Daphnia Orthology Gene Groups with Over-Abundances Compared to Insects

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Daphnia orthology gene groups with over-abundances compared to insects Notes: Gene_Group documentation is at http://insects.eugenes.org/arthropods/; Gene_Class is a consensus functional annotation of genes in this group; Description is a consensus description of the genes; Groups with limited annotations (hypothetical) were excluded from this list. Daph column is gene count for Daphnia, * mark is for nDaph > Insects with significance p < 0.01 using chi-square test, others are groups with 2+ Daphnia genes for 1- 1 Insect genes. dPI column lists protein percent identity mean, and maximum in the group. iAve, iMax are average, maximum other (insect) gene counts for the group; marks of ^Aphid indicate overabundant group shared with Aphid Gene Group Daph dPI iAve iMax Gene_Class Description ARP1_G1539 2 88 0.9 1 ABC_transporter ATP-binding cassette sub-family F member 1 ^Aphid ARP1_G1456 2 56 1 2 Abhydrolase conserved hypothetical protein ^Aphid ARP1_G360 15* 45/70 1.3 4 Abhydrolase lysosomal acid lipase ^Aphid ARP1_G2060 2 94 1 1 Acetyl coA-transferase 4-Hydroxybutyrate CoA-transferase ARP1_G2713 2 100 0.9 1 acetylcholinesterase membrane anchor CutA homolog conserved hypothetical protein ARP1_G1507 2 69 1 1 acetylgalactosaminidase alpha-galactosidase/alpha-n-acetylgalactosaminidase ^Aphid ARP1_G187 4 25/30 2.8 3 actin binding beta chain spectrin ARP1_G236 20* 52/95 1.6 3 Acyl_transf conserved hypothetical protein ARP1_G1343 4 72/97 1.1 2 acyl-CoA binding peroxisomal 3,2-trans-enoyl-CoA isomerase ARP1_G331 8 81/100 1.8 2 acyl-CoA binding acyl-CoA-binding protein ARP1_G1582 2 36 1.2 2 acyl-CoA dehydrogenase short-chain specific acyl-CoA dehydrogenase ARP1_G1760 3 48/57 1 1 Acyltransferase 1-acylglycerol-3-phosphate acyltransferase ARP1_G1989 3 57/76 1 2 Adenylate cyclase adenylate cyclase ^Aphid ARP1_G2596 2 100 0.9 1 Adenylate cyclase conserved hypothetical protein ^Aphid ARP1_G1070 4 59/69 1.1 2 ADH_short short-chain dehydrogenase ARP1_G1638 5 74/91 1 2 ADH_short dehydrogenase/reductase SDR family member 4 ARP1_G1957 2 62 1.1 2 ADH_short dehydrogenase/reductase SDR family member 7 ARP1_G3060 2 99 1 1 ADH_short short-chain dehydrogenase ^Aphid ARP1_G3360 3 76/85 1.1 2 ADH_short short-chain dehydrogenase ARP1_G5899 2 39 0.9 1 ADH_short GA21392-PA ARP1_G6031 4* 57/63 0.5 4 ADH_short Carbonyl reductase ^Aphid ARP1_G732 3 58/62 1.1 2 ADH_short steroid dehydrogenase ARP1_G9451 5* 49/59 0 1 ADH_short Steroid dehydrogenase ARP1_G3110 2 61 0.8 1 Adiponectin receptor adiponectin receptor protein 2 ARP1_G4686 2 99 1.1 2 alanine-glyoxylate transaminase Alanine-glyoxylate aminotransferase ARP1_G2324 3 96/98 1 1 Alcohol dehydrogenase class 3 alcohol dehydrogenase class 3 ARP1_G4324 2 80 0.9 1 Aldedh aldehyde dehydrogenase 7 family ARP1_G944 4 89/93 1.1 2 Aldedh pyrroline-5-carboxylate dehydrogenase ARP1_G1087 2 98 1.3 2 allatostatin receptor allatostatin C receptor 2 CG13702-PB ARP1_G1055 3 64/69 1.2 2 Alpha_L_fucos plasma alpha-L-fucosidase ARP1_G1408 2 77 1.1 2 amidase amidase ARP1_G5562 2 28 0.9 1 Amidohydro_1 CyPIN guanine aminohydrolase family (cpin-1) ARP1_G1329 2 71 1 1 amino acid and derivative metabolic processaromatic-L-amino-acid decarboxylase ARP1_G947 4 60/80 0.8 1 Amino acid transporter proton-coupled amino acid transporter 1 ARP1_G4427 2 99 1 1 aminolevulinate synthase 5-aminolevulinic acid