Ornithodoros Moubata
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein LigaseElectronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
- 
												  TICKS in RELATION to HUMAN DISEASES CAUSED by <IUniversity of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln U.S. Navy Research U.S. Department of Defense 1967 TICKS IN RELATION TO HUMAN DISEASES CAUSED BY RICKETTSIA SPECIES Harry Hoogstraal Follow this and additional works at: https://digitalcommons.unl.edu/usnavyresearch This Article is brought to you for free and open access by the U.S. Department of Defense at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in U.S. Navy Research by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. TICKS IN RELATION TO HUMAN DISEASES CAUSED BY RICKETTSIA SPECIES1,2 By HARRY HOOGSTRAAL Department oj Medical Zoology, United States Naval Medical Research Unit Number Three, Cairo, Egypt, U.A.R. Rickettsiae (185) are obligate intracellular parasites that multiply by binary fission in the cells of both vertebrate and invertebrate hosts. They are pleomorphic coccobacillary bodies with complex cell walls containing muramic acid, and internal structures composed of ribonucleic and deoxyri bonucleic acids. Rickettsiae show independent metabolic activity with amino acids and intermediate carbohydrates as substrates, and are very susceptible to tetracyclines as well as to other antibiotics. They may be considered as fastidious bacteria whose major unique character is their obligate intracellu lar life, although there is at least one exception to this. In appearance, they range from coccoid forms 0.3 J.I. in diameter to long chains of bacillary forms. They are thus intermediate in size between most bacteria and filterable viruses, and form the family Rickettsiaceae Pinkerton. They stain poorly by Gram's method but well by the procedures of Macchiavello, Gimenez, and Giemsa.
- 
												  (12) United States Patent (10) Patent No.: US 6,395,889 B1 Robison (45) Date of Patent: May 28, 2002USOO6395889B1 (12) United States Patent (10) Patent No.: US 6,395,889 B1 Robison (45) Date of Patent: May 28, 2002 (54) NUCLEIC ACID MOLECULES ENCODING WO WO-98/56804 A1 * 12/1998 ........... CO7H/21/02 HUMAN PROTEASE HOMOLOGS WO WO-99/0785.0 A1 * 2/1999 ... C12N/15/12 WO WO-99/37660 A1 * 7/1999 ........... CO7H/21/04 (75) Inventor: fish E. Robison, Wilmington, MA OTHER PUBLICATIONS Vazquez, F., et al., 1999, “METH-1, a human ortholog of (73) Assignee: Millennium Pharmaceuticals, Inc., ADAMTS-1, and METH-2 are members of a new family of Cambridge, MA (US) proteins with angio-inhibitory activity', The Journal of c: - 0 Biological Chemistry, vol. 274, No. 33, pp. 23349–23357.* (*) Notice: Subject to any disclaimer, the term of this Descriptors of Protease Classes in Prosite and Pfam Data patent is extended or adjusted under 35 bases. U.S.C. 154(b) by 0 days. * cited by examiner (21) Appl. No.: 09/392, 184 Primary Examiner Ponnathapu Achutamurthy (22) Filed: Sep. 9, 1999 ASSistant Examiner William W. Moore (51) Int. Cl." C12N 15/57; C12N 15/12; (74) Attorney, Agent, or Firm-Alston & Bird LLP C12N 9/64; C12N 15/79 (57) ABSTRACT (52) U.S. Cl. .................... 536/23.2; 536/23.5; 435/69.1; 435/252.3; 435/320.1 The invention relates to polynucleotides encoding newly (58) Field of Search ............................... 536,232,235. identified protease homologs. The invention also relates to 435/6, 226, 69.1, 252.3 the proteases. The invention further relates to methods using s s s/ - - -us the protease polypeptides and polynucleotides as a target for (56) References Cited diagnosis and treatment in protease-mediated disorders.
