Investigation of Phosphatidylinositol 5- Phosphate's Role in Insulin

Investigation of Phosphatidylinositol 5- Phosphate’s Role in Insulin-Stimulated Glucose Uptake in a Skeletal Muscle Cell Line

A thesis submitted to The University of Manchester for the Degree of Physiology Ph.D. in the Faculty of Life Sciences

2010

Deborah Louise Grainger

Words (excluding tables, legends and references): 35,000

Table of Contents

List of Figures ...... 8 List of Tables ...... 9 List of Abbreviations ...... 10 Abstract ...... 13 Lay Abstract ...... 14 Declaration ...... 15 Copyright Statement ...... 16 Acknowledgements ...... 17 Dedication ...... 18 1 Introduction ...... 19 1.1 GLUT4 ...... 22 1.1.1 Specialised subcellular storage of GLUT4 ...... 23 1.1.2 Increasing GLUT4 at the plasma membrane ...... 24 1.1.3 The Insulin Receptor ...... 26 1.1.3.1 IR structure and mechanism of activation ...... 27

1.1.3.2 IR splice variants ...... 27

1.1.3.3 Regulation of the IR ...... 28

1.1.4 Insulin receptor substrates ...... 28 1.1.4.1 Downstream of kinase (DOK) proteins ...... 29

1.1.4.2 Mechanism of IRS activation ...... 30

1.1.4.3 Regulation of IRS proteins ...... 31

1.1.5 Class IA PI3-kinase ...... 32 1.1.5.1 Regulation of Class IA PI3-kinase signalling by removal of its product,

PtdIns(3,4,5)P3 ...... 35

1.1.6 Akt ...... 37 1.1.6.1 Isoform specific Akt regulation ...... 38

1.1.6.2 Akt activation ...... 39

1.1.6.3 Akt inhibition ...... 40

1.1.7 Signalling downstream of Akt ...... 41 1.1.7.1 AS160 ...... 41

1.1.7.2 TBC1D1 ...... 43

1.1.7.3 PIKfyve ...... 44

1.1.8 Atypical Protein Kinase C ...... 46

1.1.9 PI3-kinase independent insulin signalling: the TC10 pathway ...... 47 1.1.9.1 The TC10 pathway and PtdIns3P ...... 49

1.1.9.2 Debated importance of the TC10 pathway ...... 50

1.2 The phosphoinositides ...... 51 1.2.1 Phosphoinositide structure and metabolism ...... 53 1.2.2 PtdIns5P ...... 54 1.2.2.1 Measurements of PtdIns5P levels ...... 55

1.2.2.2 PtdIns5P production ...... 55

1.2.2.2.1 PIKfyve: Direct or indirect route to PtdIns5P? ...... 56

1.2.2.2.2 The myotubularins ...... 58

1.2.2.2.3 PIP5KI: potential to phosphorylate PtdIns to PtdIns5P? ...... 60

1.2.2.2.4 4-phosphatases: dephosphorylation of PtdIns(4,5)P2 to PtdIns5P ...... 60

1.2.2.3 Removal of PtdIns5P ...... 61

1.2.2.3.1 The role of PIP4KIIs in regulating PtdIns5P ...... 61

1.2.2.3.2 PIP4KII regulation of PtdIns(3,4,5)P3 levels: a role for PtdIns5P? ...... 63

1.2.2.3.3 PTPMT1 ...... 64

1.2.3 Potential roles of PtdIns5P ...... 65 1.2.3.1 PtdIns5P in the Nucleus ...... 66

1.2.3.2 PtdIns5P and intracellular trafficking ...... 67

1.2.3.3 PtdIns5P and T-Cell activation...... 68

1.2.4 PtdIns5P has a potential role in the insulin signalling pathway ...... 69 1.2.4.1 PtdIns5P and insulin-induced actin reorganisation ...... 69

1.2.4.2 Effect of PtdIns5P on GLUT4 translocation ...... 70

1.2.4.3 PtdIns5P and PI3-kinase/Akt activity...... 71

1.3 Summary ...... 74 1.4 Aims ...... 74 2 : Materials and Methods ...... 75 2.1 Materials ...... 76 2.2 Cell biology techniques ...... 77 2.2.1 Cell culture ...... 77 2.2.2 Overexpression of proteins in HeLa(S3) cells and L6 myotubes ...... 78 2.2.2.1 Nucleofection ...... 78

2.2.2.2 Calcium phosphate precipitation transfection ...... 79

2.2.2.3 Recombinant adenoviral transduction ...... 79

2.2.3 Fluorescence microscopy ...... 80 2.2.3.1 Fixation ...... 80

2.2.3.2 Immunofluorescence staining ...... 80

2.2.3.3 Microscopy ...... 80

2.2.4 Protein Isolation ...... 81 2.2.4.1 Cell lysis with SDS Sample Buffer ...... 81

2.2.4.2 Cell lysis with RIPA buffer ...... 81

2.2.5 SDS-Polyacrylamide gel electrophoresis (PAGE) ...... 82 2.2.6 Coomassie blue staining of polyacrylamide gels...... 82 2.2.7 Gel drying ...... 82 2.2.8 Western transfer ...... 82 2.2.9 Western blotting ...... 83 2.2.10 Blot stripping and reprobing ...... 83 2.2.11 Cell stimulation and phosphotyrosine immunoprecipitation ...... 83 2.2.12 Carrier-mediated delivery of mono-phosphoinositides ...... 84 2.2.12.1 Lipid-carrier complex formation ...... 85

® 2.2.12.2 Delivery of BODIPY PtdIns5P-diC16 ...... 85

2.2.13 Plasma membrane lawn preparation ...... 86 2.2.14 Staining PM Lawns for microscopy ...... 86 2.2.15 Quantifying GLUT4 present on PM lawns ...... 87 2.3 Molecular biology techniques ...... 87 2.3.1 Transformation ...... 87 2.3.2 DNA isolation ...... 88 2.3.3 Agarose gel electrophoreisis ...... 88 2.3.4 Restriction digests ...... 88 2.3.5 Gel purification ...... 88 2.3.6 Ligation ...... 88 2.3.7 Primer design ...... 89 2.3.8 Polymerase chain reaction ...... 89 2.3.9 Degenerative PCR generation of 2xPHD-ING2 6A K/R construct ...... 90 2.3.10 Expression of fusion proteins ...... 91 2.3.11 Clean up and biotinylation of 2xPHD-ING2 and its null-binding mutant 2xPHD-ING2 6A K/R ...... 93 2.3.11.1 Dialysis and concentration ...... 93

2.3.11.2 Biotinylation ...... 93

2.4 Biochemical assays ...... 93 2.4.1 2 Deoxy-D-glucose uptake assay ...... 93 2.4.2 PtdIns5P mass assay ...... 94 2.4.2.1 Lipid Extraction ...... 94

2.4.2.2 Purification of phosphoinositides ...... 96

2.4.2.3 Radiolabelling of PtdIns5P ...... 97

2.4.2.4 Thin layer chromatography ...... 97

2.4.3 Phosphorus assay ...... 98

2.4.4 PtdIns(3,4,5)P3 Assay ...... 99 2.4.4.1 Lipid extraction ...... 99

2.4.4.2 Neomycin purification of phosphinositides ...... 99

2.4.4.3 Protein-lipid overlay assay ...... 100

2.5 Statistical analyses ...... 100 3 Results I: Characterisation of L6 Myotubes ...... 101 3.1 L6 myoblasts display morphological differentiation to multinucleate myotubes ...... 102 3.2 Myotubes are molecularly distinct from myoblasts ...... 104 3.3 Tyrosine phosphorylation is enhanced in L6 myotubes stimulated with insulin ...... 106 3.4 Insulin stimulation of class I PI3-kinase in L6 myotubes ...... 107 3.5 L6 myotubes show enhanced Akt phosphorylation in response to stimulation with insulin...... 110 3.6 Insulin induces GLUT4 translocation to the plasma membrane in L6 myotubes ...... 111 3.7 Glucose uptake in response to both 100nM and 1μM insulin ...... 112 3.8 Summary of results I ...... 115 4 Results II: Investigating a potential role for PtdIns5P in insulin stimulated events in L6 myotubes ...... 116 4.1 PtdIns5P increases in response to insulin in L6 myotubes ...... 117 4.2 The effect of PIP4KIIα overexpression on glucose uptake in L6 myotubes ...... 119 4.2.1 Optimisation of multiplicity of infection for adenoviral infection of L6 myotubes ...... 120 4.2.2 PIP4KIIα Overexpression results in attenuated PtdIns5P levels in the presence of Insulin ...... 120

4.2.3 PIP4KIIα overexpression abolishes insulin-stimulated glucose uptake in L6 myotubes ...... 121 4.3 Increasing PtdIns5P levels in the absence of insulin by carrier-mediated lipid delivery and its effect on glucose uptake ...... 121 4.3.1 Delivery of BODIPY™ labelled PtdIns5P to the myotube cell interior 123 4.3.2 Delivery of unlabelled PtdIns5P into L6 myotubes successfully raises its levels ...... 123 4.3.3 Increasing PtdIns5P levels by carrier-mediated delivery enhances glucose uptake in L6 myotubes ...... 125 4.4 Carrier-mediated delivery of PtdIns5P increases plasma membrane association of GLUT4 ...... 125 4.5 The effect of increasing PtdIns3P levels by carrier-mediated delivery on glucose uptake in L6 myotubes ...... 126 4.5.1 Delivery of PtdIns3P to L6 myotubes has no effect on glucose uptake ...... 128 4.5.2 Detection of PtdIns3P carrier-mediated delivery with GFP-FENS-1-FYVE PtdIns3P binding domain ...... 129 4.6 PtdIns5P enhancement of glucose uptake is wortmannin-sensitive ...... 130 4.7 PtdIns5P enhanced glucose uptake is sensitive to the tyrosine kinase inhibitor Tyrphostin AG213 ...... 132 4.8 PtdIns5P delivery activates Akt phosphorylation on both T308 and S473 residues ...... 132 4.8.1 Comparison of PtdIns5P-induced and insulin-induced Akt phosphorylation ...... 134 4.9 Discussion of results II ...... 135 5 Results III: Development of tools for further investigation of PtdIns5P‟s role in insulin signalling ...... 140 5.1 Attempted development of a PtdIns5P binding protein for multiple applications ...... 141 5.2 Development of the PHD domain of ING2 for use in this project ...... 144 5.2.1 Generation of a PtdIns5P null-binding mutant of 2xPHD-ING2 ...... 144 5.2.2 Examining the binding affinities of both 2xPHD-ING2 and 2xPHD-ING2 6A K/R ...... 146 5.3 Development of a chemically inducible PtdIns5P removal system ...... 146 5.3.1 Deletion of the N-terminal mitochondrial targeting region of PTPMT1 ...... 148 5.3.2 YFP-FKBP-Δ37PTPMT1 is successfully excluded from mitochondria . 148 5.3.3 Heterodimerisation of YFP-FKBP-Δ37PTPMT1 with FRB-HA ...... 150

