunofluorscence antibody technique kDa kilodalton KOH potassium hydroxide LB Luria-Bertani LPS lipopolysaccharide MIC minimal inhibition concentration min minutes

MgCl2 magnesium chloride MLST multilocus sequence typing mM millimolar mL milliliter NaCl sodium choloride OMP outer membrane protein(s) PFGE pulsed field gel electrophoresis PCR polymerase chain reaction qPCR quantitative real-time PCR R reverse RAPD random amplified polymorphic DNA

IX RFLP restriction fragment length polymorphism RNA ribonucleic acid RTFS rainbow trout fry syndrome s second SDS-PAGE sodium dodecylsulphate polyacrylamide gel electrophoresis SSH suppression subtractive hybridization TCSs two component regulatory system(s) TSA tripticase soy agar microgram microliter X-Gal 5-bromo-4-chloro-3-indolyl-P-D-galactopyranoside

x REVIEW OF THE LITERATURE

1.1. Introduction Bacterial coldwater disease (BCWD) is one of the most important bacterial diseases affecting aquaculture worldwide. This disease is caused by the yellow-pigmented bacterium Flavobacterium psychrophilum, which is also the causative agent of rainbow trout fry syndrome (RTFS) in Europe. F. psychrophilum has been reported to cause mortalities in excess of 70 % in outbreaks of RTFS, depending on the species and size of the fish that is infected (Nematollahi et al., 2003a). High mortality rates commonly occur in juvenile trout and salmon, and surviving fish often exhibit vertebral deformations, resulting in economic losses in the aquaculture industry. However, there have been no published studies to estimate the specific cqst of BCWD to the fish farming industry in

North America. Both horizontal and vertical transmission of this fish pathogen have been reported (Nematollahi et al., 2003a). No vaccines are available to prevent BCWD and control of outbreaks involves the use of antimicrobial agents and fish health management practices. This review is concerned primarily with the identification, population structure, antimicrobial susceptibility patterns, and virulence of F. psychrophilum isolated from salmonids.

1.2. The microbiology of Flavobacterium psychrophilum

1.2.1. Taxonomy and isolation

The latest classification by Bernardet (2006) is based on the G+C composition of genomic DNA, 16S rRNA sequence analyses, DNA-rRNA hybridization and profiles of fatty acids and proteins. In this scheme, Flavobacterium psychrophilum (formerly known

1 as Flexibacter psychrophilus and Cytophaga psychrophila) belongs to the phylum

Cytophaga-Flavobacterium-Bacteroides, family Flavobacteriaceae, and genus

Flavobacterium (Bernardet et al., 2006). Several other species of the genus

Flavobacterium, including Flavobacterium columnare, Flavobacterium branchiophilum,

Flavobacterium aquatile and Flavobacterium johnsoniae have also been associated with fish disease (Bernrardet et al., 2006).

Flavobacterium psychrophilum cells are long, slender, flexible, filamentous, gram- negative rods, 3 to 7 urn long and 0.3 to 0.5 (am wide. They are strict aerobes with weak oxidase and catalase activity that are motile by gliding and produce a non-diffusible yellow pigment called flexirubin (Beraaradet et al., 2006).

F. psychrophilum does not grow on commonly used rich media such as blood agar but rather needs to be cultured on specific media that contain only a few nutrients and low salt concentration. Many media have been suggested for the growth of F. psychrophilum. However, cytophaga agar (CA) (Anacker and Ordal, 1959) containing tryptone, yeast extract, beef extract and sodium acetate, is perhaps the most common low nutrient medium that is employed for cultivation of F. psychrophilum. After incubation for 48 to 96 h at 12 to 20 °C the bacterium produces bright yellow, smooth, discreet, circular, convex, and non-adherent colonies on CA. Some strains display a spreading phenotype; both spreading and non-spreading colonies can be seen on the same plate derived from a pure culture (Bernaradet et al., 2006). F. psychrophilum from clinical material tends to be present in mixed culture and isolation of pure cultures from clinical samples can be challenging because of slow growth of the bacteria and the presence of contaminants (Wiklund et al., 2000). The selective inhibitory effect of Congo red on

2 growth of F. psychrophilum provides a simple differentiation test for this pathogen from other yellow- pigmented isolates and other Flavobacterium spp. (Crump and Key, 2008).

The bacterium is described as highly proteolytic and it has been suggested that F. psychrophilum is not able to utilize either simple or complex carbohydrates, although a cytophaga medium supplemented with D(+) galactose, D(+) glucose and L-rhamnose is reported to improve the growth of F. psychrophilum isolates (Daskalov et al., 1999). This bacterium is also reported to have the ability to degrade some polysaccharide components of connective tissue such as chondrotin sulfate and hyaluronic acid (Stringer-Roth et al.,

2002).

1.2.2. Identification

Identification of F. psychrophilum is routinely made on the basis of morphological, biochemical, and physiological characteristics. Current methods for identification of F. psychrophilum include enzyme-linked immunosorbent assay

(Rangdale, 1995), immunohistochemistry (Evensen and Lorenzen, 1996), in situ hybridization (Liu et al., 2001), an antibody-based latex bead agglutination assay (Crump

et al, 2003), immunofluorescence antibody technique (IFAT) (Lorenzen and Karas 1992;

Amita et al., 2000; Madetoja et al., 2000), and flow cytometry (Hibi et al., 2007).

Detection of F. psychrophilum can also be achieved by means of the polymerase

chain reaction (PCR) assays targeting either 16S ribosomal RNA or gyrB genes (Toyama

et al., 1994; Urdaci et al., 1998; Cepeda and Santos, 2000; Izumi and Wakabayashi,

2000). These PCR assays have been used to detect DNA from fish tissue and water

samples (Wiklund et al, 2000; Madetoja and Wiklund, 2002). PCR assays have also

3 been used to identify the pathogen in ovarian fluid and eggs (Izumi and Wakabayashi,

1997; Kumagai and Takahashi 1997; Baliarda et al., 2002), in salmonid gill washings and from benthic diatoms as potential reservoirs of F. psychrophilum (Izumi et al., 2005), and from wax-embedded infected fish tissues (Crumlish et al., 2007). Variations of the PCR assays that have been used include a RAPD PCR (Crump et al., 2001) and a TaqMan

PCR (del Cerro et al., 2002).

1.3. Diseases caused by Flavobacterium psychrophilum

1.3.1. Clinical signs and pathology

The diseases caused by F. psychrophilum are referred to as bacterial cold water disease (BCWD) in North America as well as rainbow trout fry syndrome (RTFS) in

European countries. These two systemic infections (BCWD is an old and general term for multiple presentations sometimes including a septicemic one) can cause significant mortality in salmonids, particularly rainbow trout {Oncorhynchus mykiss) and coho salmon {Oncorhynchus kisutch). F. psychrophilum can also cause disease in non- salmonid fish species, including three species of cyprinids {Cyprinus carpio, Carassius carassius and Tinea tinea), ayu (Plecoglossus altivelis), eel {Anguilla anguilla) and sea lamprey, {Petromyzon marinus) (Lehman et al., 1991; Iida and Mizokami 1996; Elsayed et al., 2006).

Several different pathological manifestations have been described depending on the species and the size of the fish affected by this pathogen (Nematollahi et al., 2003a).

Adult fish suffer from BCWD, which includes a variety of clinical presentations most of which are characterized by extensive necrotic lesions, whereas young fish are affected

4 predominantly by RTFS, a hemorrhagic septicemia associated with severe mortality. In

BCWD, the pathogen often infects the external surfaces of the fish resulting in ulceration of the dermis and necrosis of the underlying muscle. The anal fin region often becomes dark and eroded and progressive ulceration may extend to the whole caudal peduncle, tail, and deep into the muscle tissue and rarely may extend to the spinal cord. The disease may also develop into a bacteriamia/septicemia and necrosis can also be observed in spleen, kidney, liver and other internal organs (Evensen and Lorenzen 1996). Gram- negative filamentous bacteria can often be isolated from the spleen and kidney of fish.

Lesions on other parts of the fish and erosion of fins are also common.

The most commonly recognized form of BCWD is tail-rot or peduncle disease, which is an ulcerative dermatitis that may involve subsequent systemic infection. Two other clinical conditions, necrotic myositis (Lumsden et al., 1996) and cephalic osteochondritis (Ostland et al., 1997) result from an initial systemic spread with localization in muscle/dermis or bone/cartilage. Common to all of these presentations is degradation of connective and muscular tissues by extracellular proteases, several of which have been identified (Bertolini et al., 1994; Ostland et al., 2000; Secades et al.,

2001, 2003). Tail-rot or peduncle disease is usually characterized by development of yellow-edged lesions in the caudal peduncle and the presence of filamentous bacteria in lesions (Holt et al., 1993; Lumsden et al., 1996).

Rainbow trout fry syndrome (RTFS), also called fry mortality syndrome, can be a severe systemic condition that usually occurs in young fish. Mortality rates of up to 70% have been reported in outbreaks of RTFS. Infected fry exhibit lethargy, pale gills, anoxia, anaemia and loss of appetite. Dark pigmentation of the skin and bilateral exophthalmia

5 are other signs of disease. Gross pathologic examination often reveals pale red gills, kidneys, intestines and liver. Lesions in the hindbrain that occur in a number of affected fry may explain the spiral swimming behavior (Nematollahi et al., 2003a). RTFS has primarily been described from salmonids in Europe, however, a similar presentation recently has been reported in North America (Bebak et al., 2007).

Recently an association between a skin condition called red mark syndrome/cold water strawberry disease and F. psychrophilum has been reported in the UK (Ferguson et al., 2006). The disease affects farmed rainbow trout and is present as severe, full- thickness lichenoid lesions that centre on the dermis. In most cases there is no ulceration and affected fish show a chronic dermatitis with an inflammatory response suggesting that an immunological hypersensitivity may be involved (Ferguson et al., 2006). Skin lesion samples of fish with this disease are positive for F. psychrophilum using a species- specific PCR test. In addition, F. psychrophilum antigens are present in skin lesions. The mortality rate associated with strawberry disease is usually low but the morbidity can be as high as 80 percent. The disease seems to be transmissible and it responds to treatment with oxytetracycline (Ferguson et al., 2006).

Strawberry disease was originally described in Idaho, USA (Olson et al., 1985) and similar presentations of disease have also been reported in rainbow trout in other countries including Japan, France, and Spain (Ferguson et al., 2006). However, while F. psychrophilum is reported to be associated with cold water strawberry disease in the UK, no correlation was found between the presence of F. psychrophilum DNA and typical lesions of strawberry disease in the USA (Lloyd et al., 2008).

6 1.4. Transmission

F. psychrophilum has been recovered from spleen, kidney, muscle lesions, brain, egg surface, ovarian fluid and milt of infected fish. Experimental studies have shown that the organism can be transmitted horizontally from fish to fish (Rangdale, 1995; Madsen and Dalsgaard 1999; Madetoja et al., 2000). Transmission is reported to be much higher when the mucus and dermis of the challenged fish are broken experimentally (Madetoja et al., 2000). The high numbers of bacterial cells that are shed from the mucus of infected and dead fish into the water may be the main source of infection (Madetoja et al., 2000).

F. psychrophilum has also been found in river water and associated with algae that grows on the surface of stones in riverbeds (Amita et al., 2000; Madetoja and

Wiklund, 2002; Vatsos et al., 2002). In addition, F. psychrophilum has been found to survive in stream water for several months (Brown et al, 1997; Vastos et al., 2001). The presence of sediment containing nutrients in water is also reported to increase the survival of pathogen (Madetoja et al., 2003). However, there are reports of unsuccessful reproduction of disease in fish through immersion challenges, suggesting that other factors are involved in this process (Iida and Mizokami 1996; Ostland etal., 1997;

Decostere et al., 2001). F. psychrophilum can also be isolated from fish without signs of disease, suggesting that healthy fish as well as infected fish that survive after outbreaks, may act as carriers or reservoirs of this pathogen (Dalsgaard and Madsen, 2000; Madetoja et al., 2000).

The presence of a large number of F. psychrophilum cells in ovarian fluids and the milt of infected salmonids indicates that vertical transmission is also a concern (Holt et al., 1993; Amita et al., 2000, Baliarda et al., 2002; Ekman et al., 2003). Moreover, the

7 fact that disease sometimes occurs without external signs may be due the bacterium being acquired by vertical transmission. Furthermore, there is evidence that vertical transmission is possible through the egg (Brown et al., 1997; Ekman et al., 2003;

Nematollahi et al., 2003; Cipriano, 2005). The contamination of fish and reproductive products by F. psychrophilum may explain the widespread distribution of rainbow trout fry syndrome through the international trade in only a few years (Rangdale et al., 1997;

Izumi and Wakabayashi, 1997; Kumagai and Takahashi, 1997; Kumagai et al., 2000).

1.5. Putative virulence factors

1.5.1. Extracellular proteases

The extensive necrotic lesions and degradation of components of cartilage, connective and muscular tissues observed in infected fish suggest that, among other virulence factors such as LPS, slime layer (Dalsgaard, 1993; Rangdale, 1995) and biofilm formation, production of extracellular proteases plays an important role in the pathogenesis of F. psychrophilum (Bertolini et al., 1994; Ostland et al., 2000; Secades et al., 2001, 2003). It has been proposed that high proteolytic activity correlated with the pathogenicity of this organism. Indeed, the complete genome sequences of F. psychrophilum strain JIP02/86 (ATCC 49511) which was recently published indicates the genome of F. psychrophilum encodes 13 putative secreted proteases that can be correlated with its pathogenicity (Duchaud et al., 2007).

Correlation between protease activity and virulence has been reported in many bacterial fish pathogens, such as Vibrio anguillarum (Varina et al., 2008), Yersinia ruckeri (Fernandez et al., 2002), Aeromonas salmonicida (Rasch et al., 2007),

8 Aeromonas hydrophila (Tan et al., 2008) and Flavobacterium columnare (Staroscik and

Nelson, 2008). Besides providing peptides as nutrients, it seems that bacterial extracellular proteases facilitate invasion and colonization of a pathogen by degradation of connective and muscular tissue components of the host (Secades et al., 2001).

Fppl is a calcium-induced, extracellular 55 kDa metalloprotease, which is produced by F. psychrophilum during the logarithmic phase of growth. This psychrophilic metalloprotease has a broad range of activity in degradation of fish connective and muscular tissues such as gelatin, laminin, fibronectin, fibrinogen, collagen, actin and myosin (Secades et al., 2001). The fact that higher amounts of Fppl are produced by F. psychrophilum cells at 12 °C, compared with 18 °C, may explain in part the occurrence of BCWD at lower temperatures. Moreover, the calcium concentration in fish blood is at the level required for induction of Fppl (Secades et al.,

2001).

Fpp2, another psychrophilic metalloprotease, has a molecular mass of 62 kDa, and is produced by F. psychrophilum under different physiological conditions. In contrast to Fppl, the production of Fpp2 is dependent on the absence of calcium, but its thermal stability requires calcium. The two enzymes are active at different temperatures and pH ranges. Fpp2 is also able to degrade muscle proteins and extracellular matrix proteins such as laminin and fibronectin (Secades et al., 2003).

In addition to these metalloproteases, Madsen and Dalsgaard (1999) reported that an elastin hydrolytic activity is associated with virulence in some F. psychrophilum isolates These researchers reported that the mortality rates in groups of rainbow trout experimentally infected with an elastin-positive strain is much higher than in groups

9 infected with an elastin-negative strain. Additionally, Ostland et al. (2000) reported that an extracellular preparation of a F. psychrophilum strain recovered from a case of necrotic myositis, contained a zinc-dependent and heat-stable metalloprotease that was able to induce severe muscle necrosis in rainbow trout (Ostland et al., 2000).

F. psychrophilum is able to lyse and agglutinate rainbow trout erythrocytes, consistent with the observation that diseased fry exhibit distinct anaemia during infection

(Lorenzen, 1994). In addition, F. psychrophilum has been shown to lyse calf and rainbow trout erythrocytes and grow better on media containing calf or fish blood cells (Lorenzen etal., 1997). This bacterium also grows better on Anacker and Ordal's agar enriched

(AOAE) that contains autoclaved bacterial cells when compared to AOAE without this supplement (Lorenzen et al., 1997).

1.5.2. Bacterial adhesions

Bacterial adherence and colonization are thought to be the initial step in infection.

F. psychrophilum cells are able to adhere to the eggs of rainbow trout (Vatsos et al.,

2001) and to the body surface of ayu (Kondo et al., 2002). Highly virulent strains of F. psychrophilum attach more readily to intestinal explants and fish gill tissue than do low virulence strains (Nematollahi et al., 2003b, 2005). The importance of adherence is suggested by the presence of 27 genes most likely related to bacterial adhesion that have been identified in the genome of F. psychrophilum strain JIP02/86 (Duchaud et al.,

2007). Fifteen of these genes encode proteins with leucine-rich repeats similar to cell surface proteins of Bacteroides forsythus and Treponema denticola. These cell surface

10 proteins are immunogenic in these bacteria and promote bacterial adherence to extracellular components (Duchaud et al., 2007).

Lectins are specific carbohydrates binding proteins, which act as adhesins or hemagglutinins in bacteria. Hemagglutination is caused by adherence of lectins to erythrocytes (IVMler et al., 2003). It has been demonstrated that a sialic acid-binding lectin is involved in the adherence to erythrocytes that is exhibited by hemagglutination- positive strains of F. psychrophilum. Hemagglutination-negative strains lack adhesive ability (IVfoller et al., 2003), however, there was no correlation between adhesive ability and virulence in these strains. Sialic acid is also suggested to be involved in adhesion of

F. psychrophilum cells to rainbow trout phagocytes (Wiklund and Dalsgaard, 2003).

1.5.3. Cell envelope

1.5.3.1. Lipopolysaccharide and outer membrane proteins

Bacterial lipopolysaccharides (LPS) and capsules are components of bacterial cell envelopes that are important in host-pathogen interactions. The outer membrane of Gram- negative bacteria acts as a protective permeability barrier mediated by LPS. Since LPS creates a permeability barrier while also impeding the destruction of the bacterial cells by host serum components and phagocytic cells, it is essential to the function of the outer membrane (Bishop, 2005). It may also be involved in bacterial colonization in host tissue as well (Lerouge and Vanderleyden, 2001). LPS in Gram-negative bacteria is composed of three parts: lipid A which is anchored in the outer membrane, core-oligosaccharide

(OS) and an antigenic O-polysaccharide (PS) (O-antigen). The O-antigen contains long chains of repeating oligosaccharide at the extracellular surface (Bishop, 2005).

11 Depending on the structure, LPS can be characterized as smooth (lipid A/core-OS containing O-PS) or rough (lipid A/core-OS lacking O-PS) (Raetz and Whitfield, 2001).

The composition of the cell envelope of F. psychrophilum has been investigated by several researchers in order to characterize immunogenic components that might be used in vaccines. Analysis by sodium dodecylsulphate polyacrylamide gel electrophoresis

(SDS-PAGE) followed by silver staining suggests that the LPS of F. psychrophilum is a smooth-type LPS and is comprised of the lipid A/core-oligosaccharide (OS) and an O- polysaccharide with various numbers of repeat subunits (LaFrentz et al., 2004, 2007).

Vaccine development studies have identified and characterized several antigens that correspond to F. psychrophilum LPS components. MacLean et al. (2001) found that LPS of F. psychrophilum possesses a highly immunogenic O-polysaccharide fraction that may interact with the rainbow trout immune system to elicit protective immune responses against BCWD. Crump et al. (2001) identified both low and high-molecular-mass lipopolysaccharides in F. psychrophilum. Further analysis indicated that the higher- molecular-mass LPS contained the O-antigen. In addition, MacLean et al. (2001) determined that lipopolysaccharide O-antigen is composed of repeating trisaccharides containing an unusual sugar (N-acylated bacillosamine), which can be used for diagnostic purposes.

The predominant antigen of F. psychrophilum recognized by rainbow trout immune serum is a low molecular mass LPS with molecular weight of 16 kDa, suggested to be involved in bacterial attachment and resistance to phagocytes (Crump et al., 2001).

These authors suggested that the high molecular weight LPS (O-antigen) with a molecular mass of approximately 70 to 200 kDa is not abundant on whole cells, but is

12 present in culture supernatants (Crump et al., 2001). More recent studies by LaFrentz et al. (2007) suggested that the high molecular mass bands of >50 kDa correspond to polysaccharide components of the glycocalyx, since these bands did not stain with silver

(which stains LPS). Immunization with 70-100 kDa antigenic fractions of F. psychrophilum LPS induced protection against BCWD in rainbow trout (LaFrentz et al.,

2004).

1.5.3.2. Glycocalyx

Some bacteria have an additional layer, called the glycocalyx that is external to the cell wall. A glycocalyx is called a slime layer when the polysaccharide molecules are diffuse, irregular and loosely associated with the cell wall, and called a capsule when the polysaccharides form a more distinct structure and are more firmly attached to the cell wall (Vimr and Steenbergen, 2009). The function of the glycocalyx is to protect the bacteria from elements of the host immune system, such as phagocytes. It also allows the bacterium to adhere and colonize in host tissue and may help in the formation of biofilms

(Vimr and Steenbergen, 2009). Electron microscopic examination has shown that cells of this bacterium are surrounded by a thin surface extracellular layer that may be involved in adhesion and gliding motility (Dalsgaard, 1993; Rangdale, 1995) as well as serum resistance (Wiklund and Dalsgaard, 2002). The surface carbohydrates of F. psychrophilum are involved in adhesion to, and stimulation of rainbow trout phagocytes

(Lammens et al, 2000; Wiklund and Dalsgaard, 2003). In addition, Decostere et al.

(2001) reported that surface carbohydrates enable F. psychrophilum cells to survive and grow within spleen phagocytes of rainbow trout fry. However, the exact role of the slime layer in the pathogenesis of F. psychrophilum needs further investigation.

13 1.5.3.3. Biofilm formation

Bacterial motility is an important factor in successful colonization and . It appears that F. psychrophilum lacks pili and flagella, but, like some other members of the CFB

(Cytophaga-Flavobacterium-Bacteroides) group, cells of this bacterium move slowly over surfaces by a process known as gliding motility (Alvarez et al., 2006). Strains that exhibit gliding motility form colonies that show a spreading phenotype (Michel and

Garcia, 2003). Some strains can shift from non-spreading colonies to spreading, and vice- versa. Bacterial motility mechanisms are known to have important roles in biofilm formation. As demonstrated by electron microscopic examination, cells of F. psychrophilum are surrounded by a thin surface extracellular layer which may be involved in adhesion and motility (Dalsgaard, 1993; Rangdale, 1995). In the opportunistic pathogen Pseudomonas aeruginosa, the exopolysaccharide alginate, which is associated with biofilm formation, provides protection against a variety of host factors by inhibiting polymorphonuclear chemotaxis, complement activation, and phagocytosis

(Davey et al., 2003, Wagner and Iglewski, 2008). Interestingly, four proteins similar to alginate-O-acetyltransferases of P. aeruginosa have been detected in the whole genome sequence of F. psychrophilum; these are likely to be involved in biofilm formation

(Duchaud et al., 2007).

14 1.6. Typing Schemes

1.6.1. Serotyping

Several serotyping methods have been used in epidemiological studies and diagnostic tests for F. psychrophilum but there is no general agreement on a single serotyping method for this bacterium. Antisera raised against F. psychrophilum whole cells are highly cross-reactive with other members of the family Flavobacteriaceae, indicating that the use of polyclonal antisera to differentiate members of this family is unreliable (Crump et al., 2003). In addition, Aeromonas salmonicida, another fish pathogen, exhibits cross-reaction with anti-F. psychrophilum serum (Evensen and

Lorenzen, 1996). Studies conducted over 40 years ago indicated that there is a strong serological homogeneity between F. psychrophilum isolated from Pacific salmon and from other areas (Pacha, 1968). More recently, several studies using rabbit or trout mono- or polyclonal antibodies and a variety of techniques, including microtiter or slide agglutination with or without reciprocal absorption of antisera, double immunodiffusion, and enzyme linked immunosorbent assay to suggest that F. psychrophilum isolates consist of three to seven serotypes (Holt, 1988; Wakabayashi et al, 1994; Lorenzen and

Olesen, 1997; Izumi and Wakabayashi, 1999; Faruk, 2000; Dalsgaard and Madsen, 2000;

Mata et al., 2002; Madetoja et al., 2001). Faruk (2000) reported that there is no correlation between serotypes, geographical origin of strains and the host species.

However, Mata et al. (2002) identified seven host-dependent serotypes from isolates worldwide. More recently, Izumi et al. (2003a) proposed a new serotype of F. psychrophilum and evaluated the previous serotyping methods.

15 1.6.2. Molecular typing

A number of molecular typing methods have been used to evaluate the genetic diversity in F. psychrophilum strains isolated from cases of BCWD and RTFS. Analysis of the electrophoretic patterns of F. psychrophilum proteases demonstrated 10 protease patterns with different activities in casein and gelatin degradation. A correlation between protease pattern and virulence was observed (Bertolini et al., 1994). Among various collections of F. psychrophilum, four to eleven plasmid profiles have been identified and there is no correlation with virulence of the strains (Lorenzen et al., 1997; Charkroun et al., 1998; Madsen and Dalsgaard, 2000).

Ribotyping (or rRNA gene restriction pattern analysis) with a number of restriction endonucleases has also been applied for fingerprinting F. psychrophilum strains. Cipriano et al. (1996) found a single ribotype among four strains they tested.

Chakroun et al. (1998) reported a clear correlation between a number of ribotypes and host species, but no correlation between ribotype and geographic origin of the strains.

Madsen and Dalsgaard (2000) investigated 299 Danish strains and found that a single ribotype was highly dominant and there was a correlation between this ribotype, serotype, and virulence. Madetoja et al. (2001) also reported this correlation. However, there was no correlation with the geographic origin in either study.

Random amplified polymorphic DNA (RAPD) analysis can be used for typing F. psychrophilum strains and for differentiation between Flavobacterium species (Chakroun et al., 1998; Crump et al., 2001). In a study by Chakroun et al. (1998), an association between RAPD profiles and host was demonstrated (Chakroun et al., 1998).

16 Amplification of universal versus F. psychrophilum-specific gyrB gene sequences generated a total of four genotypes, and a correlation between RFLP patterns and the species of fish host was observed (Izumi et al., 2003b). In a later study of 244 F. psychrophilum strains by Izumi et al. (2007), PCR-RFLP analysis of the gyrA gene was used to identify eight genotypes, with a possible correlation between one genotype and fish host.

Based on PFGE, the genetic diversity of F. psychrophilum isolated from ayu,

Plecoglossus altivelis and other Japanese fish was examined; 24 distinct PFGE types were identified among 64 isolates that were investigated (Arai et al., 2007). Moreover, there was evidence for host species association with PFGE types. Using the same technique, Chen et al. (2008), reported a higher degree of genetic diversity in PFGE profiles within F. psychrophilum isolated from coho salmon compared with isolates from rainbow trout.

More recently, a multilocus sequence typing (MLST) of 11 protein-coding loci was applied to 50 F. psychrophilum isolates (Nicolas et al., 2008). Among the isolates that were collected from 10 different host species originating from four continents, 33 distinct sequence types were identified. The existence of host-specific associations between clonal types was also demonstrated (Nicolas et al., 2008).

Although the population structure of F. psychrophilum appeared to be serologically homogeneous in early studies, current molecular typing techniques have shown that a high degree of heterogeneity exists among F. psychrophilum isolates. This is likely due to the greater discriminatory power of the newer techniques.

17 1.7. Control and treatment

Due to the wide distribution of F. psychrophilum, prevention of RTFS and

BCWD is difficult. Stresses normally associated with routine fish culture practices (e.g., handling during grading and transport, vaccination, as well as elevated rearing densities, poor water quality, and the presence of other pathogens or parasites) may increase the chances of infection (Evensen and Lorenzen, 1996) when water temperatures are permissive for expression of disease. The main source of infection is the high number of bacterial cells that are shed into the water from the body of infected and dead fish

(Madetoja et al., 2000). Removal of dead and sick fish from the water is therefore extremely important, helping to reduce the bacterial load and the risk of disease transmission. Avoiding crowding and stressful events, optimizing water flows and water quality and good health management practices are important as well. High levels of nitrite and the presence of organic material in the water have been reported to enhance the adhesion of the bacterium to rainbow trout gill tissue in vitro (Nematollahi et al.,

2003). Furthermore, since F. psychrophilum has been detected in ovarian fluid and on egg-surfaces (Holt, 1988; Rangdale et al., 1997; Madetoja, 2002) disinfection of the eggs using an iodophore is a practical method to reduce bacterial contamination.

An alternative treatment to control F. psychrophilum infections is phage therapy.

A number of studies have demonstrated that use of specific phages against various fish and shellfish pathogens such as Aeromonas salmonicida in brook trout (Oncorhynchus fontinalis) (Imbeault et al., 2006), Vibrio harveyi in shrimp (Penaeus monodon)

(Karunasagar et al., 2007), Pseudomonas plecoglossicida in ayu (Plecoglossus altivelis)

(Park et al., 2000) and Lactococcus garvieae in yellowtail (Seriola quinqueradiata)

18 (Nakai et al., 1999) has significantly reduced the impact of pathogens on fish hosts. In a recent study in Denmark, a collection of phages that were able to infect and lyse a wide range of F. psychrophilum strains was isolated and characterized (Stenholm et al., 2008).

The study suggests that F. psychrophilum phages are widely distributed in Danish rainbow trout aquaculture, even during the periods of time without RTFS outbreaks. The authors concluded that certain F. psychrophilum phages had strong lytic activity against pathogenic F. psychrophilum and could provide a potential treatment for RTFS.

