DOCSLIB.ORG

Relevance Network Between Chemosensitivity and Transcriptome in Human Hepatoma Cells1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Relevance Network Between Chemosensitivity and Transcriptome in Human Hepatoma Cells1 Vol. 2, 199–205, February 2003 Molecular Cancer Therapeutics 199 Relevance Network between Chemosensitivity and Transcriptome in Human Hepatoma Cells1 Masaru Moriyama,2 Yujin Hoshida, topoisomerase II ␤ expression, whereas it negatively Motoyuki Otsuka, ShinIchiro Nishimura, Naoya Kato, correlated with expression of carboxypeptidases A3 Tadashi Goto, Hiroyoshi Taniguchi, and Z. Response to nimustine was associated with Yasushi Shiratori, Naohiko Seki, and Masao Omata expression of superoxide dismutase 2. Department of Gastroenterology, Graduate School of Medicine, Relevance networks identified several negative University of Tokyo, Tokyo 113-8655 [M. M., Y. H., M. O., N. K., T. G., H. T., Y. S., M. O.]; Cellular Informatics Team, Computational Biology correlations between gene expression and resistance, Research Center, Tokyo 135-0064 [S. N.]; and Department of which were missed by hierarchical clustering. Our Functional Genomics, Graduate School of Medicine, Chiba University, results suggested the necessity of systematically Chiba 260-8670 [N. S.], Japan evaluating the transporting systems that may play a major role in resistance in hepatoma. This may provide Abstract useful information to modify anticancer drug action in Generally, hepatoma is not a chemosensitive tumor, hepatoma. and the mechanism of resistance to anticancer drugs is not fully elucidated. We aimed to comprehensively Introduction evaluate the relationship between chemosensitivity and Hepatoma is a major cause of death even in developed gene expression profile in human hepatoma cells, by countries, and its incidence is increasing (1). Despite the using microarray analysis, and analyze the data by progress of therapeutic technique (2), the efficacy of radical constructing relevance networks. therapy is hampered by frequent recurrence and advance of In eight hepatoma cell lines (HLE, HLF, Huh7, Hep3B, the tumor (3). Although chemotherapy was initially expected PLC/PRF/5, SK-Hep1, Huh6, and HepG2), the baseline to provide a breakthrough for the treatment of advanced expression levels of 2300 genes were measured by hepatoma, the overall results were disappointing (4, 5). We cDNA microarray. The concentrations of eight cannot identify the few patients who will respond to chem- anticancer drugs (nimustine, mitomycin C, cisplatin, otherapy, and we do not have clear explanation of the mech- carboplatin, doxorubicin, epirubicin, mitoxantrone, and anism of resistance to treatment. 5-fluorouracil) needed for 50% growth inhibition were The development of hepatoma is a complicated process, examined and used as a measure of chemosensitivity. associated with numerous genetic factors. Large-scale tran- These data were combined and comprehensive pair- scriptional profiling allows us to obtain large amounts of data wise correlations between gene expression levels and about complicated biological processes. However, to interpret the 50% growth inhibition values were calculated. the result of DNA microarray experiments, we have to extract Significant correlations with significance were used to the biologically significant information from the many changes construct networks of similarity. that are random or not related to the phenomena studied. Fifty-two relations, including 42 genes, were Relevance networks offer a method to construct networks selected. Among them, nearly 20% were various types of similarity with various type of information, including mutual of transporters, and most of them negatively correlated information and the correlation status (6). In this study, we with chemosensitivity. Transporter associated with applied this methodology to provide new information on antigen processing 1 was associated with resistance to chemosensitivity in hepatoma. mitoxantrone, consistent with previous reports. Other transporters were not reported previously to associate Materials and Methods with chemosensitivity. Resistance to doxorubicin and Hepatoma Cells. Eight hepatoma cell lines (HLE, HLF, Huh7, its analogue, epirubicin, were positively correlated with Hep3B, PLC/PRF/5, SK-Hep1, Huh6, and HepG2) were ob- tained from RIKEN Cell Bank (Tsukuba, Japan). They were maintained using DMEM containing 10% fetal bovine serum. Received 