DOCSLIB.ORG

Supplementary Information Genomice and Transcriptomic Analysis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Information Genomice and Transcriptomic Analysis Supplementary Information Genomice and Transcriptomic Analysis for Identification of Genes and Interlinked Pathways Mediating Artemisinin Resistance in Leishmania donovani Sushmita Ghosh1,2, Aditya Verma1, Vinay Kumar1, Dibyabhaba Pradhan3, Angamuthu Selvapandiyan 2, Poonam Salotra1, Ruchi Singh1* 1. ICMR- National Institute of Pathology, Safdarjung Hospital Campus, New Delhi-110029, India 2. Jamia Hamdard University-Institute of Molecular Medicine, New Delhi-110062, India 3. ICMR-AIIMS Computational Genomics Centre, Indian Council of Medical Research, New Delhi- 110029 *Correspondence: [email protected] Supplementary Figures and Tables: Figure S1. Figure S1: Comparative transcriptional responses following ART adaptation in L. donovani. Overlap of log2 transformed K133 AS-R and K133 WT expression ratio plotted as a function of chromosomal location of probes representing the full genome microarray. The plot represents the average values of three independent hybridizations for each isolate. Table S1: List of genes validated for their modulated expression by Quantitative real time- PCR S.N Primer Gene Name/ Function/relevance Primer Sequence o. Name Gene ID 1 AQP1 Aquaglyceropor Metal ion F- in (LinJ.31.0030) transmembrane 5’CAGGGACAGCTCGAGGGTAA transporter activity, AA3’ integral to membrane; transmembrane R- transport; transporter 5’GTTACCGGCGTGAAAGACAG activity; water TG3’ transport. 2 A2 A2 protein Cellular response to F- (LinJ.22.0670) stress 5’GTTGGCCCGCTTTCTGTTGG3’ R- 5’ACCAACGTCAACAGAGAGA GGG3’ 3 ABCG1 ATP-binding ATP binding, ATPase F- cassette protein activity, coupled to 5’GATCTTCTTGAATGTGCGGGC subfamily G, transmembrane C3’ member 1 movement of (LmjF.06.0080) substances, R- phosphopantetheine 5’CCACCAGCACTGCAAGAATC binding TG3’ 4 GATase Glutamine Putative cysteine F- aminotransferas conjugate beta- 5’GCAGGCTCTCAACGCCATATT e (LinJ.33.1410) lyase,aminotransferase C3’ - like proteinbiosynthetic R- process 5’AGCTTCCAGTTCTCAGCGGAT T3’ 5 PECH peroxisomaleno Putativeenoyl-CoA F- yl-coahydratase hydratase activity, 5’AGATTATCCAGCGCTCCTCAC (LinJ.18.0580) Fatty acid metabolism C3’ R- 5’ TTGATGGCAGCTTGGTACTCGA 3’ 6 ATPP autophagocytosi autophagy; cytoplasm; F- s protein transport 5’CCCTGAGAGCGTGCAAGACT protein 3’ (LinJ.33.0320) R- 5’CGCCAGAGTCATCGTCGTCT 3’ 7 Tpx Tryparedoxin- Hypothetical protein, F- like protein involved in redox 5’CTCATCTGCTTCTCCGCCCA 3’ (LinJ.31.2010) metabolism in trypanosomatids R- 5’CAGTCTCGGCCGATCGTCTG3 ’ 8 VPS vacuolar protein vesicle docking F- sorting-like involved in exocytosis 5’GTTCTTAGCAGGGTGTACGA protein vesicle-mediated G3’ (LinJ.25.2280) transport R- 5’ GGAAAGCAAGTGAACGACAA C3’ 9 HDH haloacid Hydrolase activity F- dehalogenase- 5’TGACCAGAATGCCCATCAAG like hydrolase 3’ (LinJ.28.1480) R- 5’GCTGGTGATAATGTAGTCCGG 3’ 10 AUT Autophagy- Autophagy-related F- related protein protein 5’CCTCTCCAGACCACCAATGT (LinJ.19.0860) ATG8/AUT7/APG8/PA CC3’ Z2, putative (ATG8B.3) R- 5’GGCGAGCGTCACCTTCTTGA3 ’ 11 gMDH glycosomal glycolysis, malate F- malate metabolic process 5’GCGTGGATGTGTTTGTGATGG dehydrogenase T3’ (LinJ.19.0710) R- 5’TTCGTCACAATGCAGAACAC CG3’ 12 ItRS Isoleucyl-tRNA isoleucyl-tRNA F- synthetase aminoacylation, 5’CCGCTGGATCGACTTTGACA (LinJ.36.5870) tRNA