DOCSLIB.ORG

1 No. Affymetrix ID Gene Symbol Genedescription Gotermsbp Q Value 1. 209351 at KRT14 Keratin 14 Structural Constituent of Cyto

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
1 No. Affymetrix ID Gene Symbol Genedescription Gotermsbp Q Value 1. 209351 at KRT14 Keratin 14 Structural Constituent of Cyto 1 Affymetrix Gene Q No. GeneDescription GOTermsBP ID Symbol value structural constituent of cytoskeleton, intermediate 1. 209351_at KRT14 keratin 14 filament, epidermis development <0.01 biological process unknown, S100 calcium binding calcium ion binding, cellular 2. 204268_at S100A2 protein A2 component unknown <0.01 regulation of progression through cell cycle, extracellular space, cytoplasm, cell proliferation, protein kinase C inhibitor activity, protein domain specific 3. 33323_r_at SFN stratifin/14-3-3σ binding <0.01 regulation of progression through cell cycle, extracellular space, cytoplasm, cell proliferation, protein kinase C inhibitor activity, protein domain specific 4. 33322_i_at SFN stratifin/14-3-3σ binding <0.01 structural constituent of cytoskeleton, intermediate 5. 201820_at KRT5 keratin 5 filament, epidermis development <0.01 structural constituent of cytoskeleton, intermediate 6. 209125_at KRT6A keratin 6A filament, ectoderm development <0.01 regulation of progression through cell cycle, extracellular space, cytoplasm, cell proliferation, protein kinase C inhibitor activity, protein domain specific 7. 209260_at SFN stratifin/14-3-3σ binding <0.01 structural constituent of cytoskeleton, intermediate 8. 213680_at KRT6B keratin 6B filament, ectoderm development <0.01 receptor activity, cytosol, integral to plasma membrane, cell surface receptor linked signal transduction, sensory perception, tumor-associated calcium visual perception, cell 9. 202286_s_at TACSTD2 signal transducer 2 proliferation, membrane <0.01 structural constituent of cytoskeleton, cytoskeleton, intermediate filament, cell-cell adherens junction, epidermis 10. 200606_at DSP desmoplakin development <0.01 lectin, galactoside- sugar binding, extracellular binding, soluble, 7 space, nucleus, apoptosis, 11. 206400_at LGALS7 (galectin 7) heterophilic cell adhesion <0.01 2 S100 calcium binding calcium ion binding, epidermis 12. 205916_at S100A7 protein A7 (psoriasin 1) development <0.01 S100 calcium binding protein A8 (calgranulin calcium ion binding, extracellular 13. 202917_s_at S100A8 A) space, inflammatory response <0.01 complement activation, lectin pathway, receptor activity, structural constituent of cytoskeleton, protein binding, protein binding, sugar binding, cytoskeleton, intermediate 14. 205900_at KRT1 keratin 1 filament, <0.01 serpin peptidase inhibitor, clade B (ovalbumin), serine-type endopeptidase 15. 204855_at SERPINB5 member 5 inhibitor activity, cell motility <0.01 calcium ion binding, calcium- dependent phospholipid binding, blood coagulation, negative 16. 203074_at ANXA8 annexin A8 regulation of coagulation <0.01 structural constituent of cytoskeleton, intermediate 17. 204734_at KRT15 keratin 15 filament, epidermis development <0.01 transporter activity, membrane fraction, integral to plasma membrane, transport, excretion, 18. 39248_at AQP3 aquaporin 3 membrane <0.01 chloride channel, calcium activated, family member 19. 217528_at CLCA2 2 <0.01 calcium ion binding, protein binding, membrane fraction, cytoskeleton, plasma membrane, intercellular junction, cell adhesion, homophilic cell 20. 206032_at DSC3 desmocollin 3 adhesion, integral to membrane <0.01 structural constituent of cytoskeleton, intermediate 21. 212236_x_at KRT17 keratin 17 filament, epidermis development <0.01 transcription factor activity, intracellular, transcription from RNA polymerase II promoter, tripartite motif-containing zinc ion binding, metal ion 22. 202504_at TRIM29 29 binding <0.01 structural constituent of cytoskeleton, protein binding, 23. 203407_at PPL periplakin cytoskeleton, keratinization <0.01 cysteine protease inhibitor 24. 204971_at CSTA cystatin A (stefin A) activity, intracellular <0.01 lymphocyte antigen 6 protein binding, membrane 25. 206276_at LY6D complex, locus D fraction, cell adhesion, membrane <0.01 3 signal transducer activity, nucleus, cytoskeleton, intermediate filament, plasma membrane, cell adhesion, signal transduction, cell-cell signaling, plakophilin 1 (ectodermal intermediate filament binding, dysplasia/skin fragility desmosome, structural constituent 26. 