DOCSLIB.ORG

Synthesis of ATP Derivatives of Compounds

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Synthesis of ATP derivatives of compounds of the mevalonate pathway (isopentenyl di- and triphosphate; geranyl di- and triphosphate, farnesyl di- and triphosphate, and dimethylallyl diphosphate) catalyzed by T4 RNA ligase, T4 DNA ligase and other ligases. Potential relationship with the effect of bisphosphonates on osteoclasts Maria A. Günther Sillero, Anabel de Diego, Janeth E.F. Tavares, Joana A.D. Catanho Da Silva, Francisco J. Pérez-Zúñiga, Antonio Sillero To cite this version: Maria A. Günther Sillero, Anabel de Diego, Janeth E.F. Tavares, Joana A.D. Catanho Da Silva, Fran- cisco J. Pérez-Zúñiga, et al.. Synthesis of ATP derivatives of compounds of the mevalonate pathway (isopentenyl di- and triphosphate; geranyl di- and triphosphate, farnesyl di- and triphosphate, and dimethylallyl diphosphate) catalyzed by T4 RNA ligase, T4 DNA ligase and other ligases. Potential relationship with the effect of bisphosphonates on osteoclasts. Biochemical Pharmacology, Elsevier, 2009, 78 (4), pp.335. 10.1016/j.bcp.2009.04.028. hal-00493523 HAL Id: hal-00493523 https://hal.archives-ouvertes.fr/hal-00493523 Submitted on 19 Jun 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Accepted Manuscript Title: Synthesis of ATP derivatives of compounds of the mevalonate pathway (isopentenyl di- and triphosphate; geranyl di- and triphosphate, farnesyl di- and triphosphate, and dimethylallyl diphosphate) catalyzed by T4 RNA ligase, T4 DNA ligase and other ligases. Potential relationship with the effect of bisphosphonates on osteoclasts Authors: Maria A. Gunther¨ Sillero, Anabel de Diego, Janeth E.F. Tavares, Joana A.D. Catanho da Silva, Francisco J. Perez-Z´ u´niga,˜ Antonio Sillero PII: S0006-2952(09)00265-2 DOI: doi:10.1016/j.bcp.2009.04.028 Reference: BCP 10143 To appear in: BCP Received date: 25-2-2009 Revised date: 31-3-2009 Accepted date: 6-4-2009 Please cite this article as: Sillero MAG, de Diego A, Tavares JEF, Silva JADC, Perez-´ Zu´niga˜ FJ, Sillero A, Synthesis of ATP derivatives of compounds of the mevalonate pathway (isopentenyl di- and triphosphate; geranyl di- and triphosphate, farnesyl di- and triphosphate, and dimethylallyl diphosphate) catalyzed by T4 RNA ligase, T4 DNA ligase and other ligases. Potential relationship with the effect of bisphosphonates on osteoclasts, Biochemical Pharmacology (2008), doi:10.1016/j.bcp.2009.04.028 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. * Manuscript Synthesis of ATP derivatives of compounds of the mevalonate 1 2 pathway (isopentenyl di- and triphosphate; geranyl di- and 3 4 5 triphosphate, farnesyl di- and triphosphate, and dimethylallyl 6 7 diphosphate) catalyzed by T4 RNA ligase, T4 DNA ligase and other 8 9 10 ligases. Potential relationship with the effect of bisphosphonates on 11 12 osteoclasts. 13 14 15 16 17 Maria A. Günther Sillero, Anabel de Diego, Janeth E. F. Tavares, Joana A. 18 19 D. Catanho da Silva, Francisco J. Pérez-Zúñiga and Antonio Sillero* 20 21 22 Departamento de Bioquímica, Instituto de Investigaciones Biomédicas Alberto 23 24 Sols, UAM/CSIC, Facultad de Medicina, 28029 Madrid, Spain. 25 26 27 28 29 30 1 4 31 Abbreviations: Ap4A, diadenosine 5’,5’’’-P ,P -tetraphospate; ApppI or iso- 32 pppA, ATP derivative of iso-PP; BP, a bisphosphonate; dim-PP, 33 34 dimethylallyl diphosphate; dim-pppA, ATP derivative of dim-PP; far-PP or 35 far-PPP, farnesyl di- or triphosphate; ger-PP or ger-PPP, geranyl di- or 36 triphosphate; iso-PP or iso-PPP, isopentenyl di- or triphosphate; iso-pppA 37 or iso-ppppA, ATP derivative of iso-PP or iso-PPP; mev-PP or mev-PPP, 38 compounds of the mevalonate pathway containing two or three terminal 39 40 phosphates; mev-pppA or mev-ppppA, ATP derivatives of mev-PP or mev- 41 PPP; N-BP, a bisphosphonate containing nitrogen; non-N-BP, a 42 bisphosphonate not containing nitrogen; p4A, adenosine 5´-tetraphosphate. 