An additional strategy to improve resistance to infectious diseases in aquaculture is selective breeding. Considering the wide distribution of F. psychrophilum in nature, the possibility of salmonids being infected at the egg and fry stages when the immune system is not developed, and the fact that no commercial vaccine is available, selectively breeding trout for resistance to F. psychrophilum infections can provide a complementary approach to control of BCWD/RTFS (Hadady et al., 2008). In particular, in a recent study in Denmark, a rainbow trout population exhibited additive genetic variation for resistance to RTFS, pointing out that selectively breeding trout for resistance to this disease may be successful (Henryon et al., 2005).

1.7.1. Antimicrobial therapy

Since no commercial vaccine is currently available, administration of antimicrobials is required to reduce the economic losses caused by BCWD and RTFS.

Infected fish are often treated with antibiotics in their food. Commonly used drugs are oxytetracycline, florfenicol, potentiated sulfonamides including trimethoprim/sulphadiazine and ormetoprim/sulfadimethoxine, ampicillin, oxolinic acid

19 and amoxicillin (Bruun et al., 2000; Dalsgaard and Madsen, 2000; Michel et al., 2003;

Izumi and Aranishi, 2004). Several studies have been published using various susceptibility testing methods for determining antimicrobial susceptibility patterns of F. psychrophilum isolates. In many of these studies there was a noticeable decrease in susceptibility of the isolates to most available antimicrobials during the past decade

(Rangdale et al., 1997; Bruun et al, 2000; Dalsgaard and Madsen, 2000; Michel et al.,

2003; Izumi and Aranishi, 2004, Kum et al., 2008). However, standardized susceptibility testing methodology has not been established for F. psychrophilum and the employment of different methods makes comparison of results problematic.

Although the use of antimicrobials (mainly florfenicol and/or tetracycline) remains the most effective control method against F. psychrophilum infections, the progressive development of resistance to most licensed antimicrobials is a concern.

Consequently, before treating any fish for BCWD or RTFS, it is extremely important to obtain a precise diagnosis and perform in vitro antimicrobial susceptibility testing as well

(Gray and Shryock, 2005). Selection of a method for antimicrobial susceptibility testing is also important as the results may vary depending on the method (Kum et al., 2008).

The results of antimicrobial susceptibility testing should be combined with clinical experience to select the most appropriate antibiotic for treatment of BCWD in accordance with good management practices. An expanded treatment of antimicrobial susceptibility is dealt with in Chapter 3.

20 1.7.2. Vaccination

Despite several studies, there is no commercial vaccine available for diseases caused by F. psychrophilum. These studies have shown that immunization with one strain does not provide good protection against infection from other strains; this is consistent with the existence of considerable genetic variation among F. psychrophilum strains

(Soule et al., 2005a; Hadadi et al., 2008). Passive immunization with trout anti-F. psychrophilum serum does not provide complete protection in experimentally infected rainbow trout indicating that antibody alone is not protective against the bacterium

(LaFrentz et al., 2003). Vaccine development has primarily involved whole-cell bacterins or outer membrane fractions. Administration of whole-cell bacterins by immersion or injection routes induce various levels of protection in challenged fish. Protection is provided to coho salmon {Oncorhynchus kisutch) by immersion with whole-cell bacterins

(Holt, 1988); however, rainbow trout (O. mykiss) are not protected by immersion with separate whole-cell bacterins (LaFrentz et al., 2002, 2003; Rahman et al., 2002).

Outer-membrane fractions of the F. psychrophilum bacterial cell surface have induced significant protection in experimental BCWD challenge (Rahman et al., 2002).

Crump et al. (2001) identified several immunogenic cell surface proteins and LPS antigens of F. psychrophilum which may be potential vaccine targets. Subsequently, the authors described a predominant 20 kDa protein antigen of F. psychrophilum designated

FspA, that might be a good recombinant vaccine candidate since convalescent serum of rainbow trout reacted strongly to this antigen (Crump et al., 2005).

A high degree of protection against BCWD was induced in rainbow trout after immunization with isolated antigenic fractions of F. psychrophilum that ranged in size

21 from 70-100 kDa (LaFrentz et al., 2004). These findings were in accord with those of

Sudheesh et al. (2007) who later reported that immunoproteomic analysis of a virulent and a non-virulent strain of F. psychrophilum in which several proteins of >50 kDa molecular mass were identified. Some low molecular mass proteins that were associated with the virulent strain were also immunogenic.

Further investigations identified two heat shock proteins designated HSP60 and

HSP70 which were strongly recognized by trout serum using Western blot assay

(Sudheesh et al., 2007). However, protection against F. psychrophilum was not generated in rainbow trout following immunization with either recombinant HSP60 or HSP70

(recombinant protein or plasmid DNA), or by these heat shock proteins alone (Plant et al.,2009).

Merle et al. (2003) identified an immunodominant integral membrane glycoprotein OmpA (P60) among 50 cell envelope polypeptides. Further study by

Dumetz et al. (2007) showed that OmpA was extensively located in the cell surface, possibly involved in pathogen-host cell interactions, and was able to induce a humoral response in rainbow trout. In another attempt to develop a vaccine for this fish pathogen, an OmpH-like protein found to be immunogenic and protective in rainbow trout (Dumetz et al, 2006). More recently, an approximately 16 kDa bacterial ribosomal LlO-like protein from F. psychrophilum was detected; when this protein was mixed with adjuvant and injected intraperitoneally, it provided a high degree of protection (82%) in immature rainbow trout and it has been suggested that it may be a recombinant vaccine candidate

(Crump et al., 2007).

22 Bacterial surface membrane vesicles are thought to contribute to pathogenesis as they may contain proteases or toxins (Negrete-Abascal et al., 2000). In search of a new target as a vaccine candidate, Ntoller et al. (2005) characterized two major bands of 62 and 58 kDa that were highly expressed in membrane vesicles of a strain with haemagglutinin activity, suggesting that membrane vesicles may play a role in the host immune response. A previous study by Kondo et al. (2001) indicated that logarithmic phase formalin-killed cells of F. psychrophilum induced immunity to BCWD in ayu

{Plecoglossus altivelis) following oral administration. Furthermore, they found that logarithmic phase F. psychrophilum possessed many outer membrane vesicles on their cell surface (Kondo et al., 2003; IVMler et al., 2003). The authors stated that the antigenicity of logarithmic phase cells may change during bacterial culture. Further investigation showed that membrane vesicles on the surface of F. psychrophilum have an adjuvant activity and combined with formalin-killed stationary phase F. psychrophilum cells induced effective protection in rainbow trout (Aoki et al., 2006).

1.8. Research proposal

Although F. psychrophilum causes considerable economic losses in Canada and worldwide, the mechanism of pathogenicity and the epidemiology of BCWD are still relatively poorly understood. The first hypothesis of this thesis was that strain characterization of Ontario Flavobacterium psychrophilum will identify phenotype and genotype diversity and types of strains that are predominant among Ontario isolates. For this purpose, isolates of F. psychrophilum that had been collected over a 16-year period

23 from farmed salmonids with signs of BCWD were characterized morphologically, biochemically, serologically, and genotypically (Chapter 2).

Vaccines are still at experimental stages and the management of outbreaks of

BCWD often requires the use of antibiotics. The development of antimicrobial resistance in F. psychrophilum is therefore a substantial concern to farmers. No standard method is available for antimicrobial susceptibility testing of F. psychrophilum. The second hypothesis of this thesis was that an adapted broth microdilution antimicrobial susceptibility method could be used to determine minimal inhibition concentrations of antimicrobial agents of the isolates. In chapter three of the thesis, 75 Ontario isolates of

F. psychrophilum were tested for susceptibility to 10 antimicrobial agents including the four that are most commonly used in Ontario, namely, ormetoprim/sulfadimethoxine, trimethoprim /sulfamethoxazole, oxytetracycline and florfenicol.

Finally, as its name suggests, BCWD caused by F. psychrophilum occurs at low water temperatures. The last part of the thesis research was therefore designed to identify genes in F. psychrophilum that are up-regulated by cold temperatures. The identification of cold-induced genes may help to elucidate mechanisms of pathogenesis of this organism; and it may also potentially reveal antigens that could be used to generate novel vaccines. The final hypothesis of this thesis was that cold induced genes of F. psychrophilum would be identified by the PCR-select suppression subtractive hybridization (SSH) method. Suppression subtractive hybridization method was chosen because it is a powerful tool for comparison of genes of related organisms that are differentially expressed under varying conditions. PCR-select SSH was developed by combining four commonly used molecular biological techniques: reverse transcription

24 mediated polymerase chain reaction (RT-PCR), DNA hybridization, cloning, and DNA sequencing.

In summary the major objectives of this research were:

1) to identify Flavobacterium psychrophilum from a collection of yellow-pigmented

bacteria isolated from salmonid fish with the signs of BCWD (Chapter 2),

2) to characterize the isolates phenotypically using bacteriological and biochemical

tests and confirm the identification using 16S rRNA assay (Chapter 2),

3) to characterize the population structure of isolates genotypically, using a restriction

fragment length polymorphism typing method (Chapter 2),

4) to adapt a standard antimicrobial susceptibility testing method for use with F.

psychrophilum (Chapter 3),

5) to identify cold-induced genes in this fish pathogen (Chapter 4) by

i) isolating mRNA from F. psychrophilum grown at two temperatures

ii) synthesizing cDNA by means of a reverse transcription reaction using RNA

obtained from cells grown under the two conditions,

iii) performing PCR-select subtractive hybridization using the cDNA and random

primers,

iv) cloning and sequencing of the differentially expressed DNA fragments..

6) to evaluate reference genes for quantitative real-time PCR with F. psychrophilum.

7) to confirm and further characterize the differentially expressed gene fragments using

quantitative real-time PCR.

Considering the importance of Flavobacterium psychrophilum as a fish pathogen and the significance of BCWD and RTFS, it is important to obtain data relating to

25 population structure, antimicrobial resistance patterns, and the mechanisms of pathogenesis of F. psychrophilum. These data are necessary to provide the scientific background to aid in the development of efficient control strategies for BCWD in aquaculture.

26 CHAPTER 2

PHENOTYPIC AND GENOTYPIC ANALYSIS OF FLAVOBACTERIUM

PSYCHROPHILUMISOLATES FROM ONTARIO SALMONIDS WITH

COLDWATER DISEASE

This chapter corresponds to the following manuscript:

Hesami, S., Allen, K. J., Metcalf, D., Ostland, V. E., Maclnnes, J. I., Lumsden, J. S.

2008. Phenotypic and genotypic analysis of Flavobacterium psychrophilum isolates from

Ontario salmonids with coldwater disease. Canadian Journal of Microbiology 54:619-

629.

2.1. Introduction

The yellow-pigmented bacterium Flavobacterium psychrophilum (formerly known as

Flexibacter psychrophilus or Cytophaga psychrophila) is the etiological agent of bacterial coldwater disease (BCWD) and rainbow trout fry syndrome (RTFS). It causes disease in fresh water-reared salmonids primarily, but other fish species can also be affected (Nematollahi et al, 2003a). Disease caused by F. psychrophilum has been reported in North America, France, Germany, Denmark, United Kingdom, Italy, Spain,

Finland, Belgium, Japan, Korea, Australia and Chile (Nematollahi et al., 2003a). BCWD can present as a diverse array of clinical conditions. The most commonly recognized form is tail-rot or peduncle disease, which is an ulcerative dermatitis that may involve subsequent systemic infection. Two other clinical conditions, necrotic myositis

27 (Lumsden et al., 1996) and cephalic osteochondritis (Ostland et al. 1997) result from an initial systemic spread with localization in muscle/dermis or bone/cartilage. Common to all of these presentations is degradation of connective and muscular tissues by extracellular proteases, several of which have been identified (Bertolini et al. 1994,

Ostland et al. 2000, Secades et al, 2001, 2003). Other putative virulence factors of F. psychrophilum include lipopolysaccharide with unusual O-antigen structure (Dalsgaard and Madsen, 2000; MacLean et al., 2001) and glycocalyx (LaFrentz et al., 2007).

A number of different typing methods have been used to evaluate the genetic diversity in F. psychrophilum strains isolated from cases of BCWD and RTFS including analysis of electrophoretic pattern of proteases (Bertolini et al., 1994), plasmid profiling

(Lorenzen et al., 1997; Chakroun et al., 1998; Madsen and Dalsgaard, 2000), ribotyping

(Cipriano et al., 1996), random amplified polymorphic DNA (RAPD) analysis (Chakroun et al., 1997; Crump et al., 2001), PCR-RFLP (Izumi et al., 2003, 2007), and pulsed-field gel electrophoresis (Arial et al., 2007). In early studies of Danish F. psychrophilum isolates, five different plasmid profiles (Lorenzen et al., 1997) and a single predominant ribotype (Madsen and Dalsgaard, 2000) were reported. In later studies, a higher degree of genetic variation was observed. For example, in a study by Izumi et al. (2007) eight genotypes were detected among 244 F. psychrophilum strains using PCR-RFLP analysis of the gyrA gene. In pulsed field gel electrophoresis studies, 81 isolates of F. psychrophilum from Japan were assigned into 20 clusters and 42 genotypes; one cluster and host species (ayu) was significantly correlated (Arai et al., 2007). Associations between ribotypes and hosts, and between RAPD profiles and hosts have also been demonstrated (Chakroun et al.,1997, 1998). Using suppression subtractive hybridization

28 with a virulent strain (CSF 259-93) and an avirulent strain (ATCC 49418) followed by microarray analysis of 34 strains of F. psychrophilum, Soule et al. (2005a) were able to demonstrate 2 genetic lineages. In these studies there were no clear association with country of isolation, but there was a strong association between lineage I and salmon and lineage II and rainbow trout. As well, these workers demonstrated 2 sequence variants of

16S rRNA genes by PCR-RFLP (Soule et al., 2005b) and further showed an association between the CSF 259-93 allele and lineage II, while both the ATCC 49418 and CSF 259-

93 alleles were associated with lineage I (Ramsrud et al., 2007).

As F. psychrophilum is a fastidious, slow growing, psychrophilic organism that is most often isolated from non-sterile sites, study of this organism can be challenging. In

Ontario, F. psychrophilum infection has considerable economic impact on the aquaculture industry. At present, there are no commercial vaccines available for BCWD and control of the disease involves the use of antimicrobial agents and health management practices (Lumsden et al., 2006). In order to understand the diversity of F. psychrophilum strains and to try to identify typical Ontario strains, 75 isolates recovered from clinically affected fish in Ontario were characterized using a variety of phenotypic and genotypic techniques.

2.2. Materials and Methods

2.2.1. Bacterial strains and growth conditions

Ninety-nine yellow-pigmented bacteria isolated from Ontario rainbow trout

{Oncorhynchus mykiss), Atlantic salmon (Salmo salar), Arctic char {Salvelinus alpinus) and brook trout {Salvelinus fontinalis) with BCWD, two French RTFS isolates, F.

29 psychrophilum ATCC 49510 from the spleen of a rainbow trout fry, F. psychrophilum

ATCC 49511 from the kidney of a rainbow trout fry and F. psychrophilum ATCC 49418 from the kidney of a coho salmon (O. kisutch) were investigated in this study (Table 1).

Among the Ontario isolates, nineteen isolates were obtained from the lesions of separate fish (MM 1-7, 2004; CAF1-6, 2005; MM 1-6, 2005) involved in three mortality events. In addition, genomic DNA of Flavobacterium aquatile ATCC 11947, Flavobacterium branchiophilum ATCC 35035, Flavobacterium columnaris ATCC 49513 and

Flavobacterium johnsoniae ATCC 17061 were used as controls for PCR amplification studies. The Ontario strains, collected from clinically affected fish over a 16-year period, were stored as frozen glycerol stocks at -70 °C. F. psychrophilum strains were grown for 72 to 96 h at 12 °C on modified cytophaga agar (CA) (Anacker and Ordal, 1959) containing 0.05% (wt/vol) tryptone, 0.05% yeast extract, 0.02% beef extract, 0.02% sodium acetate, 0.05% anhydrous calcium chloride, 0.05% magnesium chloride, 0.05% potassium chloride, 1.5% agar and 0.02% gelatin, pH 7.5. Unless otherwise specified, media components were purchased from Difco Laboratories (Detroit, MI, USA) and chemicals were obtained from Fisher Scientific (Toronto, ON, Canada).

2.2.2. Biochemical testing

Preliminary biochemical characterization was carried out as described previously

(Lumsden et al., 1996). Briefly, F. psychrophilum isolates were tested for cytochrome oxidase activity using Dry-Slide test cards containing N,N,N',N'-tetramethyl-p- phenylenediamine dihydrochloride (BD BBL, Franklin Lakes, NJ). A positive reaction was recorded when the color changed to purple within 20 s of application of the bacteria

30 to the card. Production of catalase was measured by suspending 2 to 3 colonies of fresh bacterial culture in a 3% aqueous solution of hydrogen peroxide, on a glass slide.

Appearance of bubbles within 30 s was considered as a positive reaction and was confirmed by microscopy if necessary. Flexirubin pigment was detected by flooding a small mass of bacterial cells on a glass slide with 20% KOH. Color change from yellow to orange, red, or brown on a white background in comparison with the control, and back to the initial color with the addition of an acidic solution, was considered as a positive reaction (Ostland et al., 1994; Bernardet et al., 2002). Growth on trypticase soy agar

(TSA) and on CA with 0.5, 0.8, 1.0 or 2.0% NaCl within 7 days was also tested. As well, growth of isolates at different temperatures was carried out by incubating bacterial cells in early log-phase on CA at 5, 10, 15, 20, 25 and 30 °C for 7 days. Production of gelatinase was tested on CA plates supplemented with 1% gelatin. Strains that produced a zone of clearance around isolated colonies within 7 days were considered positive. All the tests were read daily during the incubation period.

2.2.3. API-ZYM profiles

API-ZYM strips (bioMerieux Durham USA) were used to detect alkaline phosphatase, esterase, esterase lipase, leucine arylamidase, lipase, valine arylamidase, cystine arylamidase, trypsin, alpha chymotrypsin, acid phosphatase, naphthol-AS-BI phosphohydrolase, alpha galactosidase, beta galactosidase, beta glucuronidase, alpha glucosidase, beta glucosidase, N-acetyl beta glucosaminidase, alpha mannosidase and alpha fucosidase activities according to the manufacturer's instructions. Briefly, a bacterial suspension with a turbidity of McFarland standard 5 was made using freshly grown (exponential phase) bacteria in 2 ml of Cytophaga broth. Each cupule received 65

31 uL of the bacterial suspension and the strips were incubated at 12 °C for 18 h. Following incubation, one drop of ZYM A reagent and one drop of ZYM B reagent was added to each cupule. As outlined in the manufacturer's instructions, color development after 5 min was rated from 0 to 5 with 0 to 2 considered negative and 3 to 5 deemed positive.

2.2.4. Slide agglutination tests

Slide agglutination was performed with a saline cell suspension and rabbit antiserum produced against three formalin-killed whole cells of F. psychrophilum: ATCC 49510 an

RTFS isolate from France, a necrotizing myositis isolate B305-94-L2 and a tail rot isolate

B3 82-90-4 from Ontario.

2.2.5. DNA extraction and PCR amplification

Genomic DNA was extracted from F. psychrophilum strains using Genomic Prep

Cells and Tissue DNA Isolation Kits from GE Health care (Buckinghamshire, England) according to the manufacturer's instruction. DNA quantification was done using DNA

Dipstick Kits from Invitrogen (Burlington, Ontario). Duplex PCR amplification was performed using the species-specific 16S rRNA primers FP-1 (5'-

GTTAGTTGGCATCAACAC-3') and FP-2 (5*-TCGATCCTACTTGCGTAG-3') (Urdaci et al., 1998) and with the specific primer pair for the gyrA gene of F. psychrophilum,

GYRA-FP1F (5'-GAAACCGGTGCACAGAAGG-3') and GYRA-FP1R (5'-

CCTGTGGC TCCGTTTATTAA-3') (Izumi and Aranishi, 2004). Each 20 uL PCR reaction mixture contained, 1.0 uL of purified template DNA, 1.0 uL of each dNTP (1.0 mM), 2.0 uL of 10 X buffer (200 mM Tris-HCl (pH 8.4), 500 mM KC1), 0.8 jiL of 50

32 mM magnesium chloride, 1.0 uL (2.5 units) Taq DNA polymerase (Invitrogen life technologies), 1.0 uL (30 uM) of each primer (two forward and two reverse), (Sigma-

Genosys Oakville-ON). PCR amplification was performed in a DNA thermal cycler

(Biometra, Goettingen, Germany) with an initial denaturation step at 95 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, annealing temperature of 58 °C for 1 min, followed by a final extension step of 72 °C for 10 min. Amplification of the gyrB gene of

F. psychrophilum was done using the primer pair PSY-G1F (5'-

TGCAGGAAATCTTACACTCG-3') and PSY-G1R (5'-GTTGCAATTACAATGTTGT-

3') (Izumi and Wakabayashi, 2000).

To identify different 16S rRNA alleles in F. psychrophilum isolates, a primer pair specific for ATCC 40418 alleles [AF49418 (5'-ATAGTGAGTTGGCATCAACACACT-

3') and AR49418 (5'-CGTCAAGCTACCTCACGAGGT-3')] and one specific for CSF

259-93 alleles [AF259-93 (5'-GAAACACTCGGTCGTGACCG-3' and AR259-93 (5*-

GACAACCATGCAGCACCTTG-3')] were used to amplify 298 and 600 bp fragments respectively (Ramsrud et al., 2007). Each 20 uL PCR reaction mixture was assembled as described above and amplification conditions were also as described above.

2.2.6. PCR-restriction fragment length polymorphism (PCR-RFLP)

The primer pair 16S-336 F (5'-AGACTCCTAC GGGAGGCAGC-3') (Warsen et al.,

2004), and 16S-517 R (5'-ATTACCGCGGCTGCTGG-3') (Muyzer et al., 1993) (Sigma-

Genosys Oakville, ON) was used to amplify a 194 bp fragment of the Flavobacterium psychrophilum 16S rRNA gene. Twenty-microlitre PCR reaction mixtures were assembled as described above. PCR was initiated with a 5 min denaturation step at 95

33 °C, followed by 28 cycles of 95 °C for 30 s, 62 °C for 1 min, and 72 °C for 1 min, with a final extension step of 72 °C for 10 min (Soule et al. 2005b). PCR products were ethanol- precipitated and resuspended in 25 uL of sterile distilled water. A 3 uL volume of the

PCR product was checked by agarose gel electrophoresis. Ten microlitres of the amplification product was digested with two U of Mnll (New England Biolabs, Canada) or Maelll (Roche, Canada) in a final volume of 50 uL. The reaction mixtures were incubated overnight at 37 °C (Mnll) or at 55 °C (Maelll). The digested products were analyzed by gel electrophoresis in 3% agarose for typing (Bio Rad Laboratories,

Mississauga, ON). The bands were visualized under UV light after staining the gels with ethidium bromide. The molecular sizes of the fragments obtained were estimated by using 4>X174 RF DNA / Haelll fragments (Invitrogen life Technologist, Burlington, ON) as a reference.

2.2.7. Sequencing of 16S rRNA gene PCR products

PCR products of 194 bp stem loop 3 region were purified using Qiaquick PCR purification kits (Qiagen Inc., Mississauga, ON) according to the manufacturer's instructions. The PCR products were sequenced by dye terminator cycle sequencing

(College of Biological Science DNA facility, University of Guelph, ON) employing the same primers. Sequences were analyzed using the Basic Local Alignment Search Tool

(BLAST) available from the National Center for Biotechnology Information web site

(http://www.ncbi.nlm.nih.gov/).

34 2.2.8. Statistical analysis

Conditional logistic regression (PO.05) was used to evaluate the relationships between the various phenotypic and genotypic features and a Fisher's exact two-tailed test (P<0.05) was used to determine an association between coldwater disease presentation and biovar (SAS, SAS Institute).

2.3. Results

2.3.1. Strain characterization

Based on PCR and biochemical testing, seventy-five of the 99 yellow-pigmented isolates from clinically affected Ontario fish were judged to be F. psychrophilum.

Microscopically, all 75 isolates were long, slender, flexible, filamentous, Gram-negative rods, 3 to 7 jam long and 0.3 to 0.5 urn wide. On CA, most F. psychrophilum colonies were bright yellow, smooth, discreet, circular, convex, and non-adherent. Approximately

50% of the isolates displayed a spreading phenotype, but this phenotype was reversible.

With 20% of isolates, both spreading and non-spreading colonies were seen on the same plate. A non-diffusible flexirubin pigment was detected in all isolates. All isolates were weakly catalase and cytochrome oxidase positive and grew at temperatures between 5 to

25 °C, but not at 30 °C. As well, all isolates grew on media containing 0.5, 0.8, or 1.0%

NaCl, but not on media with 1.5 or 2.0% NaCl. Sixty-seven percent of the isolates grew on TSA after 72 h. Gelatin was hydrolyzed by all the isolates.

35 2.3.2. API-ZYM profiles

Two distinct enzyme production patterns were detected when API-ZYM tests were performed. The three ATCC strains plus 42 Ontario isolates had eight enzyme activities

(alkaline phosphatase, esterase lipase, leucine arylamidase, valine arylamidase, cystine arylamidase, trypsin, acid phosphatase, naphthol-AS-BI phosphohydrolase) and were designated biovar I. In addition to having the above enzyme activities, the remaining 33 strains also produced two or more of the following enzyme activities: alpha- galactosidase, beta-galatosidase, alpha-glucosidase, beta-glucosidase, or N-acetyl-beta- glucosaminidase activities and were designated biovar II.

2.3.3. Slide agglutination tests

About 96% of isolates were reacted with three antisera produced against three F. psychrophilum strains, i. e., ATCC 49510 an RTFS isolate from France, a necrotizing myositis isolate B305-94-L2 and a tail rot isolate B382-90-4 from Ontario.

2.3.4. PCR amplification

Amplicons of the predicted sizes were produced in all ATCC (3) and Ontario F. psychrophilum isolates (75) tested in a duplex PCR that was developed using FP-1 and

FP-2 16S rRNA and GYRA-FP1F and GYRA-FP1R gyrase A gene primers. No amplicons were detected by this duplex PCR test using total cellular DNA from

Flavobacterium aquatile ATCC11947, F. branchiophilum ATCC 35035, F. columnaris

ATCC 49513 or F. johnsoniae ATCC 17061 (Fig. 2.1). Using the gyrB primers PSY-

36 GIF and PSY-G1R, the expected 1017-bp PCR amplicon was generated in only 62 of the

75 isolates tested.

2.3.5. PCR-RFLP

Three approaches were used to look for heterogeneity of the 16S rRNA genes in

Ontario F. psychrophilum isolates. Using the PCR-RFLP method of Soule et al. (2005a) that allows characterization of a 194 bp stem loop 3 region, 4 variants were found. 16S rRNA amplicons from 43 isolates were cleaved by Maelll; 18 were cut with Mnl\, 1 was cut with both enzymes and 16 amplicons were not cut with either enzyme (Table 2.3, Fig.

2.2). There was a statistically significant relationship between biovar II and the presence of the Mnll site (P< 0.49; odds ratio 0.5; CI 0.142-2.434) and a highly statistically significant relationship between biovar I and digestion with Maelll (P < 0.001; odds ratios 1.392, CI 6.355-50.65).

2.3.6. Sequencing of 16S rRNA gene PCR products

In all cases, comparison of the nucleotide sequences of bases 120 to 140 (of the 194 bp 16SrRNA amplicon) was consistent with the observed digestion pattern. A total of 9 different sequence types were present amongst the 78 strains tested. All of the 16S rRNA amplicons that were cut with Maelll were sequence type "a" while those that cut with

Mnll were most often sequence type "c" (13/18) and those that were not cut with either enzyme were predominantly sequence type "d" (12/16).

16S rRNA polymorphisms was also characterized using the specific PCR tests for the

ATCC 49418 and CSF 259-58 alleles described by Ramsrud et al. (2007) (Table 2.1). In

37 addition to the one strain with both restriction sites (no. 96) all of the strains with

16SrRNA amplicons cut by Maelll were amplified with the CSF 259-93 primer pair.

With the exception of strain no. 59 where amplification was detected with only the

ATCC 49918 primer pair, all of the strains that had a 16S rRNA amplicon that cut with

Mnll were amplified with both the CSF 259-93 and ATCC 49418 primer pairs.

2.3.7. Association between biovars, sequence types and mortality events

Isolates from three mortality events were evaluated in this study. In the first, all of the isolates (nos. 75 to 81) belonged to biovar II and 6 of the 7 isolated had the same 16 rRNA alleles, but 2 different sequence types (Tables 2.1 and 2.3). Four of the isolates

(nos. 76-78, 81) were phenotypically and genotypically indistinguishable, but 3 of the 4 were associated with superficial disease (ulcerative dermatitis) while one, no. 78, was recovered from a fish with osteochondritis. In a second mortality event at the same location one year later, 5 of the 6 isolates (nos. 88 to 93) belonged to biovar I, and all were demonstratively different from the isolates recovered in the previous year. In this second mortality event, 4 of the 6 isolates were phenotypically and genotypically identical; all were recovered from fish with ulcerative dermatitis. In the third mortality event that was evaluated, 4 of the 6 isolates had the same 16S rRNA genotype, but 1 of these isolates belonged to biovar I isolate while the rest were biovar II. The sole biovar I strain (no. 84) was indistinguishable from 4 of the isolates (nos. 88, 90-92) characterized in the second mortality event.

