Daphnia Orthology Gene Groups with Over-Abundances Compared to Insects
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0. -
Relevance Network Between Chemosensitivity and Transcriptome in Human Hepatoma Cells1
Vol. 2, 199–205, February 2003 Molecular Cancer Therapeutics 199 Relevance Network between Chemosensitivity and Transcriptome in Human Hepatoma Cells1 Masaru Moriyama,2 Yujin Hoshida, topoisomerase II  expression, whereas it negatively Motoyuki Otsuka, ShinIchiro Nishimura, Naoya Kato, correlated with expression of carboxypeptidases A3 Tadashi Goto, Hiroyoshi Taniguchi, and Z. Response to nimustine was associated with Yasushi Shiratori, Naohiko Seki, and Masao Omata expression of superoxide dismutase 2. Department of Gastroenterology, Graduate School of Medicine, Relevance networks identified several negative University of Tokyo, Tokyo 113-8655 [M. M., Y. H., M. O., N. K., T. G., H. T., Y. S., M. O.]; Cellular Informatics Team, Computational Biology correlations between gene expression and resistance, Research Center, Tokyo 135-0064 [S. N.]; and Department of which were missed by hierarchical clustering. Our Functional Genomics, Graduate School of Medicine, Chiba University, results suggested the necessity of systematically Chiba 260-8670 [N. S.], Japan evaluating the transporting systems that may play a major role in resistance in hepatoma. This may provide Abstract useful information to modify anticancer drug action in Generally, hepatoma is not a chemosensitive tumor, hepatoma. and the mechanism of resistance to anticancer drugs is not fully elucidated. We aimed to comprehensively Introduction evaluate the relationship between chemosensitivity and Hepatoma is a major cause of death even in developed gene expression profile in human hepatoma cells, by countries, and its incidence is increasing (1). Despite the using microarray analysis, and analyze the data by progress of therapeutic technique (2), the efficacy of radical constructing relevance networks. therapy is hampered by frequent recurrence and advance of In eight hepatoma cell lines (HLE, HLF, Huh7, Hep3B, the tumor (3). -
Supplementary Information Genomice and Transcriptomic Analysis
Supplementary Information Genomice and Transcriptomic Analysis for Identification of Genes and Interlinked Pathways Mediating Artemisinin Resistance in Leishmania donovani Sushmita Ghosh1,2, Aditya Verma1, Vinay Kumar1, Dibyabhaba Pradhan3, Angamuthu Selvapandiyan 2, Poonam Salotra1, Ruchi Singh1* 1. ICMR- National Institute of Pathology, Safdarjung Hospital Campus, New Delhi-110029, India 2. Jamia Hamdard University-Institute of Molecular Medicine, New Delhi-110062, India 3. ICMR-AIIMS Computational Genomics Centre, Indian Council of Medical Research, New Delhi- 110029 *Correspondence: [email protected] Supplementary Figures and Tables: Figure S1. Figure S1: Comparative transcriptional responses following ART adaptation in L. donovani. Overlap of log2 transformed K133 AS-R and K133 WT expression ratio plotted as a function of chromosomal location of probes representing the full genome microarray. The plot represents the average values of three independent hybridizations for each isolate. Table S1: List of genes validated for their modulated expression by Quantitative real time- PCR S.N Primer Gene Name/ Function/relevance Primer Sequence o. Name Gene ID 1 AQP1 Aquaglyceropor Metal ion F- in (LinJ.31.0030) transmembrane 5’CAGGGACAGCTCGAGGGTAA transporter activity, AA3’ integral to membrane; transmembrane R- transport; transporter 5’GTTACCGGCGTGAAAGACAG activity; water TG3’ transport. 2 A2 A2 protein Cellular response to F- (LinJ.22.0670) stress 5’GTTGGCCCGCTTTCTGTTGG3’ R- 5’ACCAACGTCAACAGAGAGA GGG3’ 3 ABCG1 ATP-binding ATP binding, ATPase -
Research Article a Liquid Chromatography with Tandem Mass Spectrometry-Based Proteomic Analysis of Primary Cultured Cells and Subcultured Cells Using Mouse Adipose-Derived