43 44 45 46 *Corresponding Author: 47 48 Fax: +3491 5854401Accepted Manuscript 49 50 51 E-mail: [email protected] (A.S.) 52 53 54 55 56 57 58 59 60 61 62 63 1 64 Page 1 of 36 65 ABSTRACT 1 2 Compounds of the mevalonate pathway containing a terminal di- or 3 4 5 triphosphate (mev-PP or mev-PPP) were tested as substrates of several 6 7 enzyme ligases (T4 RNA ligase, T4 DNA ligase, firefly luciferase and other 8 9 10 ligases) for the synthesis of ATP derivatives of the mev-pppA or mev-ppppA 11 12 type. T4 RNA ligase, in the presence of ATP and the substrates: geranyl, 13 14 farnesyl or isopentenyl triphosphates, and geranyl, farnesyl, dimethylallyl or 15 16 17 isopentenyl diphosphates, all at 0.3 mM concentration, catalyzed the 18 19 synthesis of the corresponding ATP derivatives at a relative rate of activity 20 21 22 of: 7.6 ± 1.4 mU/mg or 100 %; 39%; 42%; 24%; 18%; 12% and 6%, 23 24 respectively. Inhibition (%) of the synthesis by excess of substrate (0.8 mM 25 26 27 vs. 0.3 mM) was observed with farnesyl diphosphate (99%); farnesyl 28 29 triphosphate (96%) and geranyl triphosphate (32%). Vmax, Km, Kcat and 30 31 K /K values were also determined. The K /K values calculated were 32 cat m cat m 33 34 for: farnesyl triphosphate, 166; geranyl triphosphate, 52.2; farnesyl 35 36 diphosphate, 12.1; geranyl diphosphate, 8.6; isopentenyl triphosphate, 6.7; 37 38 39 dimethylallyl diphosphate, 3.1 and isopentenyl diphosphate, 0.9. Similar 40 41 results were obtained with T4 DNA ligase. The above-mentioned 42 43 44 compounds were also substrates of firefly luciferase synthesizing the mev- 45 46 pppA or mev-ppppA derivatives. In our hands, neither the acyl- or acetyl- 47 48 CoA synthetasesAccepted nor the ubiquiting activating Manuscript enzyme (E1) catalyzed the 49 50 51 synthesis of ATP derivatives of these compounds. The results here 52 53 presented could be related with the mechanism of action of 54 55 56 bisphosphonates on osteoclasts or tumor cells. 57 58 59 60 61 62 63 2 64 Page 2 of 36 65 1. Introduction 1 2 Bisphosphonates (P-C(R1)(R2)-P) (BPs) are widely used in the treatment of 3 4 5 osteoporosis and other bone diseases [1]. After being fixed to bone tissues 6 7 [2-4], they exert a damaging effect on osteoclasts through two classically 8 9 10 described mechanisms: a) as substrates of different ligases generating BP 11 12 derivatives of ATP through reactions 1, 5; 1a, 5a (see Table 1); this effect is 13 14 supposed to be carried out by the first generation, or not containing 15 16 17 nitrogen, bisphosphonates (non-N-BPs) [5-9]; b) as inhibitors of the 18 19 mevalonate pathway (Fig. 1) by causing several pathological 20 21 22 consequences such as: inhibition of the synthesis of cholesterol and its 23 24 derivatives and, secondarily, inhibition of the post-translational modifications 25 26 27 (isoprenylation, farnesylation) of important regulatory proteins [10-15]. 28 29 The stimulation of the synthesis of ApppI (here named iso-pppA, see 30 31 nomenclature below) in osteoclasts and J774 macrophages when treated 32 33 34 with nitrogen containing bisphosphonates (N-BPs) (zoledronate, 35 36 risedronate, ibandronate, alendronate) has been recently reported [16]. 37 38 39 ApppI is the compound resulting from the union of the AMP moiety of ATP 40 41 with isopentenyl pyrophosphate, a component of the mevalonate pathway. 42 43 44 The synthesis of iso-pppA correlated well with the capacity of those BPs to 45 46 inhibit the mevalonate pathway. Moreover, iso-pppA, as well as the ATP 47 48 derivative ofAccepted clodronate (AppCCl2p), inhibited Manuscript the mitochondrial ADP/ATP 49 50 51 translocase and caused apoptosis in osteoclasts [16, 17]. ApppI (iso-pppA) 52 53 can then be an interesting compound to be considered in the mechanism of 54 55 56 action of bisphosphonates. Mönkkönen et al. [16] suggested that the 57 58 59 60 61 62 63 3 64 Page 3 of 36 65 synthesis of iso-pppA could be catalyzed by aminoacyl tRNA synthetases 1 2 through reactions 1 and 6 (Table 1). 3 4 5 The work here presented started by exploring the synthesis of iso-pppA by 6 7 different enzyme ligases, and has been further extended to explore the 8 9 10 synthesis of similar derivatives (mev-pnA) of other compounds of the 11 12 mevalonate pathway, based on the following grounds. 13 14 A. In our experience with enzyme ligases [18], the formation of the complex 15 16 17 E-X-AMP (or E-AMP) is rather specific for each enzyme (Table 1, reactions 18 19 1 or 1a). Once the E-X-AMP (or E-AMP) complex is formed, its AMP moiety 20 21 22 reacts forming a phosphodiester bond with nucleotides containing 2, 3, or 23 24 more terminal phosphates or even with polyphosphate chains of variable 25 26 27 length (Table 1, reactions 2, 3 and 4).
Recommended publications
  • {Replace with the Title of Your Dissertation}