5.3.4 The effect of rapamycin induced relocation of YFP-FKBP-Δ37PTPMT1 to the plasma membrane in pervanadate treated HeLa(S3) cells ...... 151 5.3.4.1 Rapamycin does not affect the pervanadate generated increase in PtdIns5P levels in HeLa(S3) cells ...... 152

5.3.4.2 The effects of Rapamycin induced YPF-FKBP-Δ37PTPMT1 and FRB-HA heterodimerisation on PtdIns5P levels in pervanadate stimulated HeLa(S3) cells ... 153

5.4 Discussion of results III ...... 154 6 General Discussion ...... 156 6.1 How might insulin increase PtdIns5P levels? ...... 157 6.2 Discussion of PtdIns5P‟s role in insulin signalling ...... 159 6.2.1 Possible mechanisms of PtdIns5P action on glucose uptake ...... 160 6.2.1.1 :Does PtdIns5P activate a PI3-kinase? ...... 160

6.2.1.2 Does PtdIns5P take its action via inhibition of a PtdIns(3,4,5)P3 or Akt phosphatase? ...... 163

6.2.1.3 GLUT4 dynamics in L6 skeletal muscle: A different perspective on PtdIns5P‟s potential mechanism of action ...... 166

6.3 Future directions ...... 167 7 References ...... 169

List of Figures

Figure 1.1: The pleiotropic effects of the insulin signal ...... 26 Figure 1.2: Schematic representation of the PI3-kinase dependent insulin signalling pathway ...... 33

Figure 1.3: PtdIns(3,4,5)P3 Phosphatases...... 36 Figure.1.4: The TC10 pathway ...... 48 Figure 1.5: Structure of Phosphatidylinositol...... 53 Figure 1.6: Phosphoinositide interconversions by sequential phosphorylations by specific enzymes ...... 54 Figure 1.7: The two suggested routes of PtdIns5P production from PtdIns ...... 57 Figure 2.1: Two-phase lipid extraction ...... 95 Figure 3.1: Morphological differentiation of L6 myoblasts to multinucleate myotubes ...... 103 Figure 3.2: Western blot showing GLUT4 expression in both L6 myoblasts and myotubes...... 105 Figure 3.3: Enhanced tyrosine phosphorylation in L6 myotubes in response to 1μM insulin...... 106

Figure 3.4: PtdIns(3,4,5,)P3 increase in response to insulin in L6 myotubes over a 30 minute time course...... 109 Figure 3.5: 100nM insulin enhances Akt phosphorylation on both S473 and T308 residues in L6 myoblasts...... 110 Figure 3.6: Insulin enhances GLUT4 translocation to the plasma membrane ...... 113 Figure 3.7: L6 myotubes glucose uptake in response to 100nM and 1μM concentrationsof insulin...... 114 Figure 4.1: Insulin increases PtdIns5P in L6 myotubes...... 118 Figure 4.2: Overexpression of PIP4KIIα with increasing MOI ...... 120 Figure 4.3: Overexpression of PIP4KIIα abolishes the rise PtdIns5P levels in response to insulin stimulation ...... 122 Figure 4.4: Overexpression of PIP4KIIα impairs insulin-stimulated glucose uptake in response to insulin ...... 122 Figure 4.5: Time course of BODIPY™ PtdIns5P carrier-mediated delivery...... 124 Figure 4.6: PtdIns5P mass assay measurements of PtdIns5P Levels after incubation with 5 and 10µM PtdIns5P-carrier complex...... 124 Figure 4.7: Carrier-delivered exogenous PtdIns5P enhances glucose uptake in the absence of insulin in L6 myotubes...... 126 Figure 4.8: PtdIns5P promotes increased GLUT4 association with the plasma membrane...... 127

Figure 4.9: Carrier-mediated delivery of PtdIns3P does not affect glucose uptake ...... 128 Figure 4.10: Localisation of GFP-FENS-1-FYVE changes upon carrier-mediated delivery of exogenous PtdIns3P ...... 130 Figure 4.11: PtdIns5P enhancement of glucose uptake is wortmannin-sensitive. 131 Figure 4.12: Enhancement of glucose uptake by PtdIns5P delivery is sensitive to the protein tyrosine kinase inhibitor Tyrphostin-AG213...... 133 Figure 4.13: Akt phosphorylation on both S473 and T308 is enhanced by delivery of PtdIns5P...... 133 Figure 4.14: 5μM PtdIns5P induced versus 100nM insulin-induce Akt S473 phosphorylation...... 134 Figure 5.1: Optimisation of GST-3xATX-PHD expression and purification...... 143 Figure 5.2: Overview of 2xPHD-ING2 and PtdIns5P null-binding mutant 2xPHD- ING2 6A K/R and their expression and purification ...... 145 Figure 5.3: Assessment of the phosphoinositide binding properties of 2xPHD-ING2...... 147 Figure 5.4: The chemically inducible FKBP and FRB heterodimerisation system. . 149 Figure 5.5: Deletion of the N-terminal mitochondrial targeting motif of PTPMT1 excludes it from the mitochondria...... 150 Figure 5.6: Addition of rapamycin causes heterodimerisation of YFP-FKBP- Δ37PTPMT1 with membrane localised FRB-HA...... 151 Figure 5.7: Rapamycin does not affect the pervanadate-stimulated rise in PtdIns5P in HeLa(S3) cells...... 152 Figure 5.8: The YFP-FKBP-Δ37PTPMT1 and FRB-HA heterodimerisation system athe PtdIns5P rise in response to pervanadate...... 153 Figure 6.1: Current potential mechanisms of PtdIns5P production and removal. . 157 Figure 6.2: Existing mechanistic theories concerning PtdIns5P‟s action on insulin- stimulated events...... 161

List of Tables

Table 1.1: Phosphoinositide amounts, binding motifs and functions ...... 52 Table 2.1: Primer sequences used to amplify template regions of DNA and incorporate desired restriction sites ...... 91

List of Abbreviations

αMEM MEM alpha modification AEBSF 4-(2-aminoethyl)benzenesulfonyl fluoride aPKC Atypical protein kinase C Adaptor protein with PH and SH2 domains (intro) OR APS ammonium persulfate (methods) AS160 Akt substrate of 160kDa ATX Arabidopsis Homolog of Trithorax BSA Bovine serum albumin CHO Chinese Hamster Ovary CMT4B1 type 4B1 charcot-marie-tooth disease DM1 myotonic dystrophy type-1 DMEM Dulbecco‟s modified Eagle‟s medium DMSO Dimethylsulfoxide DOG deoxy-glucose DOK Downstream of kinase DTT Dithiothreitol ECL Enhanced Chemiluminescence FBS fetal bovine serum FKBP FK506-binding protein FRB rapamycin-binding domain of mTOR Fab 1 (yeast orthologue of PIKfyve), YOTB, Vac 1 (vesicle transport FYVE protein) GFP Green fluorescent protein GLUT4 Glucose transporter isoform 4 Grb10 growth-factor-receptor bound protein 10 GRP1 General receptor for phosphoinositides 1 GST Glutathione S-transferase GSV GLUT4 storage vesicle HA Hemagglutinin HBS HEPES buffered saline HRP Horse radish peroxidise IL Interleukin ING2 Inhibitor of growth protein 2 IP Immunoprecipitation IPTG Isopropyl β-D-1-thiogalactopyranoside IR Insulin receptor IRAP Insulin-responsive amino peptidase IRS Insulin receptor substrate JNK Jun N-terminal kinase LB Luria-Bertani MAPK Mitogen-activated protein kinase MTM Myotubularin MTMR Myotubularin related protein mTOR Mammalian target of rapamycin mTORC2 mTOR complex associated with RICTOR

NGS Normal Goat Serum NPM-ALK Nucleophosmin-Anaplastic Lymphoma Kinase N-WASP Neural Wiskott-Aldrich syndrome protein PAGE polyacrylamide gel electrophoresis PAS phoshpo (ser/thr) Akt substrate PBS phosphate buffered saline PCA perchloric acid PDGF Platelet-derived growth factor PDK-1 phosphoinositide-dependent kinase-1 PFA Paraformaldehyde PH Pleckstrin homology PHD Plant Homeodomain PHLPP PH domain leucine-rich protein phosphatase PI3-Kinase Phosphatidylinositol 3-kinase PIKfyve Phosphoinositide kinase for five position containing a five finger PIP Phosphatidylinositol phosphate PIP4KII Phosphatidylinositol phosphate 4-kinase II PIP5KII Phosphatidylinositol phosphate 5-kinase I PM Plasma membrane (method and results chapters) PP2A Protein phosphatase 2A PTB Phosphotyrosine binding PtdIns Phosphatidylinositol