38 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 vf 4 7 » »

Fig. 2=1. 16S rRNA / gyrA gene duplex PCR. 100 bp molecular weight marker (lane 1), Flavobacterium psychrophilum isolates nos. 1, 4, 10, 14, 18, 22, 35, 49, 75, 88, 93, 99 (lanes 2 to 13), F. aquatile ATCC11947 (lane 14), F. bronchiophilum ATCC 35035 (lane 15), F. columnaris ATCC 49513 (lane 16), Flavobacteriujohnsoniae ATCC 17061 (lane 17).

(a)

6 •8 9

ILSMJ-

Fig. 2.2. (a). 194 bp PCR-RFLP products before digestion, (b). 194 bp PCR-RFLP products digestion patterns of F. psychrophilum isolates, (f)X174 DNA / Haelll molecular weight marker (lane 1); B216=93=4 (25) (lanes 2 and 3); MM3-Q5 (89) (lanes 4 and 5); CAF8=Q6 (96) (lane 6 and 7), and MM 1=04 (75) lanes 8 and 9 digested with Maelll (lanes 2, 5, 6, and 8) or with Mnll (lanes 3, 4, 7, and 9).

39 Table 2.1. Flavobacterium psychrophilum strains used in this study

Isolate Year of Fish species Tissue ®, disease Biovar 16S RNA 16S allele Isolation RE site F. psychrophilum 1988 Spleen I Maelll CSF 259-93 ATCC 49510(1) 0. mykiss F. psychrophilum 1986 Kidney I Maelll CSF 259-93 ATCC 49511 (2) 0. mykiss F. psychrophilum 1947 Kidney I Mnl\ Both ATCC 49418 (3) 0. kisutch B127-96-1 (4) 1996 0. mykiss Ulcerative dermatitis II - -

B127-96-2 (5) 1996 O. mykiss Ulcerative dermatitis II - - B127-96-3 (6) 1996 O. mykiss Ulcerative dermatitis II - - Lab tr-2 (7) 1996 0. mykiss Ulcerative dermatitis I Maelll CSF 259-93 Lab tr-3 (8) 1996 0. mykiss Ulcerative dermatitis I - - B305-94-1 (10) 1994 O. mykiss Kidney, necrotic I Maelll CSF 259-93 myositis B305-94-2(ll) 1994 O. mykiss Kidney, necrotic I Maelll CSF 259-93 myositis B305-94-3 (12) 1994 0. mykiss Kidney, necrotic I - - mvositis B305-94-4(13) 1994 O. mykiss Necrotic myositis I Maelll CSF 259-93 B305-94-L2 (14) 1994 O. mykiss Necrotic myositis II Mnll Both B305-94-L3(15) 1994 O. mykiss Necrotic myositis I Maelll CSF 259-93 B305-94-L4(16) 1994 O. mykiss Necrotic myositis I Maelll CSF 259-93 B305-94-L5m(17) 1994 O. mykiss Necrotic myositis II Mnll Both B339-96-1 (18) 1996 0. mykiss Necrotic myositis II - - B358-96-1 (19) 1996 O. mykiss Necrotic myositis II - - B388-96(21) 1996 0. mykiss Ulcerative dermatitis II - -

40 Table 2.1. Flavobacterium psychrophilum strains used in this study, continued

B149-95 (22) 1995 0. mykiss Ulcerative dermatitis I Maelll CSF 259-93 B216-93-4 (25) 1993 0. mykiss Ulcerative dermatitis, I Maelll CSF 259-93 necrotizing stomatitis B232-93-1 (26) 1993 0. mykiss Ulcerative dermatitis 11 - - B326-92-1 (27) 1992 0. mykiss Ulcerative dermatitis I - - B220-1 (32) Unknown I Maelll CSF 259-93 B205-3 (33) Unknown I Maelll CSF 259-93 B283-92 (35) 1992 O. mykiss Necrotizing I Maelll CSF 259-93 stomatitis B341-90-l(36) 1990 O. mykiss Ulcerative dermatitis I Maelll CSF 259-93 B349-95-2 (37) 1995 O. mykiss Not recorded II - - B41-96 (38) 1996 O. mykiss Ulcerative dermatitis I Maelll CSF 259-93 B170-96 (39) 1996 O. mykiss Ulcerative dermatitis II Mnll Both B58-97 (40) 1997 O. mykiss Ulcerative dermatitis I Maelll CSF 259-93 B78-97-l(41) 1997 0. mykiss Not recorded II Mnll Both B66-98 (42) 1998 O. mykiss Necrotic myositis I Maelll CSF 259-93 B269-98-4 (43) 1998 S. alpinus Necrotic myositis II Mnll Both B1044-97-1 (44) 1997 O. mykiss Ulcerative dermatitis I Maelll CSF 259-93 B112-97-1 (45) 1997 O. mykiss Ulcerative dermatitis I Maelll CSF 259-93 B12-96-2 (46) 1996 O. mykiss Ulcerative dermatitis I Maelll CSF 259-93 B131-96-2(47) 1996 O. mykiss Necrotic myositis I Maelll CSF 259-93 B160-97-2 (48) 1997 0. mykiss Ulcerative dermatitis I Maelll CSF 259-93 B179-97-4 (49) 1997 O. mykiss Ulcerative dermatitis I Maelll CSF 259-93 B19-93-3 (50) 1993 S. salar Ulcerative dermatitis I Maelll CSF 259-93 B212-97 (51) 1997 0. mykiss Ulcerative dermatitis I Maelll CSF 259-93 B220-3 (53) Unknown I Maelll CSF 259-93 B300-92 (58) 1992 0. mykiss Necrotic myositis I Maelll CSF 259-93 B31-97-1(59) 1997 O. mykiss Not recorded II Mnll ATCC

41 Table 2.1. Flavobacterium psychrophilum strains used in this study, continued

B31-98-2 (60) 1998 0. mykiss Necrotic myositis I Maelll CSF 259-93 B328-96(61) 1996 O. mykiss Not recorded II Mnl\ Both B341-90(62) 1990 O. mykiss Ulcerative dermatitis I Maelll CSF 259-93 B382-90-4 (63) 1990 S. fontinalis Ulcerative dermatitis I Maelll CSF 259-93 B82-97 (64) 1997 S. alpinus Necrotizing stomatitis, I MaeUl CSF 259-93 Osteochondritis B87-95-2 (65) 1995 0. mykiss Necrotizing stomatitis II - - B89-96-3 (66) 1996 Q. mykiss Ulcerative dermatitis II - - F314-98-1(70) 1998 Unknown I Maelll CSF 259-93 MM 1-04 (75) 2004 O. mykiss Ulcerative dermatitis II - - MM2-04 (76) 2004 O. mykiss Ulcerative dermatitis II Mnll Both MM3-04 (77) 2004 0. mykiss Ulcerative dermatitis II Mnll Both MM4-04 (78) 2004 O. mykiss Osteochrondritis II Mnll Both MM5-04 (79) 2004 0. mykiss Ulcerative dermatitis II Mnll Both MM6-04 (80) 2004 0. mykiss Ulcerative dermatitis II Mnll Both MM7-04(81) 2004 O. mykiss Ulcerative dermatitis II Mnll Both CAF2-05 (82) 2005 O. mykiss Ulcerative dermatitis II Maelll CSF 259-93 CAF3-05 (83) 2005 0. mykiss Ulcerative dermatitis II Maelll CSF 259-93 CAFl-05(84) 2005 O. mykiss Ulcerative dermatitis I Maelll CSF 259-93 CAF6-05 (85) 2005 O. mykiss Ulcerative dermatitis 11 Mnll Both CAF4-05 (86) 2005 O. mykiss Ulcerative dermatitis II Maelll CSF 259-93 CAF5-05 (87) 2005 0. mykiss Ulcerative dermatitis II Mnll Both MM2-05 (88) 2005 O. mykiss Ulcerative dermatitis I Maelll CSF 259-93 MM3-05 (89) 2005 O. mykiss Ulcerative dermatitis I Mnll Both MM4-05 (90) 2005 0. mykiss Ulcerative dermatitis I Maelll CSF 259-93 Table 2.1. Flavobacterium psychrophilum strains used in this study, continued

42 MM5-05(91) 2005 0. mykiss Ulcerative dermatitis I MaelU CSF 259-93 MM6-05 (92) 2005 0. mykiss Ulcerative dermatitis I Maelll CSF 259-93 MM8-05 (93) 2005 O. mykiss Ulcerative dermatitis II - - B154-05 (94) 2005 O. mykiss Ulcerative dermatitis II - - B155-06 (95) 2006 S. alpinus Ulcerative dermatitis II Maelll CSF 259-93 CAF8-06 (96) 2006 S. alpinus Ulcerative dermatitis I Both CSF 259-93 CAFl-06(97) 2006 0. mykiss Ulcerative dermatitis II Mnll Both GAF2-06 (98) 2006 S. alpinus Ulcerative dermatitis I Maelll CSF 259-93 CAF3-06 (99) 2006 O. mykiss Ulcerative dermatitis I Maelll CSF 259-93

- = not digested by either enzyme, present of neither of alleles. ®isolates were obtained from the skin/lesion unless otherwise indicated

43 Table 2.2 Sequence of 16S rRNA, gyrase A and gyrase B primers

Amplicon Gene Primer Sequence 5' to 3' Location Reference size bp Bank No. 16S rRNA FP-1 GTTAGTTGGCATCAACAC 186-203 1088® D12670 Urdaci et FP-2 TCGATCCTACTTGCGTAG (1092) al., 1998 1278-1262

16S-336F AGACTCCTACGGGAGGCAGC Warsen et 336-356 al., 2004 194@(181) AY577825 16S-517R ATTACCGCGGCTGCTGG Muyzer et 517-500 al., 1993

AF49418 ATAG T GAG T T GGCAT CAACAC Toyama et 136-160 ACT al., 1994 298 AY662493 AR49418 CGTCAAGCTACCTCACGAGGT Ramsrud et 443-422 al., 2007

AF259-93 GAAACACTCGGTCGTGACCG Ramsrud et 414-434 al., 2007 600 AY662494 AR259-93 GACAACCATGCAGCACCTTG del Cerro 1014-994 et al, 2002

Gyrase A GYRA- GAAACCGGT GCACAGAAGG 1-20 Izumi & FP1F AB158109 396 Aranishi, GYRA- CCTGTGGCTCCGTTTATTAA 396-376 2004 FP1R

Gyrase B PSY-G1F TGCAGGAAATCTTACACTCG Izumi & 1017 5298638 * Wakabaya PSY-G1R GTTGCAATTACAATGTTGT shi, 2000

* not reported or found in published sequences ® reported and calculated sizes slightly different

44 Table 2.3. 16S rRNA PCR-RFLP cut-site and sequence type of Flavobacterium psychrophilum isolates

Sequence Strains® No. of strains Enzyme Sequence (Nucleotides 120-140) type Biovar I

8,12,27 3 Neither D ACTGCTTCGT GAAGCAGCTT 96 1 Both E ACCTCTACCG TGACAGACTT 1,2,7, 10, 11, 40 MaelU A ACTCGGTCGT GACCGAGCTT 13,15, 16,22, 25, 32, 33, 35, 36, 38, 40, 42, 44,45-51,53, 58, 60, 62-64, 70, 84, 88, 90- 92, 95,98, 99 3,89 2 Mnll B ACTACCTCGT GAGGTAGCTT Biovar II

37,94 2 Neither F AACTCTACGT GTAGAGTCTT 75 1 Neither G ACTACTTCGT GAAGTAGCTT 4,5,6,18,19, . 9 Neither D ACTGCTTCGT GAAGCAGCTT 21,26,65,66 93 1 Neither I AGTTCTACGT GTAGAACCTT 82, 83, 86 3 Maelll A ACTCGGTCGT GACCGAGCTT 85,87 2 Mnll B ACTACCTCGT GAGGTAGCTT 14,17,39,41, 13 Mnll C ACCTCTACGT GTAGAGACTT 43,61,76-81, 97 59 1 Mnll H ACTCCCTCGT GAGGGAGCTT

as described in Table 1; note strains 1, 2, and 3 in bold are ATCC isolates, the rest are Ontario strains

45 2.4. Discussion

The strains of F. psychrophilum investigated in this study were isolated from external lesions and internal organs of rainbow trout and other salmonids. Seventy-five isolates in a collection of 99 yellow-pigmented bacteria from diseased fish were found to have biochemical and morphological properties typical of F. psychrophilum (Brown and

Bruno, 2002; Nematollahi et al., 2003a). Amplicons were produced with all of these strains using a duplex PCR that targeted the species-specific 16S rRNA and gyrA genes, but only 62 of 75 strains were amplified using gyrB primers. None of the closely related species that were tested gave amplification products of the predicted size. Taken together, these data suggest that a 16S rRNAJgyrA PCR test might permit rapid and acute diagnosis of F. psychrophilum, but further studies would be needed before it would be used as a routine diagnostic test with clinical samples.

Although the initial biochemical and morphological properties of the Ontario F. psychrophilum isolates suggested that the population was phenotypically highly homogeneous, two distinct API-ZYM patterns were detected. Forty-three of the Ontario isolates (plus three ATCC strains) had proteolytic and lipolytic activities, but no ability to degrade carbohydrates. In addition to having these proteolytic and lipolytic activities, 32 isolates produced two or more enzymes associated with carbohydrate metabolism including alpha-galactosidase, beta-galatosidase, alpha-glucosidase, beta-glucosidase, and N-acetyl-beta-glucosaminidase. It had been reported previously that F. psychrophilum is unable to degrade simple or complex carbohydrates (Bernardet and

Kerouault, 1989; Lorenzen et al, 1997; Madetoja et al., 2001). The difference from earlier reports may be due to differences in the populations of strains examined. In

46 addition to reference strains, which belonged to biovar I, almost all of the isolates examined in earlier studies, were from locations in Europe and many were associated with RTFS rather than BCWD. Based on these and other studies, it appears that

European F. psychrophilum strains may be different than those found in North America, but further studies would be needed to confirm this. In addition, it is not immediately apparent what role in these glycolytic enzymes found in biovar II strains may have in pathogenesis, but it is possible that they aid in nutrient acquisition or in altering host cell surface to facilitate attachment or invasion.

While the number of copies of 16S rRNA genes may vary among bacterial species, their nucleotide sequences are assumed identical, with only minor differences. However,

16S rRNA polymorphism has been described in Escherichia coli, Mycobacterium terrae,

Mycobacterium celatum, Paenibacillus polymyxa, Streptomyces strains (Marchandin et al, 2003) and the genus Vibrio (Moreno et al., 2002). Using a PCR-RFLP technique,

Soule et al. (2005a,b) recently identified two genetic lineages of F. psychrophilum isolates based on six heterogeneous bases within the variable stem-loop region 3 of the

16S rRNA gene. Lineage I strains were characterized by the presence of an Mnll restriction site in the most abundant allele type while the loop 3 amplicons of lineage II strains had an Maelll cleavage site. In these studies, lineage I isolates, which included the avirulent ATCC 49418 strain, were most frequently recovered from Pacific salmon, while the lineage II isolates, which included the virulent CSF 259-93, were isolated primarily from trout. Using specific probes for the ATCC 49418 and CSF 259-93 16S variants,

Ramsrud et al. (2007) analyzed 77 strains from four continents and were further able to show that F. psychrophilum isolates from Pacific salmon were most likely to harbor both

47 alleles while those from rainbow trout were most likely to contain the CSF 259-93 allele alone. The authors, however, cautioned that the pattern of association of genotype with host might reflect ecological associations rather than host specificity.

In the current study of Ontario F. psychrophilum, 4 rather than 2 RFLP variants were found. Eighteen (2 biovar I, 16 biovar II) strains had loop 3 amplicons that cut with Mnll

(lineage I) while 43 (40 biovar I and 3 biovar II) strains had alleles with the Maelll cleavage site (lineage II). In addition, a single biovar I isolate had a dominant allele that cut with both enzymes while 3 biovar I and 13 biovar II isolates cut with neither enzyme

(Table 2.3). These findings were confirmed by sequencing, revealing that there were four

RNA genotypes of biovar I isolates, but strains with sequence type "a" were by far the most commonly found. It might be noted that all six 16S alleles reported in the complete genome sequence of F. psychrophilum ATCC 49511 have sequence type "a" (Duchaud et al., 2007). Eight different sequence types were represented in biovar II, but 21 of the 32 strains had sequence type "c" or "d". The basis of the difference in heterogeneity is not immediately apparent, could conceivably, it could be associated with a less active DNA repair system.

In contrast to the populations of isolates studied by Soule et al. (2005 a, b) and

Ramsrud et al., 2007), we were not able to correlate 16S genotype with host specificity.

All 16S sequence types except "e" included isolates recovered from rainbow trout.

Moreover, it was not possible to associate sequence type with date of isolation or with type of disease. Although it is likely that there are some strains that are better able to infect particular fish hosts, at this time there do not seem to be any simple universal phenotypic or genotypic markers that can used to predict host tropism.

48 The recovery of different genotypes originating from a single mortality event is also noteworthy and deserving of further investigation. Isolation of different clones of F. psychrophilum from single outbreak has been reported previously (Madetoja et al., 2001).

This finding speaks to the need to thoroughly characterize multiple isolates from each outbreak to ensure that appropriate treatment and management practices are used.

In conclusion, our studies have demonstrated the existence of two main lineages among the Ontario F. psychrophilum isolates based on biotype. As well, three predominant 16S sequence types were detected, but there was no association between biotype or 16S genotype and host species or type of disease. These data suggest that similar to opportunistic pathogens such as F. johnsoniae-like organisms where there are no clear virulence markers, host factors may play a decisive role in BCWD (Fleming et al., 2007). Consistent with this notion, recent studies by Johnson et al. (2008) the mortality rate in 71 full-sib families challenged with F. psychrophilum CSF 259-93 ranged between 28 and 99%.

49 CHAPTER 3

ANTIMICROBIAL SUSCEPTIBILITY OF ONTARIO ISOLATES OF

FLAVOBACTERIUMPSYCHROPHILUM

This chapter corresponds to the following manuscript:

Hesami, S., Parkman, J., Machines, J. I., Gray, J. T., Gyles, C. L., Lumsden, J. S. 2009.

Antimicrobial susceptibility of Ontario isolates of Flavobacterium psychrophilum.

Accepted, Journal of Aquatic Animal Health.

3.1. Introduction

The rapid expansion of the aquaculture industry in recent years has been accompanied by increased losses due to systemic bacterial infection throughout the world. The use of antimicrobial agents in the control of bacterial fish diseases has been associated with increased antibiotic resistance in fish pathogens and other aquatic bacteria. For example, acquired sulfonamide resistance in Aeromonas salmonicida subsp. salmonicida, the causative agent of furunculosis in salmonid fish, was reported in the

USA in 1959 and, by the 1960s, multi-resistant strains were detected in Japan (Aoki et al., 1983). Later on, transferable plasmids encoding resistance to sulfonamides, tetracycline, trimethoprim, chloramphenicol and streptomycin have been reported in A. salmonicida strains from many countries around the world (S0rum, 2006). Similarly, in

1980s the use of quinolones resulted in isolates of A. salmonicida with increased resistance to oxolinic acid and flumequine (Sorum, 2006).

50 Flavobacterium psychrophilum is the cause of bacterial coldwater disease

(BCWD), which has deleterious impacts on fish in temperate waters worldwide, and rainbow trout fry syndrome (RTFS) in Europe (Nematollahi et al. 2003a). The optimum growth temperature of this psychrophilic, slow growing bacterium is 12 to 15 °C with the incubation time of 72 to 96 h to grow. F. psychrophilum has been reported to cause mortalities in excess of 70 % depending on the species and size of infected fish and survivors can exhibit spinal cord deformations (Nematollahi et al. 2003a). BCWD causes a diverse array of clinical conditions, of which the most commonly recognized form is tail-rot or peduncle disease, an ulcerative dermatitis that may involve subsequent systemic infection. Two other clinical conditions, necrotic myositis (Lumsden et al.,

1996) and cephalic osteochondritis (Ostland et al., 1997) result from an initial systemic spread with localization in muscle/dermis or bone/cartilage. An acute systemic form described to be similar to RTFS was recently reported in the USA (Bebak et al., 2007) and a similar presentation in Ontario rainbow trout fry is also very common (J. S.

Lumsden, personal communication). Although vaccination is used to prevent many bacterial diseases in fish, there is no commercial vaccine available for the prevention of

BCWD and RTFS. Accordingly, antimicrobial compounds are essential to limit economic losses due to mortality that occurs in clinical outbreaks of F. psychrophilum infection in intensive aquaculture.

Several studies have reported antimicrobial susceptibility results of F. psychrophilum, but differences in the medium and growth conditions used make comparisons amongst'different studies difficult (Rangdale et al., 1997; Schmidt et al.,

51 2000; Bruun et al., 2000, 2003; Dalsgaard and Madsen, 2000; Michel et al., 2003; Izumi and Aranishi 2004). Table 3. La and 3.1.b provide a summary of these studies.

For example, in a study performed in the UK, Rangdale et al. (1997) used modified Anacker and Ordal medium and a broth dilution method and found that F. psychrophilum isolates were susceptible to florfenicol, doxycycline, sarafloxacin, enrofloxacin and oxolinic acid, but resistant to trimethoprim/sulfadiazine, oxytetracycline, ciprofloxacin and amoxicillin. The majority of Danish F. psychrophilum isolates collected over a 1-year period and tested on diluted Mueller Hinton agar by an agar dilution method had increased resistance to oxolinic acid, sulfadiazine-trimethoprim, amoxicillin and oxytetracycline (Schmidt et al., 2000). In the same study, all of the strains tested were susceptible to florfenicol (Schmidt et al., 2000). In a second study, using the same method and medium, Bruun et al. (2000) detected resistance of Danish F. psychrophilum to various antimicrobials including oxytetracycline, oxolinic acid, amoxicillin, trimethoprim/sulfamethoxazole and sulfadiazine; again, all isolates were susceptible to florfenicol. In a third study of Danish isolates, more than half of 250 F. psychrophilum isolates were resistant to oxolinic acid and oxytetracycline but none were resistant to amoxicillin when they were tested by a disk diffusion assay on cytophaga agar (Dalsgaard and Madsen, 2000).

In a recent study in Turkey, different results were observed even for the same antimicrobial agent using either disk diffusion or agar dilution methods (Kum et al.,

2008). In that study, the modified Mueller-Hinton agar as described by Hawke and

Thune (1992) was used to evaluate the susceptibility of 20 F. psychrophilum isolates.

They found that 90% of isolates were resistant to amoxicillin-clavulanic acid using disk

52 diffusion, while only 15% of isolates showed resistance to this agent using agar dilution method. In the case of oxytetracycline, 20% of isolates were found to be resistant using disk diffusion compared with 75% using agar dilution. However, the authors noticed that resistance of isolates to gentamicin (disk diffusion method: 70%; agar dilution method:

95%), erythromycin (65%; 100%), and sulfamethoxazole-trimethoprim (75%; 100%) was high, while resistance to enrofloxacin (10%; 15%) as well as florfenicol (25%; 25%) was low using either method.

In the present study of Ontario F. psychrophilum isolates, we employed an adapted version of a recently standardized broth microdilution method recommended by the

Clinical and Laboratory Standards Institute (CLSI) for aquatic bacteria with optimal growth temperature below 35°C (Miller et al., 2005; CLSI 2006a). In this adapted method, the incubation temperature of 18 °C instead of 22 °C, and incubation time of 72 h instead of 24 or 48 h, were used to provide the optimal growth condition for this slow growing psychrophilic fish pathogen. This work provides a baseline to which future studies can be compared to determine trends in antimicrobial resistance.

3.2. Materials and methods.

3.2.1. Bacterial strains and growth conditions

A total of 75 F. psychrophilum strains were obtained from rainbow trout

(Oncorhynchus mykiss), Atlantic salmon (Salmo salar), and Arctic charr (Salvelinus alpinus) with tail rot, necrotic myositis, and osteochondrosis. Three reference strains were included: two isolates from France, (F. psychrophilum ATCC 49510 from the spleen of a rainbow trout and F. psychrophilum ATCC 49511 from the kidney of a

53 rainbow trout) and F. psychrophilum ATCC 49418 from the kidney of a coho salmon (O. kisutch) from the USA (Hesami et al., 2008). F. psychrophilum strains were grown for

72 to 96 h at 12 C on modified cytophaga agar (CA) (Anacker and Ordal 1959) containing 0.05% (wt/vol) tryptone, 0.05% yeast extract, 0.02% beef extract, 0.02% sodium acetate, 0.05% anhydrous calcium chloride, 0.05% magnesium chloride, 0.05% potassium chloride, 1.5% agar and 0.02% gelatin, pH 7.5. The isolates were characterized phenotypically, biochemically and confirmed to be F. psychrophilum by

16S rRNA PCR assay as described previously (Hesami et al., 2008). API-ZYM strips

(bioMerieux, Durham USA) were used according to the manufacturer's instructions to detect enzyme profiles in isolates. For MIC determinations, two quality control strains A. salmonicida subsp. salmonicida ATCC 33658 and E. coli ATCC 25922 were grown on trypticase soy agar (TSA; Difco Laboratories, Detroit, USA) at 25 and 37 °C, respectively.

3.2.2. Antimicrobial susceptibility testing

To determine antimicrobial susceptibility patterns, the minimal inhibitory concentrations of ten antimicrobial agents were assessed using custom TREK

SENSITITRE susceptibility plates for aquaculture (Trek Diagnostic system, Cleveland,

USA). The MIC test plates were 96-well dry-form plates that contain a 2-fold serial dilution of the following ranges of antimicrobial agents: enrofloxacin (0.002 to 1 ug/mL), ampicillin (0.03 to 16 ug/mL), oxytetracycline (0.015 to 8 Ug/mL), erythromycin (0.25 to

128 ug/mL), florfenicol (0.03 to 16 ug/mL), flumequine (0.008 to 4 ug/mL), ormetoprim/sulfadimethoxine (0.008/0.15 to 4/76 ug/mL; first value = ormetoprim, second

54 value = sulfadimethoxine), oxolinic acid (0.004 to 2 ug/mL), gentamicin (0.06 to 4

|ag/mL), and trimethoprim/sulfamethoxazole (0.015/0.3 to 1/19 ug/mL; first value = trimethoprim, second value = sulfamethoxazole). The positive growth control well contained no antimicrobial agent.

Colonies of F. psychrophilum and quality control strains were grown on CA and

TSA, respectively. As described in the manufacturer's instructions, bacterial colonies were added to 5 mL of Sensititer demineralized water until the turbidity was similar to that of a 0.5 McFarland standard. Approximately 30 uL of E. coli ATCC 25922, 35 uL of

A. salmonicida ATCC 33658 and 50 uL of F. psychrophilum suspension was transferred separately into 11 mL of Sensititer cation-adjusted Mueller-Hinton broth (CAMHB).

These volumes provided standardized inocula equal to 5.0><105 CFU/mL. Wells of the microtiter plate were inoculated with 100 uL suspensions of the organisms. After covering all wells with an adhesive seal, the plates were incubated at 18 °C for 72h.

Results were evaluated visually with SensiTouch plate reader (TREK Diagnostic

Systems, Cleveland, USA). Gram-stained smears from the positive control wells were examined to check for purity. The minimum inhibition concentrations were recorded as the lowest concentrations of antimicrobial agent that inhibited visible growth of bacteria.

Each isolate was tested at least three times and the most common value of three repeats was reported. For purposes of comparison, the MIC values of F. psychrophilum isolates were compared with the A. salmonicida quality control strain but were also designated as high, medium and low as indicated by the concentration supplied by the Sensititer plates.

For all antimicrobials except gentamicin and trimethoprim/sulfamethoxazole, the highest three concentrations are designated 'high', the middle three 'medium' and lowest four

55 'low'. For gentamicin and trimethoprim/sulfamethoxazole, with only seven concentrations supplied there are only 'high' (highest three concentrations) and 'low'

(lowest four) designations used.

3.2.3. Statistical methods

JMP software (SAS Institute, Cary, NC, USA) was used for statistical analysis.

MIC data for each isolate was ordinally ranked and the number of isolates with high MICs for Canadian-licensed antimicrobials was compared by a Wilcoxon two-sample test.

Ranked data was analyzed by an ordinal logistic regression to determine differences in

MICs between biovar I and biovar II strains and between florfenicol susceptibility of strains isolated before and after 1996, the year that florfenicol was available for use in

Canada.

3.3. Results and Discussion

3.3.1. Strain characterization

Bacterial isolates were confirmed to be F. psychrophilum based on a species- specific PCR, biochemical testing and on morphological appearance (Hesami et al.,

2008). The isolates were also biotyped using the API-ZYM test. Two distinct enzyme production patterns were detected when API-ZYM tests were performed. The three

ATCC strains and 42 Ontario isolates which had eight enzyme activities were designated biovar I while the remaining 33 isolates, which had two or more additional enzyme activities, were designated biovar II strains (Hesami et al., 2008). All but three strains of biovar II grew well in CAMHB (biovar I, n=42, biovar II, n=30) and those three strains

56 were excluded from subsequent testing (total n=72). The F. psychrophilum ATCC strains required a longer incubation time to grow to a density that was adequate for interpretation.

3. 3. 2. Antimicrobial susceptibility testing

The MIC values obtained with the two quality control strains, E. coli ATCC 25922 and A. salmonicida subsp. salmonicida ATCC 33658, grown in the present study at 18 °C and 22 °C, for 48 h, were within the range published by CLSI which used 22° C for bacterial growth (Miller et al. 2005) (Table 3.2). The distribution of the number of F. psychrophilum isolates within various minimal inhibition concentrations for 10 antimicrobial agents is shown in Table 3.3. The MIC value distributions for 10 antimicrobial agents used in this study including the four antimicrobials licensed for use in food fish i in Canada (ormetoprim/sulfadimethoxine (Romet 30), trimethoprim/sulfamethoxazole (Tribrissen®), oxytetracycline (Terramycin®) and florfenicol (NUFLOR®)) and for erythromycin; available on an emergency drug-release basis, are shown in Figures 3.1a-j.