    {Replace with the Title of Your Dissertation}

    Characterization and evolution of artificial RNA ligases A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY Aleardo Morelli IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY Adviser: Burckhard Seelig June 2015 © Aleardo Morelli, 2015 Abstract Enzymes enable biocatalysis with minimal by-products, high regio- and enantioselectivity, and can operate under mild conditions. These properties facilitate numerous applications of enzymes in both industry and research. Great progress has been made in protein engineering to modify properties such as stability and catalytic activity of an enzyme to suit specific processes. On the contrary, the generation of artificial enzymes de novo is still challenging, and only few examples have been reported. The study and characterization of artificial enzymes will not only expand our knowledge of protein chemistry and catalysis, but ultimately improve our ability to generate novel biocatalysts and engineer those found in nature. My thesis focused on the characterization of an artificial RNA ligase previously selected from a library of polypeptide variants based on a non-catalytic protein scaffold. The selection employed mRNA display, a technique to isolate de novo enzymes in vitro from large libraries of 1013 protein variants. The artificial RNA ligase catalyzes the formation of a phosphodiester bond between two RNA substrates by joining a 5'- triphospate to a 3'-hydroxyl, with the release of pyrophosphate. This activity has not been observed in nature. An initial selection carried out at 23°C yielded variants that were poorly suitable for biochemical and biophysical characterization due do their low solubility and poor folding.
  • Supplementary Information Genomice and Transcriptomic Analysis