aminoacylation AC 3’ for protein translation, translation R- 5’AGGAAGTATGTGTTGGGGTC GG3’ 13 AC Adenylate cyclic nucleotide F- cyclase-like biosynthetic process, 5’CGGTATGGAAAGGTGTACGA protein intracellular signaling AG3’ (LinJ.28.0090) pathway, transport R- Purine metabolism 5’TCGATGTATGACTGCAAGAC G3’ 14 CYPs Cytochrome Electron carrier F- p450-like activity, heme binding, 5’TACATCCCCTTCAGCTGCGG3’ protein monooxiginase activity (LinJ.34.3110) R- 5’CGCTCGTAAACCTCGCCAAC3 ’ 15 CBS cystathionine Endogenous control F- beta-synthase gene 5’GAAGTACACGGTGGAGGCTG (LinJ.17.0300) 3’ R- 5’CGCTGATCACGACCTTCTTC3’ 16 GAPDH Glyceraldehyde Endogenous control F- s-3 gene 5’CGCCGATGTCAACTGGATG3’ Phosphatedehy R- drogenase 5’GCTCCTTCTTCAGCGTGTCG3’ (LinJ.30.2990) Table S2: Pattern of up-regulated and down-regulated gene expression in K133 AS-R parasite: Fold changes AS-R, Up-regulated AS-R, Down regulated >2.0-3.0 70 85 >3.0 – 4.0 20 16 >4.0 12 5 Total genes 102 106 Percent of modulated genes 1.11% 1.15% Footnote: The percent modulated genes calculated from the total 9,170 genes obtained in QC after filter Table S3: Genes differentially modulated with their functional categories in K133 AS-R L. donovani parasites. FOLD CHANG S.N E REGULA GENE ID DESCRIPTION O K133AS- -TION R/ K133WT NUCLEIC ACID METABOLISM LmjF23.snRNA. 1. 5.49 UP small nuclear RNA, U1 snRNA 01 Hypothetical protein , conserved LinJ.32.2210 2.81 2. UP catalytic activity, hydrolase activity, zinc ion binding LinJ.35.2650 Hypothetical protein , unknown function 3. 2.49 UP DNA binding LmjF23.snRNA. 4. 2.36 UP small nuclear RNA, U3 snRNA 02 LinJ.06.0750 Hypothetical protein , conserved 5. 2.30 UP Regulation of transcription , DNA binding LinJ.15.0140 hypothetical protein, conserved 6. 2.27 UP nucleic acid binding, zinc ion binding Methylthioadenosinephosphorylase, putative LinJ.05.0830 7. 2.12 UP transferase activity, transferring pentosyl groups LinJ.33.0580 Hypothetical protein , conserved 8. 2.09 UP RNA ligase activity LinJ.25.1350 DNA-directed RNA polymerase ii 9. 2.03 UP Transcription LmjF31.snRNA. 10. 2.01 UP small nuclear RNA, U2 snRNA 01 LinJ.36.1680 3.79 Universal minicircle sequence binding protein, 11. DOWN putative; nucleic acid binding, zinc ion binding LmjF27.rRNA.25 3.76 12. DOWN 28S ribosomal RNA (LSU-beta) LinJ.28.1000 3.30 Endonuclease/exonuclease/phosphatase-like 13. DOWN protein; endonuclease &exonuclease activity Nucleoside transporter 1, putative LinJ.36.2040 3.20 14. DOWN nucleoside transmembrane transporter activity; guanosine salvage; inosine salvage. LinJ.33.3390 2.93 h1 histone-like protein 15. DOWN LinJ.29.0260 2.67 Thymine-7-hydroxylase, putative 16. DOWN Iron ion binding; oxidoreductase activity. LinJ.36.1710 2.29 Poly-zinc finger protein 2, putative 17. DOWN Nucleic acid binding ; Zinc ion binding LinJ.33.3340 2.22 Small nuclear ribonucleoprotein SmD2 18. DOWN RNA splicing LinJ.36.0800 2.22 Uncharacterized protein 19. DOWN Metal ion binding LinJ.30.3630 2.12 Zinc finger-domain protein, putative 20 DOWN nucleic acid binding ; zinc ion binding PROTEIN , AMINO ACID METABOLISM LinJ.33.0320 3.57 Autophagy-related protein 3 21. UP autophagy ; protein transport LinJ.18.1130 Hypothetical protein, conserved 22. 