synthase ARP1_G12942 3* 53/55 0 1 ammonium transporter Ammonium transporter (ISS) ARP1_G3342 2 65 1 1 Ammonium_transp Rh-like protein ARP1_G1292 3 76/78 1 1 AMP-binding long-chain-fatty-acid coa ligase ARP1_G399 12* 59/98 1.4 3 AMP-binding AMP dependent coa ligase ARP1_G793 4 48/60 1.5 3 AMP-binding amp dependent coa ligase ARP1_G538 3 72/78 1.1 2 AMP-binding long-chain-fatty-acid coa ligase ARP1_G3452 3 67/69 0.8 1 Ancient conserved domain ancient conserved domain protein 2 (cyclin m2) ARP1_G2783 2 83 1.1 2 Arfaptin islet cell autoantigen 1 ARP1_G1181 3 44/58 1 1 Arrestin conserved hypothetical protein ^Aphid ARP1_G222 16* 51/96 2.1 5 Astacin zinc metalloproteinase nas-14 ARP1_G8409 4* 72/76 0.3 2 Astacin zinc metalloproteinase dpy-31 ARP1_G804 2 na 1 1 ATP-binding cassette sub-family D memberATP-binding 2 cassette sub-family D member 1 ARP1_G1932 2 96 1 1 ATPase conserved hypothetical protein ^Aphid ARP1_G195 15* 59/89 2.2 4 ATPase abc transporter ARP1_G203 11* 60/83 2 3 ATPase ATP-binding cassette sub-family G member 4 ARP1_G2163 2 89 1.1 2 ATPase ATP-dependent Clp protease ATP-binding subunit clpX ARP1_G890 2 91 1 1 ATPase mitochondrial atp synthase b chain ^Aphid ARP1_G964 3 57/80 1.1 2 acetylhexosaminidase beta-N-acetylglucosaminidase ARP1_G2899 3 87/89 1 1 binding tetratricopeptide repeat protein 1 ARP1_G794 2 82 1 2 binding importin beta-2 ARP1_G2288 2 43 1 1 Biotin_lipoyl dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase ARP1_G870 5 58/72 1.1 2 bombesin receptor subtype-3 bombesin receptor subtype-3 ^Aphid ARP1_G2258 2 99 1.1 2 Brix domain brix domain-containing protein 2 ARP1_G4778 2 99 0.8 1 Calcitonin gene-related peptide-receptor componentcalcitonin proteingene-related peptide-receptor component protein ARP1_G5840 2 85 0.9 1 calcium channel dihydropyridine-sensitive l-type calcium channel ARP1_G1199 2 31 1.2 2 calcium ion binding fibrillin 2 ARP1_G4096 3 58/70 0.9 1 calcium ion binding nadph oxidase ARP1_G4617 2 36 1 1 calcium ion binding fibulin 1 and ARP1_G970 4 72/98 1.3 2 calcium ion binding calcyphosine-like protein ARP1_G889 3 50/78 1.1 2 calcium ion transport Na/Ca exchange protein don gilbert Page 1 3/27/09 Daphnia orthology gene groups with over-abundances compared to insects Gene Group Daph dPI iAve iMax Gene_Class Description ARP1_G640 2 100 0.9 1 cAMP-dependent protein kinase regulator camp-dependent protein kinase type i-beta regulatory subunit ARP1_G152 20* 52/89 2.5 4 Carb_anhydrase Carbonic anhydrase 2 CG6906-PA ARP1_G441 15* 96/100 0.9 2 Carb_anhydrase carbonic anhydrase ARP1_G3593 2 57 1 1 Carb_anhydrase putative cytoplasmic carbonic anhydrase ARP1_G1682 2 35 1.1 2 carbohydrate metabolic process conserved hypothetical protein ARP1_G4691 2 91 1 1 carboxylic acid metabolic process Glutamate decarboxylase-like 1 ARP1_G630 2 na 1.1 2 caspase activation disulfide oxidoreductase ARP1_G1803 2 44 1.2 2 catalytic isochorismatase domain-containing protein 2 ARP1_G3515 2 99 1 1 catalytic conserved hypothetical protein ARP1_G1018 2 45 1.3 2 Cation efflux protein cation efflux protein/ zinc transporter ^Aphid ARP1_G3858 2 98 1 1 CCAAT-box-binding transcription factor conserved hypothetical protein ARP1_G702 2 36 1.1 2 cell cycle arrest Short stop/Kakapo long isoform ARP1_G402 3 43/56 2 2 Chitin synthase Chitin synthase variant 1 ARP1_G1754 4 78/100 1.1 2 Chitin_bind conserved hypothetical protein ARP1_G3063 2 63 1 1 Chitin_bind conserved hypothetical protein ARP1_G647 19* 39/100 0.2 1 