    Supplementary Information Genomice and Transcriptomic Analysis

    Supplementary Information Genomice and Transcriptomic Analysis for Identification of Genes and Interlinked Pathways Mediating Artemisinin Resistance in Leishmania donovani Sushmita Ghosh1,2, Aditya Verma1, Vinay Kumar1, Dibyabhaba Pradhan3, Angamuthu Selvapandiyan 2, Poonam Salotra1, Ruchi Singh1* 1. ICMR- National Institute of Pathology, Safdarjung Hospital Campus, New Delhi-110029, India 2. Jamia Hamdard University-Institute of Molecular Medicine, New Delhi-110062, India 3. ICMR-AIIMS Computational Genomics Centre, Indian Council of Medical Research, New Delhi- 110029 *Correspondence: [email protected] Supplementary Figures and Tables: Figure S1. Figure S1: Comparative transcriptional responses following ART adaptation in L. donovani. Overlap of log2 transformed K133 AS-R and K133 WT expression ratio plotted as a function of chromosomal location of probes representing the full genome microarray. The plot represents the average values of three independent hybridizations for each isolate. Table S1: List of genes validated for their modulated expression by Quantitative real time- PCR S.N Primer Gene Name/ Function/relevance Primer Sequence o. Name Gene ID 1 AQP1 Aquaglyceropor Metal ion F- in (LinJ.31.0030) transmembrane 5’CAGGGACAGCTCGAGGGTAA transporter activity, AA3’ integral to membrane; transmembrane R- transport; transporter 5’GTTACCGGCGTGAAAGACAG activity; water TG3’ transport. 2 A2 A2 protein Cellular response to F- (LinJ.22.0670) stress 5’GTTGGCCCGCTTTCTGTTGG3’ R- 5’ACCAACGTCAACAGAGAGA GGG3’ 3 ABCG1 ATP-binding ATP binding, ATPase
  • Comparative Transcriptome Analysis of Waterlogging-Sensitive

    Comparative Transcriptome Analysis of Waterlogging-Sensitive

    Article Comparative Transcriptome Analysis of Waterlogging-Sensitive and Tolerant Zombi Pea (Vigna Vexillata) Reveals Energy Conservation and Root Plasticity Controlling Waterlogging Tolerance Pimprapai Butsayawarapat 1, Piyada Juntawong 1,2,3*, Ornusa Khamsuk 4 and Prakit Somta 5 1 Department of Genetics, Faculty of Science, Kasetsart University, Bangkok 10900, Thailand 2 Center for Advanced Studies in Tropical Natural Resources, National Research University -Kasetsart University, Bangkok 10900, Thailand 3 Omics Center for Agriculture, Bioresources, Food and Health, Kasetsart University (OmiKU), Bangkok 10900, Thailand 4 Department of Botany, Faculty of Science, Kasetsart University, Bangkok 10900, Thailand 5 Department of Agronomy, Faculty of Agriculture at Kamphaeng Saen, Kasetsart University, Nakhon Pathom 73140, Thailand *Correspondence: [email protected]; Tel.: +66-02-562-5555 Received: 22 June 2019; Accepted: 31 July 2019; Published: 2 August 2019 Abstract: Vigna vexillata (zombi pea) is an underutilized legume crop considered to be a potential gene source in breeding for abiotic stress tolerance. This study focuses on the molecular characterization of mechanisms controlling waterlogging tolerance using two zombi pea varieties with contrasting waterlogging tolerance. Morphological examination revealed that in contrast to the sensitive variety, the tolerant variety was able to grow, maintain chlorophyll, form lateral roots, and develop aerenchyma in hypocotyl and taproots under waterlogging. To find the mechanism controlling waterlogging tolerance in zombi pea, comparative transcriptome analysis was performed using roots subjected to short-term waterlogging. Functional analysis indicated that glycolysis and fermentative genes were strongly upregulated in the sensitive variety, but not in the tolerant one. In contrast, the genes involved in auxin-regulated lateral root initiation and formation were expressed only in the tolerant variety.
  • Product Sheet Info