Of the 42 biovar I strains and 30 biovar II strains evaluated in this study, the biovar II strains were significantly (p<0.05) less susceptible to florfenicol (Figure 3.1a), oxytetracycline (Figure 3.1b), erythromycin (Figure 3.1c), ampicillin (Figure 3.1e), and gentamicin (Figure 3.1i). There were no significant differences between the two biovars for the remaining five antimicrobials that were assayed. The MIC values of all antimicrobial agents tested for F. psychrophilum ATCC strains were consistently lower than the MIC values of the clinical isolates (results not shown).

57 Table 3.1a. Flavobacterium psychrophilum antimicrobial susceptibility studies using broth microdilution and agar dilution methods

NCIMB 1947* Antimicrobial agent (ranges) MIC (ug/mL) Criteria for resistance Study MIC (ng/mL) and percentage of isolates

Rangdale et al., 1997 0.000977 Enrofloxacin (0.00098-0.25) MIC90= 0.125 NA

Used broth microdilution and MAOB 0.00391 Ciprofloxacin (0.0005-0.5) MIC90= 0.25 NA for 47 F. psychrophilum isolates 0.00195 Sarafloxacin (0.000195-8.0) MIC90=2.0 NA

0.25 Oxolinic Acid (0.03125-16.0) MIC90= 2.0 NA

0.125 Doxycycline (0.03125-8.0) MIC90= 2.0 97% >4.0 and 8.0

0.125 Oxytetracycline (0.03125-64.0) MIC90=32.0 28% <=1.0

0.0625 Amoxicillin (0.00195-64.0) MIC90=1.0 94%<=1.0

16.0 Trimethoprimsulfa (8.0-512.0) MIC90=256.0 NA

0.5 Florfenicol( 0.00098-16.0) MIC90=8.0 NA

Schmidt et al., 2000 0.063-0.125 Oxytetracycline (0.125-1,024) 1.0-8.0 71%

Used agar dilution method and MMHA 0.25 Oxolinic acid (0.125-1,024) 4.0-16.0 100% for 89 isolates NA Trimethoprimsulfa (0.125-1,024) 50.0-100.0 100%

0.016-0.125 Amoxicillin (0.125-1,024) 1.0-2.0 50%

NA Florfenicol (0.125-1,024) NA resistance not found

58 Table 3.1a. Flavobacterium psychrophilum antimicrobial susceptibility studies using broth microdilution and agar dilution methods,

continued

Bruun et al., 2000 0.13-0.25 Oxolinic acid (0.016-256) MIC mean 6.4 66%

Used agar dilution and MMHA 0.063-0.13 Amoxycillin (0.016-256) MIC mean 2.0 11%

for 387 isolates 16-32 Trimethoprimsulfa (0.016-256) MIC mean 113 98%

0.063-0.13 Oxytetracycline (0.016-256) MIC mean 5.2 68.2%

0.5-1.0 Florfenicol (0.016-256) MIC mean 0.61 100%

!Cum et al. 2008 NA Amoxicillin-clavulanic acid (2.0->256.0) 15%>64.0

Used agar dilution and MMHA Gentamicin (4.0-256.0) 95% >265

for 20 isolates Erythromycin (16.0-256.0) 100%>128.0

Enrofloxacin (2.0-32.0) 15%>8.0

Florfenicol (0.5.0-16.0) 25%>8.0

Oxytetracycline (1.0-256.0) 75% > 16.0

Trimethoprimsulfa (4.0-256.0) 100%>4.0/75.0

NCIMB 1947=Quality control strain F. psychrophilum NC1MB 1947; MAOB= Modified Anacker and Ordal; MMHA=Modified Mueller-Hinton Agar; CA=

Cytophaga Agar; NA= Not Available

59 Table3.1b. Flavobacterium psychrophilum antimicrobial susceptibility studies using agar disk diffusion agar

Study Method Medium Antimicrobial agent Disk content of antimicrobial (ug) Zone diam (mm)

Dalsgaard and Madsen, 2000 Disk diffusion agar CA Amoxicillin 30.0 100% >43

for 250 isolates Oxolinic acid 10.0 59%<30(in 1994)

52%<30(inl995)

Oxytetracycline 80.0 53% < 42 (in 1994)

76% < 42 (in 1995)

Kum et al. 2008 Disk diffusion agar MMHA Amoxicillin-clavulan ic acid 30.0 90%< 14

for 20 isolates Gentamicin 10.0 70%< 12

Erythromycin 15.0 13%<13

Enrofloxacin 5.0 10%<15

Florfenicol 30.0 25%< 14

Oxytetracycline 30.0 20%< 14

Trimethoprimsulfa 25.0 75%< 10

NCIMB 1947= Quality control strain F. psychrophilum NCIMB 1947; MAOB= Modified Anacker and Ordal; MMHA=Modified Mueller-Hinton Agar; CA= Cytophaga Agar

60 Table 3.2. MIC (ug/mL) ranges of 10 antimicrobial compounds for A. salmonicida ATCC 33658 and E. coli ATCC 25922 at 18 °C and 22 °C/48 h.

A. salmoncida E. coli Antimicrobial agent ATCC 33658 ATCC 25922 18C/48h 22 C/48 h 18 C/48 h 22 C/48 h

Enrofloxacin 0.03 0.015 0.008 0.004 Ampicillin 1 0.5 8 Oxytetracycline 1 0.25 1 Erythromycin 16 16 Not tested Florfenicol 2 1 8 8 Flumequine 0.12 0.06 0.25 0.25 Ormetoprim/sulfadimethoxine3 0.5/9.5 0.5/9.5 1/19 0.5/9.5 Oxolinic acid 0.03 0.03 0.12 0.12 Gentamicin 1 1 0.25 0.5 Trimethoprim/sulfamethoxazoleb 0.25/4.8 0.25/4.8 0.12/2.4 0.12/2.4

a First value indicates concentration of ormetoprim; second value concentration of sulfadimethoxine b First value indicates concentration of trimethoprim; second value concentration of sulfamethoxazole

61 Table 3.3. Minimal inhibition concentration of 10 antimicrobial agents for 72 Flavobacterium psychrophilum isolates.

MIC Range (ug/mL)

Antimicrobial Agent 0.002 0.004 0.008 0.015 0.03 0.06 0.12 0.25 0.5 1 2 4 8 16 32 64 128

Enrofloxacin 0 0 0 P 9 6 14" 14 11 17c 3 4 4 2 7 2 2 10 4 34 Ampicillin . 0 3 5 5 4 . 4 7 6 10 28 Oxytetracycline 1 4 12 10 3 14 16 10 2 0 Erythromycin 0 0 0 2 5 13 14 12 16 10 Florfenicol 0 0 1 9 9 17 11 15 10 Flumequine 0 0 0 0 0 3 2 1 6 11 49 Ormetoprim/Sulfa 0 1 1 3 7 16 17 27 Oxolinic Acid 0 0 0 0 0 6d 6 11 49 Gentamicin 0 0 0 3 5 15 49 Trimethoprim/Sulfa

1 Antimicrobial concentrations in bold were designated as low b Antimicrobial concentrations that were designated as moderate without bold or underlining c Underlined antimicrobial concentrations are designated as high Since there were only seven concentrations of gentamicin and trimethoprin/sulfa no moderate designation was used

62 Figure 3.1. Minimum inhibition concentration (ug/mL) of a) ormetoprim/sulfadimethoxine, b) trimethoprim/sulfamethoxazole, c) oxytetracycline, d) fiorfenicol, e) erythromycin, f) oxolinic acid, g) flumequine h) enrofloxacin, i) gentamicin and j) ampicillin for biovar I and biovar II isolates of Flavobacterium psychrophilum.

63 «n o IIA1 fk HNUlW °r> o o \ - n •<£• ..U~_J_—iLJ1._- %h o '^S <> ^ % % < o' 03 CO D • -* ™.

"l f 1 Number ofisolates

o o az n n tar r op t t ft H ime |Hri © f& ^5 3 1—* gj <*5 BT *—» TO* e m 3 Q § CD O D • Number ofisolates < o TO* •n C 3 ofS' Number of isolates e Number of isolates ••J c l-» H> M H» H» to o NJ *• en oo o NJ ONiimoooMjsmco

^ o. °s ^

• ^ ft «••- O o (A S3

ON c n © mi 8

*> *>

D D • CO 5s 03 CO o' o" o o' < 0<) < < a. & Figure 3.1e

Erythromycin 12

| 10 ••!

9 6 • Biovarl DBiovarll JEL $ J \ % * «b sfe fy y» o^ S MICs

Figure 3. If

OxolinicAcid 45 40 35 -j I 30 -1 25 i 20 4 4i 15 4 £ • Biovarl 3 10 -j 5 -I DBiovarll z i 0 c^ c?> >i> ~~& \V •& jf~~

~~66 Figure 3.1g~~

~~Flumequine~~

~~12 1 10 -j I 8 i i 6 OP JQ 1 E 4 1 • Biovarl i z 2 4 DBiovarll oi~~

~~MICs~~

~~Figure 3.1h~~

~~12 Enrofloxacin io 4 J5 8~~

~~6 i 41 £ I Biovarl 3 Z iBiovarll~~

~~C> CS^ C^ CV> C^ O -^ ft*5 '> $>' O- O- O-~~

~~MICs~~

~~67 Figure 3.1i~~

~~Gentamicin 30 -~~

~~M 25 - 1 20 -~~

*S 15 - V- • Biovarl

~~3 Q Biovarl! 2 5 - • ill n <=0.06 0.12 0.25 0.5 1 2 >=4~~

~~MICs~~

~~Figure 3.1j~~

~~25 Ampicillin -o 20 £ IS g 15 ^~~

~~X 10 • Biovarl~~

~~a Biovarl Ji M Jo . • Jo. <3> & N a ** % /£~~

~~MICs~~

~~68 3.3.3. Ormetoprim/sulfadimethoxine and trimethoprim/sulfamethoxazole~~

For ormethoprim/sulfadimethoxine, 91.7, 8.3 and 0% of isolates were inhibited by high, medium and low concentrations, respectively (Table 3.3, Figure 3.1a). For trimethoprim/ sulfamethoxazole, 95.8 and 4.2% of isolates were inhibited by high and low concentrations, respectively (Table 3.3, Figure 3.1b).

Sulfonamides and diaminopyrimidines inhibit the folate pathway in bacteria far more efficiently than in eukaryotes. These agents are not particularly effective against bacteria when they are used alone. However, when combination of diaminopyrimidines and sulfonamides are employed, they display a synergistic inhibitory effect on microorganisms (Guardabassi and Courvalin, 2006). Examples of such potentiated sulfonamide preparations include trimethoprim/sulfamethoxazole and ormetoprim/ sulfadimethoxine used in aquaculture. High MIC values for trimethoprim/sulfadiazine have been reported by several investigators for F. psychrophilum (Rangdale et al., 1997;

~~Schmidt et al., 2000; Dalsgaard and Madsen, 2000). It has also been suggested previously that F. psychrophilum is intrinsically resistant to potentiated sulfonamides~~

~~(Bruun et al., 2000), although the mechanism is not known.~~

~~3.3.4. Oxytetracycline~~

High concentrations of oxytetracycline inhibited 61.1% of F. psychrophilum isolates, while 20.8 and 18.1% of strains were inhibited by medium and low concentrations, respectively (Table 3.3, Figure 3.1c). Tetracyclines inhibit bacterial protein synthesis by binding to the 3 OS subunit of the bacterial ribosome (Guardabassi and Courvalin, 2006) and are widely used in aquaculture as antibacterial agents for

~~69 treatment of various fish diseases such as vibriosis and furunculosis (Shao, 2001).~~

~~Oxytetracycline, an analogue of tetracycline, is the most widely used drug in North~~

~~America for the treatment of fish disease including BCWD (Shao, 2001; Soule et al.,~~

~~2005b). Oxytetracycline was effective in field outbreaks of RTFS in Europe during the~~

1980s (Lorenzen et al. 1991) but the effectiveness of oxytetracycline decreased during the next decade (Bruun et al. 2000). More recently, the majority of Danish isolates were reported to be resistant to this drug (Lorenzen 1994; Bruun et al., 2000, 2003).

~~Correlation between the MIC value of F. psychrophilum strains and clinical response to oxytetracycline following experimental injection has been demonstrated (Bruun et al.,~~

~~2003).~~

~~3.3.5.' Florfenicol~~

High concentrations of florfenicol inhibited 52.8% of F. psychrophilum isolates, while 44.4 and 2.8% of isolates were inhibited by medium and low concentrations, respectively (Table 3.3, Figure 3.Id). In Canada, florfenicol has been approved by the

Canadian Veterinary Drug Directorate since 1996 for treatment of bacterial infections in salmonids. It is the most recently introduced antimicrobial agent used in Ontario fish farms and is the drug of choice for farmers treating smaller fish with BCWD (J. S.

Lumsden, personal communication). Florfenicol is a fluorinated structural analogue of thiamphenicol and chloramphenicol approved exclusively for veterinary use; however, chloramphenicol, from which florfenicol is derived, was used for many years in human and veterinary medicine.

~~70 Bacterial cross-resistance to chloramphenicol and florfenicol is being increasingly reported in microbes cultured from domestic animals other than fish~~

(Arcangioli et al., 2000; White et al, 2000; Cloeckaert et al., 2001). In recent studies in the U.K. and Denmark, F. psychrophilum isolates were found to be susceptible to florfenicol (Rangdale et al., 1997; Bruun et al., 2000; Schmidt et al., 2000). In France, chloramphenicol resistance was more frequent than florfenicol resistance in RTFS isolates (Michel et al., 2003). Given these data and the relatively recent introduction of florfenicol in Canada, the proportion of isolates with high MIC values was unexpected. It is notable, however, that there was no difference in MICs for florfenicol in F. psychrophilum isolates collected before 1996 versus those obtained after that date.

~~3.3.6. Erythromycin~~

~~High concentrations of erythromycin were required to inhibit 16.7% of isolates, while medium and low concentrations inhibited 45.8 and 37.5%, respectively (Table 3.3).~~

~~The histogram for MICs of erythromycin has a bimodal distribution (Figure 3.1e).~~

Erythromycin is not registered for use in food fish in Canada; however, it is available on an emergency drug release application basis and has been used primarily for the treatment of broodstock as part of a program to reduce the impact of Renibacterium salmoninarum, the causative agent of bacterial kidney disease.

~~3.3.7. Oxolinic acid, flumequine and enrofloxacin~~

~~Eighty-three, 15.5 and 1.4% of isolates were inhibited by high, medium and low concentrations of oxolinic acid, respectively (Table 3.3, Figure 3.If). Oxolinic acid is a~~

~~71 - synthetic quinolone antimicrobial that inhibits DNA gyrase, the enzyme that catalyzes~~

~~DNA topological changes necessary for DNA replication in bacteria (Guardabassi and~~

~~Courvalin, 2006). Danish F.psychrophilum isolates obtained from 1994-1998 were found~~

~~to be less susceptible to oxolinic acid than those obtained earlier (Bruun et al. 2000). In~~

~~addition, about half of the F. psychrophilum isolates from Japan and the United States~~

~~were resistant to both oxolinic acid and nalidixic acid as a result of mutation in the A~~

~~subunit of DNA gyrase (Izumi and Aranishi 2004). Fifty, 48.6 and 1.4% of isolates were~~

~~inhibited by high, medium and low concentrations of flumequine, respectively (Table 3.3,~~

~~Figure 3.1g). Flumequine is a first generation fluoroquinolone that also inhibits DNA~~

~~gyrase. Higher MICs (> 0.03 ug/mL) for enrofloxacin, another fluoroquinolone, were~~

~~also detected for the majority of the isolates. Fifty-eight point three, 40.3 and 1.4% of~~

~~isolates were inhibited by high, medium and low concentrations of enrofloxacin,~~

~~respectively (Table 3.3, Figure 3.1h). Quinolones are widely used both in human and in~~

~~veterinary medicine for treatment of a variety of bacterial infections (Endtz et al., 1991;~~

~~Angulo et al., 2004). Several quinolones such as flumequine and oxolinic acid are used in~~

~~many countries for therapy of bacterial fish infections including vibriosis, furunculosis,~~

~~and yersiniosis (Shao, 2001). Resistance to quinolones appears to be increasing due to~~

~~application of these antimicrobials in both human and veterinary medicine (Sheng et al.,~~

~~2002).~~

~~3.3.8. Gentamicin~~

~~High concentrations of gentamicin inhibited 91.7% of F. psychrophilum isolates,~~

~~while low concentrations inhibited only 8.3% (Table 3.3, Figure 3.1i). Resistance of European~~

72 isolates to gentamicin and neomycin has been reported (Rangdale, 1995) and in a recent study in Denmark, neomycin was used as a supplement to isolate F. psychrophilum strains from mixed cultures (Madsen et al., 2005).

~~3.3.9. Ampicillin~~

~~Sixty-six point seven, 15.3 and 18.1% of F. psychrophilum isolates were inhibited by high, medium and low concentrations of ampicillin, respectively (Table 3.3, Figure 3,le).~~

Ampicillin is a beta-lactam antibiotic, which is closely related to amoxicillin. In two surveys of the susceptibility of F. psychrophilum isolates, the majority of Danish isolates were found to be resistant to amoxicillin (Schmidt et al., 2000, Bruun et al,. 2000). Amoxicillin has been widely used for treatment of RTFS in Europe but during the last decade it has become less effective and florfenicol is a common alternative choice (Bruun et al., 2000).

Based on the MIC values obtained from the present study, most isolates of F. psychrophilum appear to have high MIC to trimethoprim/sulfamethoxazole and . ormetoprim/sulfadimethoxine, two of the four antimicrobial agents currently available in

Ontario aquaculture. Using ordinal ranking of the concentrations of each antimicrobial compound included in the Sensititer plate, significantly more F. psychrophilum isolates had higher MICs for ormetoprim/sulfadimethoxine and trimethoprim/sulfamethoxazole than for florfenicol (pO.OOOl) or oxytetracyline (p<0.001). Most isolates also had higher

MICs for oxytetracycline than for florfenicol (p<0.004). For the majority of isolates, MIC values were also higher for gentamicin (83%), ampicillin (68%), flumequine (86.1%) and oxolinic acid (98.6%). As stated above, other authors have also reported high MICs to

~~73 these antimicrobials, although results are difficult to compare because of the use of different techniques.~~

Vaccination is effective for the prevention of many bacterial infections in fish, such as enteric red mouth disease and furunculosis, caused by Yersinia ruckeri and Aeromonas salmonicida, respectively. However, no vaccine is available to control BCWD and antimicrobial agents and health management practices are critical for treatment of diseased fish (Lumsden et al., 2006). Since variations due to the use of different media and methods make it difficult to directly compare susceptibility results reported by various researchers, a standardized antimicrobial susceptibility testing procedure for aquatic bacteria, including

F. psychrophilum, is required. F. psychrophilum is best cultured on media such as CA or tryptone yeast extract salt agar that contains both low nutrients and low salt. However, CA and tryptone yeast extract salt agar contain the divalent cations, magnesium and calcium, which interfere with the susceptibility results for tetracycline, quinolones and potentiated sulfonamides (Pursell et al., 1995).

The method of susceptibility testing used most widely in diagnostic laboratories is the agar disc diffusion technique. It is simple to perform and a single bacterial isolate can be easily tested with several antimicrobial agents. The disc diffusion method on diluted

~~Mueller-Hinton agar has been recommended for susceptibility testing of F. psychrophilum isolates by some authors (Alderman and Smith. 2001, Dalsgaard, 2001).~~

~~However, this method may be less reliable for slow growing bacteria such as F. psychrophilum because apparent zones of inhibition may be the result of delayed growth~~

~~(Miller et al., 2005). The agar dilution method requires considerable work and is time consuming. The broth dilution method used in the present study with CAMHB seems to~~

74 be preferable to evaluate the susceptibility of a slow growing bacterium such as F. psychrophilum. Since F. psychrophilum tends to be present in mixed culture and isolation of pure cultures from clinical samples can be challenging, one of the advantages of this method is the ability to detect contamination by performing Gram stain from the positive control well in MIC test plates.

Antimicrobial resistance in bacteria can be the result of a number of genetic mechanisms. Bacteria can undergo chromosomal mutations, express a latent resistance gene, or acquire new genetic material (chromosomal or extra-chromosomal DNA) via conjugation, transduction or transformation. Some bacterial species are inherently resistant to a range of antibiotics (Guardabassi and Courvalin, 2006). The most common plasmid in F. psychrophilum strains, designated pCPl, has been sequenced recently

(Alvarez et al. 2004). This 3.407 kb plasmid contains four open reading frames, one of which encodes a plasmid replication gene, with the remaining three genes having unknown functions (Alvarez et al., 2004). Since R plasmids have not been reported in

F. psychrophilum, chromosomally determined mechanisms of resistance are presumed to be more important in this bacterium (Schmidtet al., 2000). Consistent with this description, in vitro experiments of conjugal transfer of oxytetracycline resistance plasmids from motile species of Aeromonas to Escherichia coli and Y. ruckeri was successful but attempts to transfer these plasmids into F. psychrophilum cells was unsuccessful (Bruun et al., 2003).

The present study showed that biovar II strains had a broader range of enzyme activities and exhibited different antimicrobial susceptibility patterns from biovar I. The biovar II strains were significantly less susceptible to oxytetracycline, florfenicol,

75 erythromycin and ampicillin than biovar I ( Fig. 3.1c, d, e, j). There was no difference in growth rates associated with the two biovars (Fig. 3.1a, b, f, g, h, i) and the different antimicrobial resistance patterns likely represent differences in genes that affect resistance. Since there are no known R plasmids in this species it is likely that the relative antibiotic resistance in biovar II strains has developed as a result of either chromosomal mutations or acquisition of genetic elements encoding resistance that became incorporated into the chromosome. Activation of an efflux pump in biovar II strains could have resulted in multi-resistance that conferred a selective advantage so that it is now characteristic of the biovar II.

~~The goal of this study was to provide baseline data on antimicrobial susceptibility of F. psychrophilum isolates originating from Ontario using methods that conform to~~

CLSI standards, which will allow monitoring of future resistance trends. Florfenicol and oxytetracycline, two of the four approved drugs in Canada, as recommended by other authors (Merle et al., 2003; Stenholm et al., 2008) are most likely to be suitable for treatment of BCWD. Florfenicol has the highest likelihood of success, but is very expensive and therefore optimally used only on smaller fish. Oxytetracycline may be suitable, but as for all antimicrobial agents used to treat bacterial infections, culture and

MIC determinations as well as careful monitoring of clinical response following treatment should be performed (Gray and Shryock, 2005). Erythromycin could be very useful for treatment and with judicious use could delay the potential onset of more widespread resistance to florfenicol or oxytetracycline. The results of the present study should now be interpreted in light of in vivo infection studies to correlate MIC values of

~~76 selected isolates with clinical response and tissue levels of antimicrobials following antibiotic treatment of BCWD.~~

~~77 CHAPTER 4~~

~~IDENTIFICATION OF COLD TEMPERATURE REGULATED GENES IN~~

~~FLA VOBACTERIUM PSYCHROPHILUM~~

~~4.1. Introduction~~

Bacterial cold water disease (BCWD) caused by F. psychrophilum occurs at low water temperatures and can cause economic losses in the aquaculture industry as a result of either direct mortality or vertebral deformities that decrease the market value of fish that survive the infection (Nematolahi et al., 2005). A number of putative virulence factors of this bacterium have been identified including the production of extracellular proteases involved in degradation of extracellular matrix components such as elastin, fibrinogen, gelatin, type IV collagen, actin and myosin (Bertolini et al., 1994; Ostland et al., 2000; Secades et al., 2001, 2003). In particular, two psychrophilic metalloproteases,

~~Fppl and Fpp2, that have been identified as putative virulence factors of F. psychrophilum and are also involved in destruction of host tissues (Secades et al., 2001,~~

~~2003). Other putative virulence factors include LPS, glycocalyx and biofilm formation~~

(LaFrentz et al., 2007). Various attempts to develop a vaccine against BCWD haven't been completely successful and fish suffering from BCWD are often treated with antimicrobial agents. Identification of virulence factors and suitable antigens for vaccine targets of F. psychrophilum requires further effort

Several methods have been developed to search for differentially-expressed genes in two or more bacterial cell populations, including genome sequencing, microarray experiments, quantitative real-time PCR, RNA arbitrarily primed PCR,

78 differential display, and subtractive hybridization. In addition, two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) has been used to detect differentially- expressed bacterial proteins. Each method has its strengths and weaknesses and no single method is optimal for all applications; the best choice depends on the objectives of the research, and available resources of the research project (Chiang et al. 1999; Handfield and Levesque, 1999; Hautefort and Hinton, 2000; Mahan et al., 2000).

BCWD occurs most often at water temperatures between 8-12 °C. Consistent with the occurrence of higher mortality at low temperature, the genes involved in virulence and in certain metabolic pathways of F. psychrophilum are likely to be optimally expressed at these temperatures.

In a recent study, Sudheesh et al. (2007) used 2D-PAGE and Western blot analysis with a virulent and a non-virulent strain and found a thermolysin which was unique to the virulent strain and two highly immunogenic heat shock proteins HSP60 and HSP70 which were shared by both strains.

Characterization of differentially-expressed genes in bacteria has been difficult because prokaryotic mRNA is unstable and isolation of a large amount of high quality mRNA for the construction of a cDNA library is challenging. Subtractive hybridization has become a valuable technique for comparison of two mRNA populations and it can be used to identify copies of genes that are expressed in one population but which are not, or are rarely expressed in the other. The method was originally applied to eukaryotic cells but it has been adapted for prokaryotes by De Long et al. (2008). In the present study the

~~PCR cDNA suppression subtractive hybridization (PCR cDNA SSH) technique was utilized to identify cold-induced up-regulated genes in F. psychrophilum.~~

~~79 4.2. Materials and Methods~~

~~4.2.1. Bacterial strain and growth conditions~~

F. psychrophilum FPG 25 (Ontario ulcerative dermatitis and necrotizing stomatitis isolate B3 82-90-4) was grown at 8 °C or at 20 °C in cytophaga broth containing 0.05% tryptone, 0.05% yeast extract, 0.02% beef extract, 0.02% sodium acetate, 0.05% anhydrous calcium chloride, 0.05% magnesium chloride, 0.05% potassium chloride, pH 7.5.

~~4.2.2. RNA isolation~~

~~Total RNA was extracted from log phase F. psychrophilum FPG 25 cells grown at~~

~~8 °C (tester) and at 20 °C (driver) to OD6oo 0.3-0.4 using TRIzol reagent (Invitrogen Life~~

~~Technologies, Burlington, ON) following the manufacturer's instructions. Contaminating~~

~~DNA was removed using a DNA-free™ DNase treatment and removal reagents~~

~~(Ambion, Austin, TX). The integrity of the extracted RNA was examined following electrophoresis of samples on a 1% denaturing agarose gel, and the RNA was quantified by spectrophotometery at 260 run.~~

~~4.2.3. mRNA isolation~~

Bacterial mRNA was purified from total RNA using the MICROBExpress bacterial mRNA kit (Ambion) following the manufacturer's instructions. Briefly, 10 jag of the bacterial total RNA was mixed with 200 ul of binding buffer. Four microliters of

Capture Oligo mix was added to the mixture and incubated at 70 °C for 10 min followed by incubation at 37 °C for 15 min. The heat denaturation of secondary structure of rRNAs at 70 °C facilitates the hybridization of the rRNA to the capture oligonucleotides

80 and incubation at 37 °C allows the capture oligonucleotides to hybridize to homologous regions of the 16S and 23 S rRNAs. Fifty microliters of Oligo Magbeads that was washed with nuclease-free water, resuspended in binding buffer, and prewarmed at 37 °C for 15 min, was added to the Capture Oligo mixture and incubated at 37 °C for 15 min. The

Oligo Magbeads contain an oligonucleotide that hybridizes to the capture oligonucleotides. The oligo Magbeads with bound 16S and 23S rRNA were then captured to one side of the tube's inner wall using a magnetic stand. The supernatant, containing the purified bacterial mRNA, was transferred to a clean RNase-free tube. The magnet application and supernatant removal were repeated three times as described above. Ten microliters of glycogen (5 mg/ml) was added to each mRNA sample. Enriched mRNA supernatent from five total RNA preparations was pooled before ethanol precipitation.

~~RNA quality and quantity were assessed using a NanoDrop spectrophotometer (ND-~~

~~1000, NanoDrop Technologies, Inc Wilmington, DE, USA). The final amount of enriched mRNA was 550 ng.~~

~~4.2.4. Suppression subtractive hybridization (SSH)~~

~~The PCR-Select cDNA subtraction kit (Clontech, Mountain View, CA) with modification for prokaryotic RNA was used for subtractive hybridization (De Long et al.,~~

~~2008). The first-strand cDNA was synthesized using 2 ug of mRNA-enriched RNA, with~~

~~2.0 uL of random hexamer prokaryotic cDNA subtraction primers containing an Rsal site~~

(5'-GTACN6-3') (10 uM). The mixture was denatured at 70 °C for 10 min then cooled on ice for 2 min. Four microliters of 5X first-strand buffer, 2 uL of dNTP mix (10 mM each) and 2 uL of Superscript III reverse transcriptase (200 U/ uL) (Life Technologies,

~~81 Burlington, ON) were added to each reaction mixture, which was incubated for 10 min at~~

~~25 °C followed by 1.5 h at 42 °C. To improve cDNA yield, an additional 2 uL of~~

Superscript III reverse transcriptase was added, and the incubation was carried on for a further 1.5 h at 42 °C (De Long et al., 2008). The second-strand cDNA was synthesized with DNA polymerase I, RNase H, E. coli DNA ligase, T4 DNA polymerase and 5X second-strand buffer, following the manufacturer's instructions. cDNA products were extracted using a QIAquick PCR purification kit (Qiagen Inc.) according to the manufacturer's instructions. Tester and driver cDNAs were digested with Rsal (a four- base-cutting restriction enzyme) to provide blunt-ended cDNA fragments. The Rsal- digested cDNA fragments were checked for complete digestion on 2% agarose gels.