12/2/02; accepted 12/2/02. Anticancer Drugs. We tested eight drugs used currently The costs of publication of this article were defrayed in part by the for the treatment of hepatoma in clinical practice: an antime- payment of page charges. This article must therefore be hereby marked 3 advertisement in accordance with 18 U.S.C. Section 1734 solely to indi- tabolite (5-FU ), two platinum anticancer agents (CDDP and cate this fact. 1 Supported in part by the Health Science Research Grants for Medical Frontier Strategy Research from the Ministry of Health, Labor, and Welfare of Japan, and by grants-in-aid for scientific research from the Ministry of 3 The abbreviations used are: 5-FU, 5-fluorouracil; ACNU, nimustine; Education, Culture, Sports, Science and Technology, Japan. ADM, doxorubicin; CBDCA, carboplatin; CDDP, cisplatin; CA1, carbonic 2 To whom requests for reprints should be addressed, at Department of anhydrase 1; CPA3, carboxypeptidase A3; CPZ, carboxypeptidase Z; Gastroenterology, Graduate School of Medicine, University of Tokyo, EpiADM, epirubicin; GI50, 50% growth inhibition activity of the drug; topo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan. Phone: 81-3-3815- topoisomerase; MIT, mitoxantrone; MMC, mitomycin C; SOD, superoxide 5411, extension 33056; Fax: 81-3-3814-0021; E-mail: moriyamam- dismutases; TAP, transporter associated with antigen processing; TRG, [email protected]. T-cell receptor ␥ locus; TOP2B, DNA topoisomerase II ␤. Downloaded from mct.aacrjournals.org on October 1, 2021. © 2003 American Association for Cancer Research. 200 Network of Genes and Anticancer Drugs in Hepatoma CBDCA), two alkylating agents (ACNU and MMC), and three Relevance Networks. Using log-transformed expression (topo) II inhibitors (ADM, EpiADM, and MIT). CDDP, CBDCA, ratios of selected genes and the GI50 values of the antican- ADM, MMC, MIT, and 5-FU were purchased from Sigma Co. cer drugs, similarity metrics, R, were calculated in a com- (St. Louis, MO). ACNU was obtained from Sankyo Co. (To- prehensive pair-wise manner as a square of the Pearson kyo, Japan). EpiADM was obtained from Pharmacia Co. correlation coefficient with original sign (positive or negative). (Peapack, NJ). The correlation coefficient, r, was calculated by the following Measurement of Response to Drugs. The response of formula: each cell line to the anticancer drugs was determined as ϭ ͚ Ϫ Ϫ ͙͚ Ϫ 2 Ϫ 2 follows. Briefly, cells were grown in 24-well microplates r (xi xmean)(yi ymean)/ (xi xmean) (yi ymean) (IWAKI Glass, Chiba, Japan) and exposed to the drugs for where xi represents the log expression ratio (log2Cy5:Cy3) of 48 h. Cell growth was assessed by 3-(4,5-dimethylthiazol-2- gene x in cell line i, whereas yi is the log response (log10GI50) yl)-2,5-diphenyltetrazolium bromide assay. The drug con- to drug y in cell line i. To generate a reference distribution of centration required to inhibit cell growth by 50% in compar- R, measurements of expression ratios and GI50 values were ison with untreated controls was designated as the growth randomly permuted 100 times, and calculated Rs were re- inhibition activity of the drug (GI50). Data were averages of corded. On the basis of these random data, we set threshold three independent experiments. values of R for selection of genes with significance levels of RNA Extraction. Total cellular RNA was extracted using P Ͻ 0.001, P Ͻ 0.01, and P Ͻ 0.05. We considered that for an acid guanidine isothiocyanate phenol-chloroform method a given pair of genes, a relationship with R higher than the according to the manufacturer’s instructions (ISOGEN Rea- threshold value may represent a significant biological rela- gent; Nippon Gene Co., Tokyo, Japan). RNA was treated with tionship. We then connected these genes with each other to RNase-free DNase to remove contaminating genomic DNA, form clusters or relevance networks of related genes and and RNA integrity was confirmed by gel electrophoresis and drugs. For these calculations, we developed custom Perl ethidium bromide staining. Polyadenylic acid mRNA was codes (included in bioperl release 1.2).4 Finally, the networks obtained using the Oligotex-dT30 mRNA purification kit were visualized as graphs using a custom JAVA application. (TaKaRa Co., Tokyo, Japan). The functions of the selected genes were obtained from cDNA Microarray. We assessed gene expression using web-based databases, e.g., the National Center for Biotech- in-house cDNA microarray