    Product Sheet Info

    Master Clone List for NR-19274 Mycobacterium tuberculosis Gateway® Clone Set, Recombinant in Escherichia coli, Plates 1-42 Catalog No. NR-19274 Table 1: Mycobacterium tuberculosis, Gateway® Clones, Plate 1 (ZMTDA), NR-19637 Clone Well ORF Locus ID Description (Gene name) Accession Average Depth Position Length Number of Coverage 71201 A01 124 Rv1572c hypothetical protein Rv1572c NP_216088.2 2 71005 A02 151 Rv3461c 50S ribosomal protein L36 (rpmJ) NP_217978.1 2 71053 A03 181 Rv3924c 50S ribosomal protein L34 (rpmH) 2 71013 A04 184 Rv2452c hypothetical protein Rv2452c NP_216968.1 2 71167 A05 193 Rv0657c hypothetical protein Rv0657c NP_215171.1 2.69948187 71177 A06 211 Rv0666 hypothetical protein Rv0666 NP_215180.1 2 71225 A07 214 Rv1693 hypothetical protein Rv1693 NP_216209.1 2 71073 A08 217 Rv2099c PE family protein (PE21) 2 70874 A09 220 Rv0810c hypothetical protein Rv0810c NP_215325.1 2 70913 A10 223 Rv2371 PE-PGRS family protein (PE_PGRS40) YP_177875.1 2 71141 A11 229 Rv2806 hypothetical protein Rv2806 NP_217322.1 2 71121 A12 235 Rv1113 hypothetical protein Rv1113 NP_215629.1 1.99574468 71181 B01 241 Rv3648c cold shock protein A (cspA) NP_218165.1 2 70937 B02 244 Rv0763c ferredoxin NP_215277.1 2 70966 B03 247 Rv1054 integrase NP_215570.2 1.27530364 71145 B04 253 Rv2377c putative protein MbtH (mbtH) NP_216893.1 2 70861 B05 253 Rv2830c hypothetical protein Rv2830c NP_217346.1 2 70853 B06 253 Rv3221c anti-sigma factor YP_177945.1 2 71210 B07 256 Rv1893 hypothetical protein Rv1893 NP_216409.1 2 71062 B08 259 Rv0378 glycine rich protein
  • T4 RNA Ligase Catalyzes the Synthesis of Dinucleoside Polyphosphates

    T4 RNA Ligase Catalyzes the Synthesis of Dinucleoside Polyphosphates

    Eur. J. Biochem. 261, 802±811 (1999) q FEBS 1999 T4 RNA ligase catalyzes the synthesis of dinucleoside polyphosphates Eva Ana Atencia, Olga Madrid, MarõÂaA.GuÈnther Sillero and Antonio Sillero Instituto de Investigaciones BiomeÂdicas Alberto Sols, UAM/CSIC, Departamento de BioquõÂmica, Facultad de Medicina, Madrid, Spain T4 RNA ligase has been shown to synthesize nucleoside and dinucleoside 50-polyphosphates by displacement of the AMP from the E-AMP complex with polyphosphates and nucleoside diphosphates and triphosphates. Displacement of the AMP by tripolyphosphate (P3) was concentration dependent, as measured by SDS/PAGE. When the enzyme 32 was incubated in the presence of 0.02 mm [a- P] ATP, synthesis of labeled Ap4A was observed: ATP was acting as both donor (Km, mm) and acceptor (Km,mm) of AMP from the enzyme. Whereas, as previously known, ATP or dATP (but not other nucleotides) were able to form the E-AMP complex, the specificity of a compound to be acceptor of AMP from the E-AMP complex was very broad, and with Km values between 1 and 2 mm. In the presence of a low concentration (0.02 mm)of[a-32P] ATP (enough to form the E-AMP complex, but only marginally enough to form Ap4A) and 4 mm of the indicated nucleotides or P3, the relative rate of synthesis of the following radioactive (di)nucleotides was observed: Ap4X (from XTP, 100); Ap4dG (from dGTP, 74); Ap4G (from GTP, 49); Ap4dC (from dCTP, 23); Ap4C (from CTP, 9); Ap3A (from ADP, 5); Ap4ddA, (from ddATP, 1); p4A (from P3, 200). The enzyme also synthesized efficiently Ap3A in the presence of 1 mm ATP and 2 mm ADP.
  • Terpene Production in the Peel of Sweet Orange Fruits