Hindawi Stem Cells International Volume 2019, Article ID 7274057, 97 pages https://doi.org/10.1155/2019/7274057 Research Article A Liquid Chromatography with Tandem Mass Spectrometry-Based Proteomic Analysis of Primary Cultured Cells and Subcultured Cells Using Mouse Adipose-Derived Mesenchymal Stem Cells Yoshiki Nakashima ,1 Saifun Nahar,2 Chika Miyagi-Shiohira,1 Takao Kinjo,3 Naoya Kobayashi,4 Issei Saitoh ,5 Masami Watanabe,6 Jiro Fujita,2 and Hirofumi Noguchi 1 1Department of Regenerative Medicine, Graduate School of Medicine, University of the Ryukyus, Okinawa 903-0215, Japan 2Department of Infectious, Respiratory, and Digestive Medicine, University of the Ryukyus, Okinawa 903-0215, Japan 3Department of Basic Laboratory Sciences, School of Health Sciences in Faculty of Medicine, University of the Ryukyus, Okinawa 903-0215, Japan 4Okayama Saidaiji Hospital, Okayama 704-8192, Japan 5Division of Pediatric Dentistry, Graduate School of Medical and Dental Science, Niigata University, Niigata 951-8514, Japan 6Department of Urology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama 700-8558, Japan Correspondence should be addressed to Hirofumi Noguchi; [email protected] Received 23 April 2018; Revised 27 September 2018; Accepted 17 October 2018; Published 10 January 2019 Academic Editor: Katia Mareschi Copyright © 2019 Yoshiki Nakashima et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Adipose-derived mesenchymal stem cells (MSC-ATs) are representative cell sources for cell therapy. However, how cell stress resulting from passage influences the MSC-AT protein expression has been unclear. -
Kidney V-Atpase-Rich Cell Proteome Database
A comprehensive list of the proteins that are expressed in V-ATPase-rich cells harvested from the kidneys based on the isolation by enzymatic digestion and fluorescence-activated cell sorting (FACS) from transgenic B1-EGFP mice, which express EGFP under the control of the promoter of the V-ATPase-B1 subunit. In these mice, type A and B intercalated cells and connecting segment principal cells of the kidney express EGFP. The protein identification was performed by LC-MS/MS using an LTQ tandem mass spectrometer (Thermo Fisher Scientific). For questions or comments please contact Sylvie Breton ([email protected]) or Mark A. Knepper ([email protected]). -
Estudio De Las Vías De Señalización E Inflamatorias Del Canal P2X7 Y Su Variante Polimórfica Gln460arg En Células Del Sistema Nervioso Central
Tesis Doctoral Estudio de las vías de señalización e inflamatorias del canal P2X7 y su variante polimórfica Gln460Arg en células del sistema nervioso central Aprile García, Fernando 2014-04-11 Este documento forma parte de la colección de tesis doctorales y de maestría de la Biblioteca Central Dr. Luis Federico Leloir, disponible en digital.bl.fcen.uba.ar. Su utilización debe ser acompañada por la cita bibliográfica con reconocimiento de la fuente. This document is part of the doctoral theses collection of the Central Library Dr. Luis Federico Leloir, available in digital.bl.fcen.uba.ar. It should be used accompanied by the corresponding citation acknowledging the source. Cita tipo APA: Aprile García, Fernando. (2014-04-11). Estudio de las vías de señalización e inflamatorias del canal P2X7 y su variante polimórfica Gln460Arg en células del sistema nervioso central. Facultad de Ciencias Exactas y Naturales. Universidad de Buenos Aires. Cita tipo Chicago: Aprile García, Fernando. "Estudio de las vías de señalización e inflamatorias del canal P2X7 y su variante polimórfica Gln460Arg en células del sistema nervioso central". Facultad de Ciencias Exactas y Naturales. Universidad de Buenos Aires. 2014-04-11. Dirección: Biblioteca Central Dr. Luis F. Leloir, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires. Contacto: [email protected] Intendente Güiraldes 2160 - C1428EGA - Tel. (++54 +11) 4789-9293 UNIVERSIDAD DE BUENOS AIRES Facultad de Ciencias Exactas y Naturales Estudio de las vías de señalización e inflamatorias del canal P2X7 y su variante polimórfica Gln460Arg en células del sistema nervioso central Tesis presentada para optar al título de Doctor de la Universidad de Buenos Aires en el área CIENCIAS BIOLOGICAS Lic. -
Gfapind Nestin G FA P DA PI
Figure S1 GFAPInd NB +bFGF/+EGF NB -bFGF/-EGF nestin GFAP DAPI (a) Figure S1 GFAPConst NB +bFGF+/+EGF NB -bFGF/-EGF nestin GFAP DAPI (b) Figure S2 +bFGF/+EGF (a) Figure S2 -bFGF/-EGF (b) Figure S3 #10 #1095 #1051 #1063 #1043 #1083 ~20 weeks GSCs GSC_IRs compare tumor-propagating capacity proliferation gene expression Supplemental Table S1. Expression patterns of nestin and GFAP in GSCs self-renewing in vitro. GSC line nestin (%) GFAP (%) #10 90 ± 1,9 26 ± 5,8 #1095 92 ± 5,4 1,45 ± 0,1 #1063 74,4 ± 27,9 3,14 ± 1,8 #1051 92 ± 1,3 < 1 #1043 96,7 ± 1,4 96,7 ± 1,4 #1080 99 ± 0,6 99 ± 0,6 #1083 64,5 ± 14,1 64,5 ± 14,1 G112-NB 99 ± 1,6 99 ± 1,6 Immunofluorescence staining of GSCs cultured under self-renewal promoting condition Supplemental Table S2. Gene expression analysis by Gene Ontology terms. -