Tester cDNA was subdivided into two portions; one portion was ligated to adaptor 1 and the second portion was ligated to adaptor 2R using T4 DNA ligase. In the first hybridization, an excess of i?sal-digested driver was added to i?.ral-digested tester cDNA with adaptor 1 and with tester cDNA ligated to adaptor 2R. Samples were heat denatured at 98 °C, and allowed to anneal at 59 °C (% G+C content of F. psychrophilum is 32.5%).

In the second hybridization, the products of the first hybridization were mixed without denaturing with fresh denatured i?sal-digested driver cDNA and hybridization was allowed to occur overnight at 63 °C. During this step, tester cDNA ligated to adaptor 1, annealed to tester cDNA ligated to adaptor 2R. The entire population of molecules was subjected to PCR using PCR primer 1 (ClonTech) to amplify the differentially-expressed sequences. Primer 1 targets a common sequence at the termini of adaptors 1 and 2R. A secondary PCR amplification was performed using the products of the primary PCR amplification and 50 nM of nested 1 and 2R primers to further reduce any nonspecific

82 background PCR products (De Long et al., 2008). Nested primers 1 and 2R target sequences unique to adaptors 1 and 2R respectively. Eight microlitres of unsubtracted and subtracted cDNA were resolved by electrophoresis through a 2.0% agarose gel and visualized by ethidium bromide staining (0.1 ug/ml).

~~4.2.5. Cloning of PCR products~~

Since the proofreading DNA polymerase I (ClonTech) removes the 3' overhangs necessary for TA cloning, 3'A-overhangs were added to the secondary PCR products. In a 10 (j.1 reaction, 5.0 ul of the subtracted product was incubated with 0.6 ul 10X buffer,

~~0.4 ul of 1 mM dNTPs and 3.4 units of Taq polymerase (Invitrogen Life Technologies) at~~

72 °C for 10 min. The products were ligated into pCR4-TOPO following the manufacturer's instructions (Invitrogen Life Technologies), mixed with 200 ul of one shot TOPO 10 chemically competent E. coli (Invitrogen Life Technologies) and heat shocked at 42°C for 1 min before plating onto LB (Luria Bertani) plates containing 50 ug/ml ampicillin and 40 ug/ml X-gal. After incubation for 24 h at 37 °C, 100 transformants were randomly chosen for characterization.

~~4.2.6. Rapid screening of clones~~

~~To select recombinant plasmids with unique inserts, a modified rapid alkaline lysis screening method was used to prepare and visualize the plasmid (Sambrook et al.,~~

~~1989). Following agarose gel electrophoresis, undigested recombinant plasmids were compared with the uncut plasmid vector to identify plasmids containing inserts.~~

~~83 4.2.7. Sequencing~~

Plasmid DNA was purified using a QIAprep Spin Miniprep Kit (Qiagen Inc.), following the manufacturer's instructions. M13F and M13R primers were used to amplify the insert cDNA in each clone. The 20 ul PCR mixtures consisted of 5.0 ul DNA template, 2.5 ul of 10X PCR buffer, 4.0 ul of dNTP, 1 ul of each M13 (F: 5'-

GTAAAACGACGGCCAGTG-3*), and M13 (R: 5'- CAG GAA ACA GCT ATG AC -3') primers, 1.0 ul Taq polymerase and 5.5 ul of H2O. PCR products that differed in size were purified using a Qiaquick PCR purification kit (Qiagen Inc.) and were sequenced at the University of Guelph, Laboratory Services Division, Guelph, Ontario. Approximately

~~3 to 20 ng template DNA was used for sequencing with an ABI Prism® BigDye®~~

~~Terminator Cycle Sequencing Ready Reaction kit v3.1 (Applied Biosystems, Foster City,~~

~~CA, USA). The cycle sequencing was performed on a GeneAmp® PCR System 9700 or~~

~~2720 Thermal Cycler (Applied Biosystems). After removing vector and adaptor sequences, insert sequences were analyzed using the Basic Local Alignment Search Tool~~

~~(BLAST). The sequences were compared to publicly available sequences by using of blastx (www.ncbi.nlm.nih.gov/BLAST).~~

~~4.2.8. Expression analysis of reference gene candidates~~

~~Nine commonly-used reference genes were evaluated as internal control genes for gene expression analysis in quantitative real-time PCR as follows, DNA gyrase subunit A~~

~~(gyrA), recombinase A (recA), DNA gyrase subunit B (gyr B), prolyl tRNA synthesase~~

~~(prolA), 50S ribosomal protein L9 (rpll), 50S ribosomal protein LI7 (rplQ), transcription~~

~~84 termination factor Rho (rho), 16S ribosomal RNA (16SrRNA) and glutamine synthetase~~

~~(glnA). Reference gene-specific primers for real-time PCR, listed in Table 4.1, were designed using primer express Software (Primer Express® software v2.0 from Applied~~

Biosystems). BLASTn was used to compare all primers with F. psychrophilum JIP02/86 genome sequences available in GenBank to ensure amplification specificity. To synthesize cDNA, 500 ng of DNase-treated total RNA was isolated from F. psychrophilum 216-93-4 grown at 8 °C or 20 °C in cytophaga broth. Quantitative real time PCR experiments were performed as described above.

The transcript quantity of each target gene was normalized to the transcript quantity of the internal control gene at the same culture conditions. The difference in expression was calculated for 8 °C-grown cultures compared with 20 °C-grown cultures

~~(Pfaffl et al., 2004).~~

~~4.2.9. Quantitative real-time PCR (qPCR) amplification of cold-induced genes~~

~~The expression of nine differentially expressed genes from the SSH study with significant similarity (e scores~~

~~(Primer Express® software v2.0 from Applied Biosystems) based on the F. psychrophilum JIP02/86 genome sequence (Duchaud et al, 2007). Primers were synthesized by Sigma-Genosys (Oakville, ON, Canada).~~

To synthesize cDNA, 500 ng of DNase-treated total RNA (isolated as described above) was used in a 20 ul reverse transcription reaction mixture supplied in the high capacity cDNA Reverse Transcription Kit (Applied Biosystems, Streetville, ON,

~~85 Canada). Real-time PCR amplification was carried out in 96-well plates using a~~

StepOnePlus thermocycler (Applied Biosystems). The 20 ul PCR reaction mixtures contained 2X Power SYBR green PCR master mix (Applied Biosystems), 100 nM of each forward and reverse primer and 5 ul of template cDNA. The following thermocycler program was used: 95° C for 10 min for activation of AmpliTAq Gold polymerase, and

40 cycles of 95° C for 15 s of denaturation and 60° C for 1 min of annealing and extension. PCR amplification was carried out on eight replicates, with four biological replicates used in the PCR for each condition (8 °C or 20 °C). Relative gene expression was calculated using the cycle threshold (Ct) values (Schmittgen and Livak, 2008).

~~4.3. Results~~

~~4.3.1. Subtractive hybridization~~

~~Analysis of 100 random subtractive hybridization recombinant plasmids revealed~~

10 genes predicted to encode the following proteins: a two-component system sensor histidine kinase, an ATP-dependent RNA helicase, an outer membrane protein, a hypothetical protein, an ATP-binding cassette transporter, a M43 cytophagalysin family metalloprotease, and 4 common housekeeping proteins, namely, DNA gyrase subunit A and subunit B, recombinase A, and prolyl tRNA synthetase (Table 4.2).

~~Sequences that displayed low levels of similarity with SprA, an oxidoreductase similar to isopenicillin N synthase and an acyl-[acyl-carrier-protein] desaturase were also detected (Table 4.1).~~

~~A number of sequences had no significant similarity with the F. psychrophilum~~

~~JIP02/86 genome; however, they showed similarities to genes of other bacteria, in~~

~~86 particular an insertion sequence (IS) homologous to IS1 of Shigella sonnei Ss046 (Table~~

~~4.1). The remaining sequences did not show similarity to any genes in the database.~~

~~4.3.2. Quantitative real-time PCR (qPCR) of differentially-expressed genes~~

Among the set of nine reference genes, including four housekeeping genes, which were previously detected by subtractive hybridization, the 16S rRNA gene showed the least variation in expression at the two temperatures in qPCR experiments (Table 4.3). It was therefore used as an internal control to normalize gene expression. To assess the up- regulation of genes at 8 °C versus 20 °C qPCR experiments were performed with the genes identified by subtractive hybridization. All 10 differentially expressed genes at low temperature were up-regulated at 8 °C. The ratio of expression of these genes was quantified based on the Ct values obtained for the total RNA transcripts obtained at 8°C and at 20°C and the results are shown in Table 4.3.

~~87 Table 4.1. Primers used in quantitative real-time PCR study~~

~~Gene description (designation or locus tag) Primer sequence~~

~~Two-component system sensor histidine F: ATTCGGCGGCCAAAACTAAT kinase (FP1516) R: AAAACGCCGCAGTTCATTGT~~

~~ATP-dependent RNA helicase (FP0666) F: TTTTCCAGCGCCTTTTGG R: CCAATGAGTTGCAAAAAGAAACAT~~

~~Outer membrane protein ( FP2096) F: GGCTTTTTTGATCCCGAATCT R: TTTGACTGGCTCCTTTTTCTACTAAAT Hypothetical protein (FP0029) F: CATCGAAACCAATAAACTCAATCCT R: GCTCCAGACCAATTCGGTAACT~~

~~ATP-binding cassette transporters (FP0834) F: CAGAAATGGTTAATGTAACGCCATA R: AAAAGGCGGGCAATATCGA~~

~~M43 cytophagalysin metalloprotease (FP1619) F: TCACGAAATAGGTCACTGGATGAA R: TGAATCATGTAACGGAGTATCTGAAAC~~

~~DNA gyrase subunit A (gyrA) F: GAAACCGGTGCACAGAAGG R: CCTGTGGCTCCGTTTATTAA~~

~~F: CGGACCAGAATCATCAGGAAA Recombinase A {reck) R: GGCGTGTTCTGCATCTATGAAA~~

~~F: GTTGTCATCGGAATGTGTCATAACT Prolyl tRNA synthesase(pro/A) R: TTGCCAATGCCGAAGGAA~~

~~F: CTAAGAAAGCCCGTGAAATGGT DNA gyrase subunit B (gyrB) R: CATTTTGCTGGATCTTGTTCAGAA~~

~~F: TGTTCAGCAACAATTTCATAAGCTAA 50S ribosomal protein L9 (rpll) R: GGTATCGTGAAAAGAACAGGAAAATAT~~

~~50S ribosomal protein LI7 (rplQ) F: GCTTCGGTAGTTGGTTCAGCTT R: AACGGTGGTAAAAAAGAAGAAGTGA~~

~~Transcription termination factor Rho (rho) F: TCGTATTATCGATTTGTTTTCTCCAA R: GCTGCAATAGCATTAGCAATCTCTT~~

~~F: AGACTCCTACGGGAGGCAGC 16S ribosomal RNA (FP0896) R: ATTACCGCGGCTGCTGG~~

~~F: CTAAGAAAGCCCGTGAAATGGT Glutamine synthetase (g/wA). R: CATTTTGCTGGATCTTGTTCAGAA~~

88 Table 4.2. Low temperature induced F. psychrophilum 216-93-4 genes identified by subtractive hybridization Clone Protein Name Locus tag Gene Bank Function E value* ID (%) (insert in bp) Accession no. (A) Two-component system sensor Signal transduction, some 770, 669, 530, histidine kinase [Flavobacterium FP1516 YP_00129639 similarities with two-component 3e-137 100 510,335,315, psychrophilum JIP02/86] sensor histidine kinase LytS" 221, 150, 145

~~Two-component system sensor GF02625 YP862648 Signal transduction 5e-58 99 histidine kinase [Gramella forseth KT0803]~~

~~Possible sensor protein [Kordia KAOT111837 ZP02159970 Predicted periplasmic ligand- 2e-34 98 algicida OT-1] binding sensor domain"~~

(B) ATP-dependent RNA helicase, 233,230,210, DEAD box family [F. FP0666 YP 001295586 RNA modification 6e-31 100 185, 180, 153, psychrophilum JIP02/86] 61 possible ATP-dependent RNA helicase [Flavobacteria bacterium FBBAL38 00395 ZP 01732763 RNA modification 2e-21 69 BAL38]

UW101DEAD/DEAH box helicase domain protein [Flavobacterium Fjoh_5046 YP 001197364 RNA modification 9e-21 57 johnsoniae U W101 ] (C) Outer membrane protein [F. Similar to outer membrane 770,730,680, psychrophilum JIP02/86] FP2096 YP 001296960 protein/protective 3e-123 100 456,159,100, antigen OMA87 COG4775 60 Outer membrane protein Fjoh_1690 YP 001194041 Surface antigen (D15) 6e-98 65 [F. johnsoniae U W101 ]

~~Outer membrane protein FBB AL3 80723 5 ZP 01734125 Putative outer membrane protein 5e-97 77 [Flavobacteria bacterium BAL38]~~

~~89 Table 4.2. Low temperature induced F. psychrophilum 216-93-4 genes identified by subtractive hybridization, continued~~

~~(D) hypothetical protein [F. 120, 117, 112, psychrophilum JIP02/86] FP0029 YP 001294969 Protein of unknown function 5e-20 100 110,100,80~~

(E) Multidrug ABC transporter ABC transporter, permease and 340, 308, 264, permease/ATPase [F. FP0834 YP001295750 ATP-binding protein (IM-ABC), 6e-43 100 268, 186, 128, psychrophilum JIP02/86] DPL-family, MDL-subfamily, 114 drug export.

~~ABC transporter related Fjoh_2815 YP001195156 ABC transporter, permease and 8e-34 78 [Flavobacterium johnsoniae ATP-binding protein UW101]~~

~~ABC superfamily ATP binding HMPREF0766 ZP04778237 ABC transporter, permease and 5e-25 55 cassette transporter, membrane 0778 ATP-binding protein protein [Sphingobacterium spiritivorum ATCC 33861]~~

~~(F) M43 cytophagalysin family 466, 350, 334, metalloprotease [F. psychrophilum FP1619 YP001296495 Zinc-dependent metalloprotease 9e-41 100 299, 202, 80 JIP02/86]~~

~~Hypothetical protein Fjoh_4597 Fjoh_4597 YP001196915 probable zinc-dependent 6e-19 60 [F. johnsoniae U W101] metalloprotease~~

~~Hypothetical protein [Gramella GF03129 YP 863140 probable zinc-dependent 3e-14 48 /oraef/7KT0803] metalloprotease~~

~~(G) DNA gyrase subunit A [F. FP0748 YP001295667 DNA replication and transcription 2e-48 100 710,690,310, psychrophilum JIP02/86] 284, 260, 255, 250, 240, 75, 60~~

~~(H) DNA gyrase subunit B FP0527 YP001295451 DNA replication and transcription 2e-23 100 228,210, 196 [F. psychrophilum J1P02/86]~~

~~90 Table 4.2. Low temperature induced F. psychrophilum 216-93- genes identified by subtractive hybridization, continued~~

~~(I) Recombinase A 524,311,155 [F. psychrophilum JIP02/86] FP2245 YP001297102 DNA recombination, and repair 3e-81 100~~

~~(J) Prolyl tRNA synthesase Catalyzes the formation of prolyl- 510, 188, 119 [F. psychrophilum JIP02/86] FP1400 YP 001296285 tRNA 3e-29 100~~

(K) Similar to SprA protein involved 212 SprA protein [F. psychrophilum FP2121 YP001296985 in gliding motility and chitin 0.055 60 J1P02/861 utilization of F johnsoniae (L) acyl-[acyl-carrier-protein] 294 desaturase [F. psychrophilum FP1155 YP001296053 Metabolism of lipids 3.3 31 JIP02/86] (M) Oxidoreductase [F. psychrophilum Dioxygenase, Similar to 154 JIP02/86] FP1029 YP001295934. isopenicillin N synthase and 0.021 73 related dioxygenases COG3491 (N) Streptococcus mutans biomarker putative ABC transporter, ATP- 360, 354, 210, 0001 EU918292 YP_002997673 binding protein 6e-24 49 80 _™______^^ (O) HmwA [Haemophilus influenzae Uncharacterized protein 388,256,122, strain AAr 105] AY601283 AAT27425 conserved in bacteria, le-31 67 115 ,__»___„«_ haemagglutination activity (P) hypothetical protein 460,440,328, BACCAP03832 [Bacteroides BACCAP_03836 EDM98348 Unknown function 2e-07 52 100 capillosus ATCC 29799]

~~(Q) hypothetical protein KP1 0491 770,590,580, [Klebsiella pneumoniaeNTUH- KP1_0491 YP 00291743 Unknown function 3e-14 100 498, 195 K2044]~~

~~(R) Transposase_27, 585, 565, 510, IS1 ORF [Shigella sonnei Ss046] SSON0977 YP309947 "insertion sequence" 7e-88 100 453 * applied for the longest insert sequence, ID= Identity~~

~~91 Table 4.3. Quantitative real-time PCR results for target and reference genes~~

~~Gene description (designation or locus tag) CT Ratio 8°C/20°C~~

~~Target genes:~~

~~Two-component system sensor histidine kinase (FP1516) 13.64~~

~~ATP-dependent RNA helicase (FP0666) X1 31~~

~~Outer membrane protein (FP2096) g 3 ^~~

~~Hypothetical protein (FP0029) 7.16 ATP-binding cassette transporter (FP0834) 3 3g~~

~~M43 cytophagalysin metalloprotease (FP1619) I 9g~~

~~Target and reference genes:~~

~~DNA gyrase subunit A (gyrA) 28.36~~

~~Recombinase A (recA) 4.33~~

~~Prolyl tRNA synthesase (prolA) 3.52~~

~~DNA gyrase subunit B (gyrB) 3.48~~

~~Reference genes:~~

~~50S ribosomal protein L9 (rpll) 67.40~~

~~50S ribosomal protein Ll7(rplQ) 31.39~~

~~Transcription termination factor Rho (rho) 2.64~~

~~16SrRNA(FP0896) 1.03~~

~~Glutamine synthetase iglnA) 0.18~~

~~CT = Cycle Threshold~~

~~92 4.4. Discussion~~

The psychrophilic bacterium F. psychrophilum is capable of growing in the temperature range of 4 °C to 20 °C, with optimum growth at 12 °C to 15 °C (Bernardet et al., 2006). The ability of microorganisms to adapt to low temperature conditions likely depends on their capacity to sense changes in temperature and respond by altering gene expression. Some genes that are involved in virulence are known to be induced or up- regulated at low temperatures and down-regulated at higher temperatures. For example, more of the extracellular metalloprotease Fppl is produced by F. psychrophilum cells at

~~12 °C compared with 18 °C (Secades et al. 2001). In order to understand how F. psychrophilum causes BCWD at low temperature, a suppression subtractive hybridization~~

~~(SSH) approach was utilized to identify genes that are differentially regulated at low temperature.~~

Based on significant similarity with homologs in the Genbank database and the frequency of recovery, ten cold-induced genes were identified in this SSH study and their up-regulation was confirmed by real-time qPCR. One of these genes encodes a two- component system sensor histidine kinase (FP1516) that was up-regulated 13.64-fold at

8°C. Two-component regulatory systems (TCSs) are widely used for signal transduction in bacteria (Beier and Gross, 2006). TCSs usually consist of a cytoplasmic membrane- located sensor protein with histidine kinase activity and a cytoplasmic transcriptional regulator protein (Beier and Gross, 2006). The histidine kinase sensor protein can sense specific changes in the environment and communicate this information to the cell. The response-regulator protein is a DNA binding protein that, when activated by the sensor kinase, promotes or inhibits transcription of required genes or operons. Pathogenic

93 bacteria often use two-component gene regulatory systems to control expression of genes encoding proteins for drug resistance, surface structures, restriction modification, toxins, adhesins, quorum sensing, biofilm formation and other virulence associated molecules that interact with the host and mediate survival in vivo (Ribardo et al, 2004; Beier and

~~Gross, 2006).~~

~~There is considerable evidence that two-component systems regulate pathways for the transduction of low-temperature signals in bacteria (Perraud et al., 1999; Suzuki~~

2000, 2001; Sakamoto and Murata, 2002). For example, histidine kinases that act as low temperature sensors in bacteria include DesK in Bacillus subtilis (Aguilar et al., 2001) and Hik33 in Synechocystis sp. PCC 6803 (Suzuki et al., 2000). However, there is little information about two-component signal transduction systems in F. psychrophilum.

The putative TCR system sensor kinase FP1516 that was identified by SSH in this study has some similarities with the two-component sensor histidine kinase LytS which is involved in regulation of cell autolysis in a variety of bacteria including Escherichia coli

SMS-3-5, Staphylococcus aureus and Bacillus subtilis (Brunskill and Bayles, 1996). A recent study of the S. aureus LytSR two-component regulatory system indicates that the products of this system regulate biofilm development in this bacterium (Sharma-Kuinkel et al., 2009). A similar regulatory system may control biofilm formation in F. psychrophilum, since four proteins similar to alginate-O-acetyltransferases of

~~Pseudomonas aeruginosa are present in genome sequence of this bacterium. These proteins are likely to be involved in biofilm formation (Duchaud et al., 2007).~~

~~Another gene that was identified in the SSH library was the ATP-dependent RNA helicase homolog (FP0666) which was up-regulated 11.31-fold at 8 °C. Based on~~

~~94 sequence homology, this gene encodes a protein that is grouped in the D-E-A-D (Asp-~~

Glu-Ala-Asp) box RNA helicases family. RNA helicase genes have been demonstrated to be cold-induced in number of different bacteria (Scherer and Neuhaus, 2006). By unwinding duplex RNA in bacteria, DEAD-box RNA helicases are involved in important cellular processes including transduction, translation, ribosome biogenesis and degradation of RNA. RNA helicases are thought to be over-expressed at low temperature in psychrophilic bacteria so they can destabilize the mRNA secondary structures and facilitate initiation of translation of related cold induced proteins (Schmid and Linder,

~~1992; Limetal., 2000).~~

Several studies have suggested that bacterial DEAD-box proteins may participate in bacterial virulence. For instance, deaD may be involved in regulating the important virulence factor urease in Helicobacter pylori (Heung and Del Poeta, 2005). In the anaerobic pathogen Clostridium perfringens, a DEAD-box RNA helicase may play a role in the adaptive response to oxidative stress (Heung and Del Poeta, 2005). The genome of

~~F. psychrophilum encodes six ATP-dependent RNA helicases that could be involved in~~

~~RNA secondary structure modification at low temperature (Duchaud et al., 2007). Three of these enzymes (including RNA helicase FP0666) are categorized as DEAD/DEAH~~

~~(Asp-Glu-Ala-His) box RNA helicase family members.~~

Secretion systems can be associated with virulence by transporting toxins and proteases to the bacterial surface. Seven SSH recombinant plasmids contained sequences related to the gene that encodes the multidrug ABC transporter permease/ATPase FP0834 which was up-regulated 3.8-fold at 8° C. In prokaryotes, ABC (ATP binding cassette) transporters are very common and have a diverse range of functions that may be required

95 in response to various environments. These transporters are often composed of multiple protein subunits, and they transport a wide variety of molecules including sugars and other carbohydrates, amino acids, peptides, polyamines, sulfate, and metal ions such as iron and molybdate across membrane layers (Garmory and Titball, 2004). A number of bacterial ABC type transporters have been associated with virulence (Janulczyk et al.,

~~2003; Nishi et al., 2003; Roset et al., 2004). ABC transporters are involved in export of capsular polysaccharide across the cytoplasmic membrane in Gram-negative bacteria~~

(Garmory and Titball, 2004). In addition to ABC-type transport systems, the Sec- dependent and Sec-independent transport systems have also been identified in the F. psychrophilum JIP02/86 genome but, sequences related to the type HI and IV secretion systems usually used by Gram-negative pathogens are not found in this genome

~~(Duchaud et al, 2007).~~

~~Another cDNA fragment obtained from the subtractive hybridization library showed similarity to the outer membrane protein/protective antigen OMA87 COG4775.~~

This OMP (FP2096) was up-regulated 8.3-fold at 8 °C. The D15/Oma87 protein family members are 87 kDa outer membrane antigens (Oma87) known to be encoded by some bacterial pathogens (Robba et al., 2001). Highly immunogenic D15 and Oma87 proteins identified in Haemophilus influenzae and Pasteurella multocida, respectively, induce protection in animal models (Adler et al., 1996, Robba et al., 2001).

The M43 cytophagalysin family zinc-dependent metalloprotease FP1619 identified in the SSH study and demonstrated to be up-regulated 1.98-fold at 8 °C by qPCR, is a putative secreted protein of F. psychrophilum. Since there is a correlation between proteolytic activity and the virulence of this organism, M43 cytophagalysin may be

~~96 involved in pathogenesis through destruction of host tissues. Interestingly, Ostland et al.,~~

(2000) reported that an extracellular preparation of an Ontario strain of F. psychrophilum recovered from a case of necrotic myositis, contained a zinc-dependent and heat-stable metalloprotease that was able to induce severe muscle necrosis in rainbow trout.

The housekeeping genes for DNA gyrase subunit A (gryA) and subunit B (gyrB), recombinase A (recA), and prolyl tRNA synthetase (prolA) were identified in the SSH experiments and their induction at 8 °C was confirmed by real-time RT-PCR.

Housekeeping genes are involved in basic cellular metabolism and are usually constitutively expressed. Such genes are not usually considered to be responsible for virulence, however, the genetic determinants of virulence are probably regulated by housekeeping genes in many instances (Wassenaar and Gaastra, 2001). Physiological and biochemical studies have revealed that bacteria can respond to low temperature by altering protein synthesis and cellular metabolism (Stubs et al., 2005; Awano et al.,

~~2008). In cold adaptation, most cold-induced proteins bind nucleic acids and are involved in DNA packaging, transcription, RNA degradation, translation and ribosome assembly~~

(Stubs et al., 2005; Awano et al., 2008). Genes for proteins such as recA, gyrA and gyrB which are involved in DNA replication, genes for RNA helicases that destabilize the secondary structures of mRNAs so as to facilitate initiation of translation, and genes for ribosomal proteins, have been reported to be involved in cold adaption in bacteria

~~(Phadtare, 2004). For instance, the enhanced level of GyrA, increases the negative supercoiling state of DNA, which in turn affects the expression of a variety of genes~~

~~(Phadtare, 2004). GyrA has been identified as a cold-inducible protein in prokaryotes previously (Scherer and Neuhaus, 2006). The gyrA and gyrB were up-regulated 28.36 and~~

~~97 3.48-fold at 8 °C respectively, in this study. The reason that gyrB was not induced at the same level as gyrA is unclear, but as suggested by other investigators (Scherer and~~

~~Neuhaus, 2006), the induction of gyrA seems to be sufficient to increase the DNA negative supercoiling after cold treatment.~~

~~An insertion sequence (IS) homologous to the transposase of Shigella sonnei Ss046 identified in this study was not present in the published data of F. psychrophilum genome~~

(Duchaud et al., 2007). Bacterial IS often cause mutations resulting in disruption of gene function, activation of inserted site or DNA rearrangements, all of which may modify bacterial characteristics, particularly in relation to pathogenesis or antimicrobial resistance (Schmidt and Hensel, 2004). The neighbouring regions of this IS fragment should be identified and sequenced to assess the significance of this cold induced gene.

To assess the up-regulation of these cold induced genes, quantitative real-time PCR was carried out. Correct evaluation of data by real-time gene expression analysis requires accurate and reliable normalization against an internal standard. Since no reference gene was available as an internal standard for F. psychrophilum, the expression stability of nine reference genes including the four common housekeeping genes identified in the

SSH experiments (gyrA, gyrB, recA and prolA) were evaluated under two temperature conditions. The nine genes selected for analysis encode proteins involved in different metabolic activitie. The rpll and rplQ genes encode ribosomal proteins and have been used as reference genes in real-time PCR experiments in both prokaryotes and eukaryotes

(Laskowski and Kazmierczak, 2006). glnA , rho, recA , gyrA , gyrB and pro 1A genes are also housekeeping genes that have been used as reference genes in similar studies of various bacteria (Takle et al., 2007). The 16S rRNA gene has also been used as a

98 reference gene in many real-time RT-PCR experiments (Venkatesh et al., 2006). Out of the nine gene candidates that were tested, only the 16S rRNA gene was stably expressed at the two temperatures and it appears to be an appropriate internal control gene for analysis of gene expression at low temperatures in F. psychrophilum. Since regulation of bacterial gene expression is complex, a single commonly and stably expressed prokaryotic housekeeping gene will not necessarily be suitable for accurate normalization of all real-time RT-PCR experiments. Therefore, for each particular real-time RT-PCR experiment, stable reference genes should be determined. With the exception of glnA, the rest of the housekeeping genes, and in particular rpll and rplQ, were highly up-regulated at 8 °C. This indicates that the regulation of housekeeping genes is a dynamic process that may be modified according to the conditions of bacterial growth.