    Terpene Production in the Peel of Sweet Orange Fruits

    Genetics and Molecular Biology, 30, 3 (suppl), 841-847 (2007) Copyright by the Brazilian Society of Genetics. Printed in Brazil www.sbg.org.br Research Article Terpene production in the peel of sweet orange fruits Marco A. Takita1,2, Irving J. Berger1, Ana Carolina Basílio-Palmieri1, Kleber M. Borges1, Juliana M. de Souza1 and Maria L.N.P. Targon1 1Centro APTA Citros Sylvio Moreira, Instituto Agronômico de Campinas, Cordeirópolis, SP, Brazil. 2Centro de Pesquisa e Desenvolvimento de Recursos Genéticos Vegetais, Instituto Agronômico de Campinas, Campinas, SP, Brazil. Abstract Terpenoids constitute the largest and most diverse class of natural products. They are important factors for aroma and flavor, and their synthesis is basically done from two compounds: isopentenyl diphosphate and dimethylallyl diphosphate. Isopentenyl diphosphate is synthesized through two different pathways, one that occurs in the cyto- plasm and one in the plastid. With the sequencing of ESTs from citrus, we were able to perform in silico analyses on the pathways that lead to the synthesis of terpenes as well as on the terpene synthases present in sweet orange. Moreover, expression analysis using real-time qPCR was performed to verify the expression pattern of a terpene synthase in plants. The results show that all the pathways for isopentenyl diphosphate are present in citrus and a high expression of terpene synthases seems to have an important role in the constitution of the essential oils of cit- rus. Key words: EST, fruit, terpenoids, orange, essential oil. Received: September 21, 2006; Accepted: July 13, 2007. Introduction ecological, providing defense against herbivores or patho- Citriculture plays a fundamental role in Brazilian ag- gens, attracting animals that disperse pollen and seeds, or ribusiness.
  • RNA Ligase Structures Reveal the Basis for RNA Specificity And

    RNA Ligase Structures Reveal the Basis for RNA Specificity And

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector RNA Ligase Structures Reveal the Basis for RNA Specificity and Conformational Changes that Drive Ligation Forward Jayakrishnan Nandakumar,1,2,3 Stewart Shuman,2 and Christopher D. Lima1,* 1 Structural Biology Program 2 Molecular Biology Program 3 Training Program in Chemical Biology Sloan-Kettering Institute, New York, NY 10021, USA *Contact: [email protected] DOI 10.1016/j.cell.2006.08.038 0 SUMMARY 5 PO4 strand is DNA or RNA (Nandakumar and Shuman, 2004). Thus, ligase specificity might be dictated by dis- T4 RNA ligase 2 (Rnl2) and kinetoplastid RNA crimination of A form and B form secondary structures in 0 0 editing ligases exemplify a family of RNA repair duplex nucleic acid on either the 3 OH or 5 PO4 sides of 0 0 enzymes that seal 3 OH/5 PO4 nicks in duplex a nick. This model is difficult to extend to RNA ligases RNAs via ligase adenylylation (step 1), AMP that join single-stranded polynucleotide ends. 0 Two families of RNA ligases, named Rnl1 and Rnl2, transfer to the nick 5 PO4 (step 2), and attack by the nick 30OH on the 50-adenylylated strand function in the repair of ‘‘purposeful’’ RNA breaks. The Rnl1 family includes bacteriophage T4 RNA ligase 1 (Silber to form a phosphodiester (step 3). Crystal struc- et al., 1972; Uhlenbeck and Gumport, 1982; Wang et al., tures are reported for Rnl2 at discrete steps 2003) and tRNA ligases of fungi and plants (Wang and along this pathway: the covalent Rnl2-AMP Shuman, 2005; Englert and Beier, 2005).
  • Systematic Evaluation and Optimization of the Experimental

    Systematic Evaluation and Optimization of the Experimental

    www.nature.com/scientificreports Corrected: Author Correction OPEN Systematic evaluation and optimization of the experimental steps in RNA G-quadruplex Received: 11 December 2018 Accepted: 20 May 2019 structure sequencing Published online: 30 May 2019 Pui Yan Yeung 1, Jieyu Zhao 1, Eugene Yui-Ching Chow 2, Xi Mou 1, HuiQi Hong3,4, Leilei Chen 4,5, Ting-Fung Chan 2 & Chun Kit Kwok 1 cDNA library preparation is important for many high-throughput sequencing applications, such as RNA G-quadruplex structure sequencing (rG4-seq). A systematic evaluation of the procedures of the experimental pipeline, however, is lacking. Herein, we perform a comprehensive assessment of the 5 key experimental steps involved in the cDNA library preparation of rG4-seq, and identify better reaction conditions and/or enzymes to carry out each of these key steps. Notably, we apply the improved methods to fragmented cellular RNA, and show reduced RNA input requirement, lower transcript abundance variations between biological replicates, as well as lower transcript coverage bias when compared to prior arts. In addition, the time to perform these steps is substantially reduced to hours. Our method and results can be directly applied in protocols that require cDNA library preparation, and provide insights to the further development of simple and efcient cDNA library preparation for diferent biological applications. Multitudes of cDNA library preparation methods have been developed as a result of the recent exploration and investigation of the novel features of RNA, such as RNA structures1–4. However, most of these methods require high RNA input (microgram of RNA), numerous processing and purifcation steps, and thus long cDNA library preparation time (few days)5–9.
  • (DDT)-Resistant Drosophila