Flavor Characteristics of Soy Products Modified by Proteases and Alpha-Galactosidase" (2007)
Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 2007 Flavor characteristics of soy products modified yb proteases and alpha-galactosidase Sheue-Lei Lock Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Agriculture Commons, and the Food Science Commons Recommended Citation Lock, Sheue-Lei, "Flavor characteristics of soy products modified by proteases and alpha-galactosidase" (2007). Retrospective Theses and Dissertations. 14899. https://lib.dr.iastate.edu/rtd/14899 This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Flavor characteristics of soy products modified by proteases and alpha-galactosidase by Sheue-Lei Lock A thesis submitted to the graduate faculty in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Major: Food Science and Technology Program of Study Committee: Cheryll A.Reitmeier, Major Professor Lawrence Johnson Petrutza Caragea Iowa State University Ames, Iowa 2007 Copyright © Sheue-Lei Lock, 2007. All rights reserved. UMI Number: 1449657 UMI Microform 1449657 Copyright 2008 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, MI 48106-1346 ii Dedicated to Dr.Cheryll A. Reitmeier and Dr. -
1 Novel Expression Signatures Identified by Transcriptional Analysis
ARD Online First, published on October 8, 2009 as 10.1136/ard.2009.108043 Ann Rheum Dis: first published as 10.1136/ard.2009.108043 on 7 October 2009. Downloaded from Novel expression signatures identified by transcriptional analysis of separated leukocyte subsets in SLE and vasculitis 1Paul A Lyons, 1Eoin F McKinney, 1Tim F Rayner, 1Alexander Hatton, 1Hayley B Woffendin, 1Maria Koukoulaki, 2Thomas C Freeman, 1David RW Jayne, 1Afzal N Chaudhry, and 1Kenneth GC Smith. 1Cambridge Institute for Medical Research and Department of Medicine, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK 2Roslin Institute, University of Edinburgh, Roslin, Midlothian, EH25 9PS, UK Correspondence should be addressed to Dr Paul Lyons or Prof Kenneth Smith, Department of Medicine, Cambridge Institute for Medical Research, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK. Telephone: +44 1223 762642, Fax: +44 1223 762640, E-mail: [email protected] or [email protected] Key words: Gene expression, autoimmune disease, SLE, vasculitis Word count: 2,906 The Corresponding Author has the right to grant on behalf of all authors and does grant on behalf of all authors, an exclusive licence (or non-exclusive for government employees) on a worldwide basis to the BMJ Publishing Group Ltd and its Licensees to permit this article (if accepted) to be published in Annals of the Rheumatic Diseases and any other BMJPGL products to exploit all subsidiary rights, as set out in their licence (http://ard.bmj.com/ifora/licence.pdf). http://ard.bmj.com/ on October 2, 2021 by guest. Protected copyright. 1 Copyright Article author (or their employer) 2009. -
1 Identification of Novel Ras Pathway Genes Using an Inducible
Identification of novel Ras pathway genes using an inducible Drosophila tumor cell line Research Thesis Presented in partial fulfillment of the requirements for graduation with research distinction in Molecular Genetics in the undergraduate colleges of The Ohio State University By Peter Lyon The Ohio State University April 2016 Project Advisor: Professor Amanda Simcox, Department of Molecular Genetics 1 Table of Contents Abstract……………………………………………………………………………………………3 Acknowledgments…………………………………………………………………………………4 Introduction………………………………………………………………………………………..5 Materials and Methods…………………………………………………………………………….8 Results & Discussion…………………………………………………………………………….11 Literature Cited…………………………………………………………………………………..22 Appendix 1…………………………………………………………………………...…………..25 Appendix 2……………………………………………………………………………...