developed by ourselves in the nology Information-Locuslink,5 Gene Ontology,6 Kyoto En- Helix Research Institute (Chiba, Japan; Ref. 7). A total of cyclopedia of Genes and Genomes,7 and other linked data- 2300 named, sequence-validated human cDNAs (Research bases. Genetics) were spotted onto carbodiimide-coated glass slides using a robot (SPBIO-2000; Hitachi Software Engi- Results neering Co., Tokyo, Japan). GI50 Values of Anticancer Drugs. Table 1 summarizes the Microarray experiments were performed as described pre- GI50 values of eight anticancer drugs in eight hepatoma cell viously (8), and for each gene, expression was compared lines. Drugs and their analogues (CDDP and CBDCA; ADM with expression in normal human liver RNA (Clontech, Palo and EpiADM) showed relatively similar ranges and average Alto, CA) using the Cy5:Cy3 ratios. To control for
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • FK506-Binding Protein 12.6/1B, a Negative Regulator of [Ca2+], Rescues Memory and Restores Genomic Regulation in the Hippocampus of Aging Rats
    This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. A link to any extended data will be provided when the final version is posted online. Research Articles: Neurobiology of Disease FK506-Binding Protein 12.6/1b, a negative regulator of [Ca2+], rescues memory and restores genomic regulation in the hippocampus of aging rats John C. Gant1, Eric M. Blalock1, Kuey-Chu Chen1, Inga Kadish2, Olivier Thibault1, Nada M. Porter1 and Philip W. Landfield1 1Department of Pharmacology & Nutritional Sciences, University of Kentucky, Lexington, KY 40536 2Department of Cell, Developmental and Integrative Biology, University of Alabama at Birmingham, Birmingham, AL 35294 DOI: 10.1523/JNEUROSCI.2234-17.2017 Received: 7 August 2017 Revised: 10 October 2017 Accepted: 24 November 2017 Published: 18 December 2017 Author contributions: J.C.G. and P.W.L. designed research; J.C.G., E.M.B., K.-c.C., and I.K. performed research; J.C.G., E.M.B., K.-c.C., I.K., and P.W.L. analyzed data; J.C.G., E.M.B., O.T., N.M.P., and P.W.L. wrote the paper. Conflict of Interest: The authors declare no competing financial interests. NIH grants AG004542, AG033649, AG052050, AG037868 and McAlpine Foundation for Neuroscience Research Corresponding author: Philip W. Landfield, [email protected], Department of Pharmacology & Nutritional Sciences, University of Kentucky, 800 Rose Street, UKMC MS 307, Lexington, KY 40536 Cite as: J. Neurosci ; 10.1523/JNEUROSCI.2234-17.2017 Alerts: Sign up at www.jneurosci.org/cgi/alerts to receive customized email alerts when the fully formatted version of this article is published.
    [Show full text]
  • Lineage-Specific Evolution of the Vertebrate Otopetrin Gene Family Revealed by Comparative Genomic Analyses
    Hurle et al. BMC Evolutionary Biology 2011, 11:23 http://www.biomedcentral.com/1471-2148/11/23 RESEARCHARTICLE Open Access Lineage-specific evolution of the vertebrate Otopetrin gene family revealed by comparative genomic analyses Belen Hurle1, Tomas Marques-Bonet2,3, Francesca Antonacci3, Inna Hughes4, Joseph F Ryan1, NISC Comparative Sequencing Program1,5, Evan E Eichler3, David M Ornitz6, Eric D Green1,5* Abstract Background: Mutations in the Otopetrin 1 gene (Otop1) in mice and fish produce an unusual bilateral vestibular pathology that involves the absence of otoconia without hearing impairment. The encoded protein, Otop1, is the only functionally characterized member of the Otopetrin Domain Protein (ODP) family; the extended sequence and structural preservation of ODP proteins in metazoans suggest a conserved functional role. Here, we use the tools of sequence- and cytogenetic-based comparative genomics to study the Otop1 and the Otop2-Otop3 genes and to establish their genomic context in 25 vertebrates. We extend our evolutionary study to include the gene mutated in Usher syndrome (USH) subtype 1G (Ush1g), both because of the head-to-tail clustering of Ush1g with Otop2 and because Otop1 and Ush1g mutations result in inner ear phenotypes. Results: We established that OTOP1 is the boundary gene of an inversion polymorphism on human chromosome 4p16 that originated in the common human-chimpanzee lineage more than 6 million years ago. Other lineage- specific evolutionary events included a three-fold expansion of the Otop genes in Xenopus tropicalis and of Ush1g in teleostei fish. The tight physical linkage between Otop2 and Ush1g is conserved in all vertebrates.