Chitin_bind prenylcysteine oxidase 1 ARP1_G831 9* 57/96 0.6 2 Chitin_bind peritrophic membrane chitin binding protein ARP1_G581 4 62/77 1.2 2 Chloride channel chloride channel protein 2 ARP1_G3158 6* 46/71 0.6 2 Chloride channel ca-activated chloride channel protein ARP1_G3355 2 na 1 1 cholesterol transporter putative cholesterol transporter BmStart1 ARP1_G1191 2 46 1 1 Choline_kinase choline/ethanolamine kinase ARP1_G2585 2 98 1 1 Chondroitin synthase chondroitin synthase ARP1_G3822 2 100 1 1 Chromatin accessibility complex protein 1histone-fold protein CHRAC subunit ARP1_G4566 2 80 1 1 Chromatin assembly chromatin assembly factor i P60 subunit ??Aphid/Daph ARP1_G5454 4 58/82 0.7 1 Chromatin assembly conserved hypothetical protein ARP1_G2475 2 61 1 2 Chromodomain heterochromatin protein 1 alpha ^Aphid ARP1_G1301 4 94/99 1 1 Chromosome region maintenance chromosome region maintenance protein 1/exportin ARP1_G5080 2 58 0.8 1 Cl_peroxidase_N presqualene diphosphate phosphatase ^Aphid ARP1_G2893 2 99 1 1 Cleavage and polyadenylation cleavage and polyadenylation specificity factor subunit 3 ??Aphid/Daph ARP1_G888 3 100/100 1 1 Coiled-coil domain conserved hypothetical protein ARP1_G4616 2 96 1 1 coupled to transmembrane m... ATP-binding cassette sub-family B member 10 ARP1_G245 12* 64/99 2.1 4 CRAL_TRIO CRAL/TRIO domain-containing protein ??Aphid/Daph ARP1_G407 4 51/66 1.4 2 CRAL_TRIO CRAL/TRIO domain-containing protein ARP1_G177 27* 48/83 1 2 CRAL_TRIO_N CRAL/TRIO domain-containing protein ARP1_G2956 2 91 1 1 Crossover junction endonuclease EME1 conserved hypothetical protein ARP1_G1749 3 53/68 0.8 1 Crust_neurohorm prepro ion transport-like peptide ARP1_G3715 2 100 1 1 Cuticle SGT1 protein homolog ecdysoneless ARP1_G49 82* 65/100 0.9 1 Cuticle Cuticular protein 146; RR-2 family ??Aphid/Daph ARP1_G88 39* 83/100 2.5 8 Cuticle pupal cuticle protein 78E ARP1_G2401 2 83 1 1 Cyclin g cyclin g ARP1_G769 2 95 1.3 2 Cysteine synthase Squamous cell carcinoma antigen ^Aphid ARP1_G2266 2 79 1 2 cytidine deaminase cytidine deaminase ARP1_G276 2 na 0.9 1 Cyt_P450 Cytochrome P450 18a1 (CYPXVIIIA1) ARP1_G219 13* 52/100 2.4 5 Cyt_P450 cytochrome P450 CYP15A1 ARP1_G5951 10* 63/89 0 0 Cyt_P450 Cytochrome P450 3A14 ARP1_G2399 2 na 1.1 2 Deadenylation factor EDEN-BP deadenylation factor EDEN-BP ARP1_G315 3 47/64 2 2 Dehalogen_hydro phospholipid-transporting atpase 1 ^Aphid ARP1_G7467 5* 87/99 0.3 1 DENN domain-containing protein 2B suppression of tumorigenicity 5 ARP1_G1509 2 44 1 1 DNA topoisomerase DNA topoisomerase 2-binding protein 1 ^Aphid ARP1_G1272 5 75/100 1 1 DNA topoisomerase II DNA topoisomerase/gyrase ARP1_G1127 2 71 1 1 DNA unwinding during replication High mobility group protein DSP1 ARP1_G2361 2 na 0.9 1 DNA_helicase ATP-dependent DNA helicase recQ ??Aphid/Daph ARP1_G5200 2 96 0.9 1 Dynactin 4 protein dynactin 4 protein ARP1_G878 8* 83/99 1 2 Dynein intermediate chain 3 dynein intermediate chain 2 ^Aphid ARP1_G1239 3 66/82 0.9 1 EF_hand_Ca_bd paramyosin ^Aphid ARP1_G4626 2 97 1 1 efhand supercoiling factor ARP1_G1054 3 59/75 1.4 2 electron transport peroxisomal N1-acetyl-spermine/spermidine oxidase ARP1_G2168 2 35 1.1 2 EMP70 transmembrane 9 superfamily protein member 3 ARP1_G347 9* 57/88 1.9 4 Endonuclease deoxyribonuclease I ARP1_G2051 2 37 1.1 2 endopeptidase spermatogenesis associated factor ARP1_G1729 2 na 1 1 epidermal growth factor receptor signalingpole ..
Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase

    METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase

    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
  • Relevance Network Between Chemosensitivity and Transcriptome in Human Hepatoma Cells1

    Relevance Network Between Chemosensitivity and Transcriptome in Human Hepatoma Cells1

    Vol. 2, 199–205, February 2003 Molecular Cancer Therapeutics 199 Relevance Network between Chemosensitivity and Transcriptome in Human Hepatoma Cells1 Masaru Moriyama,2 Yujin Hoshida, topoisomerase II ␤ expression, whereas it negatively Motoyuki Otsuka, ShinIchiro Nishimura, Naoya Kato, correlated with expression of carboxypeptidases A3 Tadashi Goto, Hiroyoshi Taniguchi, and Z. Response to nimustine was associated with Yasushi Shiratori, Naohiko Seki, and Masao Omata expression of superoxide dismutase 2. Department of Gastroenterology, Graduate School of Medicine, Relevance networks identified several negative University of Tokyo, Tokyo 113-8655 [M. M., Y. H., M. O., N. K., T. G., H. T., Y. S., M. O.]; Cellular Informatics Team, Computational Biology correlations between gene expression and resistance, Research Center, Tokyo 135-0064 [S. N.]; and Department of which were missed by hierarchical clustering. Our Functional Genomics, Graduate School of Medicine, Chiba University, results suggested the necessity of systematically Chiba 260-8670 [N. S.], Japan evaluating the transporting systems that may play a major role in resistance in hepatoma. This may provide Abstract useful information to modify anticancer drug action in Generally, hepatoma is not a chemosensitive tumor, hepatoma. and the mechanism of resistance to anticancer drugs is not fully elucidated. We aimed to comprehensively Introduction evaluate the relationship between chemosensitivity and Hepatoma is a major cause of death even in developed gene expression profile in human hepatoma cells, by countries, and its incidence is increasing (1). Despite the using microarray analysis, and analyze the data by progress of therapeutic technique (2), the efficacy of radical constructing relevance networks. therapy is hampered by frequent recurrence and advance of In eight hepatoma cell lines (HLE, HLF, Huh7, Hep3B, the tumor (3).
  • Supplementary Information Genomice and Transcriptomic Analysis