One limitation of the subtractive hybridization approach is the presence of background molecules in the subtracted library. They can result from nonspecific annealing during the adaptor ligation or the presence of redundant cDNA fragments that are not eliminated during the two rounds of hybridization. In addition, the use of random primers in prokaryotes results in a further increase in the background and can make subtraction insufficient. However, in the current study, by using mRNA purification and prokaryotic cDNA subtraction random primers containing an Rsal site, the background molecules were noticeably reduced. In addition, as recommended by De Long et al.

~~(2008), for further background reduction, the concentration of nested PCR primer was reduced in the secondary PCR amplification assay.~~

~~Another limitation of the SSH method is that fragments lacking Rsal restriction sites cannot be detected even though they are differentially expressed. This is illustrated by~~

~~99 the fact that real-time RT-qPCR revealed that two ribosomal proteins rpll and rplQ are highly up-regulated at 8 °C, but they were not detected in the present SSH study.~~

~~In conclusion, we have found that genes encoding a two-component system~~

~~sensor histidine kinase, an ATP-dependent RNA helicase, an ATP-binding cassette~~

~~transporter, an outer membrane protein, a M43 cytophagalysin metalloprotease, and a~~

~~hypothetical protein FP0029, plus seven housekeeping genes were up-regulated in F.~~

~~psychrophilum cells after growth at 8 °C compared with growth at 20 °C. Real-time~~

~~reverse transcription PCR assays confirmed the SSH data findings. The F. psychrophilum~~

~~216-93-4 train used in current study is a representative strain of a predominant biovar and~~

~~genotype in heterogeneous population of Ontario strains. However, it is necessary to~~

~~examine strains belonging to other biovars and genotypes of this population for up-~~

~~regulation of these identified cold induced genes as well.~~

~~More research needs to be done to determine whether any of the differentially-~~

~~expressed genes identified in this study can be used as the basis for control of BCWD in~~

~~aquaculture settings. In particular, while immunization with whole-cell bacterins induces~~

~~partial protection, antigens associated with the outer membrane (OM) fractions of F.~~

~~psychrophilum have been reported to elicit protective immunity in experimental infected~~

~~fish (Merle et al., 2003; LaFrentz et al., 2004; Sudheesh et al., 2007). OMPs are located~~

~~within or near the bacterial cell surface and are in direct contact with the host immune~~

~~system. Several immunogenic surface molecules of F. psychrophilum have been~~

~~implicated in pathogenesis, some of which may be good candidates for F. psychrophilum~~

~~vaccines (Rahman et al., 2002; Merle et al., 2003; Crump et al., 2005; Dumetz et al.,~~

~~2006, 2007, 2008). The FP2096 Omp identified in this study belongs to the D15/Oma87~~

~~100 protein family that is highly immunogenic and highly conserved among a wide range of bacterial species although the exact function of D15/Oma87 is not known (Adler et al.,~~

~~1996; Robbaetal., 2001).~~

Microbial responses during the infection process cannot be determined from in vitro studies alone since host-pathogen-environment interactions are much more complex. Host factors involved in immune response in BCWD are also important. Fish are ectotherms and the immune response of ectothermic animals is influenced by environmental temperature. Similar to other metabolic processes, decreasing the water temperature below the optimum for a particular species usually reduces or delays the immune response (Raida and Buchmann, 2007; Bowden, 2008). However, there are immunologically 'non-permissive' temperatures, which are different in each fish species and in rainbow trout is approximately 4 °C (Bly and Clem, 1992). This appears to involve deficient T cell activation and MHC expression (Clem et al., 1984; Rodriguez et al,

~~1998). The physiological optimal temperature for rainbow trout is 15 °C (Raida and~~

~~Buchmann, 2007) while BCWD outbreaks commonly occur at somewhat lower water temperatures, between 8 and 12 °C. BCWD doesn't occur at temperatures in excess of 15~~

°C, despite the fact that, F. psychrophilum grows very well at 15 °C in vitro (Hesami et al., 2008). Thus, while decreased temperature associated with decreased host immune function likely plays a role in the pathogenesis of BCWD and since outbreaks commonly occur at higher temperatures than those considered to be immunologically 'non- permissive', temperature-sensitive factors in the agent are thought to be central to the pathogenesis of BCWD. Nevertheless, the role of the host and its immune status in the outcome of BCWD is still unclear and needs further investigation.

101 Moreover, environmental signals that regulate F. psychrophilum gene expression other than low temperature need to be identified. For instance, as noted above, production of the Fppl metalloprotease is increased in response to other environmental conditions such as the concentration of calcium in the culture medium, and bacterial growth phase as well as low temperature (Secades et al., 2001, 2003). More research, including mutation analysis, is needed to define the molecular link between these cold induced genes and

~~BCWD.~~

~~102 CHAPTER FIVE~~

~~GENERAL DISCUSSION~~

~~The four hypotheses developed for this thesis were: (1) strain characterization of~~

~~Ontario Flavobacterium psychrophilum will identify phenotype and genotype diversity~~

~~among isolates; (2) an adapted standard antimicrobial susceptibility testing can be used to~~

~~detect minimal inhibition concentration in isolates; and (3) cold-induced genes of F. psychrophilum can be identified by the PCR-select subtractive hybridization method and,~~

~~(4) further characterization of these differentially expressed genes can be made by using~~

~~quantitative real-time PCR.~~

~~To test the first hypotheses it was necessary to characterize/confirm which of the~~

~~stored isolates that had been collected from salmonids with signs of BCWD were F. psychrophilum (Chapter 2). The physiological and biochemical testing that was applied to~~

~~isolates from a collection of 95 yellow-pigmented bacteria suggested that 75 of the 95~~

~~isolates were F. psychrophilum. A species-specific 16S rRNA-based PCR test confirmed~~

~~the identification of F. psychrophilum isolates. Although the initial serological,~~

~~morphological and biochemical examination of the Ontario F. psychrophilum isolates~~

~~suggested that the population was highly homogeneous, two distinct API-ZYM patterns~~

~~were detected. Soule et al. (2005 a, b) recently identified two 16S rRNA gene sequence~~

~~variants in a collection of 29 F. psychrophilum strains in which 73.5% of the isolates~~

~~originated from North America. Using the PCR-RFLP technique of Soule et al. (2005a),~~

~~four rather than two RFLP variants were detected in Ontario strains. There were~~

~~significant (p<0.001) correlations found between biovar I and digestion with Maelll, and~~

103 between biovar II and digestion with Mnll (p<0.05). By identification of nine sequence types within a 194 bp region of the 16S rRNA genes, further heterogenity was demonstrated. Two major sequence types (a and c) were the most frequently isolated in this study. Strains with sequence type "a" were the predominant genotype and represented

~~54.7% of the isolates, and it was the same sequence type of strains with demonstrated virulence (CSF 259-93 - Soule et al, 2005a, b; JIP02/86 - Dachau et al., 2007).~~

More than one biovar and genotype was identified among the strains recovered from several independent BCWD outbreaks. There was no association between genotype or biotype and clinical presentation of BCWD (superficial or systemic disease). Further, there was no association between biotype or 16S genotype and host species, but the number of isolates from Atlantic salmon, Arctic char and brook trout in this study were insufficient to make firm conclusions.

Currently, no commercial vaccine is available and administration of antimicrobials is required to reduce the economic losses caused by BCWD. Antimicrobial resistance of F. psychrophilum to has been reported from various countries in the world (Rangdale et al.,

1997; Schmidt et al, 2000; Bruun et al., 2000, 2003; Dalsgaard and Madsen, 2000; Michel et al., 2003; Izumi and Aranishi, 2004). A standardized susceptibility testing methodology has not been established for F. psychrophilum and the employment of different methods makes comparison of results problematic. A second goal of this research (Chapter 3) was therefore to determine whether an adapted version of a recently standardized broth microdilution method recommended by the CLSI (Clinical and Laboratory Standards

~~Institute) for aquatic bacteria with optimal growth temperature below 35 °C (Miller et al.~~

~~2005), M49-A (CLSI 2006a), can be applied for F. psychrophilum isolates. For this~~

~~104 purpose, 75 Ontario isolates of F. psychrophilum were tested for susceptibility to 10 antimicrobial agents including the four agents that are licensed for use in foodfish in~~

~~Ontario, namely: ormetoprim/sulfadimethoxine, trimethoprim /sulfamethoxazole, oxytetracycline and florfenicol.~~

Of the three methods of susceptibility testing used most widely in diagnostic laboratories, the broth dilution method with cation-adjusted Mueller-Hinton broth was selected to evaluate the susceptibility of the slow growing F. psychrophilum. Most F. psychrophilum isolates had very high MIC values to two of the four antibiotics licensed for use in Ontario, (i. e., ormetoprim/sulfadimethoxine and trimethoprim/ sulfamethoxazole). MICs for ampicillin, oxolinic acid and gentamicin were also high, while for 83% of the strains tested the MICs of erythromycin were low. High MIC values

(> 2 ug/mL) to florfenicol and oxytetracycline were found for 53% and 61% of the isolates, respectively. The results of this study showed that among the four approved drugs in Canada, florfenicol and oxytetracycline are most likely to be suitable for treatment of BCWD. Erythromycin could also be useful for treatment, although it is only available on an emergency drug release basis. Rotation of these three antimicrobials might be a practical way to delay the development of further antimicrobial resistance.

This study showed that the biovar II strains were significantly less susceptible to florfenicol, oxytetracycline, erythromycin and ampicillin. Although the use of antimicrobials (mainly florfenicol and/or oxytetracycline) remains the most effective control method for F. psychrophilum infections, the progressive development of resistance to most licensed antimicrobials is a concern. Importantly, more than one biovar and genotype was identified among the strains recovered from single BCWD outbreaks. Thus,

~~105 before treating fish for BCWD or RTFS, it is extremely important to obtain a precise~~

~~diagnosis and perform in vitro antimicrobial susceptibility testing on multiple isolates~~

~~(Gray and Shryock, 2005). The results of antimicrobial susceptibility testing should be~~

~~combined with clinical experience to select the most appropriate antibiotic for treatment of~~

~~BCWD in accordance with good management practices.~~

~~Since R plasmids have not been reported in F. psychrophilum, chromosomally~~

~~determined mechanisms of resistance are presumed to be important in this bacterium~~

~~(Schmidt et al., 2000). It has also been suggested that F. psychrophilum is intrinsically~~

~~resistant to potentiated sulfonamides (Bruun et al., 2000), although the mechanism is not~~

~~known. In studies by Izumi and Aranishi (2004), about half of the F. psychrophilum~~

~~isolates from Japan and the United States were resistant to both oxolinic acid and nalidixic~~

~~acid as a result of mutation in the gene that encodes the A subunit of DNA gyrase. It~~

~~would be useful to identify and characterize antimicrobial resistance genes in Ontario F. psychrophilum isolates.~~

~~The mechanisms of F. psychrophilum pathogenicity are not well~~

~~understood. Adhesion is a requirement for colonization, and highly virulent strains of F.~~

~~psychrophilum attach more efficiently to the host gill tissue than less virulent strains~~

~~(Nematollahi et al., 2003). A sialic acid-binding lectin, which is able to hemagglutinate~~

~~F. psychrophilum cells and rainbow trout erythrocytes, is related to the adhesion of this~~

~~bacterium (IVteller et al., 2003). Cells of F. psychrophilum produce a number of~~

~~proteases involved in the degradation of products such as chondroitin sulfate, collagen~~

~~and fibrinogen that may play a role in the disease process (Bertolini et al., 1994), and~~

~~there is a correlation between the production of specific proteases and virulence (Ostland~~

106 et al., 2000). Two F. psychrophilum metalloproteases, Fppl and Fpp2, exhibit broad hydrolysis activities on matrix and muscle proteins of host tissue and may be involved in pathogenicity (Secades et al., 2001, 2003). A number of surface components of F. psychrophilum have been associated in pathogenesis and were subjects of several recent studies (MacLean et al., 2001; Crump et al., 2001, 2005; Merle et al., 2003; Dumetz et al., 2006, 2007, 2008). Given that BCWD occurs at temperature less than 12° C, we hypothesized that genes encoding at least some of these virulence factor would be induced at low temperatures.

Many techniques are available to search for differentially expressed genes in bacteria. Subtractive hybridization, differential display, and more recently, microarray analysis all have been used to identify genes that are differentially expressed in two bacterial cell populations. Although microarrays are powerful tools for identifying differentially expressed genes, they are very costly. Differential display and RNA arbitrarily primed PCR methods tend to have a high rate of false positives. Subtractive hybridization was originally developed to identify differentially expressed genes in eukaryotic cells, but has since been modified for use in prokaryotes (Chiang et al., 1999;

Handfield and Levesque, 1999; Hautefort and Hinton, 2000, Mahan et al., 2000; De long et al., 2008). SSH technique permits identification of infrequent and abundant fragments and capture of a diverse gene pool. Unlike DNA-microarrays, SSH does not require the availability of specific sequences and can be applied to identify expression of genes in bacteria lacking well-developed genetic manipulation systems (De long et al., 2008).

~~However, there are disadvantages to the SSH approach. Removal of rRNA sequence is required for optimal results and differentially expressed genes lacking Rsal restriction sites~~

~~107 are not detected by this method. Utilizing more than one restriction enzyme can be useful to reduce this technical limitation (Soule et al., 2005b). Additionally, identification of~~

~~genes that are up-regulated at 20 °C can be obtained by switching the tester and driver in a~~

~~SSH study.~~

~~In order to identify some of the genes that have allowed F. psychrophilum to cause~~

~~BCWD at low temperatures, a suppression subtractive hybridization (SSH) approach was~~

~~utilized (Chapter 4). We hypothesized that some of the genes that are involved in virulence~~

~~of the pathogenic strain F. psychrophilum 216-93-4, would be induced at low temperatures~~

~~and suppressed at higher temperatures. F. psychrophilum 216-93-4 belongs to biovar I and~~

~~genotype "a" which is the predominant genotype identified in Ontario isolates.~~

~~Analysis of the subtractive hybridization library revealed ten genes that were up-~~

~~regulated at low temperature. These induced genes were predicted to encode a two-~~

~~component system sensor histidine kinase, an ATP-dependent RNA helicase, an outer~~

~~membrane protein, an ATP-binding cassette transporter, an M43 cytophagalysin~~

~~metalloprotease, and a hypothetical protein plus the housekeeping genes DNA gyrase~~

~~subunit A and subunit B, recombinase A, and prolyl tRNA synthetase. Quantitative real~~

~~time PCR assay was used to verify up-regulation of these identified genes.~~

~~The products of the genes identified in the current study could contribute to~~

~~different stages of F. psychrophilum pathogenesis at low temperatures. Although it~~

~~remains to be demonstrated, the outer membrane protein could contribute to attachment~~

~~and entry into fish, the M43 cytophagalysin metalloprotease may be involved in~~

~~colonization and spread within tissues, the two-component system sensor histidine kinase~~

~~could play a role in signal transduction of cold-induced virulence genes, and the ATP-~~

~~108 binding cassette transporter is possibly involved in transporting toxins and proteases to the bacterial surface.~~

Real-time gene expression analysis identified that out of the nine gene candidates that were tested in present study, only the 16S rRNA gene proved to be stably expressed at the two temperatures and can be applied as a candidate internal control in future real time

~~PCR experiments, at least when using variable temperature conditions, for this fish pathogen.~~

Many genes involved in bacterial pathogenesis are better described as virulence- associated rather than virulence genes. Since this was an in vitro investigation with only one condition associated with virulence, it is logical that the SHH study would identify some virulence-associated along with "true" virulence genes knowing that there are generally more of the former than of the latter. RNA helicases that are over-expressed at low temperature in psychrophilic bacteria are examples of virulence-associated genes.

~~RNA helicases destabilize the mRNA secondary structures and presumably facilitate initiation of translation of related cold induced proteins (Schmid and Linder, 1992; Lim et al., 2000).~~

The SHH technique did not identify psychrophilic metalloproteases FP1 and FP2 which are two putative virulence factors of F. psychrophilum. Production of proteases in bacteria is largely dependent on culture conditions. Presence of various carbohydrate and nitrogen components in the medium can affect the production of extracellular protease

(Secades et al., 2001a, b). In many cases, expression of virulence factors is mediated by a combination of two or more signals rather than a single environmental factor. For instance, production of the Shigella dysenteriae Shiga toxin is regulated by temperature

~~109 and iron (Unkmeir and Schmidt, 2000), and induction of several virulence determinants in~~

~~Yersinia spp. are controlled by temperature and calcium (Viboud and Bliska, 2005).~~

Future research should focus on identifying genes of F. psychrophilum that are turned on/off in response to specific host products such as fish serum or calcium that are included in the medium, in combination with low temperature.

The study of cold-shock response shows that a subset of proteins, termed cold- shock proteins, is produced when mesophilic bacterial cells are exposed to a low temperature. This reaction was originally found in Escherichia coli and later the cold- shock response was reported in many bacterial species (Gualerzi et al., 2003). CspA is a major cold-shock protein in E. coli and may play a key role in the adaptation to low temperature. It serves as a transcriptional regulator and a RNA chaperone to prevent the formation of secondary structures in RNA molecules (Gualerzi et al., 2003; Scherer and

~~Neuhaus, 2006). H-NS, GyrA , RecA, NusA, PNP, Hsc66, a HSP70 homologue, IF-2, and~~

RbfA, which is a 30S ribosomal-binding factor have also been described as cold-shock proteins. Three ribosomal-associated proteins, IF-2, RbfA and CsdA, have been identified as low temperature-inducible proteins in E. coli as well (Scherer and Neuhaus, 2006). The major genes and proteins that are induced following downshift in temperature in

Synechocystis, E. coli, B. subtilis, Vibrio cholerae and Methanococcoides burtonii can be categorized as genes for: fatty acid desaturases; RNA chaperones similar to the Csp proteins of E. coli and B. subtilis; replication, such as genes for DnaA, RecA, NusA, and

~~HNS; transcription, such as rpoA and sigD; translation, for example the gene for elongation factor EF-G, RNA helicases, ribosomal proteins, e.g., S6, L7/L12 , TF, CsdA,~~

~~110 RbfA , IF2, IF2a, and IF2 /?; and the peptidyl-prolyl cisltrans isomerise (Gualerzi et al.,~~

~~2003; Phadtare, 2004; Scherer and Neuhaus, 2006; Feller, 2007).~~

~~In the present study, the genes for a number of previously identified cold-induced proteins, i.e., GyrA , RecA, RNA helicase and prolyl tRNA synthetase were identified by~~

~~SSH. Sequences that had lower similarity with an acyl desaturase were also identified, however, no sequence similar to CspA was identified by this study.~~

Gene inactivation analysis could be employed to characterize the role of differentially-expressed genes identified by the SSH study in the pathogenesis of F. psychrophilum. One of the cDNA fragments obtained from the subtractive library showed similarity to a two-component system sensor histidine kinase LytS in S. aureus and products of this system are possibly involved in biofilm formation (Sharma-Kuinkel et al.,

~~2009). In addition, mutation analysis has revealed that inactivation of two-component systems has noticeably reduced the virulence of pathogenic bacteria (Stephenson and~~

Hoch, 2002). For example, gene inactivation studies revealed that eight out of the 13 two- component systems in the genome of Streptococcus pneumoniae are required for virulence in a mouse respiratory tract infection model (Stephenson and Hoch, 2002).

To find genes essential for survival of F. psychrophilum in the host it might be possible to develop a signature tag mutagenesis system. For this purpose, the mini Tn5 signature tagged mutants that are unable to infect or survive in rainbow trout kidney or spleen post-infection can be screened for interrupted genes. These mutants are assumed to be attenuated due to the insertion of the transposon into a gene that is required for survival in rainbow trout (Camilli et al., 2001). In order to characterize the rainbow trout transcriptional response to F. psychrophilum, differential expression of rainbow trout

~~111 genes could be evaluated by experimental infection with F. psychrophilum and comparing with uninfected trout by suppression subtractive hybridization (Mahan et al.,~~

~~2000; Uthe et al., 2006).~~

~~In summary, this study provides new information that contributes to a better understanding of F. psychrophilum and the pathogenesis of BCWD using one of the few~~

~~Canadian collections of F. psychrophilum strains. The conclusions reached from this work are that:~~

~~1) the Ontario strains were consist of two biovars although they were homogeneous by~~

~~morphological and serological criteria,~~

~~2) four restriction pattern types were detected by 16S rRNA PCR-RFLP analysis,~~

~~3) there was a significant correlation between biovar I and digestion with Maelll and~~

~~between biovar II and digestion with Mnll,~~

~~4) nine 16S rRNA sequence types were identified,~~

~~5) sometimes more than one biovar and genotype was recognized among the strains~~

~~recovered from a single BCWD mortality events and,~~

~~6) no association was found between genotype or biotype and clinical presentation of~~

~~disease.~~

~~By using of a modified standardized broth microdilution methodology for antimicrobial susceptibility~~

~~1) most F. psychrophilum isolates were found to have very high MIC values to two of~~

~~the four antibiotics licensed for use in Ontario,~~

~~2) high MIC values to florfenicol and oxytetracycline were obtained for 53% and 61%-of~~

~~isolates, respectively,~~

~~112 3) MIC values for ampicillin, oxolinic acid and gentamicin were also high~~

~~4) eighty-three per cent of the isolates demonstrated low MICs for erythromycin~~

~~5) the biovar II strains were significantly less susceptible to florfenicol, oxytetracycline,~~

~~erythromycin and ampicillin compared with biovar I strains, and~~

~~6) florfenicol and oxytetracycline, of the approved antimicrobials for use in food fish, are~~

~~more likely to be suitable for treatment of BCWD, based on MIC values.~~

~~Using suppression subtractive hybridization, several F. psychrophilum genes were identified to be up-regulated at 8 °C versus 20 °C. They were:~~

~~1) a two-component system sensor histidine kinase (FP1516), an outer membrane protein~~

~~(FP2096) and a M43 metalloprotease (FP1619) which are likely to be important in the~~

~~pathogenesis of BCWD.~~

~~2) an ATP-dependent RNA helicase, a hypothetical protein, an ATP-binding cassette~~

~~transporter and four common housekeeping proteins, namely, DNA gyrase subunit A~~

~~and subunit B, recombinase A, and prolyl tRNA synthetase.~~

Finally, using quantitative real-time PCR, up-regulation of these identified genes were verified and the 16S rRNA gene was evaluated as a reference gene that can be used in qPCR experiment for this fish pathogen.

This work should serve as a foundation for future development of potential vaccines, improved diagnostic tests and management of BCWD. Two putative virulence factors, an outer membrane protein similar to omp/protective antigen OMA87 and the zinc-dependant M43 metalloprotease identified in this study, are especially good vaccine candidates and their roles in pathogenesis of F. psychrophilum infections require further investigation.

~~113 REFERENCES~~

~~Adler, B., Bulach, D., Chung, J., Doughty, S., Hunt, M., Rajakumar, K., Serrano,~~

~~M., van Zanden, A., Zhang, Y., Ruffolo, C. Candidate vaccine antigens and genes in~~

~~Pasteurella multocida. 1996. J. Biotechnol. 73:83-90.~~

~~Aguilar, P. S., Hernandez-Arriaga, A. M. , Cybulski, L. E. , Erazo, A. C, de~~

~~Mendoza, D. 2001. Molecular basis of thermosensing: A two-component signal transduction thermometer in Bacillus subtilis. EMBO J. 20:1681-1691.~~

Alderman, D. J., Smith, P. 2001. Development of draft protocols of standard reference methods for antimicrobial agent susceptibility testing of bacteria associated with fish diseases. Aquaculture 196: 211-243.

~~Alvarez, B., Secades, P., McBride, M. J., Guijarro J. A. 2004. Development of genetic techniques for the psychrotrophic fish pathogen Flavobacterium psychrophilum. Appl.~~

~~Environ. Microbiol. 70:581-587.~~

Alvarez, B., Secades, P., Prieto, M., McBride, M. J., Guijarro, J. A. 2006. A mutation in Flavobacterium psychrophilum tlpB inhibits gliding motility and induces biofilm formation. Appl. Environ. Microbiol.72:4044-53.

~~Amita, K., Hoshino, M., Honma, T., Wakabayashi, H. 2000. An investigation on the distribution of Flavobacterium psychrophilum in the Umikawa River. Fish Pathol.~~

~~35:193-197.~~

~~Anacker, R. L., Ordal, E. J. 1959. Study on the myxobacterium Chondrococcus columnaris. I. Serological typing. J. Bacteriol. 78:25-32.~~

~~Angulo, F.J., Nunnery, J. A, Bair, H. D. 2004. Antimicrobial resistance in zoonotic enteric pathogens. Rev. Sci. Tech. 23:485-96.~~

~~114 Aoki, T., Kitao, T., Iemura, N., Mitoma, Y. , Nomura, T. 1983. The susceptibility of~~

~~Aeromonas salmonicida strains isolated in cultured and wild salmonids to various chemotherapeutants. Bull. Jpn. Soc. Sci. Fish. 49:17-22.~~

~~Aoki, M., Kondo, M., Nakatsuka,Y., Kawai, K., Oshima, S. 2006. Stationary phase culture supernatant containing membrane vesicles induced immunity to rainbow trout~~

~~Oncorhynchus mykiss fry syndrome. Vaccine 25:561-569.~~

~~Arai, H., Morita,Y., Izumi, S. Katagiri, T., Kimura, H. 2007. Molecular typing by pulsed field gel electrophoresis of Flavobacterium psychrophilum isolates derived from~~

~~Japanese fish. J. Fish Dis. 30:345-355.~~

Arcangioli, M. A., Leroy-Setrin, S., Martel, J. L. Chaslus-Dancla, E. 2000. Evolution of chloramphenicol resistance, with emergence of cross-resistance to florfenicol, in bovine Salmonella typhimurium strains implicates definitive phage type (DT) 104. J.

~~Med. Microbiol. 49:103-110.~~

~~Awano, N., Inouye, M., Phadtare, S. 2008. RNase activity of polynucleotide phosphorylase is critical at low temperature in Escherichia coli and is complemented by~~

~~RNase II. J. Bacteriol. 190:5924-5933.~~

~~Baliarda, A., Faure, D., Urdaci, M.C. 2002. Development and application of a nested~~

~~PCR to monitor brood stock salmonid ovarian fluid and spleen for detection of the fish pathogen Flavobacterium psychrophilum. J. Appl. Microbiol. 92:510-516.~~

~~Bebak, J. A., Welch, T. J., Starliper, C. E., Baya, A. M., Garner, M. M. 2007.~~

~~Improved husbandry to control an outbreak of rainbow trout fry syndrome caused by infection with Flavobacterium psychrophilum. J. Am. Vet. Med. Assoc. 231:114-116.~~

~~115 Beier, D., Gross, R. 2006. Regulation of bacterial virulence by two-component systems.~~

~~Curr. Opin. Microbiol. 9:143-152.~~

~~Bernardet, J. F., Kerouault, B. 1989. Phenotypic and genomic studies oi^Cytophaga psychrophila" isolated from diseased rainbow trout (Oncorhynchus mykiss) in France.~~

~~Appl. Environ. Microbiol. 55:1796-1800.~~

Bernardet, J. F., Nakagawa, Y., Holmes, B. 2002. Proposed minimal standard for describing new taxa of the family Flavobacteriaceae and emended description of the family Int. J. Syst. Evol. Microbiol. 52:1049-1070.

~~Bernardet, J. F., Bowman, J. P. 2006. The Genus Flavobacterium. In The Prokaryotes,~~

~~Vol. 7 (eds. Dworkin, M. et al.) Springer-Verlag, New York, pp. 481-531.~~

~~Bertolini, J. M., Wakabayashi, H., Watral, V. G., Whipple, M. J., Rohovec, J. S.~~

~~1994. Electrophoretic detection of protease from selected strains of Flexibacter psychrophilus and assessment of their variability. J. Aquat. Anim. Health 6: 224-233.~~

~~Bishop, R. E. 2005. Fundamentals of endotoxin structure and function. Contrib.~~

~~Microbiol. 12:1-27.~~

~~Bly, J. E., Clem, L. W. 1992. Temperature and teleost immune functions. Fish Shellfish~~

~~Immunol. 2: 159-171.~~

~~Bowden, T. J. 2008. Modulation of the immune system of fish by their environment.~~

~~Fish Shellfish Immunol. 25:373-83.~~

~~Brown, L.L., Cox, W.T., Levine, R.P. 1997. Evidence that the causal agent of bacterial cold-water disease Flavobacterium psychrophilum is transmitted within salmonid eggs.~~

~~Dis. Aquat. Organ. 29:213-218.~~

~~116 Brown, L. L., Bruno, D.W. 2002. Infectious diseases of coldwater fish in fresh water. In~~

~~Diseases and disorders in finfish in cage culture, (eds. Woo, P. T. K. et al.) CAB~~

~~International, London, U.K. pp. 107-170.~~

~~Brunskill, E.W., Bayles, K. W. 1996. Identification of LytSR-regulated genes from~~

~~Staphylococcus aureus. J. Bacteriol. 178:5810-5812.~~

~~Bruun, M. S., Schmidt, A.S., Madsen, L., Dalsgaard, I. 2000. Antimicrobial resistance patterns in Danish isolates of Flavobacterium psychrophilum. Aquaculture 187:201-212.~~

Bruun, M. S., Madsen, L., Dalsgaard, I. 2003. Efficacy of oxytetracycline treatment in rainbow trout experimentally infected with Flavobacterium psychrophilum strains having different in vitro antibiotic susceptibilities. Aquaculture 215:11-20.