    (DDT)-Resistant Drosophila

    Genome-wide transcription profile of field- and laboratory-selected dichlorodiphenyltrichloroethane (DDT)-resistant Drosophila J. H. F. Pedra†‡, L. M. McIntyre§, M. E. Scharf¶, and Barry R. Pittendrigh†‡ʈ †Department of Entomology, ‡Molecular Plant Resistance and Nematode Team, and ¶Center for Urban and Industrial Pest Management, Department of Entomology, Purdue University, West Lafayette, IN 47907-1158; and §Computational Genomics, Department of Agronomy, 1150 Lilly Hall of Science, Purdue University, West Lafayette, IN 47905 Edited by May R. Berenbaum, University of Illinois at Urbana–Champaign, Urbana, IL, and approved March 22, 2004 (received for review January 26, 2004) Genome-wide microarray analysis (Affymetrix array) was used (i)to a specific P450 enzyme (Cyp6g1). Daborn et al. (16) used determine whether only one gene, the cytochrome P450 enzyme custom-made microarrays comprised of all known members of Cyp6g1, is differentially transcribed in dichlorodiphenyltrichloroeth- Drosophila cytochrome P450 genes and metabolic enzymes such ane (DDT)-resistant vs. -susceptible Drosophila; and (ii) to profile as esterases and GSTs in addition to housekeeping genes. common genes differentially transcribed across a DDT-resistant field Overexpression of Cyp6g1 in transgenic Drosophila showed only isolate [Rst(2)DDTWisconsin] and a laboratory DDT-selected population slight increases in resistance, suggesting that there is much more [Rst(2)DDT91-R]. Statistical analysis (ANOVA model) identified 158 to resistance than a single gene. probe sets that were differentially transcribed among Rst(2)DDT91-R, To date, no genome-wide expression profile has been evaluated Rst(2)DDTWisconsin, and the DDT-susceptible genotype Canton-S (P < to investigate the extent to which gene transcription varies between 0.01).
  • Isolation of a Ribozyme with 5'-5' Ligase Activity

    Isolation of a Ribozyme with 5'-5' Ligase Activity

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Isolation of a ribozyme with 5’-5’ ligase activity Karen B Chapman+ and Jack W Szostak* Department of Molecular Biology, Massachusetts General Hospital, Boston, MA 02114, USA Background: Many new ribozymes, including sequ- linkage. Deletion analysis of one of the selected ence-specific nucleases, ligases and kinases, have been sequences revealed that a 54-nucleotide RNA retained isolated by in vitro selection from large pools of random- activity; this small ribozyme folds into a pseudoknot sec- sequence RNAs.We are attempting to use in vitro selec- ondary structure with an internal binding site for the tion to isolate new ribozymes that have, or can be substrate oligonucleotide.The ribozyme can also synthe- evolved to have, RNA polymerase-like activities. As size 5’-5’ triphosphate and 5’-5’ pyrophosphate linkages. phosphorimidazolide-activated nucleosides are exten- Conclusions: The emergence of ribozymes that acceler- sively used to study non-enzymatic RNA replication, we ate an unexpected 5’-5’ ligation reaction from a selection wished to select for a ribozyme that would accelerate the designed to yield template-dependent 3’-5’ ligases template-directed ligation of 5’-phosphorimidazolide- suggests that it may be much easier for RNA to catalyze activated oligonucleotides. the synthesis of 5’-5’ linkages than 3’-5’ linkages. 5’-5’ Results: Ribozymes selected to perform the desired linkages are found in a variety of contexts in present-day template-directed ligation reaction instead ligated them- biology. The ribozyme-catalyzed synthesis of such selves to the activated substrate oligonucleotide via their linkages raises the possibility that these 5’-5’ linkages 5’-triphosphate, generating a 5’-5’ P’,P4-tetraphosphate originated in the biochemistry of the RNA world.
  • T4 RNA Ligase 2 Catalyzes Phosphodiester Bond Formation Between a 5’ Phosphate T4 RNA Ligase 2 and 3’ Hydroxyl of RNA