    Supplementary Information Genomice and Transcriptomic Analysis

    Supplementary Information Genomice and Transcriptomic Analysis for Identification of Genes and Interlinked Pathways Mediating Artemisinin Resistance in Leishmania donovani Sushmita Ghosh1,2, Aditya Verma1, Vinay Kumar1, Dibyabhaba Pradhan3, Angamuthu Selvapandiyan 2, Poonam Salotra1, Ruchi Singh1* 1. ICMR- National Institute of Pathology, Safdarjung Hospital Campus, New Delhi-110029, India 2. Jamia Hamdard University-Institute of Molecular Medicine, New Delhi-110062, India 3. ICMR-AIIMS Computational Genomics Centre, Indian Council of Medical Research, New Delhi- 110029 *Correspondence: [email protected] Supplementary Figures and Tables: Figure S1. Figure S1: Comparative transcriptional responses following ART adaptation in L. donovani. Overlap of log2 transformed K133 AS-R and K133 WT expression ratio plotted as a function of chromosomal location of probes representing the full genome microarray. The plot represents the average values of three independent hybridizations for each isolate. Table S1: List of genes validated for their modulated expression by Quantitative real time- PCR S.N Primer Gene Name/ Function/relevance Primer Sequence o. Name Gene ID 1 AQP1 Aquaglyceropor Metal ion F- in (LinJ.31.0030) transmembrane 5’CAGGGACAGCTCGAGGGTAA transporter activity, AA3’ integral to membrane; transmembrane R- transport; transporter 5’GTTACCGGCGTGAAAGACAG activity; water TG3’ transport. 2 A2 A2 protein Cellular response to F- (LinJ.22.0670) stress 5’GTTGGCCCGCTTTCTGTTGG3’ R- 5’ACCAACGTCAACAGAGAGA GGG3’ 3 ABCG1 ATP-binding ATP binding, ATPase
  • Research Article a Liquid Chromatography with Tandem Mass Spectrometry-Based Proteomic Analysis of Primary Cultured Cells and Subcultured Cells Using Mouse Adipose-Derived

    Research Article a Liquid Chromatography with Tandem Mass Spectrometry-Based Proteomic Analysis of Primary Cultured Cells and Subcultured Cells Using Mouse Adipose-Derived

    Hindawi Stem Cells International Volume 2019, Article ID 7274057, 97 pages https://doi.org/10.1155/2019/7274057 Research Article A Liquid Chromatography with Tandem Mass Spectrometry-Based Proteomic Analysis of Primary Cultured Cells and Subcultured Cells Using Mouse Adipose-Derived Mesenchymal Stem Cells Yoshiki Nakashima ,1 Saifun Nahar,2 Chika Miyagi-Shiohira,1 Takao Kinjo,3 Naoya Kobayashi,4 Issei Saitoh ,5 Masami Watanabe,6 Jiro Fujita,2 and Hirofumi Noguchi 1 1Department of Regenerative Medicine, Graduate School of Medicine, University of the Ryukyus, Okinawa 903-0215, Japan 2Department of Infectious, Respiratory, and Digestive Medicine, University of the Ryukyus, Okinawa 903-0215, Japan 3Department of Basic Laboratory Sciences, School of Health Sciences in Faculty of Medicine, University of the Ryukyus, Okinawa 903-0215, Japan 4Okayama Saidaiji Hospital, Okayama 704-8192, Japan 5Division of Pediatric Dentistry, Graduate School of Medical and Dental Science, Niigata University, Niigata 951-8514, Japan 6Department of Urology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama 700-8558, Japan Correspondence should be addressed to Hirofumi Noguchi; [email protected] Received 23 April 2018; Revised 27 September 2018; Accepted 17 October 2018; Published 10 January 2019 Academic Editor: Katia Mareschi Copyright © 2019 Yoshiki Nakashima et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Adipose-derived mesenchymal stem cells (MSC-ATs) are representative cell sources for cell therapy. However, how cell stress resulting from passage influences the MSC-AT protein expression has been unclear.
  • Kidney V-Atpase-Rich Cell Proteome Database

    Kidney V-Atpase-Rich Cell Proteome Database

    A comprehensive list of the proteins that are expressed in V-ATPase-rich cells harvested from the kidneys based on the isolation by enzymatic digestion and fluorescence-activated cell sorting (FACS) from transgenic B1-EGFP mice, which express EGFP under the control of the promoter of the V-ATPase-B1 subunit. In these mice, type A and B intercalated cells and connecting segment principal cells of the kidney express EGFP. The protein identification was performed by LC-MS/MS using an LTQ tandem mass spectrometer (Thermo Fisher Scientific). For questions or comments please contact Sylvie Breton ([email protected]) or Mark A. Knepper ([email protected]).
  • Estudio De Las Vías De Señalización E Inflamatorias Del Canal P2X7 Y Su Variante Polimórfica Gln460arg En Células Del Sistema Nervioso Central