2.95 UP zinc ion binding Tubulin-tyrosine ligase-like protein LinJ.32.3080 2.91 23. UP tubulin-tyrosine ligase activity protein modification process Putative lipoate protein ligase LinJ.36.3230 2.72 ligase activity ; octanoyltransferase activity ; 24. UP cellular protein modification process ; lipoate biosynthetic process Ubiquitin-like protein, putative LinJ.36.0590 2.66 damaged DNA binding 25. UP nucleotide-excision repair, proteasomal ubiquitin-dependent protein catabolic process LinJ.27.0310 2.45 26. UP Methylmalonyl-coenzyme a mutase, putative LinJ.19.1560 2.34 Peptidylprolylisomerase-like protein 27. UP isomerase activity ; protein folding Hypothetical protein, LinJ.31.0290 28. 2.16 UP L-ascorbic acid binding, iron ion binding, oxidoreductase activity LinJ.33.1410 Cysteine conjugate beta-lyase, 29. 2.07 UP aminotransferase- like protein lyase activity ; pyridoxal phosphate binding ; transaminase activity ; biosynthetic process LinJ.04.0160 7.11 Cell adhesion ; 30. DOWN metalloendopeptidase activity LinJ.19.0860 5.32 Autophagy-related protein 31. DOWN autophagy LinJ.09.0180 4.28 Autophagy-related protein 32. DOWN autophagy calpain-like cysteine peptidase, LinJ.20.1320 3.86 33. DOWN putative,calpain-like cysteine peptidase, Clan CA, family C2 LinJ.19.0820 3.83 Autophagy-related protein 34. DOWN Autophagy Putative calpain-like cysteine peptidase LinJ.20.1220 2.47 35. DOWN calcium-dependent cysteine-type endopeptidase activity ;proteolysis. Putative calpain-like cysteine peptidase LinJ.20.1210 2.37 36. DOWN calcium-dependent cysteine-type endopeptidase activity ; proteolysis. Putative aminopeptidase 2.18 aminopeptidase activity ; manganese ion 37. LinJ.11.0640 DOWN binding ; metalloexopeptidase activity ; proteolysis. Ubiquitin-protein ligase, putative LinJ.36.6600 2.13 acid-amino acid ligase activity ; protein 38. DOWN modification process ; ubiquitin-protein transferase activity LinJ.33.2670 2.03 Putative carboxypeptidase 39. DOWN metallocarboxypeptidase activity ;proteolysis. Putative N-acyl-L-amino acid amidohydrolase LinJ.31.1140 2.01 40. DOWN metallopeptidase activity ;protein dimerization activity;proteolysis ;aminoacylase activity TRANSLATION LmjF21.0960 3.18 Hypothetical protein, conserved 41. UP ATP binding ; aminoacyl-tRNA ligase activity LmjF27.rRNA. 8.27 42. 32 DOWN 28S ribosomal RNA (LSU-delta, M2) Translation initiation factor IF-2, putative LinJ.33.2880 2.54 43. DOWN GTP binding ;translation initiation factor activity; GTPase activity. Isoleucyl-tRNAsynthetase, putative LinJ.36.5870 2.43 ATP binding ;aminoacyl-tRNA ligase activity ; 44. DOWN isoleucine-tRNA ligase activity ; nucleotide binding; zinc ion binding. LinJ.36.1490 2.14 Translation elongation factor 1-beta, putative 45. DOWN translation elongation factor activity LIPID METABOLISM Myo-inositol-1-phosphate synthase,inositol-3- LinJ.14.1450 2.59 phosphate synthase, putative (INO1) 46. UP Inositol biosynthetic process, metabolic process, phospholipid biosynthetic process Hypothetical protein, triglyceride lipase LinJ.13.0200 2.25 47. UP activity, zinc ion binding hydrolase activity ; lipid metabolic process
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • {Replace with the Title of Your Dissertation}