    [Show full text]
  • Genome-Wide Rnai Screening Identifies Human Proteins with A
    RESOURCES Genome-wide RNAi screening identifies human proteins with a regulatory function in the early secretory pathway Jeremy C. Simpson1,7, Brigitte Joggerst2, Vibor Laketa2, Fatima Verissimo2, Cihan Cetin2, Holger Erfle2,6, Mariana G. Bexiga1, Vasanth R. Singan1, Jean-Karim Hériché3, Beate Neumann3, Alvaro Mateos2, Jonathon Blake4, Stephanie Bechtel5, Vladimir Benes4, Stefan Wiemann5, Jan Ellenberg2,3 and Rainer Pepperkok2,7 The secretory pathway in mammalian cells has evolved to facilitate the transfer of cargo molecules to internal and cell surface membranes. Use of automated microscopy-based genome-wide RNA interference screens in cultured human cells allowed us to identify 554 proteins influencing secretion. Cloning, fluorescent-tagging and subcellular localization analysis of 179 of these proteins revealed that more than two-thirds localize to either the cytoplasm or membranes of the secretory and endocytic pathways. The depletion of 143 of them resulted in perturbations in the organization of the COPII and/or COPI vesicular coat complexes of the early secretory pathway, or the morphology of the Golgi complex. Network analyses revealed a so far unappreciated link between early secretory pathway function, small GTP-binding protein regulation, actin cytoskeleton organization and EGF-receptor-mediated signalling. This work provides an important resource for an integrative understanding of global cellular organization and regulation of the secretory pathway in mammalian cells. Within higher eukaryotic cells membrane traffic pathways connect the Extensive efforts over many years have revealed a significant number various membrane-bounded organelles, thereby ensuring that they of regulators associated with the secretory pathway. Early biochemical retain the correct complement of proteins and lipids to maintain approaches to identify individual machinery components have started cellular homeostasis.
    [Show full text]
  • Title Second-Line Chemotherapy for Small-Cell Lung Cancer
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Kyoto University Research Information Repository Second-line chemotherapy for small-Cell Lung Cancer Title (SCLC). Author(s) Kim, Young Hak; Mishima, Michiaki Citation Cancer treatment reviews (2011), 37(2): 143-150 Issue Date 2011-04 URL http://hdl.handle.net/2433/137220 Right © 2010 Elsevier Ltd Type Journal Article Textversion author Kyoto University Second-line Chemotherapy for Small-Cell Lung Cancer (SCLC) Young Hak Kim and Michiaki Mishima Department of Respiratory Medicine, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaharacho, Sakyo-ku, Kyoto 606-8507, Japan For reprints and all correspondence: Young Hak Kim Department of Respiratory Medicine, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaharacho, Sakyo-ku, Kyoto 606-8507, Japan Phone: +81-75-751-3830; Fax: +81-75-751-4643; E-mail: [email protected] Running title: Second-line Chemotherapy for SCLC Key words: small-cell lung cancer, relapsed, chemotherapy, second line, sensitive, refractory 1 Abstract Although small-cell lung cancer (SCLC) generally shows an excellent response to initial chemotherapy, most patients finally relapse and salvage chemotherapy is considered. Usually, the response to salvage chemotherapy significantly differs between sensitive and refractory relapse. Sensitive relapse is relatively chemosensitive and re-challenge with the same drugs as used in the initial chemotherapy has been used historically, while refractory relapse is extremely chemoresistant and its prognosis has been abysmal. To date, a number of clinical trials have been carried out for relapsed SCLC; however, the number of randomized trials is quite limited.