CLSI (Clinical and Laboratory Standards Institute). 2006a. Methods for broth dilution susceptibility testing of bacteria isolated from aquatic animals: approved guideline. CLSI, Document M49-A. Clinical and Laboratory Standards Institute, Wayne,

~~Pennsylvania.~~

~~Camilli, A., Merrell, D. S., Mekalanos, J. J. 2001. Strategies to identify bacterial pathogenicity factors. In Principles of bacterial pathogenesis (ed. Groisman, E. A.),~~

~~Academic Press, San Diego, CA. pp. 133-175.~~

~~Cepeda, C, Santos, Y. 2000. Rapid and low-level toxic PCR based method for routine identification of Flavobacterium psychrophilum. Int. Microbiol. 3:235-238.~~

Chakroun, C, Urdaci, M.C., Faure, D., Grimont, F., Bernadet, J. F. 1997. Random amplified polymorphic DNA analysis provides rapid differentiation among isolates of the fish pathogen Flavobacterium psychrophilum and among Flavobacterium species. Dis.

~~Aqual. Org. 31:187-197.~~

~~117 Chakroun, C, Grimont, F., Urdaci, M. C, Bernardet, J. F. 1998. Fingerprinting of~~

~~Flavobacterium psychrophilum isolates by ribotyping and plasmid profiling. Dis. Aquat.~~

~~Organ. 33:167-177.~~

~~Chen, Y-C, Davis, M. A., LaPatra, S. E., Cain, K. D., Snekvik, K. R., Call, D. R.~~

2008. Genetic diversity of Flavobacterium psychrophilum recovered from commercially raised rainbow trout, Oncorhynchus mykiss (Walbaum), and spawning coho salmon, O. kisutch (Walbaum). J. Fish Dis. 31:765-773.

~~Chiang, S. L., Mekalanos, J. J., Holden, D. W. 1999. In vivo genetic analysis of bacterial virulence. Annu. Rev. Microbiol. 53:129-54.~~

Cipriano, R. C, Schill, W. B., Teska, J. D., Ford, L. A. 1996. Epidemiological study of bacterial cold-water disease in Pacific salmon and further characterization of the etiological agent, Flexibacterpsychrophilus. J. Aquat. Anim. Health 8:28-36.

~~Cipriano, R. C. 2005. Intraovum infection caused by Flavobacterium psychrophilum among eggs from captive Atlantic salmon broodfish. J. Aquat. Anim. Health 17:275-283.~~

~~Clem, L. W., Faulmann, E., Miller, N. W., Ellsaesser, C, Lobb, C. J., Cuchens, M.~~

~~A. 1984. Temperature-mediated processes in teleost immunity: Differential effects of in~~

~~vitro and in vivo.~~

~~Cloeckaert, A., Baucheron, S., Chaslus-Dancla, E. 2001. Nonenzymatic~~

~~chloramphenicol resistance mediated by IncC plasmid R55 is encoded by afloR gene~~

~~variant. Antimicrob. Agents Chemother. 45:2381-2382.~~

~~Crumlish, M., Diab, A. M., George, S., Ferguson, H. W. 2007. Detection of the~~

~~bacterium Flavobacterium psychrophilum from a natural infection in rainbow trout,~~

~~118 Oncorhynchus mykiss (Walbaum), using formalin-fixed, wax-embedded fish tissues. J.~~

~~Fish Dis. 30:37-41.~~

~~Crump, E. M., Perry, M. B., Clouthier, S. C. Kay, W.W. 2001. Antigenic characterization of the fish pathogen Flavobacterium psychrophilum. Appl. Environ.~~

~~Microbiol. 67:750-759.~~

~~Crump, E. M., Perry, M.B., Gale, S., Crawford, E., Kay, W. W. 2003.~~

~~Lipopolysaccharide O antigen antibody-based detection of the fish pathogen~~

~~Flavobacterium psychrophilum. J. Mol. Microbiol. Biotechnol. 6:182-190.~~

~~Crump, E. M., Burian, J., Allen, P. D., Kay, W.W. 2005. Identification and expression of a host recognized antigen, FspA, from Flavobacterium psychrophilum. Microbiology.~~

~~151:3127-3135.~~

Crump, E. M., Burian, J., Allen, P. D., Gale, S., Kay, W. W. 2007. Identification of a ribosomal LlO-like protein from Flavobacterium psychrophilum as a recombinant vaccine candidate for rainbow trout fry syndrome. J. Mol. Microbiol. Biotechnol. 13:55-

~~64.~~

~~Crump, E. M., Key, W. W. 2008. Congo red inhibition as a convenient diagnostic for~~

~~Flavobacterium psychrophilum. J. Fish Dis. 31:553-7.~~

~~Dalsgaard, I. 1993. Virulence mechanisms in Cytophaga psychrophila and other~~

~~Cytophaga-like bacteria pathogenic for fish. In Annual Review of Fish Diseases, (eds.~~

~~Faisal, M., Hetrick, F. M), New York, NY: Pergamon Press, pp. 127-144.~~

~~Dalsgaard, I., Madsen, L. 2000. Bacterial pathogens in rainbow trout, Oncorhynchus mykiss (Walbaum), reared at Danish freshwater farms. J. Fish Dis. 23:199-206.~~

~~119 Dalsgaard, I. 2001. Selection of media for antimicrobial susceptibility testing of fish pathogenic bacteria. Aquaculture 196:267-275.~~

~~D'Amico, S., Collins, T., Marx, J.C., Feller, G. Gerday, C. 2006. Psychrophilic microorganisms : challenges for life. EMBO Rep. 7:385-389.~~

~~Daskalov, H., Austin, D.A., Austin, B. 1999. An improved growth medium for~~

~~Flavobacterium psychrophilum. Lett. Appl. Microbiol. 28: 297-299.~~

~~Davey, M. E., Caiazza, N. C, OTool, G. A. 2003. Rhamnolipid surfactant production affects biofilm architecture in Pseudomonas aeruginosa PAOl. J. Bacteriol. 185:1027-~~

~~1036.~~

Decostere, A., D'Haese, E., Lammens, M., Nelis, H., Haesebrouck, F. 2001. In vivo study of phagocytosis, intracellular survival and multiplication of Flavobacterium psychrophilum in rainbow trout, Oncorhynchus mykiss (Walbaum), spleen phagocytes. J.

~~Fish Dis. 24:481-487.~~

del Cerro, A., Mendoza, M. C, Guijarro, J. A. 2002. Usefulness of a TaqMan-based polymerase chain reaction assay for the detection of the fish pathogen Flavobacterium psychrophilum. J. Appl. Microbiol. 93:149-156.

~~De Long, S. K. Kinney, K. A., Kirisits, M. J. 2008. Prokaryotic suppression subtractive~~

~~hybridization per cdna subtraction, a targeted method to identify differentially expressed~~

~~genes. Appl. Env. Microbiol. 74:225-232.~~

~~Duchaud, E., Boussaha, M., Loux, V., Bernardet, J. F., Michel, C, Kerouault, B.,~~

~~Mondot, S., Nicolas, P., Bossy, R., Caron, C, Bessieres, P., Gibrat, J. F., Claverol, S.,~~

~~Dumetz, F., Le Henaff, M., Benmansour, A. 2007. Complete genome sequence of the~~

~~fish pathogen Flavobacterium psychrophilum. Nat. Biotechnol. 25:763-9.~~

~~120 Dumetz, F., Duchaud, E., LaPatra, S. E., Claire Le Marrec, C, Claverol, S., Urdaci,~~

~~M. C, Le Henaff, M. 2006. A protective immune response is generated in rainbow trout by an OmpH-like surface antigen (PI8) of Flavobacterium psychrophilum. Appl.~~

~~Environ. Microbiol. 72:4845^852.~~

~~Dumetz, F., LaPatra, S. E., Duchaud, E., Claverol, S., Le Henaff, M. 2007. The~~

~~Flavobacterium psychrophilum OmpA, an outer membrane glycoprotein, induces a humoral response in rainbow trout. J. Appl. Microbiol .103:1461-1470.~~

~~Dumetz, F., Duchaud, E., Claverol, S., Orieux, N., Papillon, S., Lapaillerie, D., Le~~

~~Henaff, M. 2008. Analysis of the Flavobacterium psychrophilum outer-membrane subproteome and identification of new antigenic targets for vaccine by immunomics.~~

~~Microbiology 154:1793-1801.~~

~~Ekman, E., Akerman, G., Balk, L., Norrgren, L. 2003. Nanoinjection as a tool to mimic vertical transmission of Flavobacterium psychrophilum in rainbow trout~~

~~Oncorhynchus mykiss. Dis. Aquat. Organ. 55:93-99.~~

~~Elsayed, E. E., Eissa, A. E., Faisal, M. 2006. Isolation of Flavobacterium psychrophilum from sea lamprey, Petromyzon marinus L., with skin lesions in Lake~~

~~Ontario. J. Fish Dis. 29:629-632.~~

~~Endtz, H. P., Ruijs, G. J., van Klingeren, B., Jansen, W. H., van der Reyden, T.,~~

~~Mouton, R. P. 1991. Quinolone resistance in Campylobacter isolated from man and poultry following the introduction of fluoroquinolones in veterinary medicine. J.~~

~~Antimicrob. Chemother. 27:199-208.~~

~~121 Evensen, O., Lorenzen, E. 1996. An immunohistochemical study of Flexibacter psychrophilus infection in experimentally and naturally infected rainbow trout~~

~~(Oncorhynchus mykiss) fry. Dis. Aquat. Organ. 25:53-61.~~

~~Faruk, M. A. R. 2000. Characterization of Flavobacterium psychrophilum, the causative agent of rainbow trout fry syndrome [PhD thesis]. University of Stirling. Stirling, UK.~~

~~Feller, G. 2007. Life at low temperatures: is disorder the driving force? Extremophiles~~

~~11:211-216.~~

~~Ferguson, H. W., Girons, A., Rizgalla, G., Lapatra, S., Branson, E. J., Mackenzie,~~

~~K., Davies, M., Collins, R.O., Diab, A., Crumlish, M. 2006. Strawberry disease in rainbow trout in Scotland: pathology and association with Flavobacterium psychrophilum. Vet. Rec. 158:630 - 631.~~

~~Fernandez, L., Secades, P., Lopez, J. R., Marquez, L, Guijarro, J. A. 2002. Isolation and analysis of a protease gene with an ABC transport system in the fish pathogen~~

~~Yersinia ruckeri: insertional mutagenesis and involvement in virulence. Microbiology~~

~~148:2233-2243.~~

~~Fleming, L., Rawlings, D., Chenia, H. 2007. Phenotypic and molecular characterisation offish-borne Flavobacterium johnsoniae-like isolates from aquaculture systems in South~~

~~Africa. Res. Microbiol. 158:18-30.~~

~~Garmory, H. S., Titball, R. W. 2004. ATP-Binding cassette transporters are targets for the development of antibacterial vaccines and therapies. Infec. Immun. 72:6757-6763.~~

~~Guardabassi, L., Courvalin, P. 2006. Modes of antimicrobial action and mechanisms of bacteria resistance. In Antimicrobial resistance in bacteria of animal origin (ed.~~

~~Aarestrup, F. M.), ASM Press, Washington, DC. pp. 1-18.~~

~~122 Gualerzi, C. O., Giuliodori, A. M., Pon, C. L. 2003. Transcriptional and post- transcriptional control of coldshock genes. J. Molec. Biol. 331:527-539.~~

~~Gray, J. T., Shryock, T. R. 2005. Antibiotic susceptibility testing of bacteria isolated from animals. Clin. Microbiol. Newsl .27:131-135.~~

~~Hadidi, S., Glenney, G. W., Welch, T. J., Silverstein, J. T., Wiens, G. D. 2008. Spleen size predicts resistance of rainbow trout to Flavobacterium psychrophilum challenge. J.~~

~~Immunol. 180:4156-4165.~~

~~Handfield, M., Levesque, R. C. 1999. Strategies for isolation of in vivo expressed genes from bacteria. FEMS Microbiol. Rev. 23:69-91.~~

~~Hautefort, I., Hinton, J. C. 2000. Measurement of bacterial gene expression in vivo.~~

~~Philos. Trans. R. Soc. Lond. B. Biol. Sci. 355:60-611.~~

~~Hawke, J. P., Thune, R. L. 1992. Systemic isolation and antimicrobial susceptibility of~~

~~Cytophaga columnaris from commercially reared channel catfish. J. Aquat. Anim. Health~~

~~4:109-113.~~

~~Henryon, M., Berg, P., Olesen, N. J., Kjaer, T. E., Slierendrecht, W. J., Jokumsen,~~

A., Lund, I. 2005. Selective breeding provides an approach to increase resistance of rainbow trout (Onchorhynchus mykiss) to the diseases, enteric red mouth disease, rainbow trout fry syndrome, and viral haemorrhagic septicaemia. Aquaculture 250:621-

~~636.~~

~~Hesami, S., Allen, K. J., Metcalf, D., Ostland, V. E., Maclnnes, J. I., Lumsden, J. S.~~

~~2008. Phenotypic and genotypic analysis of Flavobacterium psychrophilum isolates from~~

~~Ontario salmonids with coldwater disease. Can. J. Microbiol. 54:619-629.~~

~~123 Heung, L. J., Del Poeta, M. 2005. Unlocking the DEAD-box: a key to cryptococcal virulence. J. Clin. Invest. 115:593-595.~~

~~Hibi, K., Mitsubayashi, K., Fukuda, H., Ushio, H., Hayashi, T., Ren, H., Endo, H.~~

~~2007. Rapid direct determination using combined separation by prepared immunomagnetic and flowcytometry of Flavobacterium psychrophilum. Biosens.~~

~~Bioelectron. 22:1916-1919.~~

~~Holt, R. A. 1988. Cytophaga psychrophila, the causative agent of bacterial coldwater disease in salmonid fish. [Ph.D. thesis]. Oregon State University, Corvallis.~~

~~Holt, R. A., Rohovec, J. S., Fryer, J. L. 1993. Bacterial cold-water disease. In bacterial diseases of fish (eds. Inglis, V. et al.), Blackwell Scientific Publications. Oxford, UK. pp.~~

~~3-22.~~

~~Iida, Y., Mizokami, A. 1996. Outbreaks of coldwater disease in wild ayu and pale chub.~~

~~Fish Pathol. 31:157-164.~~

Imbeault, S., Parent, S., Lagace, M., Uhland, C. F., Blais, J. F. 2006. Using bacteriophages to prevent furunculosis caused by Aeromonas salmonicida in farmed brook trout. J. Aquat. Anim. Health. 18:203-214.

~~Izumi, S., Wakabayashi, H. 1997. Use of PCR to detect Cytophaga psychrophila from apparently healthy juvenile ayu and coho salmon eggs. Fish Pathol. 32:169-173.~~

~~Izumi, S., Wakabayashi, H. 1999. Further study on serotyping of Flavobacterium psychrophilum. Fish Pathol. 34:89-90.~~

~~Izumi, S., Wakabayashi, H. 2000. Sequencing of gyrB and their application in the identification of Flavobacterium psychrophilum by PCR. Fish Pathol. 35:93-94.~~

~~124 Izumi, S., Liu, H., Aranishi, F. Wakabayashi, H. 2003a. A novel serotype of~~

~~Flavobacterium psychrophilum detected using antiserum against an isolate from amago,~~

~~Oncorhynchus masou rhodurus Jordan & Gilbert, in Japan. J. Fish Dis. 26:677-80.~~

~~Izumi, S., Aranishi, F., Wakabayashi, H. 2003b. Genotyping of Flavobacterium psychrophilum using PCR-RFLP analysis. Dis. Aquat. Org. 56:207-214.~~

~~Izumi, S., Aranishi, F. 2004. Relationship between gyrA mutations and quinolone resistance in Flavobacterium psychrophilum isolates. Appl. Env. Microbiol. 70:3968-~~

~~3972.~~

~~Izumi, S., Fujii, H., Aranishi, F. 2005. Detection and identification of Flavobacterium psychrophilum from gill washings and benthic diatoms by PCR-based sequencing analysis. J. Fish Dis. 28:559-564.~~

~~Izumi, S., Ouchi, S., Kuge, T., Arai, H., Mito, T., Fujii, H., Aranishi, F., Shimizu, A.~~

~~2007. PCR-RFLP genotypes associated with quinolone resistance in isolates of~~

~~Flavobacterium psychrophilum. J. Fish Dis. 30:141-147.~~

~~Janulczyk, R., Ricci, S., Bjorck, L. 2003. MtsABC is important for manganese and iron transport, oxidative stress resistance, and virulence of Streptococcus pyogenes. Infect.~~

~~Immun. 71:2656-2664.~~

~~Johnson, N. A., Vallejo, R. L., Silverstein, J. T., Welch, T. J., Wiens, G. D.,~~

~~Hallerman, E. M., Palti, Y. 2008. Suggestive association of major histocompatibility IB genetic markers with resistance to bacterial cold water disease in rainbow trout~~

~~(Oncorhynchus mykiss). Mar. Biotechnol. 10:429-437.~~

~~125 Karunasagar, I., Shivu, M. M., Girisha, S. K., Krohne, G. Karunasagar, I. 2007.~~

~~Biocontrol of pathogens in shrimp hatcheries using bacteriophages. Aquaculture~~

~~268:288-292.~~

Kent, M. L., Groff, J. M., Morrison, J. K., Yasutake, W. T., Holt, R. A. 1989. Spiral swimming behavior due to cranial and vertabral lesions associated with Cytophaga psychrophila infections in salmonid fishes. Dis. Aquat. Organ. 6:11-16.

~~Kondo, M., Kawai, K., Yagyu, K., Nakayama, K., Kurohara, K., Oshima, S. 2001.~~

~~Changes in the cell structure of Flavobacterium psychrophilum with length of culture.~~

~~Microbiol. Immunol. 45:813-818.~~

~~Kondo, M., Kawai, K., Kurohara, K., Oshima, S. 2002. Adherence of Flavobacterium psychrophilum on the body surface of the ayu Plecoglossus altivelis. Microbes Infect.~~

~~4:279-283.~~

~~Kondo, M., Kawai, K., Okabe, M., Nakano, N., Oshima, S. 2003. Efficacy of oral vaccine against bacterial coldwater disease in ayu Plecoglossus altivelis. Dis. Aquat.~~

~~Organ. 55:261-264.~~

Kum, C, Kirkan, S., Sekkin, S., Akar, F., Boyacioglu, M. 2008. Comparison of in vitro antimicrobial susceptibility in Flavobacterium psychrophilum isolated from rainbow trout fry. J. Aquat. Anim. Health 20:245-251.

~~Kumagai, A., Takahashi, K. 1997. Imported eggs responsible for the outbreaks of coldwater disease among cultured coho salmon in Japan. Fish Pathol. 32:231-232.~~

~~Kumagai, A., Yamakoa, S., Takahashi, K., Fukuda, H., Wakabayashi, H. 2000.~~

~~Waterborne transmission of Flavobacterium psychrophilum in coho salmon eggs. Fish~~

~~Pathol. 35:25-28.~~

~~126 Laskowski, M. A., Kazmierczak, B. I. 2006. Mutational analysis of RetS, an unusual sensor kinase-response regulator hybrid required for Pseudomonas aeruginosa virulence.~~

~~Infect Immun. 74:4462-4473.~~

LaFrentz, B. R., LaPatra, S. E., Jones, G. R., Cain, K. D. 2003. Passive immunization of rainbow trout, Oncorhynchus mykiss (Walbaum), against Flavobacterium psychrophilum, the causative agent of bacterial coldwater disease and rainbow trout fry syndrome. J. Fish Dis. 26:371-384.

LaFrentz, B. R., LaPatra, S. E., Jones, G. R., Cain, K. D. 2004. Protective immunity in rainbow trout Oncorhynchus mykiss following immunization with distinct molecular mass fractions isolated from Flavobacterium psychrophilum. Dis. Aquat. Organ. 59:17-

~~26.~~

~~LaFrentz, B. R., Lindstrom, N. M., LaPatra, S. E., Call, D. R., Cain, K. D. 2007.~~

~~Electrophoretic and Western blot analyses of the lipopolysaccharide and glycocalyx of~~

~~Flavobacterium psychrophilum. Fish Shellfish Immunol. 23:770-780.~~

~~Lammens, M., Decostere, A., Haesebrouck, F. 2000. Effect of Flavobacterium psychrophilum strains and their metabolites on the oxidative activity of rainbow trout~~

~~Oncorhynchus mykiss phagocytes. Dis. Aquat. Organ. 41:173-179.~~

~~Lehman, J., Mock, D., Sturenberg, F. J., Bernardet, J. F. 1991. First isolation of~~

~~Cytophaga psychrophila from a systematic disease in eel and cyprinids. Dis. Aquat.~~

~~Organ. 10:217-220.~~

~~Lerouge, I., Vanderleyden, J. 2001. O-antigen structural variation: mechanisms and possible roles in animal/plant-microbe interactions. FEMS Microbiol. Rev. 26:17-47.~~

~~Lim, J., Thomas, T., Cavicchioli, R. 2000. Low temperature regulated DEAD-box RNA~~

~~127 helicase from the Antarctic archaeon, Methanococcoides burtonii. J. Mol. Biol. 297:553-~~

~~567.~~

~~Liu, H., Izumi, S. Wakabayashi, H. 2001. Detection of Flavobacterium psychrophilum in various organs of ayu Plecoglossus altivelis by in situ hybridization. Fish Pathol. 36:7-~~

~~11.~~

~~Lloyd, S. J., LaPatra, S. E., Snekvik, K. R., St-Hilaire, S., Cain, K. D., Call, D. R.~~

~~2008. Strawberry disease lesions in rainbow trout from southern Idaho are associated with DNA from a Rickettsia-like organism. Dis. Aquat. Organ. 82:111-118.~~

~~Lorenzen, E., Dalsgaard, I. From, J., Hansen, E. M., Horlyck, V., Korsholm, H.,~~

~~Mellergaard, S., Olesen, N. J. 1991. Preliminary investigations of fry mortality syndrome in rainbow trout. Bull. Eur. Assoc. Fish Pathol. 11:77-79.~~

~~Lorenzen, E., Karas, N. 1992. Detection of Flexibacter psychrophilus by immunofluorescence in fish suffering from fry mortality syndrome: A rapid diagnostic method. Dis. Aquat. Org. 13:231-234.~~

Lorenzen, E. 1994. Studies on Flexibacter psychrophilus in relation to rainbow trout fry syndrome (rtfs) [PhD thesis]. National Veterinary Laboratory, Arhus, Royal veterinary and Agriculture University. Copenhagen, Denmark.

~~Lorenzen, E., Dalsgaard, I., Bernardet, J. F. 1997. Characterization of isolates of~~

~~Flavobacterium psychrophilum associated with coldwater disease or rainbow trout fry syndrome I: phenotypic and genomic studies. Dis. Aquat. Organ. 31:197-208.~~

Lorenzen, E., Olesen, N. J. 1997. Characterization of isolates of Flavobacterium psychrophilum associated with coldwater disease or rainbow trout fry syndrome II: serological studies. Dis. Aquat. Org. 31:209-220.

~~128 Lumsden, J. S., Ostland, V. E., Ferguson, H. W. 1996. Necrotic myositis in cage cultured rainbow trout, Oncorhynchus mykiss (Walbaum), caused by Flexibacter psychrophilus. J. Fish Dis. 19:113-119.~~

~~Lumsden, J. S., Young, K., Russell, S., Welsh, K., Maclnnes, J. I., Hesami, S. 2006.~~

~~Management approaches for coldwater disease caused by Flavobacterium psychrophilum.~~

~~Proceedings of the National Freshwater Aquaculture Symposium, Aquaculture Canada~~

~~Special Publication No. 11. pp. 111-117.~~

MacLean, L. L., Vinogradov, E., Crump, E. M., Perry, M. B., Kay, W. W. 2001. The structure of the lipopolysaccharide O-antigen produced by Flavobacterium psychrophilum . Eur. J. Biochem. 268:2710-2716.

~~Madetoja, J., Nyman, P., Wiklund, T. 2000. Flavobacterium psychrophilum, invasion into and shedding by rainbow trout {Oncorhynchus Mykiss). Dis. Aquat. Organ. 43:27-38.~~

~~Madetoja, J., Haenninen, M., Hirvelae-Koski, V., Dalsgaard, I., Wiklund, T. 2001.~~

~~Phenotypic and genotypic characterization of Flavobacterium psychrophilum from~~

~~Finnish fish farms. J. Fish Dis. 24:469-479.~~

~~Madetoja, J., Nystedt, S., Wiklund, T. 2002. Survival and virulence of Flavobacterium psychrophilum in water microcosms. Microb. Ecol. 1446:1-7.~~

~~Madetoja, J., Wiklund, T. 2002. Detection of the fish pathogen Flavobacterium psychrophilum in water from fish farms. Syst. Appl. Microbiol. 25:259-266.~~

~~Madsen, L., Dalsgaard, I. 1999. Reproducible methods for experimental infection with~~

~~Flavobacterium psychrophilum in rainbow trout Oncorhynchus mykiss. Dis. Aquat~~

~~Organ. 36:169-176.~~

~~129 Madsen, L., Dalsgaard, I. 2000. Comparative studies of Danish Flavobacterium psychrophilum isolates: ribotypes, plasmid profiles, serotypes and virulence. J. Fish Dis.~~

~~23:211-218.~~

Madsen, L., Moller, J. D., Dalsgaard, I. 2005. Flavobacterium psychrophilum in rainbow trout, Oncorhynchus mykiss (Walbaum), hatcheries: Studies on broodstock, eggs, fry and environment. J. Fish Dis. 28:39-47.

~~Mahan, M. J., Heithoff, D. M., Sinsheimer, R. L., Low, D. A. 2000. Assessment of bacterial pathogenesis by analysis of gene expression in the host. Annu. Rev. Genet.~~

~~34:139-64.~~

~~Marchandin, H., Teyssier, C, Simeon de Buochberg, M., Jean-Pierre, H., Carriere,~~

~~C, Jumas-Bilak, E. 2003. Intra-chromosomal heterogeneity between the four 16S rRNA gene copies in the genus Veillonella: implications for phylogeny and taxonomy.~~

~~Microbiology 149:1493-1501.~~

~~Mata, M., Skarmeta, A., Santos, Y. 2002. A proposed serotyping system for~~

~~Flavobacterium psychrophilum. Lett. Appl. Microbiol. 35:166-170.~~

Merle, C, Faure, D., Urdaci, M. C, Le Henaff, M. 2003. Purification and characterization of a membrane glycoprotein from the fish pathogen Flavobacterium psychrophilum. J. Appl. Microbiol. 94:1120-1127.

~~Michel, C, Garcia, C. 2003. Virulence stability in Flavobacterium psychrophilum after storage and preservation according to different procedures. Vet. Res. 34:127-32.~~

~~Michel, C, Kerouault, B., Martin, C. 2003. Chloramphenicol and florfenicol susceptibility of fish-pathogenic bacteria isolated in France: comparison of minimum~~

~~130 inhibitory concentration, using recommended provisory standards for fish bacteria. J.~~

~~App. Microbiol. 95:1008-1015.~~

Miller, R. A., Walker, R. D., Carson, J., Coles, M., Coyne, R. 2005. Standardization of a broth microdilution susceptibility testing method to determine minimum inhibitory concentrations of aquatic bacteria. Dis. Aquat. Organ. 64:211-222.

Moller, J. D., Larsen, J. L, Madsen, L., Dalsgaard, I. 2003. Involvement of a sialic acid-binding lectin with haemagglutination and hydrophobicity of Flavobacterium psychrophihim. Appl. Environ. Microbiol. 69:5275-5280.

~~Moller, J. D., Barnes, A. C, Dalsgaard, I., Ellis, A. E. 2005. Characterisation of surface blebbing and membrane vesicles produced by Flavobacterium psychrophihim.~~

~~Dis. Aquat. Organ. 64:201-209.~~

~~Moreno, C, Romero, J., Espejo, R. T. 2002. Polymorphism in repeated 16S rRNA genes is a common property of type strains and environmental isolates of the genus~~

~~Vibrio. Microbiology 148:1233-1239.~~

Muyzer, G., de Waal, E. C, Uitterlinden, A. G. 1993. Profiling of complex microbial population by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59:695-700.

~~Nakai, T., Sugimoto, R., Park, K. H., Mori, K. I., Nishioka, T., Maruyama, K. 1999.~~

~~Protective effects of bacteriophage on experimental Lactococcus garvieae infection in yellowtail. Dis. Aquat. Organ. 37:33-41.~~

~~Negrete-Abascal, E., Garcia, R. M., Reyes, M. E., Godinez, D., de la Garza, M. 2000.~~

~~Membrane vesicles released by Actinobacillus pleuropneumoniae contain proteases and~~

~~Apx toxins. FEMS Microbiol. Lett. 191:109-113.~~

~~131 Nematollahi, A., Decostere, A., Pasmans, F., Haesebrouck, F. 2003 a.~~

~~Flavobacterium psychrophilum infections in salmonid fish. J. Fish Dis. 26:563-574.~~

~~Nematollahi, A., Decostere, A., Pasmans, F., Ducatelle, R., Haesebrouck, F. 2003b.~~

~~Adhesion of high and low virulence Flavobacterium psychrophilum strains to isolated gill arches of rainbow trout Oncorhynchus mykiss. Dis. Aquat. Organ. 55:101-107.~~

Nematollahi, A., Pasmans, F., Haesebrouck, F., Decostere, A. 2005. Early interactions of Flavobacterium psychrophilum with macrophages of rainbow trout Oncorhynchus mykiss. Dis. Aquat. Organ. 64:23-28.