    Characterization and evolution of artificial RNA ligases A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY Aleardo Morelli IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY Adviser: Burckhard Seelig June 2015 © Aleardo Morelli, 2015 Abstract Enzymes enable biocatalysis with minimal by-products, high regio- and enantioselectivity, and can operate under mild conditions. These properties facilitate numerous applications of enzymes in both industry and research. Great progress has been made in protein engineering to modify properties such as stability and catalytic activity of an enzyme to suit specific processes. On the contrary, the generation of artificial enzymes de novo is still challenging, and only few examples have been reported. The study and characterization of artificial enzymes will not only expand our knowledge of protein chemistry and catalysis, but ultimately improve our ability to generate novel biocatalysts and engineer those found in nature. My thesis focused on the characterization of an artificial RNA ligase previously selected from a library of polypeptide variants based on a non-catalytic protein scaffold. The selection employed mRNA display, a technique to isolate de novo enzymes in vitro from large libraries of 1013 protein variants. The artificial RNA ligase catalyzes the formation of a phosphodiester bond between two RNA substrates by joining a 5'- triphospate to a 3'-hydroxyl, with the release of pyrophosphate. This activity has not been observed in nature. An initial selection carried out at 23°C yielded variants that were poorly suitable for biochemical and biophysical characterization due do their low solubility and poor folding.
    [Show full text]
  • Relevance Network Between Chemosensitivity and Transcriptome in Human Hepatoma Cells1
    Vol. 2, 199–205, February 2003 Molecular Cancer Therapeutics 199 Relevance Network between Chemosensitivity and Transcriptome in Human Hepatoma Cells1 Masaru Moriyama,2 Yujin Hoshida, topoisomerase II ␤ expression, whereas it negatively Motoyuki Otsuka, ShinIchiro Nishimura, Naoya Kato, correlated with expression of carboxypeptidases A3 Tadashi Goto, Hiroyoshi Taniguchi, and Z. Response to nimustine was associated with Yasushi Shiratori, Naohiko Seki, and Masao Omata expression of superoxide dismutase 2. Department of Gastroenterology, Graduate School of Medicine, Relevance networks identified several negative University of Tokyo, Tokyo 113-8655 [M. M., Y. H., M. O., N. K., T. G., H. T., Y. S., M. O.]; Cellular Informatics Team, Computational Biology correlations between gene expression and resistance, Research Center, Tokyo 135-0064 [S. N.]; and Department of which were missed by hierarchical clustering. Our Functional Genomics, Graduate School of Medicine, Chiba University, results suggested the necessity of systematically Chiba 260-8670 [N. S.], Japan evaluating the transporting systems that may play a major role in resistance in hepatoma. This may provide Abstract useful information to modify anticancer drug action in Generally, hepatoma is not a chemosensitive tumor, hepatoma. and the mechanism of resistance to anticancer drugs is not fully elucidated. We aimed to comprehensively Introduction evaluate the relationship between chemosensitivity and Hepatoma is a major cause of death even in developed gene expression profile in human hepatoma cells, by countries, and its incidence is increasing (1). Despite the using microarray analysis, and analyze the data by progress of therapeutic technique (2), the efficacy of radical constructing relevance networks. therapy is hampered by frequent recurrence and advance of In eight hepatoma cell lines (HLE, HLF, Huh7, Hep3B, the tumor (3).