    [Show full text]
  • Genome-Wide Enrichment Analysis Between Endometriosis and Obesity-Related Traits Reveals Novel Susceptibility Loci
    Human Molecular Genetics, 2015, Vol. 24, No. 4 1185–1199 doi:10.1093/hmg/ddu516 Advance Access published on October 8, 2014 Genome-wide enrichment analysis between endometriosis and obesity-related traits reveals novel susceptibility loci Nilufer Rahmioglu1, Stuart Macgregor2, Alexander W. Drong1,A˚ sa K. Hedman1,5, Holly R. Harris6,7, Joshua C. Randall8, Inga Prokopenko1,9,10, The International Endogene Consortium (IEC), The GIANT Consortium, Dale R. Nyholt3, Andrew P. Morris1,11,{, Grant W. Montgomery4,{, Downloaded from https://academic.oup.com/hmg/article/24/4/1185/617584 by guest on 05 February 2021 Stacey A. Missmer6,{, Cecilia M. Lindgren1,12,{ and Krina T. Zondervan1,13,∗,{ 1Wellcome Trust Center for Human Genetics, University of Oxford, Oxford OX3 7BN, UK, 2Statistical Genetics, 3Neurogenetics, 4Molecular Epidemiology, QIMR Berghofer Medical Research Institute, Brisbane, QLD 4029, Australia, 5Department of Medical Sciences, Molecular Epidemiology and Science for Life Laboratory, Uppsala University, Uppsala, Sweden, 6Department of Obstetrics, Gynecology and Reproductive Biology, Brigham and Women’s Hospital and Harvard Medical School, 75 Francis Street, Boston, MA 02115, USA, 7Unit of Nutritional Epidemiology, Institute for Environmental Medicine, Karolinska Institutet, PO Box 210, SE-171 77 Stockholm, Sweden, 8Wellcome Trust Sanger Institute, Hinxton, Cambridge CB10 1SA, UK, 9Department of Genomics of Common Disease, Imperial College London, London W12 0NN, UK, 10Oxford Centre for Diabetes, Endocrinology and Metabolism, University
    [Show full text]
  • Supplementary Information Genomice and Transcriptomic Analysis
    Supplementary Information Genomice and Transcriptomic Analysis for Identification of Genes and Interlinked Pathways Mediating Artemisinin Resistance in Leishmania donovani Sushmita Ghosh1,2, Aditya Verma1, Vinay Kumar1, Dibyabhaba Pradhan3, Angamuthu Selvapandiyan 2, Poonam Salotra1, Ruchi Singh1* 1. ICMR- National Institute of Pathology, Safdarjung Hospital Campus, New Delhi-110029, India 2. Jamia Hamdard University-Institute of Molecular Medicine, New Delhi-110062, India 3. ICMR-AIIMS Computational Genomics Centre, Indian Council of Medical Research, New Delhi- 110029 *Correspondence: [email protected] Supplementary Figures and Tables: Figure S1. Figure S1: Comparative transcriptional responses following ART adaptation in L. donovani. Overlap of log2 transformed K133 AS-R and K133 WT expression ratio plotted as a function of chromosomal location of probes representing the full genome microarray. The plot represents the average values of three independent hybridizations for each isolate. Table S1: List of genes validated for their modulated expression by Quantitative real time- PCR S.N Primer Gene Name/ Function/relevance Primer Sequence o. Name Gene ID 1 AQP1 Aquaglyceropor Metal ion F- in (LinJ.31.0030) transmembrane 5’CAGGGACAGCTCGAGGGTAA transporter activity, AA3’ integral to membrane; transmembrane R- transport; transporter 5’GTTACCGGCGTGAAAGACAG activity; water TG3’ transport. 2 A2 A2 protein Cellular response to F- (LinJ.22.0670) stress 5’GTTGGCCCGCTTTCTGTTGG3’ R- 5’ACCAACGTCAACAGAGAGA GGG3’ 3 ABCG1 ATP-binding ATP binding, ATPase
    [Show full text]
  • The Abundance of Cis-Acting Loci Leading to Differential Allele