PtdIns(3,4)P2 Phosphatidylinositol (3,4) bisphosphate

PtdIns(3,4,5)P3 Phosphatidylinositol (3,4,5) trisphosphate

PtdIns(3,5)P2 Phosphatidylinositol (3,5) bisphosphate

PtdIns(4,5)P2 Phosphatidylinositol (4,5) bisphosphate PtdIns3P Phosphatidylinositol 3-phosphate PtdIns4P Phosphatidylinositol 4-phosphate PtdIns5P Phosphatidylinositol 5-phosphate PtdSer Phosphatidylserine PTEN Phosphatase and tensin homology deleted on chromosome 10 PTK Protein tyrosine kinase PTP1B Protein tyrosine phosphatase 1B PVDF polyvinylidene difluoride S6K1 protein S6 kinase 1 SDS Sodium dodecyl sulphate SER Smooth endoplasmic reticulum ser/thr serine/threonine SGK1 Serum and glucose regulated kinase SH2 Src homology 2 SHIP1/2 Src homology 2-containing inositol 5-phosphatases ½ skeletal muscle and kidney enriched inositol polyphosphate SKIP phosphatase SOC suppressor of cytokine signalling TA Tibialis Anterior TBAS Tetrabutylammonium sulphate TBS tris buffered saline

TBS-T TBS-Tween20 TCR T-cell receptor TEAB Triethylbicarbonate TEMED N,N,N',N'-Tetramethylethylenediamine TLC Thin layer chromatography TLP Theoretical lower phase TUP Theoretical upper phase VAMP2 vesicle-associated membrane protein 2 XLMTM X-linked myotubular myopathy YFP Yellow fluorescent protein

Abstract

Phosphatidylinositol 5-phosphate (PtdIns5P) is the least well-characterised member of the phosphoinositide family of essential regulatory phospholipids. PtdIns5P levels are altered within cells in response to a number of stimuli and evidence is accumulating to suggest that it possesses important functions in cellular signalling. However, the physiological role of this lipid remains imperfectly understood.

Previous studies have shown that PtdIns5P is elevated in adipocytes in response to insulin, and microinjection of PtdIns5P into these cells promotes plasma membrane insertion of the insulin-regulated glucose transporter GLUT4 (Sbrissa et al., 2004). This finding suggests a potential role of PtdIns5P as a mediator in insulin-stimulated glucose uptake, a process essential for efficient glucose homeostasis.

As approximately 75% of postprandial glucose disposal is carried out by skeletal muscle, it is important to investigate the role of PtdIns5P in the response of this tissue to insulin. Therefore, this work has used differentiated myotubes of the rat muscle cell line, L6, to explore the effects of altered PtdIns5P levels on insulin- stimulated glucose uptake. This cell model had not been previously used in the laboratory so it first required characterisation.

Here insulin is shown to stimulate a transient increase of PtdIns5P in L6 myotubes, indicative of a signalling role in response to insulin. This project developed several tools to further investigate this potential role for PtdIns5P in the insulin response of myotubes. One such development was the successful overexpression of the PtdIns5P 4-kinase PIP4KIIα in these cells, which was able to abolish the insulin- stimulated PtdIns5P rise. This correlated with a loss of insulin-stimulated glucose uptake (upon PIP4KIIα expression). Interestingly, artificial elevation of PtdIns5P in L6 myotubes increases glucose uptake in the absence of stimulation. This phenomenon appears to result from the activation of PI3-kinase signalling, as it is abolished by the PI3-kinase inhibitor wortmannin, and involves activation of the PI3-kinase effector Akt. These results are consistent with the idea that insulin- stimulated PtdIns5P production contributes to the robust PI3-kinase/Akt activation necessary for insulin-stimulated glucose uptake in muscle.

Lay Abstract

Blood glucose levels need to be tightly regulated as loss of this regulation can cause diseases such as type 2 diabetes. The high levels of glucose seen in badly managed type 2 diabetes are damaging to the body‟s tissues and cause further (secondary) complications. Some examples of these are nerve and kidney damage and loss of sight. Type 2 diabetes is a major health problem in the UK today. It affects over 2 million people and its care costs the NHS around £1 million per hour to provide. This expense is largely due to the irreversible nature of diabetes; once it has developed, there is no real cure. Furthermore, most cases of diabetes are identified long after its development, by presentation of secondary complications. To reduce the burden of type 2 diabetes on both patients and healthcare organisations, better treatments and earlier diagnostic tools are required. To achieve this, more research into the finer detail of how the body‟s tissues regulate blood glucose is needed.

Insulin is a hormone released by the pancreas following a meal. Its principal role is to normalise blood sugar levels, which are elevated by the digestion of dietary starch and the release of the resulting glucose into the bloodstream. Muscle and fat tissues play a part in this by responding to insulin and taking up the excess glucose. Muscle is especially important in maintaining healthy blood glucose regulation; it accounts for the majority of glucose uptake in response to insulin. For this reason it has been chosen for further study in this project. Not everything is known about how muscle (and fat) achieves glucose uptake, so any work which may further this knowledge is important. Previously, a molecule commonly known as PI5P has been implicated in glucose uptake in fat tissue. Its levels rise in fat cells in response to insulin. The work here concerns the role of PI5P, in the process of glucose uptake by muscle in response to insulin. This project found a similar rise in PI5P in a muscle cell model and set about investigating this in more detail.

Declaration

No part of this thesis has been submitted in support of an application for any degree qualification of The University of Manchester or any other University or Institute of Learning.

i. The author of this thesis (including any appendices and/or schedules to this thesis) owns certain copyright or related rights in it (the “Copyright”) and s/he has given The University of Manchester certain rights to use such Copyright, including for administrative purposes.

ii. Copies of this thesis, either in full or in extracts and whether in hard or electronic copy, may be made only in accordance with the Copyright, Designs and Patents Act 1988 (as amended) and regulations issued under it or, where appropriate, in accordance with licensing agreements which the University has from time to time. This page must form part of any such copies made.

iii. The ownership of certain Copyright, patents, designs, trade marks and other intellectual property (the “Intellectual Property”) and any reproductions of copyright works in the thesis, for example graphs and tables (“Reproductions”), which may be described in this thesis, may not be owned by the author and may be owned by third parties. Such Intellectual Property and Reproductions cannot and must not be made available for use without the prior written permission of the owner(s) of the relevant Intellectual Property and/or Reproductions.

iv. Further information on the conditions under which disclosure, publication and commercialisation of this thesis, the Copyright and any Intellectual Property and/or Reproductions described in it may take place is available in the University IP Policy

(seehttp://www.campus.manchester.ac.uk/medialibrary/policies/intellect ual-property.pdf), in any relevant Thesis restriction declarations deposited in the University Library, The University Library‟s regulations (see http://www.manchester.ac.uk/library/aboutus/regulations) and in The University‟s policy on presentation of Theses.

Acknowledgements

I take this opportunity to extend my warmest thanks to my Supervisor, Dr. Katherine Hinchliffe, who has always provided much support and encouragement as well as academic help and feedback throughout the duration of this project. Gratitude is also due for her critical reading of this work.

I also extend thanks to my Advisor, Dr. Donald Ward, for providing additional support and academic discussions when needed.

To my fellow members of the Hinchliffe lab, past and present: Dr. Andrew Wilcox, Dr. Sanaa Al Ahdab, Mr. Christodoulos Tavelis and Mr. Alexander Ryan, thank you for your help and support (and jokes) both at the desk and at the bench. Special thanks to Dr. Sanaa Al Adhab, with whom I have shared most of my PhD experience. Thank you for your mutual support and friendship.

Special mention goes to Dr. Andrew Chadburn of the Tammaro lab and Elaine Grainger, of the Grainger household, for their proofreading of this work.

To my family and friends, who never quite worked out what it was I actually studied, thank you for smiling and nodding at the appropriate moments. Humour aside, you all have had your part to play in seeing me to the submission of this thesis. Thank you for being you, all of you.

Finally, I would like to thank my fellow young scientists of the 2nd Floor CTF, both past and present, for making the Ph.D. journey an unforgettable experience. It has been an honour and a pleasure to share the road with you. I wish everyone the greatest success for new and different roads taken, wherever they may lead.

Dedication

For Margaret

1 Introduction

The hormone insulin is produced and released by pancreatic β-cells in response to a postprandial rise in glucose in the bloodstream (Gembal et al., 1992;Stokoe et al.,

1997). This increases the concentration of circulating insulin which, in turn, stimulates glucose uptake in skeletal muscle and adipose tissues. This leads to the removal of glucose from the bloodstream and maintenance of normal glucose levels. Preservation of this homeostatic mechanism is important for mammalian health as chronically high levels of circulating glucose causes damage to a wide range of tissues (Stratton et al., 2000).

When the appropriate regulation of glucose levels by insulin is lost completely, the onset of diabetes occurs. There are two major forms of this disease: type 1 and type 2 diabetes. Type 1 diabetes is caused by the destruction of β-cells by the body‟s immune system and insulin production is lost or significantly reduced. Type

2 diabetes occurs when a state of insulin resistance – where the body fails to respond appropriately to normal concentrations of insulin – becomes irreversible. Of the 2.6 million people who have been diagnosed with diabetes in the United

Kingdom, 90 per cent suffer from the type 2 form. Their numbers are expected to double by the year 2025 (DiabetesUK, 2010). Type 2 diabetes is the fifth most common cause of death in this country, with its associated complications contributing further (Roglic et al., 2005). The National Health Service spends 10 per cent of its budget treating diabetes, equivalent to £1 million pounds per hour (NHS,

2007). The need for the development of early detection methods (most cases of type 2 diabetes are diagnosed after secondary associated complications develop

(Harris et al., 1992;King et al., 1999;Ijuin and Takenawa, 2003) and effective treatments is clear. However, for successful development of diagnosis and treatments for diabetes, the molecular mechanisms underlying both healthy and aberrant insulin responses in skeletal muscle and adipose tissues must be understood.

Since the mid-1950s it was known that insulin enhances the glucose uptake abilities of skeletal muscle and adipose tissues (Park and Johnson, 1955;Levine and

Goldstein, 1958). Yet, the first discovery regarding the uptake mechanism was not until the early 1980s (Cushman and Wardzala, 1980;Suzuki and Kono, 1980).