    [Show full text]
  • T4 RNA Ligase Catalyzes the Synthesis of Dinucleoside Polyphosphates
    Eur. J. Biochem. 261, 802±811 (1999) q FEBS 1999 T4 RNA ligase catalyzes the synthesis of dinucleoside polyphosphates Eva Ana Atencia, Olga Madrid, MarõÂaA.GuÈnther Sillero and Antonio Sillero Instituto de Investigaciones BiomeÂdicas Alberto Sols, UAM/CSIC, Departamento de BioquõÂmica, Facultad de Medicina, Madrid, Spain T4 RNA ligase has been shown to synthesize nucleoside and dinucleoside 50-polyphosphates by displacement of the AMP from the E-AMP complex with polyphosphates and nucleoside diphosphates and triphosphates. Displacement of the AMP by tripolyphosphate (P3) was concentration dependent, as measured by SDS/PAGE. When the enzyme 32 was incubated in the presence of 0.02 mm [a- P] ATP, synthesis of labeled Ap4A was observed: ATP was acting as both donor (Km, mm) and acceptor (Km,mm) of AMP from the enzyme. Whereas, as previously known, ATP or dATP (but not other nucleotides) were able to form the E-AMP complex, the specificity of a compound to be acceptor of AMP from the E-AMP complex was very broad, and with Km values between 1 and 2 mm. In the presence of a low concentration (0.02 mm)of[a-32P] ATP (enough to form the E-AMP complex, but only marginally enough to form Ap4A) and 4 mm of the indicated nucleotides or P3, the relative rate of synthesis of the following radioactive (di)nucleotides was observed: Ap4X (from XTP, 100); Ap4dG (from dGTP, 74); Ap4G (from GTP, 49); Ap4dC (from dCTP, 23); Ap4C (from CTP, 9); Ap3A (from ADP, 5); Ap4ddA, (from ddATP, 1); p4A (from P3, 200). The enzyme also synthesized efficiently Ap3A in the presence of 1 mm ATP and 2 mm ADP.
    [Show full text]
  • RNA Ligase Structures Reveal the Basis for RNA Specificity And
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector RNA Ligase Structures Reveal the Basis for RNA Specificity and Conformational Changes that Drive Ligation Forward Jayakrishnan Nandakumar,1,2,3 Stewart Shuman,2 and Christopher D. Lima1,* 1 Structural Biology Program 2 Molecular Biology Program 3 Training Program in Chemical Biology Sloan-Kettering Institute, New York, NY 10021, USA *Contact: [email protected] DOI 10.1016/j.cell.2006.08.038 0 SUMMARY 5 PO4 strand is DNA or RNA (Nandakumar and Shuman, 2004). Thus, ligase specificity might be dictated by dis- T4 RNA ligase 2 (Rnl2) and kinetoplastid RNA crimination of A form and B form secondary structures in 0 0 editing ligases exemplify a family of RNA repair duplex nucleic acid on either the 3 OH or 5 PO4 sides of 0 0 enzymes that seal 3 OH/5 PO4 nicks in duplex a nick. This model is difficult to extend to RNA ligases RNAs via ligase adenylylation (step 1), AMP that join single-stranded polynucleotide ends. 0 Two families of RNA ligases, named Rnl1 and Rnl2, transfer to the nick 5 PO4 (step 2), and attack by the nick 30OH on the 50-adenylylated strand function in the repair of ‘‘purposeful’’ RNA breaks. The Rnl1 family includes bacteriophage T4 RNA ligase 1 (Silber to form a phosphodiester (step 3). Crystal struc- et al., 1972; Uhlenbeck and Gumport, 1982; Wang et al., tures are reported for Rnl2 at discrete steps 2003) and tRNA ligases of fungi and plants (Wang and along this pathway: the covalent Rnl2-AMP Shuman, 2005; Englert and Beier, 2005).