221854_at PKP1 syndrome) of epidermis <0.01 structural molecule activity, cytoplasm, intermediate filament, small proline-rich protein epidermis development, 27. 205064_at SPRR1B 1B (cornifin) keratinization <0.01 chloride channel, calcium activated, family member 28. 206165_s_at CLCA2 2 <0.01 calcium ion binding, protein binding, membrane fraction, cytoskeleton, plasma membrane, intercellular junction, cell adhesion, homophilic cell 29. 206033_s_at DSC3 desmocollin 3 adhesion, integral to membrane <0.01 30. 210020_x_at CALML3 calmodulin-like 3 calcium ion binding <0.01 PERP, TP53 apoptosis 31. 217744_s_at PERP effector unknown <0.01 LY6/PLAUR domain 32. 204952_at LYPD3 containing 3 unknown <0.01 transcription factor activity, nucleus, transcription, apoptosis, induction of apoptosis, Notch 33. 209863_s_at TP73L tumor protein p73-like signaling pathway <0.01 calcium ion binding, cytoskeleton, intercellular junction assembly, homophilic cell adhesion, calcium-dependent 34. 206642_at DSG1 desmoglein 1 cell-cell adhesion, <0.01 structural constituent of cytoskeleton, intermediate filament, cytoskeleton organization and biogenesis, cell proliferation, epidermis 35. 209800_at KRT16 keratin 16 development <0.01 MAP/ERK kinase kinase activity, epidermal growth factor receptor activity, negative regulation of progression through cell cycle, regulation of peptidyl-tyrosine phosphorylation, regulation of epidermal growth factor nitric-oxide synthase activity, 36. 201983_s_at EGFR receptor actin filament binding <0.01 4 actin binding, integrin binding, structural constituent of cytoskeleton, calcium ion binding, integrin-mediated signaling pathway, intermediate filament cytoskeleton 37. 204455_at DST dystonin organization and biogenesis <0.01 structural constituent of cytoskeleton, intermediate 38. 209126_x_at KRT6B keratin 6B filament, ectoderm development <0.01 structural molecule activity, small proline-rich protein epidermis development, 39. 213796_at SPRR1A 1A keratinization <0.01 nucleotide binding, GTPase activity, structural molecule activity, protein binding, GTP tubulin, alpha 1 (testis binding, microtubule, 40. 212242_at TUBA1 specific) microtubule-based movement, <0.01 calcium ion binding, protein cadherin 1, type 1, E- binding, homophilic cell 41. 201131_s_at CDH1 cadherin adhesion, integral to membrane <0.01 rhodopsin-like receptor activity, receptor activity, signal transduction, G-protein coupled G protein-coupled receptor protein signaling 42. 219936_s_at GPR87 receptor 87 pathway, <0.01 structural molecule activity, intermediate filament, epidermis 43. 213287_s_at KRT10 keratin 10 development <0.01 carbonate dehydratase activity, one-carbon compound metabolism, zinc ion binding, integral to membrane, lyase 44. 214164_x_at CA12 carbonic anhydrase XII activity, metal ion binding <0.01 chloride channel, calcium activated, family member 45. 206166_s_at CLCA2 2 unknown <0.01 extracellular region, response to pest, pathogen or parasite, defense response to bacteria, 46. 210397_at DEFB1 defensin, beta 1 innate immune response, <0.01 structural constituent of cytoskeleton, intermediate 47. 205157_s_at KRT17 keratin 17 filament, epidermis development <0.01 calcium ion binding, protein binding, cytoskeleton, desmoglein 3 (pemphigus intercellular junction, cell 48. 205595_at DSG3 vulgaris antigen) adhesion <0.01 5 transporter activity, binding, adaptor-related protein Golgi stack, coated pit, protein complex 1, gamma 1 complex assembly, intracellular 49. 215867_x_at AP1G1 subunit protein transport <0.01 carbonate dehydratase activity, one-carbon compound metabolism, zinc ion binding, 50. 203963_at CA12 carbonic anhydrase XII integral to membrane, <0.01 structural constituent of cytoskeleton, intermediate 51. 214580_x_at KRT6A keratin 6A filament, ectoderm development <0.01 structural molecule activity, intermediate filament, epidermis 52. 207023_x_at KRT10 keratin 10 development <0.01 DNA binding, RNA polymerase II transcription factor activity, Kruppel-like factor 5 nucleus, transcription, regulation 53. 209212_s_at KLF5 (intestinal) of transcription, <0.01 receptor activity, protein binding, coxsackie virus and plasma membrane, integral to 54. 