~~Nicolas, P., Mondot, S., Achaz, G., Bouchenot, C, Bernardet, J. F., Duchaud, E.~~

~~2008. Population structure of the fish-pathogenic bacterium Flavobacterium psychrophilum. Appl. Environ. Microbiol. 74:3702-3709.~~

~~Nishi, J., Sheikh, J., Mizuguchi, K., Luisi, B., Burland, V., Boutin, A., Rose, D. J.,~~

~~Blattner, F. R., Nataro, J. P. 2003. The export of coat protein from enteroaggregative~~

~~Escherichia coli by a specific ATP binding cassette transporter system. J. Biol. Chem.~~

~~278:45680^15689.~~

~~Olson, D. P., Beleau, M. H., Busch, R. A., Roberts, S., Krieger, R. I. 1985. Strawberry disease in rainbow trout, Salmo gairdneri Richardson. J. Fish Dis. 8:103-111.~~

~~Ostland, V. E., Lumsden, J. S., MacPhee, D. D., Ferguson, H. W. 1994.~~

~~Characteristics of Flavobacterium branchiophilum, the cause of salmonid bacterial gill disease in Ontario. J. Aquat. Anim. Health. 6:13-26.~~

Ostland, V. E., McGrogan, D. C, Ferguson, H. W. 1997. Cephalic osteochondritis and necrotic scleritis in intensively reared salmonids associated with Flexibacter psychrophilus. J. Fish Dis. 20:443-450.

132 Ostland, V. E., Byrne, P. J., Hoover, G., Ferguson, H. W. 2000. Necrotic myositis of rainbow trout, Oncorhynchus my kiss (Walbaum): proteolytic characteristics of a crude extracellular preparation from Flavobacterium psychrophilum. J. Fish Dis. 23:329-336.

~~Pacha, R. E., Porter, S. 1968. Characteristics of myxobacteria isolated from the surface of freshwater fish. Appl. Microbiol. 16:1901-1906.~~

Park, S. C, Shimamura, L, Fukunaga, M., Mori, K. I., Nakai, T. 2000. Isolation of bacteriophages specific to a fish pathogen, Pseudomonas plecoglossicidae, as a candidate for fish disease control. Appl. Environ. Microbiol. 66:1416-1422.

~~Perraud, A. L., Weiss, V., Gross, R. 1999. Signalling pathways in two-component phosphorelay systems. Trends Microbiol. 7:115-120.~~

~~Pfaffl, M.W., Tichopad, A., Prgomet, C, Neuvians, T. P. 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity:~~

~~BestKeeper - Excel-based tool using pair-wise correlations. Biotechnol. Lett. 26:509-~~

~~515.~~

~~Phadtare, S. 2004. Recent developments in bacterial cold-shock response. Curr. Issues~~

~~Mol. Biol. 6:125-136.~~

~~Plant, K. P., LaPatra, S. E., Cain, K. D. 2009. Vaccination of rainbow trout,~~

~~Oncorhynchus myhiss (Walbaum), with recombinant and DNA vaccines produced to~~

~~Flavobacterium psychrophilum heat shock proteins 60 and 70. J. Fish Dis. 32:521-534.~~

Pursell, L., Samuelsen, O. B., Smith, P. 1995. Reduction in the in-vitro activity of flumequine against Aeromonas salmonicida in the presence of the concentrations of Mg and Ca ions found in sea water. Aquaculture 135: 245-255.

~~133 Raida, M. K., Buchmann, K. 2007. Temperature-dependent expression of immune- relevant genes in rainbow trout following Yersinia ruckeri vaccination. Dis. Aquatic~~

~~Organ.77:41-52.~~

~~Raetz, C. R., Whitfield, C. 2001. Lipopolysaccharide endotoxins. Annu. Rev. Biochem.~~

~~71:635-700.~~

~~Rahman, H., Kuroda, A., Dijkstra, J. M., Kiryu, I., Nakanishi, T., Ototake, M. 2002.~~

~~The outer membrane fraction of Flavobacterium psychrophilum induces protective immunity in rainbow trout and ayu. Fish Shellfish Immunol. 12:169-17.~~

~~Ramsrud, A. L., LaFrentz, S. A., LaFrentz, B. R., Cain, K. D., Call, D.R. 2007.~~

~~Differentiating 16S rRNA alleles of Flavobacterium psychrophilum using a simple PCR assay. J. Fish Dis. 30:175-180.~~

~~Rangdale, R. E. 1995. Studies on rainbow trout fry syndrome (RTFS) [Ph.D. thesis],~~

~~University of Sterling, Scotland, U.K.~~

~~Rangdale, R. E., Way, K. 1995. Rapid identification of Cytophaga psychrophila from infected spleen tissue using an enzyme-linked-immunosorbent assay (ELISA). Bull. Eur.~~

~~Ass. Fish Pathol. 15:213-216.~~

Rangdale, R. E., Richards, R. H., Alderman, D. J. 1997. Minimum inhibitory concentration of selected antimicrobial compounds against Flavobacterium psychrophilum, the causal agent of rainbow trout fry syndrome (RTFS). Aquaculture

~~158:193-201.~~

~~Rasch, M., Kastbjerg, V. G., Bruhn, J. B., Dalsgaard, I., Givskov, M., Gram, L.~~

~~2007. Quorum sensing signals are produced by Aeromonas salmonicida and quorum~~

~~134 sensing inhibitors can reduce production of a potential virulence factor. Dis. Aquat.~~

~~Organ.78:105-13.~~

Ribardo, D. A., Lambert, T. J., Mclver, K. S. 2004. Role of Streptococcus pyogenes two-component response regulators in the temporal control of Mga and the Mga- regulated virulence gene emm. Infect. Immun. 72:3668-3673.

~~Robba, C. W., Orihuelaa, C. J., Ekkelenkampa, M. B., Niesel, D. W. 2001.~~

~~Identification and characterization of an in vivo regulated D15/Oma87 homologue in~~

~~Shigella flexneri using differential display polymerase chain reaction. Gene 262:169-177.~~

~~Rodriguez, P. N. S., Dixon, B., Roelofs, J., Rombout, J. H. M.W., Egberts, E.,~~

~~Pohajdak, B., Stet, R. J. M. 1998. Expression and temperature-dependent regulation of the Bta2-microglobulin (Cyca-B2m) gene in a cold-blooded vertebrate, the common carp~~

~~(Cyprinus carpio L.). Dev. Immunol. 5:263-275.~~

Roset, M. S., Ciocchini, A. E., Ugalde, R. A., Inon de Iannino, N. 2004. Molecular cloning and characterization of cgt, the Brucella abortus cyclic beta-l,2-glucan transporter gene, and its role in virulence. Infect. Immun. 72:2263-2271.

~~Sakamoto, T., Murata, N. 2002. Regulation of the desaturation of fatty acids and its role in tolerance to cold and salt stress. Curr. Opin. Microbiol. 5:206-210.~~

~~Sambrook, J., Fritsch, E. F., Maniatis, T. 1989. Volume 1. Plasmid Vectors. Molecular cloning : a laboratory manual. Cold Spring Harbor Laboratory Press, pp. 1-32.~~

~~Scherer, S., Neuhaus, K. Life at low temperatures. 2006. In The Prokaryotes, Vol.~~

~~2(eds. Dworkin, M. et al.) Springer-Verlag, New York, pp. 210-262.~~

~~Schmid, S.R., Linder, P. 1992. D-E-A-D protein family of putative RNA helicases. Mol.~~

~~Microbiol. 6:283-292.~~

~~135 Schmidt, A. S., Bruun, M. S. , Dalsgaard, I, Pedersen, K, Larsen, J. L. 2000.~~

~~Occurrence of antimicrobial resistance in fish-pathogenic and environmental bacteria associated with four Danish rainbow trout farms. Appl. Environ. Microbiol. 66:4908-~~

~~4915.~~

~~Schmidt, H., Hensel, M. 2004. Pathogenicity islands in bacterial pathogenesis. Clin.~~

~~Microbiol. Rev. 17:14-56.~~

~~Schmittgen, T, D., Livak, K. J. 2008. Analyzing real time PCR data by the comparative~~

~~C (T) method. Nat. Protoc. 3:1101 -1108.~~

Secades, P., Alvarez, B., Guijarro J. A. 2001. Purification and characterization of a psychrophilic calcium induced, growth-phase-dependent metalloprotease from the fish pathogen Flavobacterium psychrophilum. Appl. Environ. Microbiol. 67:2436-2444.

Secades, P., Alvarez, B., Guijarro, J. A. 2003. Purification and properties of a new psychrophilic metalloprotease (Fpp2) in the fish pathogen Flavobacterium psychrophilum. FEMS Microbiol. Lett. 226:273-279.

~~Shao, Z. J. 2001. Aquaculture pharmaceuticals and biologicals: current perspectives and future possibilities. Adv. Drug Deliv. Rev. 50:229-243.~~

~~Sharma-Kuinkel, B. K., Mann, E. E., Ahn, J. S., Kuechenmeister, L. J., Dunman, P.~~

~~M., Bayles, K. W. 2009. The Staphylococcus aureus LytSR Two-Component Regulatory~~

~~System Affects Biofilm Formation. J. bacterio. 191:4767-4775.~~

~~Sheng, W. H., Chen, Y. C, Wang, J. T., Chang, S. C, Luh, K. T., Hsieh, W. C. 2002.~~

~~Emerging fluoroquinolone-resistance for common clinically important gram-negative bacteria in Taiwan. Diagn. Microbiol. Infect. Dis. 43:141-147~~

~~136 Serum, H. 2006. Antimicrobial drug resistance in fish pathogens. In Antimicrobial resistance in bacteria of animal origin (edr. Aarestrup, F. M). ASM Press, Washington,~~

~~DC. pp. 213-238.~~

~~Soule, M., Cain, K., LaFrentz, S., Call, D. R. 2005a. Combining suppression subtractive hybridization and microarrays to map the intraspecies phylogeny of~~

~~Flavobacterium psychrophilum. Infect. Immun. 73:3799-802.~~

~~Soule, M., LaFrentz, S., Cain, K., LaPatra, S. Call, D. R. 2005b. Polymorphisms in~~

~~16S rRNA genes of Flavobacterium psychrophilum correlate with elastin hydrolysis and tetracycline resistance. Dis. Aquat. Organ. 65:209-216.~~

~~Staroscik, A. M., Nelson, D. R. 2008. The influence of salmon surface mucus on the growth of Flavobacterium columnare. J. Fish Dis. 31:59-69.~~

~~Stenholm, A. R., Dalsgaard, I., Middelboe, M. 2008. Isolation and characterization of bacteriophages infecting the fish pathogen Flavobacterium psychrophilum. Appl.~~

~~Environ. Microbiol. 74:4070-4078.~~

Stephenson, K., Hoch, J. A. 2002. Virulence and antibiotic resistance associated two-component signal transduction systems of Gram-positive pathogenic bacteria as targets for antimicrobial therapy. Pharmacol. Ther. 93:293-305.

~~Stringer-Roth, K. M., Yunghans, W., Caslake, L. F. 2002. Differences in chondroitin~~

~~AC lyase activity of Flavobacterium columnare isolates. J. Fish Dis. 25:687-691.~~

~~Stubs, D., Fuchs, T. M., Schneider, B., Bosserhoff, A., Gross, R. 2005. Identification and regulation of cold-inducible factors of Bordetella bronchiseptica. Microbiology~~

~~151:1895-1909.~~

~~137 Sudheesh, P. S., LaFrentz, B. R., Call, D. R., Siems, W. F., LaPatra, S. E., Wiens, G.~~

~~D., Cain, K. D. 2007. Identification of potential vaccine target antigens by immunoproteomic analysis of a virulent and a non-virulent strain of the fish pathogen~~

~~Flavobacterium psychrophilum. Dis. Aquat. Organ. 74:37—47.~~

~~Suzuki, I., Los, D.A., Kanesaki, Y., Mikami, K., Murata, N. 2000. The pathway for perception and transduction of low-temperature signals in Synechocystis. Embo J.~~

~~19:1327-1334.~~

~~Suzuki, I., Kanesaki, Y., Mikami, K., Kanehisa, M., Murata, N. 2001. Cold-regulated genes under control of the cold sensor Hik33 in Synechocystis. Mol. Microbiol. 40:235-~~

~~244.~~

~~Tan, Y.W., Yu, H. B., Leung, K.Y., Sivaraman, J., Mok, Y. K. 2008. Structure of~~

~~AscE and induced burial regions in AscE and AscG upon formation of the chaperone needle-subunit complex of type III secretion system in Aeromonas hydrophila. Protein~~

~~Sci. 17:1748-1760.~~

~~Takle, G. W., Toth, I. K., Brurberg, M. B. 2007. Evaluation of reference genes for real-time RT-PCR expression studies in the plant pathogen Pectobacterium atrosepticum.~~

~~BMC Plant Biol. 7:50-59.~~

~~Toyama, T., Kita-Tsukamoto, K., Wakabayashi, H. 1994. Identification ofCytophaga psychrophila by PCR targeted 16S ribosomal RNA. Fish Pathol. 29:271-275.~~

Unkmeir, A., Schmidt, H. 2000. Structural analysis of phage-borne stx genes and their flanking sequences in shiga toxin-producing Escherichia coli and Shigella dysenteriae type 1 strains. Infect. Immun. 68:4856-64.

~~138 Urdaci, M. C, Chakroun, C, Faure, D., Bernardet J. F. 1998. Development of a polymerase chain reaction assay for identification and detection of the fish pathogen~~

~~Flavobacterium psychrophilum. Res. Microbiol. 149:519-530.~~

Uthe, J. J., Stabel, T. J., Zhao, S. H., Tuggle, C. K., Bearson, S. M. 2006. Analysis of porcine differential gene expression following challenge with Salmonella enterica serovar Choleraesuis using suppression subtractive hybridization. Vet. Microbiol.

~~114:60-71.~~

~~Varina, M., Denkin, S. M., Staroscik, A. M., Nelson, D. R. 2008. Identification and characterization of Epp, the secreted processing protease for the Vibrio anguillarum~~

~~EmpA metalloprotease. J. Bacteriol. 190:6589-6597.~~

~~Vatsos, I. N., Thompson, K. D., Adams, A. 2001. Adhesion of the fish pathogen~~

~~Flavobacterium psychrophilum to unfertilized eggs of rainbow trout (Oncorhynchus mykiss) and n-hexadecane. Lett. Appl. Microbiol. 33:178-182.~~

~~Vatsos, I. N., Thompson, K. D., Adams, A. 2002. Development of an immunofluorescent antibody technique (IFAT) and in situ hybridization to detect~~

~~Flavobacterium psychrophilum in water samples. Aquacult. Res. 33:1087-1090.~~

~~Venkatesh, B., Babujee, L., Liu, H., Hedley, P., Fujikawa, T., Birch, P., Toth, I.,~~

~~Tsuyumu, S. 2006. The Erwinia chrysanthemi 3937 PhoQ sensor kinase regulates several virulence determinants. J. Bacteriol. 188:3088-3098.~~

~~Vimr, E. R., Steenbergen, S. M. 2009. Early molecular-recognition events in the synthesis and export of group 2 capsular polysaccharides. Microbiology 155:9-15.~~

~~Viboud, G. I., Bliska, J. B. 2005. Yersinia outer proteins: role in modulation of host cell signaling responses and pathogenesis. Annu. Rev. Microbiol. 59:69-89.~~

~~139 Wagner, V. E., Iglewski, B. H. 2008. Pseudomonas aeruginosa biofilms in CF infection. Clin. Rev. Allergy Immunol. 35:124-34.~~

~~Wakabayashi, H., Toyama, T., Iida, T. 1994. A study on serotyping of Cytophaga psychrophila isolated from fishes in Japan. Fish Pathol. 29:101-104.~~

~~Warsen, A.E., Krug, M.J., LaFrentz, S., Stanek, D.R., Loge, F.J., Call, D.R. 2004.~~

~~Simultaneous discrimination between 15 fish pathogens by using 16S ribosomal DNA~~

~~PCR and microarrays. Appl. Environ. Microbiol. 70:4216-4221.~~

~~Wassenaar, T. M., Gaastra, W. 2001. Bacterial virulence: can we draw the line? FEMS~~

~~Microbiol. Lett. 201:1-7.~~

~~White, D. G., Hudson, C, Maurer, J. J., Ayers, S., Zhao, S., Lee, M. D., Bolton, L.,~~

~~Foley, T., Sherwood, J. 2000. Characterization of chloramphenicol and florfenicol resistance in Escherichia coli associated with bovine diarrhea. J. Clin. Microbiol.~~

~~38:4593-4598.~~

~~Wiklund, T., Madsen, L., Bruun, M. S., Dalsgaard, I. 2000. Detection of~~

~~Flavobacterium psychrophilum from fish tissue and water samples by PCR amplification.~~

~~J. Appl. Microbiol. 88:299-307.~~

~~Wiklund, T., Dalsgaard, I. 2002. Survival of Flavobacterium psychrophilum in rainbow~~

~~trout {Oncorhynchus mykiss) serum in vitro. Fish Shell. Immunol. 12:141-153.~~

~~Wiklund, T., Dalsgaard, I. 2003. Association of Flavobacterium psychrophilum with~~

~~rainbow trout {Oncorhynchus mykiss) kidney phagocytes in vitro. Fish Shell. Immunol.~~

~~15:387-395.~~

~~140 APPENDIX~~

~~A. Nucleotide sequences of the longest insert sequence obtained from subtracted library for each identified gene~~

Clone A ttcggcgttaaaagcgtgtacaaatacattttcaataaacggttgcaacaacatggttggcacttcaatttcttgcgcattaatatttgattctacttttagatttataa ttttatttccaaaacgagtattttctataaaaatatagttctttaaaaaactaatttcctcttgtaatgttatggttttctttgtagaattatccagcgttagtcgcattaact tagccaattcgctaacaaaatttaacgaattgtcaatatcattactaattataaaatcttgaatggtattcatagcattaaacgtaaaatgaggattcatctgacttta agtgcttctaattttgtttctgcaatacgttgattaattaaagctttttcctctgcggtctttttttttctttttactactacgaatactaaagctgatagaaccgaaaacac tataattgcaaaccaccaagtaagccaaaaaggtggcgtaattactaattttaaaactttaaattgtttggtttctccagaatttaaatctaaaatttcaatttctaaat gatacttaccatatggtaaataagataaaaatacggttggtttatcagtatatggactccaattatttttgctatttaatctgtatctaaattttaatttatttggaaacg gatgtccaacaggaataaaatctatagaaaaagaattgtttttataatctgtagtcaattcatttgagttaaatgtaaaccaacgactatttgtaccaa

Clone B tctgtctactacagcatccatctgtttctaaaaagaatatcgcaatcatctactacaaacatttttacagtgctaatgttaaaacctgccgatgagaacatagcgttt atcctgtttggtgttcctataagtacatcaagtcccattgaaattacatttttgtcgtaatctacatcacccttttcgtgtacaccaaaaacacttaaatcgtggtatttt ccgtattttaggaa

Clone C tacaaagaaaacggatatcgtgatgcaagaataatatccgattcagtaacttacgaaaaagaaaaaaacacagtagccattagtataaatgtcgaagaagga aataaatattattttggagatataaaatttttaggaaatacgatttacaatgaccaattattaggtagagttttaggcatcaaaaaaggcgatgtttacaacggtgttt tactagaaaaaagaattgcagacaaatctagtccagatagtgaagacttaaccaatttataccaaaacaatggataccttttttctaccataaacccagttgaagt ttctacggcaaacaacatcatcaatatggaaattcgtgtaaccgaaggaccattagcatattttaacaaaatatcagttgtaggaaatgacaagacaaatgaaa agttatatatagagaacttcgcacaaaaccaggaaacatatacagcaaagaaacattaattagaaccattcgtgagataggacaattaggcttttttgatcccg aatctataaaaccagatttcgaaaatgtagatcccgcagcaggaaccgtagatattaaataccatttagtagaaaaaggagccagtcaaatagagctacaag gtggttacggtggtggtggatttataggaacgctagggctttcttttaacaacttttctattggaaatatttttaataaaaaatcatacagaccattacctatgggg acggtcagaaagtatctttacgtttacaagcaa

~~Clone D tggtacaattatttcatcagagttaccgaattggtctggagcagaaattttcacgatgggtatttgattgaagtttataccgaaaaatatggtgatcatttagcttc aattacaatttaa~~

Clone E ttctamcgtaccattcgffigcaaatgctMacattggttatgccttgcagtgmcttcaacaactacttggctttcggcaatffigtcttgtgttttttttccgtattttc tgataaatcttccaaaaattactgccgcaactgcaactacaggaacgatagacatcatcattaaagttaattttgggcttatggttgctaaaatgataaatccgcc aataattaatataaattgacgtaaaaattcggcaattgtactagttaaggtatcttgcagctgagaaatatcggcacttaatctgctatttaattctccaacacgcttt tgagcgtaa

141 Clone F actaagcacaagtagaattgtaaatggagttatcgaaattcctatggtatttaatgttctttacaataccgcagcagataatacctcgttagcacaaattcaat cgcaagttgatgcactaaataaagattttaatgcaacaaattctgattataatacagcaaataacccttacagcagcgtgagagcaaatattggtattcgtttt gtgttagacagagtaattagaaaacaatctcctaaaactatatggtattctgaagacggatatatgaaaatcgctgctcaaggcggtatggctccaacatct ccaactactaaacttaacgtttgggtagtaaataatttagcaagtagaacttctggtcagttattaggatatgcacaatttccaggaggatcttctgcaactga cggttacgtttgtggaaattattgtttaggaacaataggaactgctgctgca

Clone G ccgatttagttaatgagaaaaaaatagaagaatatccaatattcgtgacgaatccgatagaaacggtatgcgtatcgtatatatcttaaaacgtgatgcaaca ccaaacgtagtattaaacacattatataaatatacgcaattacaatcttccttttctgtaaataatattgcattagtaaaaggtcgtccgcaaatgttaaatctgaa agatttaattcattattttgtagaacaccgtcatgatgtagtagttcgtagaacaaaattcgatttaagaaaagcagaagaaagagcacatatattagaaggac taatcattgcatcagacaatattgatgaagtaattgctttaattcgtagttctaaaaacacagatgaagctaaagaaaaattaatcgaaagatttaaactatctga tattcagtcacgtgctatcgtagaaatgcgtttgcgtcagcttacaggtctagaacaagacaagttaagagccgagtatgaagagttaatgaaattgatcga gcatttgaaagctttgcttgccgatgtaaacctaagaaccgcattaataaaagaagaattagaagatatgcgtgccaaatacggtgacgagcgtcgttctca aattgaatattctggtggcgatgtaagtattgaagatttaattgccgacgaaaatgtagttattaccatttctcatgcaggttata

Clone H acaacgagatcaagccaacgagagaatgggtggtagcgcaacaattcaacgttataaaggtcttggagaaatgaatgcagaacaattgtgggacacaa ctttaaatcctgaatttagaactttgcgtcaagtaaatattgatagtttagcagaagctgatagagttttctcaatgttaatgggagatgaggttccgcctcgtag gaatttatcgaaaaaaatgcagt

Clone I acagaaaaagaagccaaactaaaagcattacagcttacattagataaattagacaagacttacggcaaaggaaccgtaatgaaaatgggcgataaagctgt agaagaagtagaaacaatttcttcaggatcattaggattagacctagccttaggagttggcggatatcctcgtggtcgtgtaattgaaatatacggaccagaat catcaggaaaaacaaccttaaccctacacgctattgccgaagcccaaaaagcaggaggaattgccgctttcatagatgcagaacacgccttcgatagaagt tatgccgaaaaattaggtgttgatatcgaaaatttaatcatttcccaaccagataacggggagcaagctttagaaatcgccgaaaacttaatacgttcaggagc aatagatattgttgtaatcgattcagttgcagcacttaccccaaaaagcgaaattgaaggcgaaatgggagattctaaaatgggtcttcatgcacgattaatgtc gcaagcctt

Clone J ctttcaattcccattctgcaaacttgaatcctggtttttgagtggttctgttatcaaatttgactgaaatattaagttttttaaattgcgatattaaatcattggctagg gccgaaattttctcgaactcttcatcggttttaaaaatgggcacaataactacttgtattggtgctaaattgggtggtaaaactaatccgttgtcatcggaatgt gtcataactaaagctcccattaatcttgtagaaactccccaagaggttccccaaacgtgttcttgttttccttcg

Clone K ttattcagaaaggaaatctgataattcgatggaaaattttaaaacaaagttaaagatactcaaaagaatttattgccaacgatattatatacagatcgaggtttatt tgaaactattatttggaagcaataccatcgatgtaataaccaacaggaactgccctagaagtcgatctgggcccctcattttcgccaagaaatagacaaagta cc

142 Clone L tcgagcggccgcccgggcaggtacgttcgcaagaatgaaactcaaaggaattgacgggggcccgcacaagcggtggagcatgtggtttaattcgatga tacgcgaggaaccttaccaaggcttaaatgtagattgaccggtttggaaacagacttttcgcaaggcaatttacaaggtgctgcatggttgtcgtcagctcgt gccgtgaggtgtcaggttaagtcctataacgagcgcaacccctgttgttagttgccagcgagtcatgtcgggaactctagcaagactgccagt

~~Clone M accaaggcagaacccaagaaggagattataaaagagttttggcattttggtcaatatgtggccccacaaagattcgaaatatgctgctgaatatcctgat aatgtagaagttaaagtaaattgccgagatttatacgaggttggtaaagagagc~~

Clone N gccgttaattattgcagttgtcgtaatgattataacaatggtttctccacaatttaatcgcttccaaacgctcattgataaaatgaacactattgtgaaataaca gctttatggcattctagtggttaaatcttttgttcaggagaaaaatcaaaataagaaatttgaaaaaatttctgatgaacttgttaagattaatatctttgttggaa attggttcgctttcatggagccagccatgacccttatcgtcttctttgcaatgtatattgctatttatgttgtgtctgacttagcaaaaacggatccgattgttgtc gggaaaatagcagtattccttgcttatgctatgcaaatgat

Clone O ttatccgcaacagtgttgacgctatcattaattgggagcaatttaacatcaaccaaaatgaaatggtgcagtttttagaaaacaacaactccgccgattaaccg cgttacatctaacctttcccaattaaaagggatttattctattcacggacaagtctttttaatcaacccaatgtcacaataggtaaagacgcaattattaacaccaa tggctttacggtcacgctaatatttctaacgaaaaccatcaaagcacgtaatttcacccttgagcaaaccaaggataaagcgctcgctgacgtgaatcacggt ttaattactgtcggtaagacggtagtgtaaatcttattggtggcaaagtgaaagagggtgtgattagcgtaaataccaagggcggcaagattaatgttcgtgct

Clone P cctccatgggggtttagctcagctggtagagcacctgctttgcaagcagggggtcaccggttcgagtccggtaacctccaccagacgggcccatagctca gctggctagagcgcgcgactgataatcgcgaggtcggtggttcgagtccacttgggcccaccacttactctttcttgaaagaaagagtaagcagaaagaa cttccacaagagaatatgcgagattggattgaagcattcaagcattgagtgtttcaatctgaccttgaaaaaggttggaaggctgcaccttgaaaactgaacaa tgtagattcaaagtatgcgaagcaagcaacagagggcaaaaacagcaatgttgtggaacttttaaatagaatggcgaaagccgttctagtgaatgggtaaaa caattagccaatttgcaaaacttctgtgaagcctgcataatttcatgatcaaat

Clone Q aatcggcaaagtgaccggtggctggcgtgatttaaccctcgataatgttcgctacgaacagcccggggtggcggtgaccgccggtcagtttcacctcagct caggttgcgctgcctgtgggacagcagcctgtgcgtaaacgacatcgcgctgcgcgatatttacgtcgccgtcgataccaagaagatgccgccctcagcg ccggtcgaggaagaggacagcgggccgctgaatctctccactccttatccgatcactctcagccgcgtcgcgctgcataacgtcaacgttaaaatcgatgat accgcggtctccgtacgcgatttttccaccggcctgaactggcaggagaaaaatctgaccctgacgccgacctcgctgcaggggctgctgatcgccctgct aaggtggcgaaagtggcgcaggagcaggtggttgagccgaaaattgacaacccgcagccgcaggaaaaaccgctcggcgagacgatgaccgacctct tctcgcagccggtgctgccggcgatgaccgatgtccatctgccgctgaacctcaatattcaggcgttccgcggcgagcagctgcgcctgaccggcgatag atatcaccgtgtataacctgctgctgaaagtcagcagtattgacggccagatgaagctcgacgcccttgatatcgactccgatcagggcaaggtcagcgcct cgggcagcgcgcagctgcaggataactggccggtggacattaccctcgccggaaccctgaacg

143 CloneR atggcaactgcagttcgcttacaccgcttctcaacccggtacgcaccagaaaatcattatatggccatgaatggcgttggatgccgggcaactgcacgcatt atgggcgttggcctcaacacgattttacgtcacttaaaaaactcaggccgcagtcggtaacctcgcgcatacagccgggcagtgacgtcatcgtctgcgcg gaaatggacgaacagtggggctatgtcggggctaaatcgcgccagcgctggctgttttacgcgtatgacagtctccggaagacggttgttgcgcacgtatt cggtgaacgcactat ggcgacgctggggcgtcttatgagcctgct gtcaccctttgacgtggtgatatggatgacggatggctggccgctgtatgaatccc gcct gaagggaaagctgcacgtaatcagcaagcgatatacgcagcgaattgagcggcataacctgaatctgaggcagcacctggcacggctgggacg gaagtcgctgtcgttctcaaaatcggtggagctgcatgacaaagtcatcgggcattatctgaacataaaacactatcaataa

~~144~~