    [Show full text]
  • Research Article a Liquid Chromatography with Tandem Mass Spectrometry-Based Proteomic Analysis of Primary Cultured Cells and Subcultured Cells Using Mouse Adipose-Derived
    Hindawi Stem Cells International Volume 2019, Article ID 7274057, 97 pages https://doi.org/10.1155/2019/7274057 Research Article A Liquid Chromatography with Tandem Mass Spectrometry-Based Proteomic Analysis of Primary Cultured Cells and Subcultured Cells Using Mouse Adipose-Derived Mesenchymal Stem Cells Yoshiki Nakashima ,1 Saifun Nahar,2 Chika Miyagi-Shiohira,1 Takao Kinjo,3 Naoya Kobayashi,4 Issei Saitoh ,5 Masami Watanabe,6 Jiro Fujita,2 and Hirofumi Noguchi 1 1Department of Regenerative Medicine, Graduate School of Medicine, University of the Ryukyus, Okinawa 903-0215, Japan 2Department of Infectious, Respiratory, and Digestive Medicine, University of the Ryukyus, Okinawa 903-0215, Japan 3Department of Basic Laboratory Sciences, School of Health Sciences in Faculty of Medicine, University of the Ryukyus, Okinawa 903-0215, Japan 4Okayama Saidaiji Hospital, Okayama 704-8192, Japan 5Division of Pediatric Dentistry, Graduate School of Medical and Dental Science, Niigata University, Niigata 951-8514, Japan 6Department of Urology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama 700-8558, Japan Correspondence should be addressed to Hirofumi Noguchi; [email protected] Received 23 April 2018; Revised 27 September 2018; Accepted 17 October 2018; Published 10 January 2019 Academic Editor: Katia Mareschi Copyright © 2019 Yoshiki Nakashima et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Adipose-derived mesenchymal stem cells (MSC-ATs) are representative cell sources for cell therapy. However, how cell stress resulting from passage influences the MSC-AT protein expression has been unclear.
    [Show full text]
  • Systematic Evaluation and Optimization of the Experimental
    www.nature.com/scientificreports Corrected: Author Correction OPEN Systematic evaluation and optimization of the experimental steps in RNA G-quadruplex Received: 11 December 2018 Accepted: 20 May 2019 structure sequencing Published online: 30 May 2019 Pui Yan Yeung 1, Jieyu Zhao 1, Eugene Yui-Ching Chow 2, Xi Mou 1, HuiQi Hong3,4, Leilei Chen 4,5, Ting-Fung Chan 2 & Chun Kit Kwok 1 cDNA library preparation is important for many high-throughput sequencing applications, such as RNA G-quadruplex structure sequencing (rG4-seq). A systematic evaluation of the procedures of the experimental pipeline, however, is lacking. Herein, we perform a comprehensive assessment of the 5 key experimental steps involved in the cDNA library preparation of rG4-seq, and identify better reaction conditions and/or enzymes to carry out each of these key steps. Notably, we apply the improved methods to fragmented cellular RNA, and show reduced RNA input requirement, lower transcript abundance variations between biological replicates, as well as lower transcript coverage bias when compared to prior arts. In addition, the time to perform these steps is substantially reduced to hours. Our method and results can be directly applied in protocols that require cDNA library preparation, and provide insights to the further development of simple and efcient cDNA library preparation for diferent biological applications. Multitudes of cDNA library preparation methods have been developed as a result of the recent exploration and investigation of the novel features of RNA, such as RNA structures1–4. However, most of these methods require high RNA input (microgram of RNA), numerous processing and purifcation steps, and thus long cDNA library preparation time (few days)5–9.