    Yeo et al. BMC Genomics (2016) 17:620 DOI 10.1186/s12864-016-2922-9 RESEARCH ARTICLE Open Access The abundance of cis-acting loci leading to differential allele expression in F1 mice and their relationship to loci harboring genes affecting complex traits Seungeun Yeo1, Colin A. Hodgkinson1, Zhifeng Zhou1, Jeesun Jung2, Ming Leung1, Qiaoping Yuan1 and David Goldman1* Abstract Background: Genome-wide surveys have detected cis-acting quantitative trait loci altering levels of RNA transcripts (RNA-eQTLs) by associating SNV alleles to transcript levels. However, the sensitivity and specificity of detection of cis- expression quantitative trait loci (eQTLs) by genetic approaches, reliant as it is on measurements of transcript levels in recombinant inbred strains or offspring from arranged crosses, is unknown, as is their relationship to QTL’s for complex phenotypes. Results: We used transcriptome-wide differential allele expression (DAE) to detect cis-eQTLs in forebrain and kidney from reciprocal crosses between three mouse inbred strains, 129S1/SvlmJ, DBA/2J, and CAST/EiJ and C57BL/6 J. Two of these crosses were previously characterized for cis-eQTLs and QTLs for various complex phenotypes by genetic analysis of recombinant inbred (RI) strains. 5.4 %, 1.9 % and 1.5 % of genes assayed in forebrain of B6/ 129SF1, B6/DBAF1, and B6/CASTF1 mice, respectively, showed differential allelic expression, indicative of cis-acting alleles at these genes. Moreover, the majority of DAE QTLs were observed to be tissue-specific with only a small fraction showing cis-effects in both tissues. Comparing DAE QTLs in F1 mice to cis-eQTLs previously mapped in RI strains we observed that many of the cis-eQTLs were not confirmed by DAE.
    [Show full text]
  • Nimustine Induces DNA Breaks and Crosslinks in NIH/3T3 Cells
    International Journal of Bioscience, Biochemistry and Bioinformatics, Vol. 3, No. 3, May 2013 Nimustine Induces DNA Breaks and Crosslinks in NIH/3T3 Cells Lin-Na Zhao, Xue-Chai Chen, Yan-Yan Zhong, Qin-Xia Hou, and Ru-Gang Zhong study of drug-induced DNA cross-linking to reveal the Abstract—The relationship between carcinogenicity and difference between the nitrosourea anticancer mechanism DNA interstrand cross-links of nitrosoureas is poorly defined. and carcinogenic role. 1-(4-amino-2-methyl-5-pyrimidinyl)methyl-3- (2-chloroethyl)- ACNU was discovered in 1974 as the first water-soluble 3- nitrosourea (ACNU, nimustine) is one of nitrosoureas used in nitrosourea compound [11], and mainly used in the clinic of the treatment of high-grade gliomas. It has the capability of causing DNA interstrand cross-links (ICLs) to kill cancer cells. glioblastoma patients before the introduction of But it can also cause the generation of secondary tumors with 8-carbamoyl-3-methylimidazo [5, 1-d]-1, 2, 3, carcinogenic side effects. In present study, we investigated DNA 5-tetrazin-4(3H) -one (temozolomide, TMZ) because of its interstrand cross-links, DNA double-strand breaks and cell high permeability across blood-brain barrier (BBB) and good cycle phase in NIH/3T3 cells from the primary mouse cytotoxic activity for gliomas [12]-[13]. BCNU always embryonic fibroblast cells induced by ACNU. This result induces two major types of genotoxic damage to the cell: indicated that the concentration of 60 and 75μg/ml of ACNU could be detected significantly ICLs, and the γ-H2AX has the DNA mono adducts and DNA interstrand cross-links.