203917_at CXADR adenovirus receptor plasma membrane, cell adhesion <0.01 55. 219597_s_at DUOX1 dual oxidase 1 unknown <0.01 CD24 antigen (small cell lung carcinoma cluster 4 plasma membrane, humoral 56. 209771_x_at CD24 antigen) immune response <0.01 serine-type endopeptidase inhibitor activity, cellular serpin peptidase inhibitor, component unknown, response to SERPINB1 clade B (ovalbumin), UV, regulation of proteolysis and 57. 217272_s_at 3 member 13 peptidolysis <0.01 nucleotide binding, receptor signaling protein tyrosine kinase activity, receptor activity, v-kit Hardy-Zuckerman 4 vascular endothelial growth feline sarcoma viral factor receptor activity, ATP 58. 205051_s_at KIT oncogene homolog binding, signal transduction, <0.01 S100 calcium binding 59. 218677_at S100A14 protein A14 calcium ion binding <0.01 signal transducer activity, protein binding, integral to plasma gap junction protein, membrane, connexon complex, alpha 1, 43kDa (connexin cell-cell signaling, heart 60. 201667_at GJA1 43) development, junction assembly, <0.01 transcription factor activity, nucleus, transcription, regulation of transcription, DNA-dependent, transcription from RNA polymerase II promoter, defense 61. 209604_s_at GATA3 GATA binding protein
Load more

Recommended publications
  • Hormone Therapy Use and Breast Tissue DNA
    http://www.diva-portal.org This is the published version of a paper published in Epigenetics. Citation for the original published paper (version of record): Harlid, S., Xu, Z., Kirk, E., Wilson, L E., Troester, M A. et al. (2019) Hormone therapy use and breast tissue DNA methylation: analysis of epigenome wide data from the normal breast study Epigenetics, 14(2): 146-157 https://doi.org/10.1080/15592294.2019.1580111 Access to the published version may require subscription. N.B. When citing this work, cite the original published paper. Permanent link to this version: http://urn.kb.se/resolve?urn=urn:nbn:se:umu:diva-157445 EPIGENETICS 2019, VOL. 14, NO. 2, 146–157 https://doi.org/10.1080/15592294.2019.1580111 RESEARCH PAPER Hormone therapy use and breast tissue DNA methylation: analysis of epigenome wide data from the normal breast study Sophia Harlid a,b, Zongli Xuc, Erin Kirkd, Lauren E. Wilson c,e, Melissa A. Troesterd, and Jack A. Taylor a,c aEpigenetics & Stem Cell Biology Laboratory, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC, USA; bDepartment of Radiation Sciences, Oncology, Umeå University, Umeå, Sweden; cEpidemiology Branch, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC, USA; dDepartment of Epidemiology, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA; eDepartment of Population Health Sciences, Duke University School of Medicine, Durham, NC, USA ABSTRACT ARTICLE HISTORY Hormone therapy (HT) is associated with increased risk of breast cancer, strongly dependent on Received 4 September 2018 type, duration, and recency of use. HT use could affect cancer risk by changing breast tissue Revised 21 December 2018 transcriptional programs.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 6,395,889 B1 Robison (45) Date of Patent: May 28, 2002
    USOO6395889B1 (12) United States Patent (10) Patent No.: US 6,395,889 B1 Robison (45) Date of Patent: May 28, 2002 (54) NUCLEIC ACID MOLECULES ENCODING WO WO-98/56804 A1 * 12/1998 ........... CO7H/21/02 HUMAN PROTEASE HOMOLOGS WO WO-99/0785.0 A1 * 2/1999 ... C12N/15/12 WO WO-99/37660 A1 * 7/1999 ........... CO7H/21/04 (75) Inventor: fish E. Robison, Wilmington, MA OTHER PUBLICATIONS Vazquez, F., et al., 1999, “METH-1, a human ortholog of (73) Assignee: Millennium Pharmaceuticals, Inc., ADAMTS-1, and METH-2 are members of a new family of Cambridge, MA (US) proteins with angio-inhibitory activity', The Journal of c: - 0 Biological Chemistry, vol. 274, No. 33, pp. 23349–23357.* (*) Notice: Subject to any disclaimer, the term of this Descriptors of Protease Classes in Prosite and Pfam Data patent is extended or adjusted under 35 bases. U.S.C. 154(b) by 0 days. * cited by examiner (21) Appl. No.: 09/392, 184 Primary Examiner Ponnathapu Achutamurthy (22) Filed: Sep. 9, 1999 ASSistant Examiner William W. Moore (51) Int. Cl." C12N 15/57; C12N 15/12; (74) Attorney, Agent, or Firm-Alston & Bird LLP C12N 9/64; C12N 15/79 (57) ABSTRACT (52) U.S. Cl. .................... 536/23.2; 536/23.5; 435/69.1; 435/252.3; 435/320.1 The invention relates to polynucleotides encoding newly (58) Field of Search ............................... 536,232,235. identified protease homologs. The invention also relates to 435/6, 226, 69.1, 252.3 the proteases. The invention further relates to methods using s s s/ - - -us the protease polypeptides and polynucleotides as a target for (56) References Cited diagnosis and treatment in protease-mediated disorders.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Aquaporin Channels in the Heart—Physiology and Pathophysiology