    [Show full text]
  • Isolation of a Ribozyme with 5'-5' Ligase Activity
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Isolation of a ribozyme with 5’-5’ ligase activity Karen B Chapman+ and Jack W Szostak* Department of Molecular Biology, Massachusetts General Hospital, Boston, MA 02114, USA Background: Many new ribozymes, including sequ- linkage. Deletion analysis of one of the selected ence-specific nucleases, ligases and kinases, have been sequences revealed that a 54-nucleotide RNA retained isolated by in vitro selection from large pools of random- activity; this small ribozyme folds into a pseudoknot sec- sequence RNAs.We are attempting to use in vitro selec- ondary structure with an internal binding site for the tion to isolate new ribozymes that have, or can be substrate oligonucleotide.The ribozyme can also synthe- evolved to have, RNA polymerase-like activities. As size 5’-5’ triphosphate and 5’-5’ pyrophosphate linkages. phosphorimidazolide-activated nucleosides are exten- Conclusions: The emergence of ribozymes that acceler- sively used to study non-enzymatic RNA replication, we ate an unexpected 5’-5’ ligation reaction from a selection wished to select for a ribozyme that would accelerate the designed to yield template-dependent 3’-5’ ligases template-directed ligation of 5’-phosphorimidazolide- suggests that it may be much easier for RNA to catalyze activated oligonucleotides. the synthesis of 5’-5’ linkages than 3’-5’ linkages. 5’-5’ Results: Ribozymes selected to perform the desired linkages are found in a variety of contexts in present-day template-directed ligation reaction instead ligated them- biology. The ribozyme-catalyzed synthesis of such selves to the activated substrate oligonucleotide via their linkages raises the possibility that these 5’-5’ linkages 5’-triphosphate, generating a 5’-5’ P’,P4-tetraphosphate originated in the biochemistry of the RNA world.
    [Show full text]
  • T4 RNA Ligase 2 Catalyzes Phosphodiester Bond Formation Between a 5’ Phosphate T4 RNA Ligase 2 and 3’ Hydroxyl of RNA
    Product Specifications L6080L Rev B Product Information Product Description: T4 RNA Ligase 2 catalyzes phosphodiester bond formation between a 5’ phosphate T4 RNA Ligase 2 and 3’ hydroxyl of RNA. The preferred substrate is nicked double-stranded RNA but single-stranded RNA can also Part Number L6080L serve as a substrate. Ligation of single-stranded RNA substrates generates either intramolecular or Concentration 30,000 U/mL intermolecular products. Besides nicked double-stranded Unit Size 4,500 U RNA substrates, other nicked nucleic acids hybrids can be sealed. The strand containing the 5’ phosphate can either Storage Temperature -25⁰C to -15⁰C be DNA or RNA. The non-ligated strand of the duplex can be either RNA or DNA. T4 RNA ligase 2 requires ATP for activity unless the substrate is preadenylated on the 5’ end. A truncated version of T4 RNA ligase 2 is a better enzyme for preadenylated substrates because it generates less side- reaction ligation products than the full length enzyme. Product Specifications L6080 SDS Specific SS DS DS E. coli DNA Non-specific Assay Purity Activity Exonuclease Exonuclease Endonuclease Contamination RNAse Units Tested n/a n/a 500 500 500 500 500 >120,000 <5.0% <1.0% No detectable non- Specification >99% No Conversion <10 copies U/mg Released Released specific RNAse Source of Protein: Purified from a strain of E. coli that expresses the recombinant T4 RNA Ligase 2 gene. Unit Definition: 1 unit is defined as the amount of enzyme required to ligate 50% of 0.4 µg of an equimolar mix of a single- stranded 5’ FAM-labeled 17-mer RNA to the 5’ phosphorylated end of a 18-mer DNA when both strands are annealed to a complementary 35-mer DNA strand in 20 µL at 37⁰C for 30 minutes.