    [Show full text]
  • Long Non-Coding RNA Lncshgl Recruits Hnrnpa1 to Suppress Hepatic Gluconeogenesis and Lipogenesis
    Page 1 of 60 Diabetes Long non-coding RNA LncSHGL recruits hnRNPA1 to suppress hepatic gluconeogenesis and lipogenesis Junpei Wang1,2#, Weili Yang1,2#, Zhenzhen Chen1, Ji Chen1, Yuhong Meng1, Biaoqi Feng1, Libo Sun3, Lin Dou4, Jian Li4, Qinghua Cui2*, Jichun Yang1* 1Department of Physiology and Pathophysiology, School of Basic Medical Sciences Key Laboratory of Molecular Cardiovascular Sciences of the Ministry of Education Center for Non-coding RNA Medicine Peking University Health Science Center Beijing 100191, China 2Department of Biomedical Informatics, School of Basic Medical Sciences Key Laboratory of Molecular Cardiovascular Sciences of the Ministry of Education, Center for Non-coding RNA Medicine Peking University Health Science Center, Beijing 100191, China 3Beijing You An Hospital，Capital Medical University, Beijing 100069, China 4Key Laboratory of Geriatrics, Beijing Institute of Geriatrics & Beijing Hospital, Ministry of Health, Beijing 100730, China #These authors contributed equally to this work *Correspondence to: Jichun Yang, Ph.D. Department of Physiology and Pathophysiology, School of Basic Medical Sciences Peking University Health Science Center, Beijing 100191, China Email: [email protected]; Tel: (+86) 10-82801403 Or to: Qinghua Cui, Ph.D. Department of Biomedical Informatics, School of Basic Medical Sciences Peking University Health Science Center, Beijing 100191, China Email:[email protected]; Tel:(+86)10-82801585 1 Diabetes Publish Ahead of Print, published online January 30, 2018 Diabetes Page 2 of 60 Abstract Mammalian genomes encode a huge number of LncRNAs with unknown functions. This study determined the role and mechanism of a new LncRNA, LncRNA Suppressor of Hepatic Gluconeogenesis and Lipogenesis (LncSHGL), in regulating hepatic glucose/lipid metabolism.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Nanoconjugates Able to Cross the Blood-Brain Barrier Alexander H Stegh, Janina Paula Luciano, Samuel A
    (12) STANDARD PATENT (11) Application No. AU 2017216461 B2 (19) AUSTRALIAN PATENT OFFICE (54) Title Nanoconjugates Able To Cross The Blood-Brain Barrier (51) International Patent Classification(s) A61K 31/7088 (2006.01) A61K 48/00 (2006.0 1) A61K 9/00 (2006.01) A61P 35/00 (2006.01) (21) Application No: 2017216461 (22) Date of Filing: 2017.08.15 (43) Publication Date: 2017.08.31 (43) Publication Journal Date: 2017.08.31 (44) Accepted Journal Date: 2019.10.17 (62) Divisional of: 2012308302 (71) Applicant(s) NorthwesternUniversity (72) Inventor(s) Mirkin, Chad A.;Ko, Caroline H.;Stegh, Alexander;Giljohann, David A.;Luciano, Janina;Jensen, Sam (74) Agent / Attorney WRAYS PTY LTD, L7 863 Hay St, Perth, WA, 6000, AU (56) Related Art US 2010/0233084 Al LJUBIMOVA et al. "Nanoconjugate based on polymalic acid for tumor targeting", Chemico-Biological Interactions, 2008, Vol. 171, Pages 195-203. WO 2011/028847 Al BONOU et al. "Nanotechnology approach for drug addiction therapy: Gene silencing using delivery of gold nanorod-siRNA nanoplex in dopaminergic neurons", PNAS, 2009, Vol. 106, No. 14, Pages 5546-5550. PATIL et al. "Temozolomide Delivery to Tumor Cells by a Multifunctional Nano Vehicle Based on Poly(#-L-malic acid)", Pharmaceutical Research, 2010, Vol. 27, Pages 2317-2329. ABSTRACT Polyvalent nanoconjugates address the critical challenges in therapeutic use. The single-entity, targeted therapeutic is able to cross the blood-brain barrier (BBB) and is thus effective in the treatment of central nervous system (CNS) disorders. Further, despite the tremendously high 5 cellular uptake of nanoconjugates, they exhibit no toxicity in the cell types tested thus far.
    [Show full text]