- 
												  1.1.1.2 Tick-Borne Encephalitis VirusThis thesis has been submitted in fulfilment of the requirements for a postgraduate degree (e.g. PhD, MPhil, DClinPsychol) at the University of Edinburgh. Please note the following terms and conditions of use: • This work is protected by copyright and other intellectual property rights, which are retained by the thesis author, unless otherwise stated. • A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. • This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the author. • The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the author. • When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given. Transcriptomic and proteomic analysis of arbovirus-infected tick cells Sabine Weisheit Thesis submitted for the degree of Doctor of Philosophy The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh 2014 Declaration .................................................................................................... i Acknowledgements ..................................................................................... ii Abstract of Thesis ....................................................................................... iii List of Figures .............................................................................................. v List
- 
												  Structure of Human Aspartyl Aminopeptidase Complexed WithChaikuad et al. BMC Structural Biology 2012, 12:14 http://www.biomedcentral.com/1472-6807/12/14 RESEARCH ARTICLE Open Access Structure of human aspartyl aminopeptidase complexed with substrate analogue: insight into catalytic mechanism, substrate specificity and M18 peptidase family Apirat Chaikuad1, Ewa S Pilka1, Antonio De Riso2, Frank von Delft1, Kathryn L Kavanagh1, Catherine Vénien-Bryan2, Udo Oppermann1,3 and Wyatt W Yue1* Abstract Backround: Aspartyl aminopeptidase (DNPEP), with specificity towards an acidic amino acid at the N-terminus, is the only mammalian member among the poorly understood M18 peptidases. DNPEP has implicated roles in protein and peptide metabolism, as well as the renin-angiotensin system in blood pressure regulation. Despite previous enzyme and substrate characterization, structural details of DNPEP regarding ligand recognition and catalytic mechanism remain to be delineated. Results: The crystal structure of human DNPEP complexed with zinc and a substrate analogue aspartate-β- hydroxamate reveals a dodecameric machinery built by domain-swapped dimers, in agreement with electron microscopy data. A structural comparison with bacterial homologues identifies unifying catalytic features among the poorly understood M18 enzymes. The bound ligands in the active site also reveal the coordination mode of the binuclear zinc centre and a substrate specificity pocket for acidic amino acids. Conclusions: The DNPEP structure provides a molecular framework to understand its catalysis that is mediated by active site loop swapping, a mechanism likely adopted in other M18 and M42 metallopeptidases that form dodecameric complexes as a self-compartmentalization strategy. Small differences in the substrate binding pocket such as shape and positive charges, the latter conferred by a basic lysine residue, further provide the key to distinguishing substrate preference.
- 
												  Bitten Enhance.Pdfbitten. Copyright © 2019 by Kris Newby. All rights reserved. Printed in the United States of America. No part of this book may be used or reproduced in any manner whatsoever without written permission except in the case of brief quotations embodied in critical articles and reviews. For information, address HarperCollins Publishers, 195 Broadway, New York, NY 10007. HarperCollins books may be purchased for educational, business, or sales pro- motional use. For information, please email the Special Markets Department at [email protected]. first edition Frontispiece: Tick research at Rocky Mountain Laboratories, in Hamilton, Mon- tana (Courtesy of Gary Hettrick, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases [NIAID], National Institutes of Health [NIH]) Maps by Nick Springer, Springer Cartographics Designed by William Ruoto Library of Congress Cataloging- in- Publication Data Names: Newby, Kris, author. Title: Bitten: the secret history of lyme disease and biological weapons / Kris Newby. Description: New York, NY: Harper Wave, [2019] Identifiers: LCCN 2019006357 | ISBN 9780062896278 (hardback) Subjects: LCSH: Lyme disease— History. | Lyme disease— Diagnosis. | Lyme Disease— Treatment. | BISAC: HEALTH & FITNESS / Diseases / Nervous System (incl. Brain). | MEDICAL / Diseases. | MEDICAL / Infectious Diseases. Classification: LCC RC155.5.N49 2019 | DDC 616.9/246—dc23 LC record available at https://lccn.loc.gov/2019006357 19 20 21 22 23 lsc 10 9 8 7 6 5 4 3 2 1 Appendix I: Ticks and Human Disease Agents
- 
												  (12) United States Patent (10) Patent No.: US 8,603,824 B2 Ramseier Et AlUSOO8603824B2 (12) United States Patent (10) Patent No.: US 8,603,824 B2 Ramseier et al. (45) Date of Patent: Dec. 10, 2013 (54) PROCESS FOR IMPROVED PROTEIN 5,399,684 A 3, 1995 Davie et al. EXPRESSION BY STRAIN ENGINEERING 5,418, 155 A 5/1995 Cormier et al. 5,441,934 A 8/1995 Krapcho et al. (75) Inventors: Thomas M. Ramseier, Poway, CA 5,508,192 A * 4/1996 Georgiou et al. .......... 435/252.3 (US); Hongfan Jin, San Diego, CA 5,527,883 A 6/1996 Thompson et al. (US); Charles H. Squires, Poway, CA 5,558,862 A 9, 1996 Corbinet al. 5,559,015 A 9/1996 Capage et al. (US) 5,571,694 A 11/1996 Makoff et al. (73) Assignee: Pfenex, Inc., San Diego, CA (US) 5,595,898 A 1/1997 Robinson et al. 5,610,044 A 3, 1997 Lam et al. (*) Notice: Subject to any disclaimer, the term of this 5,621,074 A 4/1997 Bjorn et al. patent is extended or adjusted under 35 5,622,846 A 4/1997 Kiener et al. 5,641,671 A 6/1997 Bos et al. U.S.C. 154(b) by 471 days. 5,641,870 A 6/1997 Rinderknecht et al. 5,643,774 A 7/1997 Ligon et al. (21) Appl. No.: 11/189,375 5,662,898 A 9/1997 Ligon et al. (22) Filed: Jul. 26, 2005 5,677,127 A 10/1997 Hogan et al. 5,683,888 A 1 1/1997 Campbell (65) Prior Publication Data 5,686,282 A 11/1997 Lam et al.
- 
												  Serine Proteases with Altered Sensitivity to Activity-Modulating(19) & (11) EP 2 045 321 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 08.04.2009 Bulletin 2009/15 C12N 9/00 (2006.01) C12N 15/00 (2006.01) C12Q 1/37 (2006.01) (21) Application number: 09150549.5 (22) Date of filing: 26.05.2006 (84) Designated Contracting States: • Haupts, Ulrich AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 51519 Odenthal (DE) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • Coco, Wayne SK TR 50737 Köln (DE) •Tebbe, Jan (30) Priority: 27.05.2005 EP 05104543 50733 Köln (DE) • Votsmeier, Christian (62) Document number(s) of the earlier application(s) in 50259 Pulheim (DE) accordance with Art. 76 EPC: • Scheidig, Andreas 06763303.2 / 1 883 696 50823 Köln (DE) (71) Applicant: Direvo Biotech AG (74) Representative: von Kreisler Selting Werner 50829 Köln (DE) Patentanwälte P.O. Box 10 22 41 (72) Inventors: 50462 Köln (DE) • Koltermann, André 82057 Icking (DE) Remarks: • Kettling, Ulrich This application was filed on 14-01-2009 as a 81477 München (DE) divisional application to the application mentioned under INID code 62. (54) Serine proteases with altered sensitivity to activity-modulating substances (57) The present invention provides variants of ser- screening of the library in the presence of one or several ine proteases of the S1 class with altered sensitivity to activity-modulating substances, selection of variants with one or more activity-modulating substances. A method altered sensitivity to one or several activity-modulating for the generation of such proteases is disclosed, com- substances and isolation of those polynucleotide se- prising the provision of a protease library encoding poly- quences that encode for the selected variants.