Since then, knowledge of how insulin triggers intracellular signals to activate the glucose uptake machinery in skeletal muscle and adipose tissues has expanded vastly, but this knowledge is far from complete. Over 60 protein and lipid intermediate molecules have been associated with the overall process (reviewed by(Taniguchi et al., 2006;Huang and Czech, 2007;Watson and Pessin, 2007;Pilch,

2008;Shisheva, 2008;Leney et al., 2009). Some have unequivocal roles such as glucose transporter isoform 4 (GLUT4). The majority of GLUT4 is found within intracellular compartments, (Dugani and Klip, 2005;Martin et al., 2006). Following insulin stimulation, a rise in plasma membrane GLUT4 is seen (Dobson et al.,

1996;Dawson et al., 2001;Ishiki et al., 2005;Stuart et al., 2009), where it executes its glucose transporter role.

A molecule that has recently been implicated in insulin signalling and the GLUT4 translocation process is the phospholipid, phosphatidylinositol 5-phosphate

(PtdIns5P), a member of the phosphoinositide family of lipid messengers.

PtdIns5P‟s putative role in GLUT4 translocation was first demonstrated in an adipocyte cell model where introduction of exogenous PtdIns5P brought about

GLUT4 translocation to the plasma membrane surface. Furthermore, PtdIns5P levels rise transiently in response to insulin stimulation (Sbrissa et al., 2004). These results imply PtdIns5P is involved in the insulin-stimulated events preceding, and necessary for GLUT4 translocation. However, it has not been specifically demonstrated whether PtdIns5P has an equivalent role in skeletal muscle. Skeletal muscle is responsible for the majority of glucose disposal in the body (Hed et al.,

1977;DeFronzo et al., 1981;Evans et al., 1984), therefore playing a major role in glucose homeostasis, it is important to look at PtdIns5P’s potential role in this

21 tissue type as well. The work presented here investigates the potential role of

PtdIns5P in the insulin signalling pathway and glucose uptake in skeletal muscle tissue.

1.1 GLUT4

Postprandial glucose uptake in skeletal muscle is primarily mediated by GLUT4.

GLUT4 is a transmembrane protein with a molecular weight of approximately 58.4 kDa consisting of twelve membrane-spanning domains. It is a member of the glucose transporter (GLUT) family, a family comprised of thirteen known members named GLUT1 to 12 and H+ -coupled myo-inositol transporter (Wood and Trayhurn,

2003). The GLUT family can be divided into three classes based upon their structural characteristics. Class 1 includes GLUTs 1-4 which are the best characterised members of the family.

GLUT proteins are unique in their tissue distribution and intracellular localisation

(Bryant et al., 2002). GLUT4 is preferentially expressed in muscle and adipose cells where it is responsible for the majority of insulin-stimulated glucose uptake (Kern et al., 1990;Robinson et al., 1993;Rudich et al., 2003). Skeletal muscle also expresses several other members of the GLUT family: GLUT1, GLUT5 and GLUT12

(Stuart et al., 2006). GLUT1 has also been implicated in insulin-stimulated glucose transport (Robinson et al., 1993) but its more probable role lies solely in basal glucose uptake (Foran et al., 1999). Indeed, patterns of both GLUT1 and 4 expression change with increasing levels of muscle differentiation, favouring GLUT4 expression in correlation with increasing insulin sensitivity (Mitsumoto et al., 1991).

Interestingly, however, GLUT4 null mice do not develop diabetes (Katz et al., 1995) suggesting some compensatory mechanism by other GLUT isoforms. Interestingly, a recent study has implicated GLUT12 in insulin-stimulated glucose uptake in human skeletal muscle, which shows a comparable rise in GLUT12 and GLUT4 at the plasma membrane in response to insulin (Stuart et al., 2009).

1.1.1 Specialised subcellular storage of GLUT4

GLUT4 is unique among the other GLUT family members in its dynamic cycling within the cell. Under basal conditions, the majority of GLUT4 (70-80%) is sequestered in intracellular membranes (Muretta et al., 2008); only a small fraction of total GLUT4 is present at the plasma membrane (Ishiki et al., 2005;Thong et al.,

2005;Muretta et al., 2008). The exact nature of these compartments remains to be understood completely. Electron microscopy and immunofluorescence studies have revealed the structural nature of these compartments and shed further light on the intracellular distribution of GLUT4 (Friedman et al., 1991;Slot et al., 1991;Smith et al., 1991;Bornemann et al., 1992). GLUT4 resides in a network of vesicular structures, starting with complex tubular-vesicular compartments at the perinuclear region of the cell through to smaller vesicles located in the cytosol and near the plasma membrane. Early studies showed isolated GLUT4-containing membranes to have a range of associated protein markers from a variety of distinct intracellular compartments including the transferrin receptor (Tanner and Lienhard, 1987) and insulin-responsive amino peptidase (IRAP) (Keller et al., 1995;Larance et al.,

2005). This was reinforced by GLUT4 colocalisation with known protein markers for a range of intracellular organelles; GLUT4 positive organelles include: the Golgi complex, the trans-Golgi network, lysosomes, late endosomes and recycling endosomes (Ralston and Ploug, 1996;Hah et al., 2002;Ishiki et al., 2005).

However, the principal pool of intracellular GLUT4 is found in a set of vesicles that show a similar morphology to recycling endosomes (Malide et al., 1997), yet a distinct molecular composition. They are biochemically identifiable by their lack of common endosomal markers such as the transferrin receptor (Wei et al., 1998) and their abundance in GLUT4, IRAP (Ueyama et al., 1999) α-tubulin (Guilherme et al.,

2000) low density lipoprotein (Jedrychowski et al., 2010) and the v-SNARE, vesicle- associated membrane protein 2 (VAMP2) (Martin et al., 1996a;Martin et al., 1998).

These vesicles, often termed GLUT4 storage vesicles (GSVs), represent the major insulin responsive element of the GLUT4 storage network.

1.1.2 Increasing GLUT4 at the plasma membrane

Adipocyte and skeletal muscle cells essentially achieve the same end-point result in response to insulin – enhanced GLUT4 levels at the plasma membrane, followed by an increase in glucose uptake; however, they each do so via two distinct mechanisms.

Studies in adipocytes demonstrate that insulin increases glucose uptake by causing a shift in the rates of exocytosis and endocytosis of GLUT4, favouring a large increase in GLUT4 exocytosis and a slight reduction in its endocytosis (Satoh et al.,

1993;)(Czech et al., 1993; Quon et al., 1994). Insulin also substantially increases the recycling pool of GLUT4 from non-recycling compartments (Govers et al.,

2004;Muretta et al., 2008) adding substantially to the total amount of GLUT4 available for transport to the plasma membrane. In contrast, skeletal muscle achieves an increase in plasma membrane GLUT4 by a different mechanism entirely

(Fazakerley et al., 2010;(Yang and Holman, 2005).

The basal rate of GLUT4 exocytosis is much higher in skeletal muscle than in adipose, (the GLUT4 exocytosis constant of adipocytes is ~0.01 min-1, whereas the exocvtosis constant for L6 myotubes is 0.06 min-1). For skeletal muscle to maintain low basal levels of glucose uptake and to offset its larger rate of GLUT4 flux to the plasma membrane, the basal rate of GLUT4 endocytosis is also much higher than adipocytes (0.43 min-1 versus 0.07 min-1 respectively;(Robinson et al.,

1992;Antonescu et al., 2008a). Given the high rate of GLUT4 exocytosis to the plasma membrane in the basal state, the interesting question is, how do L6 myotubes modulate plasma membrane levels of GLUT4 comparable to those seen in adipocytes in response to insulin stimulation?

Further observations in L6 myotubes show that two changes in GLUT4 trafficking events are brought about by insulin that facilitate GLUT4s 35-45% rise at the plasma membrane (Stockli et al., 2010;Fazerkeley et al,. 2010). First, an increase in the recycling pool of GLUT4 is seen (from 61% of total GLUT4 during basal conditions to 75% during stimulation – in adipocytes only 10-20% of GLUT4 is found in the recycling pool under basal conditions;(Govers et al., 2004;Muretta et al., 2008). Second, and most intriguingly considering past models that draw similarities with adipocytes, is that insulin stimulation reduces the endocytosis rate of GLUT4 by 50% (Fazerkerley et al., 2010).

Both insulin and exercise bring about the increased amount of GLUT4 at the plasma membrane in skeletal muscle (Lund et al., 1995;Yang and Holman, 2005;Muretta et al., 2008). However, they do so by different signalling pathways; whereas insulin stimulates this translocation via phosphoinositide 3-kinase (PI3-kinase) and

Akt/PKB, exercise acts through a different pathway involving AMP-activated protein kinase (AMPK). The 50% reduction in GLUT4 endocytosis is also observed following stimulation with AMPK agonists and interestingly, there is no additivity between these and insulin (Fazakerley et al., 2010). This suggests these two stimuli slow endocytosis via the same mechanism. This evidence clearly demonstrates the difference between the mechanisms employed by L6 myotubes and adipocytes to bring about a similar scale increase at the plasma membrane. However, the underlying molecular mechanism has yet to be identified in response to insulin or other stimuli. What is known about insulin action on skeletal muscle models (and adipocytes in relevant places) is discussed in the following sections (1.1.3-1.1.9.2).

1.1.3 The Insulin Receptor

The first critical component of the insulin signalling pathway is the IR. It is the

origin of the insulin signal at the plasma membrane, triggering a cascade of

signalling events on the cytosolic side of the membrane upon insulin binding to its

extracellular ligand binding site. These signalling cascades control a vast array of

cellular responses in different tissues of the body (see figure 1.1), to cover all of

these would be unnecessary here so only the glucose uptake pathway has been

concentrated on. The IR is a receptor-tyrosine kinase with intrinsic protein tyrosine

kinase (PTK) activity. It is closely related to the insulin-like growth factor-1 receptor

(IGF1R), and the two can be bound by the other‟s ligand (insulin or insulin-like

Figure 1.1: The pleiotropic effects of the insulin signal It is important to bear in mind that insulin stimulation of the IR causes activation or inhibition of several downstream processes needed for cell survival, not just GLUT4 translocation and does not elicit the same responses in all cell types. Insulin controls the regulation of gene expression (Goodison et al., 1992), transport of sodium ions via SGK signalling in epithelial (Wang et al., 2001) and renal cells (Blazer-Yost et al., 2003;Ijuin and Takenawa, 2003;Backer, 2008), protein synthesis (Proud, 2006), lipolysis (McTernan et al., 2002) and stimulation of glycogen and fatty acid synthesis (Moule et al., 1995). However, only GLUT4 translocation is relevant in terms of this introduction (highlighted in box).