    T4 RNA Ligase 2 Catalyzes Phosphodiester Bond Formation Between a 5’ Phosphate T4 RNA Ligase 2 and 3’ Hydroxyl of RNA

    Product Specifications L6080L Rev B Product Information Product Description: T4 RNA Ligase 2 catalyzes phosphodiester bond formation between a 5’ phosphate T4 RNA Ligase 2 and 3’ hydroxyl of RNA. The preferred substrate is nicked double-stranded RNA but single-stranded RNA can also Part Number L6080L serve as a substrate. Ligation of single-stranded RNA substrates generates either intramolecular or Concentration 30,000 U/mL intermolecular products. Besides nicked double-stranded Unit Size 4,500 U RNA substrates, other nicked nucleic acids hybrids can be sealed. The strand containing the 5’ phosphate can either Storage Temperature -25⁰C to -15⁰C be DNA or RNA. The non-ligated strand of the duplex can be either RNA or DNA. T4 RNA ligase 2 requires ATP for activity unless the substrate is preadenylated on the 5’ end. A truncated version of T4 RNA ligase 2 is a better enzyme for preadenylated substrates because it generates less side- reaction ligation products than the full length enzyme. Product Specifications L6080 SDS Specific SS DS DS E. coli DNA Non-specific Assay Purity Activity Exonuclease Exonuclease Endonuclease Contamination RNAse Units Tested n/a n/a 500 500 500 500 500 >120,000 <5.0% <1.0% No detectable non- Specification >99% No Conversion <10 copies U/mg Released Released specific RNAse Source of Protein: Purified from a strain of E. coli that expresses the recombinant T4 RNA Ligase 2 gene. Unit Definition: 1 unit is defined as the amount of enzyme required to ligate 50% of 0.4 µg of an equimolar mix of a single- stranded 5’ FAM-labeled 17-mer RNA to the 5’ phosphorylated end of a 18-mer DNA when both strands are annealed to a complementary 35-mer DNA strand in 20 µL at 37⁰C for 30 minutes.
  • 3′ RNA Ligase Mediated Rapid Amplification of Cdna Ends For

    3′ RNA Ligase Mediated Rapid Amplification of Cdna Ends For

    Journal of Virological Methods 250 (2017) 29–33 Contents lists available at ScienceDirect Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet Short communication 3′ RNA ligase mediated rapid amplification of cDNA ends for validating MARK viroid induced cleavage at the 3′ extremity of the host mRNA ⁎ ⁎ Charith Raj Adkar-Purushothama , Pierrick Bru, Jean-Pierre Perreault RNA Group/Groupe ARN, Département de Biochimie, Faculté de médecine des sciences de la santé, Pavillon de Recherche Appliquée au Cancer, Université de Sherbrooke, 3201 rue Jean–Mignault, Sherbrooke, Québec, J1E 4K8, Canada ARTICLE INFO ABSTRACT Keywords: 5′ RNA ligase-mediated rapid amplification of cDNA ends (5′ RLM-RACE) is a widely-accepted method for the Viroids validation of direct cleavage of a target gene by a microRNA (miRNA) and viroid-derived small RNA (vd-sRNA). PSTVd However, thi\s method cannot be used if cleavage takes place in the 3′ extremity of the target RNA, as this gives vd-sRNA insufficient sequence length to design nested PCR primers for 5′ RLM RACE. To overcome this hurdle, we have 3' UTR developed 3′ RNA ligase-mediated rapid amplification of cDNA ends (3′ RLM RACE). In this method, an oli- RNA silencing gonucleotide adapter having 5′ adenylated and 3′ blocked is ligated to the 3′ end of the cleaved RNA followed by RACE fi fi ′ ′ ′ Chloride channel CLC-b-like PCR ampli cation using gene speci c primers. In other words, in 3 RLM RACE, 3 end is mapped using 5 fragment instead of small 3′ fragment. The method developed here was verified by examining the bioinformatics predicted and parallel analysis of RNA ends (PARE) proved cleavage sites of chloride channel protein CLC-b-like mRNA in Potato spindle tuber viroid infected tomato plants.