    Estudio De Las Vías De Señalización E Inflamatorias Del Canal P2X7 Y Su Variante Polimórfica Gln460arg En Células Del Sistema Nervioso Central

    Tesis Doctoral Estudio de las vías de señalización e inflamatorias del canal P2X7 y su variante polimórfica Gln460Arg en células del sistema nervioso central Aprile García, Fernando 2014-04-11 Este documento forma parte de la colección de tesis doctorales y de maestría de la Biblioteca Central Dr. Luis Federico Leloir, disponible en digital.bl.fcen.uba.ar. Su utilización debe ser acompañada por la cita bibliográfica con reconocimiento de la fuente. This document is part of the doctoral theses collection of the Central Library Dr. Luis Federico Leloir, available in digital.bl.fcen.uba.ar. It should be used accompanied by the corresponding citation acknowledging the source. Cita tipo APA: Aprile García, Fernando. (2014-04-11). Estudio de las vías de señalización e inflamatorias del canal P2X7 y su variante polimórfica Gln460Arg en células del sistema nervioso central. Facultad de Ciencias Exactas y Naturales. Universidad de Buenos Aires. Cita tipo Chicago: Aprile García, Fernando. "Estudio de las vías de señalización e inflamatorias del canal P2X7 y su variante polimórfica Gln460Arg en células del sistema nervioso central". Facultad de Ciencias Exactas y Naturales. Universidad de Buenos Aires. 2014-04-11. Dirección: Biblioteca Central Dr. Luis F. Leloir, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires. Contacto: [email protected] Intendente Güiraldes 2160 - C1428EGA - Tel. (++54 +11) 4789-9293 UNIVERSIDAD DE BUENOS AIRES Facultad de Ciencias Exactas y Naturales Estudio de las vías de señalización e inflamatorias del canal P2X7 y su variante polimórfica Gln460Arg en células del sistema nervioso central Tesis presentada para optar al título de Doctor de la Universidad de Buenos Aires en el área CIENCIAS BIOLOGICAS Lic.
  • Gfapind Nestin G FA P DA PI

    Gfapind Nestin G FA P DA PI

    Figure S1 GFAPInd NB +bFGF/+EGF NB -bFGF/-EGF nestin GFAP DAPI (a) Figure S1 GFAPConst NB +bFGF+/+EGF NB -bFGF/-EGF nestin GFAP DAPI (b) Figure S2 +bFGF/+EGF (a) Figure S2 -bFGF/-EGF (b) Figure S3 #10 #1095 #1051 #1063 #1043 #1083 ~20 weeks GSCs GSC_IRs compare tumor-propagating capacity proliferation gene expression Supplemental Table S1. Expression patterns of nestin and GFAP in GSCs self-renewing in vitro. GSC line nestin (%) GFAP (%) #10 90 ± 1,9 26 ± 5,8 #1095 92 ± 5,4 1,45 ± 0,1 #1063 74,4 ± 27,9 3,14 ± 1,8 #1051 92 ± 1,3 < 1 #1043 96,7 ± 1,4 96,7 ± 1,4 #1080 99 ± 0,6 99 ± 0,6 #1083 64,5 ± 14,1 64,5 ± 14,1 G112-NB 99 ± 1,6 99 ± 1,6 Immunofluorescence staining of GSCs cultured under self-renewal promoting condition Supplemental Table S2. Gene expression analysis by Gene Ontology terms.
  • Flavor Characteristics of Soy Products Modified by Proteases and Alpha-Galactosidase" (2007)

    Flavor Characteristics of Soy Products Modified by Proteases and Alpha-Galactosidase" (2007)