    International Journal of Molecular Sciences Review Aquaporin Channels in the Heart—Physiology and Pathophysiology Arie O. Verkerk 1,2,* , Elisabeth M. Lodder 2 and Ronald Wilders 1 1 Department of Medical Biology, Amsterdam University Medical Centers, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; [email protected] 2 Department of Experimental Cardiology, Amsterdam University Medical Centers, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; [email protected] * Correspondence: [email protected]; Tel.: +31-20-5664670 Received: 29 March 2019; Accepted: 23 April 2019; Published: 25 April 2019 Abstract: Mammalian aquaporins (AQPs) are transmembrane channels expressed in a large variety of cells and tissues throughout the body. They are known as water channels, but they also facilitate the transport of small solutes, gasses, and monovalent cations. To date, 13 different AQPs, encoded by the genes AQP0–AQP12, have been identified in mammals, which regulate various important biological functions in kidney, brain, lung, digestive system, eye, and skin. Consequently, dysfunction of AQPs is involved in a wide variety of disorders. AQPs are also present in the heart, even with a specific distribution pattern in cardiomyocytes, but whether their presence is essential for proper (electro)physiological cardiac function has not intensively been studied. This review summarizes recent findings and highlights the involvement of AQPs in normal and pathological cardiac function. We conclude that AQPs are at least implicated in proper cardiac water homeostasis and energy balance as well as heart failure and arsenic cardiotoxicity. However, this review also demonstrates that many effects of cardiac AQPs, especially on excitation-contraction coupling processes, are virtually unexplored.
    [Show full text]
  • Structure of Human Aspartyl Aminopeptidase Complexed With
    Chaikuad et al. BMC Structural Biology 2012, 12:14 http://www.biomedcentral.com/1472-6807/12/14 RESEARCH ARTICLE Open Access Structure of human aspartyl aminopeptidase complexed with substrate analogue: insight into catalytic mechanism, substrate specificity and M18 peptidase family Apirat Chaikuad1, Ewa S Pilka1, Antonio De Riso2, Frank von Delft1, Kathryn L Kavanagh1, Catherine Vénien-Bryan2, Udo Oppermann1,3 and Wyatt W Yue1* Abstract Backround: Aspartyl aminopeptidase (DNPEP), with specificity towards an acidic amino acid at the N-terminus, is the only mammalian member among the poorly understood M18 peptidases. DNPEP has implicated roles in protein and peptide metabolism, as well as the renin-angiotensin system in blood pressure regulation. Despite previous enzyme and substrate characterization, structural details of DNPEP regarding ligand recognition and catalytic mechanism remain to be delineated. Results: The crystal structure of human DNPEP complexed with zinc and a substrate analogue aspartate-β- hydroxamate reveals a dodecameric machinery built by domain-swapped dimers, in agreement with electron microscopy data. A structural comparison with bacterial homologues identifies unifying catalytic features among the poorly understood M18 enzymes. The bound ligands in the active site also reveal the coordination mode of the binuclear zinc centre and a substrate specificity pocket for acidic amino acids. Conclusions: The DNPEP structure provides a molecular framework to understand its catalysis that is mediated by active site loop swapping, a mechanism likely adopted in other M18 and M42 metallopeptidases that form dodecameric complexes as a self-compartmentalization strategy. Small differences in the substrate binding pocket such as shape and positive charges, the latter conferred by a basic lysine residue, further provide the key to distinguishing substrate preference.