- 
												  Molecular Evidence of Babesia Infections in Spinose Ear Tick, Otobius Megnini Infesting Stabled Horses in Nuwara Eliya Racecourse: a Case StudyCeylon Journal of Science 47(4) 2018: 405-409 DOI: http://doi.org/10.4038/cjs.v47i4.7559 SHORT COMMUNICATION Molecular evidence of Babesia infections in Spinose ear tick, Otobius megnini infesting stabled horses in Nuwara Eliya racecourse: A case study G.C.P. Diyes1,2, R.P.V.J. Rajapakse3 and R.S. Rajakaruna1,2,* 1Department of Zoology, Faculty of Science, University of Peradeniya, Peradeniya 20400, Sri Lanka 2The Postgraduate Institute of Science, University of Peradeniya, Peradeniya 20400, Sri Lanka 3Department of Veterinary Pathobiology, Faculty of Veterinary Medicine & Animal Science, University of Peradeniya, Peradeniya 20400, Sri Lanka Received:26/04/2018; Accepted:02/08/2018 Abstract: Spinose ear tick, Otobius megnini (Family Argasidae) Race Club (Joseph, 1982). There is a speculation that O. is a one-host soft tick that parasitizes domesticated animals and megnini was introduced to Sri Lanka from India via horse occasionally humans. It causes otoacariasis or parasitic otitis in trading. The first report of O. megnini in Sri Lanka is in humans and animals and also known to carry infectious agents. 2010 from stable workers and jockeys as an intra-aural Intra aural infestations of O. megnini is a serious health problem infestation (Ariyaratne et al., 2010). In Sri Lanka, O. in the well-groomed race horses in Nuwara Eliya. Otobius megnini appears to have a limited distribution with no megnini collected from the ear canal of stabled horses in Nuwara records of it infesting any other domesticated animals other Eliya racecourse were tested for three possible infections, than horses in the racecourses (Diyes and Rajakaruna, Rickettsia, Theileria and Babesia.
- 
												  Relevance Network Between Chemosensitivity and Transcriptome in Human Hepatoma Cells1Vol. 2, 199–205, February 2003 Molecular Cancer Therapeutics 199 Relevance Network between Chemosensitivity and Transcriptome in Human Hepatoma Cells1 Masaru Moriyama,2 Yujin Hoshida, topoisomerase II  expression, whereas it negatively Motoyuki Otsuka, ShinIchiro Nishimura, Naoya Kato, correlated with expression of carboxypeptidases A3 Tadashi Goto, Hiroyoshi Taniguchi, and Z. Response to nimustine was associated with Yasushi Shiratori, Naohiko Seki, and Masao Omata expression of superoxide dismutase 2. Department of Gastroenterology, Graduate School of Medicine, Relevance networks identified several negative University of Tokyo, Tokyo 113-8655 [M. M., Y. H., M. O., N. K., T. G., H. T., Y. S., M. O.]; Cellular Informatics Team, Computational Biology correlations between gene expression and resistance, Research Center, Tokyo 135-0064 [S. N.]; and Department of which were missed by hierarchical clustering. Our Functional Genomics, Graduate School of Medicine, Chiba University, results suggested the necessity of systematically Chiba 260-8670 [N. S.], Japan evaluating the transporting systems that may play a major role in resistance in hepatoma. This may provide Abstract useful information to modify anticancer drug action in Generally, hepatoma is not a chemosensitive tumor, hepatoma. and the mechanism of resistance to anticancer drugs is not fully elucidated. We aimed to comprehensively Introduction evaluate the relationship between chemosensitivity and Hepatoma is a major cause of death even in developed gene expression profile in human hepatoma cells, by countries, and its incidence is increasing (1). Despite the using microarray analysis, and analyze the data by progress of therapeutic technique (2), the efficacy of radical constructing relevance networks. therapy is hampered by frequent recurrence and advance of In eight hepatoma cell lines (HLE, HLF, Huh7, Hep3B, the tumor (3).