    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 2007 Flavor characteristics of soy products modified yb proteases and alpha-galactosidase Sheue-Lei Lock Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Agriculture Commons, and the Food Science Commons Recommended Citation Lock, Sheue-Lei, "Flavor characteristics of soy products modified by proteases and alpha-galactosidase" (2007). Retrospective Theses and Dissertations. 14899. https://lib.dr.iastate.edu/rtd/14899 This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Flavor characteristics of soy products modified by proteases and alpha-galactosidase by Sheue-Lei Lock A thesis submitted to the graduate faculty in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Major: Food Science and Technology Program of Study Committee: Cheryll A.Reitmeier, Major Professor Lawrence Johnson Petrutza Caragea Iowa State University Ames, Iowa 2007 Copyright © Sheue-Lei Lock, 2007. All rights reserved. UMI Number: 1449657 UMI Microform 1449657 Copyright 2008 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, MI 48106-1346 ii Dedicated to Dr.Cheryll A. Reitmeier and Dr.
  • 1 Novel Expression Signatures Identified by Transcriptional Analysis

    1 Novel Expression Signatures Identified by Transcriptional Analysis

    ARD Online First, published on October 8, 2009 as 10.1136/ard.2009.108043 Ann Rheum Dis: first published as 10.1136/ard.2009.108043 on 7 October 2009. Downloaded from Novel expression signatures identified by transcriptional analysis of separated leukocyte subsets in SLE and vasculitis 1Paul A Lyons, 1Eoin F McKinney, 1Tim F Rayner, 1Alexander Hatton, 1Hayley B Woffendin, 1Maria Koukoulaki, 2Thomas C Freeman, 1David RW Jayne, 1Afzal N Chaudhry, and 1Kenneth GC Smith. 1Cambridge Institute for Medical Research and Department of Medicine, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK 2Roslin Institute, University of Edinburgh, Roslin, Midlothian, EH25 9PS, UK Correspondence should be addressed to Dr Paul Lyons or Prof Kenneth Smith, Department of Medicine, Cambridge Institute for Medical Research, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK. Telephone: +44 1223 762642, Fax: +44 1223 762640, E-mail: [email protected] or [email protected] Key words: Gene expression, autoimmune disease, SLE, vasculitis Word count: 2,906 The Corresponding Author has the right to grant on behalf of all authors and does grant on behalf of all authors, an exclusive licence (or non-exclusive for government employees) on a worldwide basis to the BMJ Publishing Group Ltd and its Licensees to permit this article (if accepted) to be published in Annals of the Rheumatic Diseases and any other BMJPGL products to exploit all subsidiary rights, as set out in their licence (http://ard.bmj.com/ifora/licence.pdf). http://ard.bmj.com/ on October 2, 2021 by guest. Protected copyright. 1 Copyright Article author (or their employer) 2009.
  • 1 Identification of Novel Ras Pathway Genes Using an Inducible

    1 Identification of Novel Ras Pathway Genes Using an Inducible

    Identification of novel Ras pathway genes using an inducible Drosophila tumor cell line Research Thesis Presented in partial fulfillment of the requirements for graduation with research distinction in Molecular Genetics in the undergraduate colleges of The Ohio State University By Peter Lyon The Ohio State University April 2016 Project Advisor: Professor Amanda Simcox, Department of Molecular Genetics 1 Table of Contents Abstract……………………………………………………………………………………………3 Acknowledgments…………………………………………………………………………………4 Introduction………………………………………………………………………………………..5 Materials and Methods…………………………………………………………………………….8 Results & Discussion…………………………………………………………………………….11 Literature Cited…………………………………………………………………………………..22 Appendix 1…………………………………………………………………………...…………..25 Appendix 2……………………………………………………………………………...………..37 Appendix 3: Characterization of CG4096, a known negative regulator of Egfr signaling………44 2 Abstract The oncogenic form of Ras signaling is associated with 30% of human cancers, including 90% of pancreatic tumors, was first genetically characterized in Drosophila. Subsequent genetic screens have identified many additional genes in the pathway. To identify novel candidates, we have conducted an in vitro screen using an inducible Ras oncogene in Drosophila tissue culture cells developed in our lab. This conditional cell line requires the control of oncogenic RasV12 expression induced by GeneSwitch-Gal4 (GSR) for proliferation. Using RNAseq analysis, 363 gene transcripts were identified that were upregulated two-fold or greater by oncogenic RasV12 expression. Of these, 91 candidate genes were tested further for functional analysis using RNAi in flies. Ubiquitous knock-down of 38 target genes caused death or decreased viability of the organism, suggesting their essential role, and depletion of another gene caused a wing phenotype. As the Ras pathway is known to play an important role in wing-vein patterning, I carried out tissue- specific knock-downs in the wing.
  • Amide Bond Activation of Biological Molecules