26 growth factor – IGF), with reduced affinities (Bailyes et al., 1997;Frasca et al.,

1999).

1.1.3.1 IR structure and mechanism of activation

Structurally, the IR consists of α- and β-subunits linked together by disulphide bonds. Two β-subunits make up the transmembrane catalytic domain and two α- subunits make up the extracellular ligand binding domain; the holoenzyme exists in a β-α-α-β arrangement (Czech, 1982). Three structural regions within the intracellular part of the β-subunit have been defined. These are the juxtamembrane region, the kinase domain and the carboxy-terminal region. Upon binding of insulin to the ligand-binding domain on the α-subunits, the receptor undergoes a conformational change that results in its autophosphorylation on tyrosine residues located in the juxtamembrane region of the β-subunits (Frattali et al., 1992).

Phosphorylation of these residues results in the loss of the autoinhibitory mechanism of the catalytic loop of the IR, which then reveals the kinase active site in the kinase domain and allows access of ATP and substrate molecules (Hubbard,

1997).

1.1.3.2 IR splice variants

There are two splice variants of the IR (Moller et al., 1989). They differ by 12 amino acids located at the distal C-terminus of the α-subunit, resulting from alternative splicing of exon 11 (Seino et al., 1989). The two IR variants created by this alternative splicing are termed IR-A, which lacks the 12 amino acids, and IR-B.

The small difference in amino acid number between these two isoforms was found to confer quite unique properties; IR-A has a slightly higher ligand-binding affinity

(McClain, 1991) and a greater affinity for IGF than its counterpart (Frasca et al.,

1999), whereas IR-B has enhanced autophosphorylation and signalling activity

(Kellerer et al., 1992). Expression of the two isoforms is tissue specific (Mosthaf et al., 1990); IR-A is more predominantly expressed in the central nervous system

27 and in foetal and hematopoietic cells, whereas the IR-B is expressed in tissues involved in glucose homeostasis such as adipose, liver and muscle tissue (Mosthaf et al., 1990). Loss of muscle-specific IR expression patterns, where IR-A expression predominates over that of IR-B, is exhibited in the muscle tissues of patients with myotonic dystrophy type-1 (DM1) (Savkur et al., 2001). DM1 is characterised

(amongst other complications in multiple tissue types) by muscle hyperexcitability

(myotonia), muscle wasting and, notably, insulin resistance (Savkur et al., 2001).

Experiments with forearm skeletal muscle from DM1 patients indicate a 70% decrease in insulin-sensitivity (Moxley et al., 1978). This indicates the importance of the IR-B isoform in skeletal muscle and glucose homeostasis.

1.1.3.3 Regulation of the IR

There are several mechanisms of negative regulation of the IR. The best understood mechanism involves the protein tyrosine phosphatase PTP1B. PTP1B reduces the activity of the IR by dephosphorylating it on important tyrosine residues. Mouse knockouts of PTP1B show improved insulin sensitivity in vivo by enhanced insulin signalling (Elchebly et al., 1999). Other proteins, such as suppressor of cytokine signalling-1 and -3 (SOCs1 and 3) (Ueki et al., 2004), growth-factor-receptor bound protein 10 (Grb10) and plasma-cell membrane glycoprotein-1 downregulate the IR by binding to it and blocking its interaction with

IRS proteins (Taniguchi et al., 2006).

1.1.4 Insulin receptor substrates

The IRS family is comprised of four established isoforms, IRS-1 to -4, and two putative IRS proteins IRS5/Downstream of Kinase 4 (DOK4) and IRS6/DOK5 (see below). Of the four established members of this family, IRS-1 and -2 seem to be the main substrate proteins involved in glucose homeostasis. IRS-1 knockout mice display generalised stunted growth, insulin resistance and impaired glucose tolerance (Araki et al., 1994). IRS-2 null mice are also insulin resistant, however,

28 they only show growth defects in certain tissues, such as pancreatic β-cells

(Withers et al., 1998). In comparison, IRS-3 and -4 null mice only show mild defects in growth and metabolism (Liu et al., 1999;Fantin et al., 2000) and their roles in insulin action require more clarification.

Despite gaining more research attention than IRS-3 and -4, the roles of IRS-1 and -

2 in mediating the insulin signal remain incompletely understood. Both IRS-1 and -

2 can compensate for the loss of the other to maintain approximately 50% of normal glucose uptake and PI3-kinase activation in mouse models (Patti et al.,

1995). The two isoforms differ in their intracellular location and tissue distribution

(Patti et al., 1995;White, 2002), and there is some evidence to suggest that they take on distinct roles in times of fasting and feeding (Kubota et al., 2008). Analysis of IRS-1 knockout mice suggest that IRS-1 is the most important isoform for insulin-induced glucose uptake and metabolism in skeletal muscle and adipose tissue (Tamemoto et al., 1994;Terauchi et al., 1997;Kido et al., 2000).

1.1.4.1 Downstream of kinase (DOK) proteins

DOK proteins are closely related to the IRS family and have similar protein domains including N-terminal PH (Guittard et al., 2009) and PTB domains and a C-terminal

SH2 domain (Cai et al., 2003). Like IRS proteins, DOKs are recruited to cell-surface

PTK receptors, where they become tyrosine phosphorylated (Yang et al.,

1999;Dong et al., 2006). They exhibit different tissue expression patterns to IRS proteins and the two have distinct roles (Mashima et al., 2009), yet there does appear to be some potential overlap between the two. Indeed, two DOK isoforms,

DOK4 and DOK5, are also known as IRS5/DOK4 and IRS6/DOK5 and they are phosphorylated on tyrosine residues in cells expressing the insulin receptor upon insulin stimulation (Cai et al., 2003) IRS5/DOK4 expression is reported in the heart, skeletal muscle, lung, kidney and brain (Grimm et al., 2001;Crowder et al., 2004).

Northern blot analyses have shown the highest levels of IRS5/DOK4 mRNA are

29 found in kidney and liver and that IRS6/DOK5 mRNA is most abundant in muscle

(Cai et al., 2003). Human IRS5/DOK4 is potentially one of the most interesting

DOKs in terms of insulin action, as it is rapidly and heavily phosphorylated in response to insulin (Cai et al., 2003). In addition to this, when phosphorylated,

IRS5/DOK4 can bind to a set of SH2 proteins. IRS6/DOK5 is also tyrosine- phosphorylated in response to insulin, but unlike IRS5/DOK4 phosphorylation its phosphorylation is much slower and increases steadily over a 40 minute period (Cai et al., 2003).

1.1.4.2 Mechanism of IRS activation

The basic mechanism by which IRSs propagate the insulin signal begins with their binding to the insulin receptor upon exposure of its catalytic loop. This is facilitated by their N-terminal phosphotyrosine binding (PTB) domains which bind to phosphorylated tyrosine 960 in the juxtamembrane region of the IR (Russell et al.,

1987;Wilden et al., 1992). This interaction is further stabilised by the association of their pleckstrin homology (PH) domains with the plasma membrane via phosphoinositides (Voliovitch et al., 1995). They then become phosphorylated by the kinase activity of the IR on specific tyrosine residues, which serves to activate their availability for substrate binding. Active IRS-1/-2 then recruits PI3-kinase through interactions with the latter‟s SH2 domain. This association activates PI3- kinase. IRS proteins are dependent on the presence of the PH domain for successful achievement of this function. Expression of IRS-1 with a partial PH domain (IRS-

1ΔPH) in COS-7 cells was found to reduce IRS-1 insulin dependent tyrosine phosphorylation when compared to wild-type IRS-1. This was also accompanied by reduced association of IRS-1 ΔPH with the p85 subunit of PI3-kinase (see 1.1.5)

(Voliovitch et al., 1995).

1.1.4.3 Regulation of IRS proteins

Tyrosine phosphorylation is not the only means of controlling IRS activity; serine/threonine (ser/thr) phosphorylation of IRS proteins by ser/thr kinases serves as a physiological negative-feedback mechanism that inhibits any further tyrosine phosphorylation of IRS proteins and controls the duration of their activation.

Candidates that have been identified as IRS-ser/thr kinases are mostly downstream effectors of PI3-kinase and include atypical protein kinase Cs (PKCs) (Ravichandran et al., 2001), mammalian target of rapamycin (mTOR) (Carlson et al., 2004), protein S6 kinase 1 (S6K1) (Harrington et al., 2004;Tremblay et al., 2007), and Jun

N-terminal kinase (JNK), a member of the mitogen-activated protein kinase (MAPK) family (Aguirre et al., 2000).

Although serine phosphorylation mainly inhibits IRS protein function, there is evidence to suggest that it may also play a positive role in the regulation of IRS activity. Enhanced tyrosine dephosphorylation was observed in cells expressing an

IRS-1 mutant lacking four phosphorylation sites (S265, S302, S325 and S358), indicating that one or more of these were potential regulatory sites of positive IRS-

1 function (Paz et al., 1999). Later S302 was found to be a positive mediator of nutrient availability, promoting mitogenesis and cell growth (Giraud et al., 2004).