    [Show full text]
  • A Cell Line P53 Mutation Type UM
    A Cell line p53 mutation Type UM-SCC 1 wt UM-SCC5 Exon 5, 157 GTC --> TTC Missense mutation by transversion (Valine --> Phenylalanine UM-SCC6 wt UM-SCC9 wt UM-SCC11A wt UM-SCC11B Exon 7, 242 TGC --> TCC Missense mutation by transversion (Cysteine --> Serine) UM-SCC22A Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC22B Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC38 Exon 5, 132 AAG --> AAT Missense mutation by transversion (Lysine --> Asparagine) UM-SCC46 Exon 8, 278 CCT --> CGT Missense mutation by transversion (Proline --> Alanine) B 1 Supplementary Methods Cell Lines and Cell Culture A panel of ten established HNSCC cell lines from the University of Michigan series (UM-SCC) was obtained from Dr. T. E. Carey at the University of Michigan, Ann Arbor, MI. The UM-SCC cell lines were derived from eight patients with SCC of the upper aerodigestive tract (supplemental Table 1). Patient age at tumor diagnosis ranged from 37 to 72 years. The cell lines selected were obtained from patients with stage I-IV tumors, distributed among oral, pharyngeal and laryngeal sites. All the patients had aggressive disease, with early recurrence and death within two years of therapy. Cell lines established from single isolates of a patient specimen are designated by a numeric designation, and where isolates from two time points or anatomical sites were obtained, the designation includes an alphabetical suffix (i.e., "A" or "B"). The cell lines were maintained in Eagle's minimal essential media supplemented with 10% fetal bovine serum and penicillin/streptomycin.
    [Show full text]
  • Newly Developed Serine Protease Inhibitors Decrease Visceral Hypersensitivity in a Post-Inflammatory Rat Model for Irritable Bowel Syndrome
    This item is the archived peer-reviewed author-version of: Newly developed serine protease inhibitors decrease visceral hypersensitivity in a post-inflammatory rat model for irritable bowel syndrome Reference: Ceuleers Hannah, Hanning Nikita, Heirbaut Leen, Van Remoortel Samuel, Joossens Jurgen, van der Veken Pieter, Francque Sven, De Bruyn Michelle, Lambeir Anne-Marie, de Man Joris, ....- New ly developed serine protease inhibitors decrease visceral hypersensitivity in a post-inflammatory rat model for irritable bow el syndrome British journal of pharmacology - ISSN 0007-1188 - 175:17(2018), p. 3516-3533 Full text (Publisher's DOI): https://doi.org/10.1111/BPH.14396 To cite this reference: https://hdl.handle.net/10067/1530780151162165141 Institutional repository IRUA NEWLY DEVELOPED SERINE PROTEASE INHIBITORS DECREASE VISCERAL HYPERSENSITIVITY IN A POST-INFLAMMATORY RAT MODEL FOR IRRITABLE BOWEL SYNDROME. Running title: Serine proteases in visceral hypersensitivity Hannah Ceuleers, Nikita Hanning, Jelena Heirbaut, Samuel Van Remoortel, Michelle De bruyn, Jurgen Joossens, Pieter van der Veken, Anne-Marie Lambeir, Sven M Francque, Joris G De Man, Jean-Pierre Timmermans, Koen Augustyns, Ingrid De Meester, Benedicte Y De Winter Hannah Ceuleers, Nikita Hanning, Jelena Heirbaut, Sven Francque, Joris G De Man, Benedicte Y De Winter, Laboratory of Experimental Medicine and Pediatrics, Division of Gastroenterology, University of Antwerp, Antwerp, Belgium. Samuel Van Remoortel, Jean-Pierre Timmermans, Laboratory of Cell Biology and Histology, University of Antwerp, Antwerp, Belgium. Jurgen Joossens, Pieter van der Veken, Koen Augustyns, Laboratory of Medicinal Chemistry, University of Antwerp, Antwerp, Belgium. Sven Francque, Antwerp University Hospital, Antwerp, Belgium. Michelle De bruyn, Anne-Marie Lambeir, Ingrid De Meester, Laboratory of Medical Biochemistry, University of Antwerp, Antwerp, Belgium.