    Amide Bond Activation of Biological Molecules

    molecules Review Review AmideAmide BondBond ActivationActivation of Biological Molecules Molecules Sriram Mahesh, Kuei-Chien Tang and Monika Raj * Sriram Mahesh, Kuei-Chien Tang and Monika Raj * Department of Chemistry and Biochemistry, Auburn University, Auburn, AL 36849, USA; [email protected] of Chemistry (S.M.); and kzt0026@ti Biochemistry,germail.auburn.edu Auburn University, (K.-C.T.) Auburn, AL 36849, USA; [email protected]* Correspondence: [email protected]; (S.M.); [email protected] Tel.: +1-334-844-6986 (K.-C.T.) * Correspondence: [email protected]; Tel.: +1-334-844-6986 Academic Editor: Michal Szostak AcademicReceived: Editor:7 September Michal 2018; Szostak Accepted: 9 October 2018; Published: date Received: 7 September 2018; Accepted: 9 October 2018; Published: 12 October 2018 Abstract: Amide bonds are the most prevalent structures found in organic molecules and various Abstract: Amide bonds are the most prevalent structures found in organic molecules and various biomolecules such as peptides, proteins, DNA, and RNA. The unique feature of amide bonds is their biomolecules such as peptides, proteins, DNA, and RNA. The unique feature of amide bonds ability to form resonating structures, thus, they are highly stable and adopt particular three- is their ability to form resonating structures, thus, they are highly stable and adopt particular dimensional structures, which, in turn, are responsible for their functions. The main focus of this three-dimensionalreview article is to structures, report the which, methodologies in turn, are for responsible the activation for their of functions.the unactivated The main amide focus bonds of this reviewpresent article in biomolecules, is to report thewhich methodologies includes the for enzy thematic activation approach, of the metal unactivated complexes, amide and bonds non-metal present inbased biomolecules, methods.
  • Supplemental Information

    Supplemental Information

    Supplemental Information 1. Supplementary Figures Supplementary Figure 1. Schematic diagram of the partial carotid ligation model, in which used in (A) genomic studies, (B) vascular inflammation and arterial wall-thickening, and (C) atherosclerosis functional studies. Supplementary Figure 2. Knockdown efficiency of Chi3l1 siRNA in iMAECs. (A) Knockdown of Chi3l1 mRNA by Chi3l1 siRNA (siChi3l1, 150 nM) in IL-6-stimulated iMAECs in comparison to control siRNA (siControl) was determined by qPCR (n = 5 each, data shown as mean ± SEM, *p < 0.05 as determined by paired t-test). (B) Representative Western blots show a decreased expression of Chi3l1 protein stimulated by IL-6 upon treatment with siChi3l1 (150 nM) in iMAECs. Supplementary Figure 3. The putative Chi3l1 targeting miRNAs. (A) The predicted miRNAs that target APP (5394 miRNAs) or Chi3l1 (527 miRNAs) from miRWalk were compared with a list of miRNAs (537 miRNAs) from a previous microarray data of mouse partial carotid ligation model. Venn diagram depicts the common miRNAs (14 miRNAs). (B) The list of 14 candidate miRNAs that regulates vascular inflammation and atherosclerosis development through targeting Chi3l1 in APPsw- Tg mice. Supplementary Figure 4. Expression of the putative Chi3l1 targeting miRNAs in APPsw-Tg mice carotid endothelium. Expression of putative Chi3l1 targeting miRNAs was determined by qPCR using the Qiagen miScript miRNA-specific primer assay for each miRNAs in endothelial- enriched RNA obtained from the LCA and RCA following partial carotid ligation in APPsw-Tg or non- Tg mice at 2 days post-ligation (n = 5, data shown as mean ± SEM). Supplementary Figure 5. Adenoviral vector construction and Chi3l1 knockdown efficiency in vitro and in vivo.