In a separate study, two other serine residues, S1223 and S629, were also found to regulate IRS-1 function in a positive manner. The phosphorylation of each site enhances IRS-1 association with the IR by two different mechanisms; S1223 is theorised to reduce the association of IRS-1 with SHP-2, a tyrosine phosphatase

(Luo et al., 2005), and S629 was proposed to attenuate phosphorylation of another serine site, S636, implicated in the negative regulation of the insulin signal (Luo et al., 2007)

1.1.5 Class IA PI3-kinase

Upon insulin-stimulated activation and assembly of the IR/IRS complex, PI3-kinase is recruited to it by association with IRS via the SH2 domain of its regulatory subunit (see Figure 1.2). This activates the kinase and places it in contact with its substrate, the phosphoinositide PtdIns(4,5)P2, at the plasma membrane. It then converts PtdIns(4,5)P2 to the phosphoinositide second messenger PtdIns(3,4,5)P3.

PtdIns(3,4,5)P3 then recruits Akt/Protein Kinase B (referred to here as Akt) to the plasma membrane where Akt becomes activated and the propagation of the insulin signal continues. This pathway (Figure 1.2) is known as the PI3-kinase dependent pathway as it mediates its effects on GLUT4 translocation via this kinase.

There are three classes of PI3-kinase, I, II and III, that phosphorylate a number of phosphoinositide substrates to 3-phosphorylated phosphoinositides (see Figure 1.6).

They all have active roles in a vast array of cell signalling events (Vanhaesebroeck et al., 2001), however, it is the class I set that is most important in terms of this work as this class of PI3-kinase has been shown to be necessary for GLUT4 translocation and glucose uptake. Two cell permeable and structurally different PI3- kinase inhibitors, LY294002 and wortmannin have been shown to inhibit both

GLUT4 translocation and glucose uptake in insulin-stimulated adipocytes (Cheatham et al., 1994), skeletal muscle (Lee et al., 1995) and CHO (Chinese Hamster Ovary) cells (Hara et al., 1994).

Class I PI3-kinases are further divided into A and B subsets, depending on their type of p110 catalytic subunit and the type of regulatory subunit these bind to ie. p85 in the case of class IA or non-p85 regulatory in the case of class IB

(Vanhaesebroeck et al., 2010). The class IB PI3-kinases are comprised of a p110γ catalytic subunit which can bind to either of the non-p85 regulatory subunits, p101 or p87. These subunits have no recognisable domain structures and no homology with p85 subunits. There are three p110 subunits that can make up class IA PI3-

Figure 1.2: Schematic representation of the PI3-kinase dependent insulin signalling pathway Insulin stimulation of the IR causes autophosphorylation of its transmembrane domain, this recruits a complex of signalling proteins involved in transduction of the insulin signal to GSVs. First IRS proteins are recruited to the IR via PTB domains, this enables the recruitment of PI3-kinase, which controls the rate limiting step of the early signal, phosphorylation of PtdIns(4,5)P2 (PIP2) to PtdIns(3,4,5)P3 (PIP3). PtdIns(3,4,5)P3 then recruits Akt to the plasma membrane where it comes into proximity with PDK-1 and the mTORC2 complex which serve to activate it via T308 and S473 phosphorylation respectively. Akt activates/inhibits further downstream effectors that are present in GSVs. For example, Akt phosphorylates AS160, blocking its inhibition of Rab proteins and facilitating AS160 dissociation from GSVs via interactions with 14-3-3 proteins. Regained Rab activity has been shown to be important for GSV translocation to the plasma membrane. PIKfyve is also phosphorylated by Akt, which is thought to activate its 5- kinase activity. It is uncertain as to whether PIKfyve is linked to positive or negative regulation of GLUT4 translocation as contradictory findings are presented in the literature (see section 1.2.5.2) kinases: p110α, p110β and p110δ. These subunits can bind five species of p85 subunit (p85α, p85β, p55α, p55γ and p50α), some of which have several splice variants. Potentially, any class IA p110 subunit could be bound by any p85 subunit, producing 15 possible catalytic-regulatory subunit combinations, even before considering splice variants (Geering et al., 2007). p85 subunits regulate the p110 subunit by repressing its kinase activity in the basal state and, under circumstances

33 of IR activation, recruiting it to phosphorylated tyrosine residues of the IRS proteins. It is the docking of p85 SH2 domains with these residues that relieves the p85-mediated inhibition of the p110 subunit‟s catalytic activity and brings it into contact with its phosphoinositide substrate PtdIns(4,5)P2. The p85 and p110 subunits mutually stabilise each other; it is thought the two subunits are unstable as monomers (Ueki et al., 2000;Foukas et al., 2006). Experiments using cells transiently overexpressing p85α showed that the half-life of p110-free p85α was at least three times less than p85α bound to p110 (Brachmann et al., 2005). It is reported that the heterodimer binds extremely tightly and can withstand high concentrations of salt, urea and detergent (Kazlauskas and Cooper, 1990;Fry et al.,

1992). Furthermore, the expression of p85 and p110 are interlinked. Indeed deletion of p85α leads to subsequent decrease in all class IA p110 isoforms (Garcia et al., 2006;Papakonstanti et al., 2008;Kurig et al., 2009). The converse is also observed, with loss of p110α leading to a reduction in the levels of p85β or p85α/p55α/p50α (Brachmann et al., 2005;Zhao et al., 2006). Even so, p85β knockout mice show unaltered levels of p110 despite a 20-30% loss of overall p85 levels (Ueki et al., 2002).

The exact roles of each PI3-kinase isoform, in both physiology and disease, remain largely unknown. p110δ is unlikely to play a role in insulin signalling due to its expression being mainly restricted to haematopoietic cells and the nervous system

(Eickholt et al., 2007). P110α is likely to play a more important role in the transduction of the insulin signal. A study conducted using p110α knock-in mice, heterozygously expressing a kinase-dead p110α (p110αD933A), showed a 50% reduction in overall class IA PI3-kinase activity in liver muscle and adipose tissue

(Foukas et al., 2006). Also, isoform-specific inhibitors reveal that p110α is the major isoform in insulin signalling in both CHO-IR cells and 3T3-L1 adpocytes

(Chaussade et al., 2007) Antibodies blocking p110β binding to the IR/IRS complex inhibit insulin-induced actin reorganisation, suggesting that this isoform is also

34 important for the relay of the insulin signal through class IA PI3-kinase

(Hooshmand-Rad et al., 2000); although this was demonstrated in porcine endothelial cells which may not be representative of either adipocytes or skeletal muscle cells.

The inhibitory element of the p85 subunit that negatively regulates p110 catalytic activity in the basal state has been briefly mentioned above. Under insulin stimulation, interaction of p85 is also crucial for mediating PI3-kinase binding to the

IR/IRS complex and the interaction of p110 subunits with their phosphoinositide substrates. Considering this, it would seem p85 is just as critical for the positive regulation of PI3-kinase activity as it is for its negative basal-state regulation. So it is interesting that mice engineered to have reduced expression of the p85α subunit show improved insulin-signalling, normal PI3-kinase activation, increased

PtdIns(3,4,5)P3 levels and increased Akt activity (Mauvais-Jarvis et al., 2002). This paradoxical result was initially explained by postulating that in normal circumstances a pool of p110-free p85 subunits exist i.e. „free‟ or monomeric p85 would compete with heterodimers for IRS docking sites in the wild-type, but in p85 knockouts, the ratio of p85:p110 is redressed and reduces competition for IRS binding. Indeed, an excess of ~30% more p85 than p110 has been observed in certain cell types (Kurosu et al., 1997;Jimenez et al., 2002). Furthermore, an excess of class I A p85s has been reported in nutritionally induced insulin resistance in humans (Adochio et al., 2009), in women with gestational diabetes (Kirwan et al., 2004) and in insulin-resistant individuals (Bandyopadhyay et al., 2005).

1.1.5.1 Regulation of Class IA PI3-kinase signalling by removal of its

product, PtdIns(3,4,5)P3

The PI3-kinase signal can be negatively regulated by removal of its phosphoinositide product, PtdIns(3,4,5)P3. Phosphatase and tensin homology deleted on chromosome 10 (PTEN), Src homology 2-containing inositol 5-

35 phosphatases 1 and 2 (SHIP1 and SHIP2) and skeletal muscle and kidney enriched inositol polyphosphate phosphatase (SKIP), are phosphoinositide phosphatases that dephosphorylate PtdIns(3,4,5)P3. PTEN is an enzyme with dual activity; it is able to dephosphorylate both proteins and lipids (Vinciguerra and Foti, 2006), however, it shows greatest specificity for PtdIns(3,4,5)P3. It removes the phosphate group at the D3 position of the phosphoinositide inositol ring, leaving PtdIns(4,5)P2 (see figure 1.3). It is also able to dephosphorylate phosphatidylinositol 3,4-bisphosphate

(PtdIns(3,4)P2) to phosphatidylinositol 4-phosphate (PtdIns4P) (Taylor et al.,

2000b). Alternatively, SHIP2 only shows specificity towards PtdIns(3,4,5)P3 (Taylor et al., 2000b). Both SHIP2 and SKIP are PtdIns(3,4,5)P3 5-phosphatases, dephosphorylating it at the D5 position of the inositol ring, leaving PtdIns(3,4)P2

(Taylor et al., 2000b;Ijuin and Takenawa, 2003). SHIP2, SKIP and PTEN have the ability to negatively regulate or even terminate insulin stimulated GLUT4 translocation by metabolising PtdIns(3,4,5)P3 (Taylor et al., 2000b;Ijuin and

Takenawa, 2003;Vinciguerra and Foti, 2006). Indeed, studies have shown that

Figure 1.3: PtdIns(3,4,5)P3 Phosphatases. SHIP2 and SKIP are 5- phosphatases that

dephosphorylate PtdIns(3,4,5)P3

to PtdIns(3,4)P2 by removal of the D5 phosphate group (Backers et al., 2003). PTEN is a

PtdIns(3,4,5)P3 3-phosphatase, removing this phosphoinositide by cleavage of its D3 phosphate group (Stokoe et al., 1997). PTEN is also able to remove the D3 phosphate

of PtdIns(3,4)P2, forming PtdIns4P (Stephens et al., 1998)

36 overexpression of PTEN inhibits insulin-induced PtdIns(3,4,5)P3 production, Akt activation, GLUT4 translocation to the plasma membrane and glucose uptake

(Nakashima et al., 2000;Ono et al., 2001). Similar results were found in a number of cell lines with regards to manipulation of SHIP2 levels (Vinciguerra and Foti,

2006) and in insulin-stimulated CHO cells overexpressing SKIP (Ijuin and

Takenawa, 2003). SKIP overexpression caused marked inhibition of GLUT4 translocation and membrane ruffle formation. In addition, SKIP knockout mice show increased insulin sensitivity and resistance to diet induced obesity (Ijuin et al.,

2008). Though SHIP1 has a major role in mediating inhibitory signalling in mast cells and B-cells, it is not expressed in insulin-responsive tissues, unlike SHIP2

(Backers et al., 2003), so lacks relevance in the subject of insulin signal regulation.