………..37 Appendix 3: Characterization of CG4096, a known negative regulator of Egfr signaling………44 2 Abstract The oncogenic form of Ras signaling is associated with 30% of human cancers, including 90% of pancreatic tumors, was first genetically characterized in Drosophila. Subsequent genetic screens have identified many additional genes in the pathway. To identify novel candidates, we have conducted an in vitro screen using an inducible Ras oncogene in Drosophila tissue culture cells developed in our lab. This conditional cell line requires the control of oncogenic RasV12 expression induced by GeneSwitch-Gal4 (GSR) for proliferation. Using RNAseq analysis, 363 gene transcripts were identified that were upregulated two-fold or greater by oncogenic RasV12 expression. Of these, 91 candidate genes were tested further for functional analysis using RNAi in flies. Ubiquitous knock-down of 38 target genes caused death or decreased viability of the organism, suggesting their essential role, and depletion of another gene caused a wing phenotype. As the Ras pathway is known to play an important role in wing-vein patterning, I carried out tissue- specific knock-downs in the wing. -
Amide Bond Activation of Biological Molecules
molecules Review Review AmideAmide BondBond ActivationActivation of Biological Molecules Molecules Sriram Mahesh, Kuei-Chien Tang and Monika Raj * Sriram Mahesh, Kuei-Chien Tang and Monika Raj * Department of Chemistry and Biochemistry, Auburn University, Auburn, AL 36849, USA; [email protected] of Chemistry (S.M.); and kzt0026@ti Biochemistry,germail.auburn.edu Auburn University, (K.-C.T.) Auburn, AL 36849, USA; [email protected]* Correspondence: [email protected]; (S.M.); [email protected] Tel.: +1-334-844-6986 (K.-C.T.) * Correspondence: [email protected]; Tel.: +1-334-844-6986 Academic Editor: Michal Szostak AcademicReceived: Editor:7 September Michal 2018; Szostak Accepted: 9 October 2018; Published: date Received: 7 September 2018; Accepted: 9 October 2018; Published: 12 October 2018 Abstract: Amide bonds are the most prevalent structures found in organic molecules and various Abstract: Amide bonds are the most prevalent structures found in organic molecules and various biomolecules such as peptides, proteins, DNA, and RNA. The unique feature of amide bonds is their biomolecules such as peptides, proteins, DNA, and RNA. The unique feature of amide bonds ability to form resonating structures, thus, they are highly stable and adopt particular three- is their ability to form resonating structures, thus, they are highly stable and adopt particular dimensional structures, which, in turn, are responsible for their functions. The main focus of this three-dimensionalreview article is to structures, report the which, methodologies in turn, are for responsible the activation for their of functions.the unactivated The main amide focus bonds of this reviewpresent article in biomolecules, is to report thewhich methodologies includes the for enzy thematic activation approach, of the metal unactivated complexes, amide and bonds non-metal present inbased biomolecules, methods. -
Supplemental Information
Supplemental Information 1. Supplementary Figures Supplementary Figure 1. Schematic diagram of the partial carotid ligation model, in which used in (A) genomic studies, (B) vascular inflammation and arterial wall-thickening, and (C) atherosclerosis functional studies. Supplementary Figure 2. Knockdown efficiency of Chi3l1 siRNA in iMAECs. (A) Knockdown of Chi3l1 mRNA by Chi3l1 siRNA (siChi3l1, 150 nM) in IL-6-stimulated iMAECs in comparison to control siRNA (siControl) was determined by qPCR (n = 5 each, data shown as mean ± SEM, *p < 0.05 as determined by paired t-test). (B) Representative Western blots show a decreased expression of Chi3l1 protein stimulated by IL-6 upon treatment with siChi3l1 (150 nM) in iMAECs. Supplementary Figure 3. The putative Chi3l1 targeting miRNAs. (A) The predicted miRNAs that target APP (5394 miRNAs) or Chi3l1 (527 miRNAs) from miRWalk were compared with a list of miRNAs (537 miRNAs) from a previous microarray data of mouse partial carotid ligation model. Venn diagram depicts the common miRNAs (14 miRNAs). (B) The list of 14 candidate miRNAs that regulates vascular inflammation and atherosclerosis development through targeting Chi3l1 in APPsw- Tg mice. Supplementary Figure 4. Expression of the putative Chi3l1 targeting miRNAs in APPsw-Tg mice carotid endothelium. Expression of putative Chi3l1 targeting miRNAs was determined by qPCR using the Qiagen miScript miRNA-specific primer assay for each miRNAs in endothelial- enriched RNA obtained from the LCA and RCA following partial carotid ligation in APPsw-Tg or non- Tg mice at 2 days post-ligation (n = 5, data shown as mean ± SEM). Supplementary Figure 5. Adenoviral vector construction and Chi3l1 knockdown efficiency in vitro and in vivo.