- 
												  Fluralaner Activity Against Life Stages of Ticks Using RhipicephalusWilliams et al. Parasites & Vectors (2015) 8:90 DOI 10.1186/s13071-015-0704-x RESEARCH Open Access Fluralaner activity against life stages of ticks using Rhipicephalus sanguineus and Ornithodoros moubata IN in vitro contact and feeding assays Heike Williams*, Hartmut Zoller, Rainer KA Roepke, Eva Zschiesche and Anja R Heckeroth Abstract Background: Fluralaner is a novel isoxazoline eliciting both acaricidal and insecticidal activity through potent blockage of GABA- and glutamate-gated chloride channels. The aim of the study was to investigate the susceptibility of juvenile stages of common tick species exposed to fluralaner through either contact (Rhipicephalus sanguineus) or contact and feeding routes (Ornithodoros moubata). Methods: Fluralaner acaricidal activity through both contact and feeding exposure was measured in vitro using two separate testing protocols. Acaricidal contact activity against Rhipicephalus sanguineus life stages was assessed using three minute immersion in fluralaner concentrations between 50 and 0.05 μg/mL (larvae) or between 1000 and 0.2 μg/mL (nymphs and adults). Contact and feeding activity against Ornithodoros moubata nymphs was assessed using fluralaner concentrations between 1000 to 10−4 μg/mL (contact test) and 0.1 to 10−10 μg/mL (feeding test). Activity was assessed 48 hours after exposure and all tests included vehicle and untreated negative control groups. Results: Fluralaner lethal concentrations (LC50,LC90/95) were defined as concentrations with either 50%, 90% or 95% killing effect in the tested sample population. After contact exposure of R. sanguineus life stages lethal concentrations were (μg/mL): larvae - LC50 0.7, LC90 2.4; nymphs - LC50 1.4, LC90 2.6; and adults - LC50 278, LC90 1973.
- 
												  Supplementary Information Genomice and Transcriptomic AnalysisSupplementary Information Genomice and Transcriptomic Analysis for Identification of Genes and Interlinked Pathways Mediating Artemisinin Resistance in Leishmania donovani Sushmita Ghosh1,2, Aditya Verma1, Vinay Kumar1, Dibyabhaba Pradhan3, Angamuthu Selvapandiyan 2, Poonam Salotra1, Ruchi Singh1* 1. ICMR- National Institute of Pathology, Safdarjung Hospital Campus, New Delhi-110029, India 2. Jamia Hamdard University-Institute of Molecular Medicine, New Delhi-110062, India 3. ICMR-AIIMS Computational Genomics Centre, Indian Council of Medical Research, New Delhi- 110029 *Correspondence: [email protected] Supplementary Figures and Tables: Figure S1. Figure S1: Comparative transcriptional responses following ART adaptation in L. donovani. Overlap of log2 transformed K133 AS-R and K133 WT expression ratio plotted as a function of chromosomal location of probes representing the full genome microarray. The plot represents the average values of three independent hybridizations for each isolate. Table S1: List of genes validated for their modulated expression by Quantitative real time- PCR S.N Primer Gene Name/ Function/relevance Primer Sequence o. Name Gene ID 1 AQP1 Aquaglyceropor Metal ion F- in (LinJ.31.0030) transmembrane 5’CAGGGACAGCTCGAGGGTAA transporter activity, AA3’ integral to membrane; transmembrane R- transport; transporter 5’GTTACCGGCGTGAAAGACAG activity; water TG3’ transport. 2 A2 A2 protein Cellular response to F- (LinJ.22.0670) stress 5’GTTGGCCCGCTTTCTGTTGG3’ R- 5’ACCAACGTCAACAGAGAGA GGG3’ 3 ABCG1 ATP-binding ATP binding, ATPase