1.1.6 Akt

The Akt serine/threonine protein kinases are critical regulators of human physiology that act downstream of PI3-kinase (Farese et al., 2005b;Gonzalez et al., 2009).

Akt activation has been shown to be necessary for glucose uptake as studies using a kinase-inactive mutant (where activation sites were also mutated(Wang et al.,

1999) demonstrated inhibition of glucose uptake (Cong et al., 1997). In addition to this, mutants of Akt engineered to be constitutively active by addition of myristoylation sequences (Kohn et al., 1996), are able to mimic insulin‟s effect on glucose uptake and glucose transport in muscle and adipocytes (Kohn et al., 1996).

Furthermore, adipocytes isolated from type 2 diabetic individuals and diabetic rat models show reduced Akt activation in line with poor glucose uptake (Carvalho et al., 2000a;Carvalho et al., 2000b).

The Akt family is comprised of three highly homologous isoforms: Akt1, Akt2 and

Akt3, each possessing a PH domain, kinase domain and regulatory domain. Akt isoform-specific knockout mice have shed light on the individual roles of the three

Akt family members in an attempt to define which cellular functions are controlled by which isoform (Chen et al., 2001;Cho et al., 2001a;Cho et al., 2001b;Garofalo

37 et al., 2003;Tschopp et al., 2005). Akt2 seems to be the most important for glucose metabolism as Akt2 knockout mice develop a type 2 diabetes-like phenotype; fasting hyperglycaemia, hyperinsulinemia, glucose intolerance and impaired glucose uptake by fat and muscle cells (Cho et al., 2001a;Garofalo et al.,

2003). Furthermore, the overexpression of Akt1 in Akt2-deficient brown fat adipocytes does not rescue this deficit in glucose uptake (Bae et al., 2003) nor does it restore GLUT4 translocation to the plasma membrane in adipocytes where Akt2 expression has been knocked down using siRNA (Gonzalez and McGraw, 2009).

Recently it has been shown that selective recruitment of Akt2 to the plasma membrane by a chemically inducible heterodimerisation system (see section 5.3 for the use of a similar system here) is sufficient to induce GLUT4 translocation in 3T3-

L1 adipocytes (Ng et al., 2008). Consistent with a requirement for Akt2 in the control of insulin signalling, a mutation in the catalytic domain of Akt2 causes severe insulin resistance and diabetes in humans (George et al., 2004). In addition to this, in vitro siRNA studies show that downregulation of Akt2 expression inhibits insulin-induced GLUT4 translocation in 3T3-L1 adipocytes (Jiang et al.,

2003;Katome et al., 2003;Gonzalez and McGraw, 2009). This suggests that impaired glucose transport in Akt-null adipocytes is due to attenuation of GLUT4 translocation.

1.1.6.1 Isoform specific Akt regulation

As Akt1 cannot rescue the impairment in insulin-stimulated glucose uptake in adipocytes caused by Akt2 deficiency (as discussed above) it is clear the two have distinct functions in glucose transport. Yet both are ubiquitously expressed in muscle and adipose tissues and both are activated by insulin (Kim et al.,

2000;Gonzalez and McGraw, 2009). Therefore, the distinct functional roles of Akt cannot be achieved via selective expression of Akt isoforms or by differential activation by insulin; this must mean the difference in isoform-specific regulation of glucose uptake is independent of kinase activation. This could perhaps be achieved

38 by different subcellular localisations of Akt isoforms, determining a different set of substrates for each. Indeed, biochemical fractionation of adipocytes has shown that

Akt2, and not Akt1, is associated with GLUT4 vesicles (Calera et al., 1998;Hill et al., 1999). Studies in intact cells using fluorescence markers and total internal reflection fluorescence microscopy show that insulin induces a preferential accumulation of Akt2, over Akt1, at the plasma membrane of adipocytes (Gonzalez and McGraw, 2009). Further investigation showed that this selectivity is not due to activity of the kinase domain (Gonzalez and McGraw, 2009). These results would suggest that the accumulation of Akt2 at the plasma membrane contributes to isoform-specific regulation of the insulin-stimulated translocation of GLUT4. In support of the Akt accumulation theory, an Akt1 mutant with enhanced plasma membrane association (Akt1E17K) was able to induce sufficient GLUT4 translocation giving Akt1, Akt2-like signalling properties (Gonzalez and McGraw, 2009).

1.1.6.2 Akt activation

Upon production of PtdIns(3,4,5)P3 by active PI3-kinase, Akt is recruited to the plasma membrane (an interaction facilitated by its PH domain) where it is phosphorylated by 3-phosphoinositide-dependent kinase-1 (PDK-1) (Alessi et al.,

1997;Stokoe et al., 1997) and mTOR complex associated with RICTOR (mTORC2)

(Sarbassov et al., 2005) on T308 and S473, respectively. mTORC2 could also potentially phosphorylate T308 as RICTOR knockdown studies show reduced T308 phosphorylation. Further studies of Akt phosphorylation in knockout mice show that

T308 phosphorylation by PDK-1 is not dependent on prior S473 phosphorylation

(Frias et al., 2006;Guertin et al., 2006;Jacinto et al., 2006). PDK-1 is recruited to the plasma membrane through interaction of its C-terminal PH domain with

PtdIns(3,4,5)P3, bringing it into contact with Akt. It is thought that the PH domain of Akt serves as an autoinhibitory domain and blocks PDK-1 access by steric hindrance. Upon Akt binding to PtdIns(3,4,5)P3 a conformational change is induced that allows PDK-1 access to the activation loop of Akt, where it is able to

39 phosphorylate T308 (Alessi et al., 1997;Stephens et al., 1998;Currie et al., 1999).

It is also worth noting that PtdIns(3,4)P2 is also able to support Akt activation as the PH domains of both PDK-1 and Akt both bind to it (Franke et al.,

1997;Stephens et al., 1998). Studies on PDK-1 suggest that it is constitutively active (Casamayor et al., 1999). Indeed, though PDK-1 possesses a conserved activation loop, regulation of this motif is mediated by autophosphorylation, specifically on S241 (Casamayor et al., 1999).

1.1.6.3 Akt inhibition

The PI3-kinase/Akt pathway can be potentially regulated by several phosphatases via the removal of PtdIns(3,4,5)P3, therefore diminishing Akt association with the plasma membrane (see section 1.1.5.1). However, Akt can be directly regulated by its own specific phosphatases as reported by Ugi et al. and Gao et al. (Ugi et al.,

2004;Gao et al., 2005). These two groups identify two phosphatases, protein phosphatase 2A (PP2A) and PH domain leucine-rich protein phosphatase (PHLPP) as negative phosphatase regulators of Akt, respectively. PP2A has been shown to dephosphorylate Akt at both S473 and T308 sites (Ugi et al., 2004) whereas PHLPP only contributes to S473 dephosphorylation (Gao et al., 2005).

PP2A is interesting here, as it has been demonstrated to have an inhibitory effect on glucose transport; upon introduction of a PP2A-inhibitory antibody, glucose uptake in 3T3-L1 adipocytes is enhanced (Ugi et al., 2004). This was also demonstrated by adenoviral expression of small-t-antigen (which reduces PP2A activity by 60%) in 3T3-L1 adipocytes and the resulting enhancement of glucose uptake could then be inhibited by introduction of a dominant negative Akt or Akt small interfering RNA (siRNA). This return to normal glucose uptake levels was not seen with the dominant negative expression of another PDK-1 substrate, PKCλ (Ugi et al., 2004). A recent publication by the Payrastre/Tronchère group implicates a

40 role for PtdIns5P in preservation of both S473 and T308 phosphorylation, (see section 1.2.4.3 and(Ramel et al., 2009).

1.1.7 Signalling downstream of Akt

1.1.7.1 AS160

Akt substrate of 160kDa (AS160; also known as TBC1D4) was first identified in

3T3-L1 adipocytes using a PAS (phospho-Akt substrate motif) antibody that recognised the Akt phosphorylation motif RXRXXpS/T (Kane et al., 2002). AS160 possesses seven potential Akt-mediated phosphorylation sites – six of which are phosphorylated in vivo – two PTB domains and a GAP domain selective for Rab small GTP-binding proteins (Kane et al., 2002). Rab proteins are a family of

GTPases involved in vesicle cycling (Hoekstra et al., 2004;Miinea et al., 2005).

AS160 is activated downstream of Akt in both skeletal muscle and adipose tissue in response to physiological insulin concentrations (Bruss et al., 2005). The increase in AS160 phosphorylation is rapid and follows kinetics consistent with response to insulin stimulation (Bruss et al., 2005) and swift reversal upon removal of insulin

(Sharma et al., 2010). Studies using expression of an AS160 mutant in mouse TA muscle cells where 4 phosphorylation sites are lost (AS1604P) demonstrate a reduction in GLUT4 translocation of approximately 75% compared to that of cells expressing wildtype AS160 alone (Sano et al., 2003).

Under basal conditions, the Rab GTPase-activating domain of unphosphorylated

AS160 catalyses the hydrolysis of Rab-bound GTP via its GAP domain, which serves to inhibit the exocytosis of GSVs. Phosphorylation of AS160 at multiple sites by Akt serves to inhibit its activity towards Rab proteins (Miinea et al., 2005), namely Rabs

8A and 14 in muscle cells (Ishikura et al., 2007) and Rab10 in adipocytes (Sano et al., 2007;Sano et al., 2008). AS160 GAP activity inhibition results in accumulation of GTP-bound Rab. These conditions favour GLUT4 movement to the plasma

41 membrane of adipocytes and muscle cells (Chen et al., 1993;Junutula et al., 2004).