    [Show full text]
  • Supplementary Table S1. Upregulated Genes Differentially
    Supplementary Table S1. Upregulated genes differentially expressed in athletes (p < 0.05 and 1.3-fold change) Gene Symbol p Value Fold Change 221051_s_at NMRK2 0.01 2.38 236518_at CCDC183 0.00 2.05 218804_at ANO1 0.00 2.05 234675_x_at 0.01 2.02 207076_s_at ASS1 0.00 1.85 209135_at ASPH 0.02 1.81 228434_at BTNL9 0.03 1.81 229985_at BTNL9 0.01 1.79 215795_at MYH7B 0.01 1.78 217979_at TSPAN13 0.01 1.77 230992_at BTNL9 0.01 1.75 226884_at LRRN1 0.03 1.74 220039_s_at CDKAL1 0.01 1.73 236520_at 0.02 1.72 219895_at TMEM255A 0.04 1.72 201030_x_at LDHB 0.00 1.69 233824_at 0.00 1.69 232257_s_at 0.05 1.67 236359_at SCN4B 0.04 1.64 242868_at 0.00 1.63 1557286_at 0.01 1.63 202780_at OXCT1 0.01 1.63 1556542_a_at 0.04 1.63 209992_at PFKFB2 0.04 1.63 205247_at NOTCH4 0.01 1.62 1554182_at TRIM73///TRIM74 0.00 1.61 232892_at MIR1-1HG 0.02 1.61 204726_at CDH13 0.01 1.6 1561167_at 0.01 1.6 1565821_at 0.01 1.6 210169_at SEC14L5 0.01 1.6 236963_at 0.02 1.6 1552880_at SEC16B 0.02 1.6 235228_at CCDC85A 0.02 1.6 1568623_a_at SLC35E4 0.00 1.59 204844_at ENPEP 0.00 1.59 1552256_a_at SCARB1 0.02 1.59 1557283_a_at ZNF519 0.02 1.59 1557293_at LINC00969 0.03 1.59 231644_at 0.01 1.58 228115_at GAREM1 0.01 1.58 223687_s_at LY6K 0.02 1.58 231779_at IRAK2 0.03 1.58 243332_at LOC105379610 0.04 1.58 232118_at 0.01 1.57 203423_at RBP1 0.02 1.57 AMY1A///AMY1B///AMY1C///AMY2A///AMY2B// 208498_s_at 0.03 1.57 /AMYP1 237154_at LOC101930114 0.00 1.56 1559691_at 0.01 1.56 243481_at RHOJ 0.03 1.56 238834_at MYLK3 0.01 1.55 213438_at NFASC 0.02 1.55 242290_at TACC1 0.04 1.55 ANKRD20A1///ANKRD20A12P///ANKRD20A2///
    [Show full text]
  • ARHGEF4 (NM 015320) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC215591 ARHGEF4 (NM_015320) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ARHGEF4 (NM_015320) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ARHGEF4 Synonyms: ASEF; ASEF1; GEF4; SMIM39; STM6 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 ARHGEF4 (NM_015320) Human Tagged ORF Clone – RC215591 ORF Nucleotide >RC215591 representing NM_015320 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCTGGGAAGAACCAGCAGGTGAGAAGCCCAGTTGCTCTCACAGTCAGAAGGCATTCCACATGGAGC CTGCCCAGAAGCCCTGCTTCACCACTGACATGGTGACATGGGCCCTCCTCTGCATCTCTGCAGAGACTGT GCGTGGGGAGGCTCCTTCACAGCCTAGGGGCATCCCTCACCGCTCGCCCGTCAGTGTGGATGACCTGTGG CTGGAGAAGACACAGAGAAAGAAGTTGCAGAAGCAGGCCCACATCGAAAGGAGGCTGCACATAGGGGCAG TGCACAAAGATGGAGTCAAGTGCTGGAGAAAGACGATCATTACCTCTCCAGAGTCTTTGAATCTCCCTAG AAGAAGCCATCCACTCTCCCAGAGTGCTCCAACGGGACTGAACCACATGGGCTGGCCAGAGCACACACCA GGCACTGCCATGCCTGATGGAGCTCTGGACACAGCTGTCTGCGCTGACGAAGTGGGGAGCGAGGAGGACC TGTATGATGACCTGCACAGCTCCAGCCACCACTACAGCCACCCTGGAGGGGGTGGGGAGCAGCTGGCTAT CAATGAGCTCATCAGCGATGGCAGTGTGGTCTGCGCTGAAGCACTCTGGGACCATGTCACCATGGACGAC
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Src Regulation of Cx43 Phosphorylation and Gap Junction Turnover