    [Show full text]
  • 3′ RNA Ligase Mediated Rapid Amplification of Cdna Ends For
    Journal of Virological Methods 250 (2017) 29–33 Contents lists available at ScienceDirect Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet Short communication 3′ RNA ligase mediated rapid amplification of cDNA ends for validating MARK viroid induced cleavage at the 3′ extremity of the host mRNA ⁎ ⁎ Charith Raj Adkar-Purushothama , Pierrick Bru, Jean-Pierre Perreault RNA Group/Groupe ARN, Département de Biochimie, Faculté de médecine des sciences de la santé, Pavillon de Recherche Appliquée au Cancer, Université de Sherbrooke, 3201 rue Jean–Mignault, Sherbrooke, Québec, J1E 4K8, Canada ARTICLE INFO ABSTRACT Keywords: 5′ RNA ligase-mediated rapid amplification of cDNA ends (5′ RLM-RACE) is a widely-accepted method for the Viroids validation of direct cleavage of a target gene by a microRNA (miRNA) and viroid-derived small RNA (vd-sRNA). PSTVd However, thi\s method cannot be used if cleavage takes place in the 3′ extremity of the target RNA, as this gives vd-sRNA insufficient sequence length to design nested PCR primers for 5′ RLM RACE. To overcome this hurdle, we have 3' UTR developed 3′ RNA ligase-mediated rapid amplification of cDNA ends (3′ RLM RACE). In this method, an oli- RNA silencing gonucleotide adapter having 5′ adenylated and 3′ blocked is ligated to the 3′ end of the cleaved RNA followed by RACE fi fi ′ ′ ′ Chloride channel CLC-b-like PCR ampli cation using gene speci c primers. In other words, in 3 RLM RACE, 3 end is mapped using 5 fragment instead of small 3′ fragment. The method developed here was verified by examining the bioinformatics predicted and parallel analysis of RNA ends (PARE) proved cleavage sites of chloride channel protein CLC-b-like mRNA in Potato spindle tuber viroid infected tomato plants.
    [Show full text]
  • Synthesis of ATP Derivatives of Compounds
    Synthesis of ATP derivatives of compounds of the mevalonate pathway (isopentenyl di- and triphosphate; geranyl di- and triphosphate, farnesyl di- and triphosphate, and dimethylallyl diphosphate) catalyzed by T4 RNA ligase, T4 DNA ligase and other ligases. Potential relationship with the effect of bisphosphonates on osteoclasts Maria A. Günther Sillero, Anabel de Diego, Janeth E.F. Tavares, Joana A.D. Catanho Da Silva, Francisco J. Pérez-Zúñiga, Antonio Sillero To cite this version: Maria A. Günther Sillero, Anabel de Diego, Janeth E.F. Tavares, Joana A.D. Catanho Da Silva, Fran- cisco J. Pérez-Zúñiga, et al.. Synthesis of ATP derivatives of compounds of the mevalonate pathway (isopentenyl di- and triphosphate; geranyl di- and triphosphate, farnesyl di- and triphosphate, and dimethylallyl diphosphate) catalyzed by T4 RNA ligase, T4 DNA ligase and other ligases. Potential relationship with the effect of bisphosphonates on osteoclasts. Biochemical Pharmacology, Elsevier, 2009, 78 (4), pp.335. 10.1016/j.bcp.2009.04.028. hal-00493523 HAL Id: hal-00493523 https://hal.archives-ouvertes.fr/hal-00493523 Submitted on 19 Jun 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Accepted Manuscript Title: Synthesis of ATP derivatives of compounds of the mevalonate pathway (isopentenyl di- and triphosphate; geranyl di- and triphosphate, farnesyl di- and triphosphate, and dimethylallyl diphosphate) catalyzed by T4 RNA ligase, T4 DNA ligase and other ligases.
    [Show full text]
  • Kidney V-Atpase-Rich Cell Proteome Database
    A comprehensive list of the proteins that are expressed in V-ATPase-rich cells harvested from the kidneys based on the isolation by enzymatic digestion and fluorescence-activated cell sorting (FACS) from transgenic B1-EGFP mice, which express EGFP under the control of the promoter of the V-ATPase-B1 subunit. In these mice, type A and B intercalated cells and connecting segment principal cells of the kidney express EGFP. The protein identification was performed by LC-MS/MS using an LTQ tandem mass spectrometer (Thermo Fisher Scientific). For questions or comments please contact Sylvie Breton ([email protected]) or Mark A. Knepper ([email protected]).
    [Show full text]