    biomolecules Article Src Regulation of Cx43 Phosphorylation and Gap Junction Turnover Joell L. Solan 1 and Paul D. Lampe 1,2,* 1 Translational Research Program, Fred Hutchinson Cancer Research Center, Seattle, WA 98109, USA; [email protected] 2 Department of Global Health, Pathobiology Program, University of Washington, Seattle, WA 98109, USA * Correspondence: [email protected] Received: 27 October 2020; Accepted: 22 November 2020; Published: 24 November 2020 Abstract: The gap junction protein Connexin43 (Cx43) is highly regulated by phosphorylation at over a dozen sites by probably at least as many kinases. This Cx43 “kinome” plays an important role in gap junction assembly and turnover. We sought to gain a better understanding of the interrelationship of these phosphorylation events particularly related to src activation and Cx43 turnover. Using state-of-the-art live imaging methods, specific inhibitors and many phosphorylation-status specific antibodies, we found phospho-specific domains in gap junction plaques and show evidence that multiple pathways of disassembly exist and can be regulated at the cellular and subcellular level. We found Src activation promotes formation of connexisomes (internalized gap junctions) in a process involving ERK-mediated phosphorylation of S279/282. Proteasome inhibition dramatically and rapidly restored gap junctions in the presence of Src and led to dramatic changes in the Cx43 phospho-profile including to increased Y247, Y265, S279/282, S365, and S373 phosphorylation. Lysosomal inhibition, on the other hand, nearly eliminated phosphorylation on Y247 and Y265 and reduced S368 and S373 while increasing S279/282 phosphorylation levels. We present a model of gap junction disassembly where multiple modes of disassembly are regulated by phosphorylation and can have differential effects on cellular signaling.
    [Show full text]
  • Analysis of Mouse Keratin 6A Regulatory Sequences in Transgenic Mice Reveals Constitutive, Tissue-Speci®C Expression by a Keratin 6A Minigene
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Analysis of Mouse Keratin 6a Regulatory Sequences in Transgenic Mice Reveals Constitutive, Tissue-Speci®c Expression by a Keratin 6a Minigene Donna Mahony, Seetha Karunaratne, Graham Cam,* and Joseph A. Rothnagel Department of Biochemistry and the Institute for Molecular Bioscience, University of Queensland, Brisbane, Queensland, and *Division of Animal Production, CSIRO, Blacktown, New South Wales, Australia The analysis of keratin 6 expression is complicated atin 6 expressing tissues, including the hair follicle, by the presence of multiple isoforms that are tongue, footpad, and nail bed, showing that both expressed constitutively in a number of internal stra- transgenes retained keratinocyte-speci®c expression. ti®ed epithelia, in palmoplantar epidermis, and in Quantitative analysis of b-galactosidase activity veri- the companion cell layer of the hair follicle. In addi- ®ed that both the 1.3 and 0.12 kb keratin 6a promo- tion, keratin 6 expression is inducible in interfollicu- ter constructs produced similar levels of the reporter. lar epidermis and the outer root sheath of the Notably, bothconstructs were constitutively follicle, in response to wounding stimuli, phorbol expressed in the outer root sheath and interfollicular esters, or retinoic acid. In order to establishthecriti- epidermis in the absence of any activating stimulus, cal regions involved in the regulation of keratin 6a suggesting that they lack the regulatory elements (the dominant isoform in mice), we generated trans- that normally silence transcription in these cells. This genic mice withtwo different-sized mouse keratin 6a study has revealed that a keratin 6a minigene con- constructs containing either 1.3 kb or 0.12 kb of 5¢ tains critical cis elements that mediate tissue-speci®c ¯anking sequence linked to the lacZ reporter gene.
    [Show full text]