Mutation of R973 within the RabGAP domain of AS160 renders the domain inactive and relieves its inhibitory effect on Rab. siRNA studies demonstrate that low levels of AS160 in adipocytes are followed by increased GLUT4 levels at the plasma membrane in the absence of insulin (Eguez et al., 2005;Larance et al., 2005).

These observations, along with the AS1604P data, suggest that wild-type AS160 functions as a negative regulator of GLUT4 trafficking under non-stimulated conditions. In support of Akt2 playing the major role in insulin signalling, this Akt isoform has been shown to play a central role in regulating AS160 and its effects of

GLUT4 translocation (Ng et al., 2008).

There is evidence that indicates AS160 is associated with GSVs under basal conditions (Larance et al. 2005; Miinea et al. 2005) and that this is mediated by an interaction with the N-terminus of IRAP (Peck et al., 2006). A 14-3-3 protein may also bind to phosphorylated AS160 at specific motifs promoting its release from

GSVs upon insulin stimulation (Ramm et al., 2006;Howlett et al., 2008). AS160 release from GSVs, in addition to GAP domain inhibition, has been demonstrated to be necessary for GLUT4 translocation and glucose uptake. The PI3-kinase inhibitors, wortmannin and LY294002, have been shown to inhibit both AS160 inhibition and its release from GSVs in insulin-stimulated adipocytes, skeletal muscle and CHO cells (Bruss et al., 2005;Funai and Cartee, 2009). However, contradictory evidence exists that shows phosphorylation of AS160 but not its dissociation from membranes is essential for insulin stimulated glucose translocation (Stockli et al., 2008). In support of this, the mutation of two AS160 phosphorylation sites, S588 and T642 to either alanine or aspartic acid (mimicking dephosphorylation and phosphorylation respectively), had not effect of the interaction between AS160 and IRAP (Peck et al., 2006).

1.1.7.2 TBC1D1

Recently TBC1D1 has been gaining much research interest in the field of glucose uptake research. It possesses 47% identity at the amino acid sequence level to

AS160 and both have several comparable structural features, such as two PTB domains, 14-3-3 binding domains (Geraghty et al., 2007;Jiang et al., 2008) and C- terminal RabGAP domains. The latter domain shares 79% amino acid sequence identity in both AS160 and TBC1D1 and shows similar Rab specificities in vitro

(Roach et al., 2007). Both TBC1D1 and AS160 are detected at around 150-160kDa upon SDS-PAGE and both can be detected using PAS antibody. At least one of

AS160s Akt phosphorylation sites is conserved in TBC1D1 and this becomes phosphorylated upon insulin stimulation (Roach et al., 2007;(Taylor et al., 2008;

Sano et al., 2003). Research into TBC1D1 functions shows that not only is it phosphorylated at a PAS site by insulin, but in response to AICAR –an AMPK activator – and contraction as well. TBC1D1 immunoprecipitated from insulin,

AICAR and contraction stimulated tibialis anterior (TA) muscle shows significantly increased PAS phosphorylation. The same study consequently found that Akt and

AMPK are TBC1D1 kinases (Taylor et al., 2008). Interestingly, TBC1D1 phosphorylation by AICAR or contraction stimulation or in vitro recombinant AMPK, caused a distinct upward shift in PAS-TBC1D1 electrophoretic mobility compared with insulin/Akt phosphorylated TBC1D1. Together these findings suggest that

TBC1D1 is differentially regulated by insulin and contraction stimulation and this protein is a potential point of convergence of both pathways to GLUT4 translocation.

Another interesting feature of TBC1D1 is its tissue expression pattern; it is expressed at levels several fold higher in skeletal muscle than white fat and cardiac tissues. Its expression seems to predominate over AS160 in muscle, especially fast- twitch muscle tissue (Taylor et al., 2008). TBC1D1 expression differs within the muscle tissue population, for instance its levels are highest in TA muscle (more that

10-fold higher than soleus muscle) followed by extensor digitorum longus (EDL) and soleus muscle. (Its levels in soleus muscle are still significantly higher than in white adipose and cardiac tissues – Taylor et al., 2008).

Mutations in TBC1D1 demonstrate its importance in metabolism. The SJL mouse strain possesses a mutation in TBC1D1 that causes premature termination of protein translation and a 70% reduction of the protein at the mRNA level (Chadt et al., 2008). This strain of mouse is resistant to high-fat diet-induced obesity (Chadt et al., 2008) and displays increased fatty acid oxidation (Chadt et al., 2008).

Paradoxical to the increase in basal glucose uptake seen after the ablation of

AS160, basal glucose uptake in extensor digitorum longus muscle isolated from SJL mice is unchanged and insulin-stimulated glucose uptake is reduced compared with a congenic control strain (Chadt et al., 2008) However the interpretation of the phenotype of this strain may be complicated by the expression of truncated

TBC1D1 which may act as a dominant-negative inhibitor (Leney and Tavaré, 2009).

In humans, American and French population studies report that a W125R coding variant of TBC1D1 (within its N-terminal PTB domain) is linked to an increased susceptibility to severe obesity in Caucasian females (Stone et al., 2006;Meyre et al., 2008). Interestingly, this mutation is not associated with milder forms of obesity in the general population. The molecular basis for the relationship between the W125R TBC1D1 genotype and the severe obesity phenotype is not known.

1.1.7.3 PIKfyve

Phosphoinositide kinase for five position containing a five finger (PIKfyve) is an evolutionarily conserved, low-abundance enzyme in mammalian cells. It is a large protein of approximately 230kDa that contains a fyve domain, which is commonly found in proteins involved in endocytotic trafficking (Cooke, 2002) and has also been shown to bind to PtdIns3P (Gaullier et al., 1998;Patki et al., 1998). PIKfyve, as well as possessing some protein kinase activity, is a PtdIns3P 5-kinase. It

44 produces the phosphoinositides PtdIns(3,5)P2 and PtdIns5P in vivo and in vitro from

PtdIns3P and phosphatidylinositol (PtdIns), respectively, via phosphorylation at the

D5 position of the inositol head group (Sbrissa et al., 1999). It has been implicated in several processes, including endosome retrograde trafficking (Rutherford et al.,

2006), the translocation of several transporters and ion channels to the plasma membrane via its interaction with serum and glucose regulated kinase 1 (SGK1)

(Seebohm et al., 2007;Shojaiefard et al., 2007;Strutz-Seebohm et al., 2007;Klaus et al., 2009), epidermal growth factor receptor endocytosis (Kim et al., 2007), exocytosis (Osborne et al., 2008) and the insulin-stimulated translocation of GLUT4 to the plasma membrane (Ikonomov et al., 2007;Ikonomov et al., 2009c).

PIKfyve can relocate to the plasma membrane upon insulin stimulation (Shisheva et al. 2001), here it can associate with class IA PI3-kinase (Shisheva et al. 2001).

Insulin promotes the phosphorylation of PIKfyve on a S318 residue and this is mediated by Akt (Berwick et al., 2004). Incubation with recombinant active Akt and

[γ32P]ATP leads to increased PIKfyve S318 phosphorylation and this stimulates its

PtdIns3P 5-kinase activity (Berwick et al., 2004). Akt is also able to phosphorylate

PIKfyve at another site based on the observation that a PIKfyveS318A mutant (see below) is still phosphorylated upon Akt and [γ32P]ATP incubation (Seebohm et al.,

2007). This site was later identified as S105, although the phosphorylation of this site seems to be unaffected by insulin (Hill et al., 2010).

The phosphorylation and activation of PIKfyve on S318 appears to have an inhibitory effect on GLUT4 translocation. Upon S318 substitution with alanine

(PIKfyveS318A), insulin-stimulated GSV translocation to the plasma membrane was enhanced rather than attenuated or abolished (Berwick et al., 2004). This observation is consistent with other studies that show enhanced secretory granule exocytosis in chromaffin and PC12 cells (cell types of or derived from the adrenal gland respectively) after pharmacologic inhibition using an ATP-competitive

45 inhibitor selective for PIKfyve, (YM201636 –(Jefferies et al., 2008) and siRNA- mediated knockdown of PIKfyve (Osborne et al., 2008).

However, there is some controversy as to whether PIKfyve‟s involvement in insulin- stimulated GLUT4 translocation is wholly negative. It has been reported that expression of a dominant negative PIKfyve mutant (PIKfyveK1831E) markedly inhibits

GLUT4 movement to the adipocyte cell surface (Ikonomov et al., 2002).

Furthermore, the loss of PIKfyve and a protein involved in its activation, ArPIKfyve, by siRNA knockdown, leads to reduced PtdIns(3,5)P2 levels and a comparable reduction in insulin-stimulated glucose uptake (Ikonomov et al., 2007).

1.1.8 Atypical Protein Kinase C

The aPKCs -δ, and -λ are relevant here as they act downstream of PI3-kinase activation (Liu et al., 2006) and are activated by phosphorylation by PDK-1 (Chou et al., 1998;Le Good et al., 1998), a protein they also negatively regulate

(Ravichandran et al., 2001). Conversely they have been shown to play a positive role in insulin-stimulated glucose uptake and GLUT4 translocation in both adipocytes and muscle (Farese, 2002;Farese et al., 2005a). Activation of aPKCs is decreased in the skeletal muscle of both type-2 diabetic patients and rodent models

(Standaert et al., 2002;Farese et al., 2005a). Futhermore, aPKCs promote insulin- induced glucose transport, in many insulin-sensitive cells, such as L6 myotubes and adipocytes and a cell-permeable myristoylated aPKC pseudosubstrate inhibits insulin-stimulated glucose transport (Bandyopadhyay et al., 2000;Farese, 2002).

Interestingly, there is evidence to suggest that aPKCs form a point of convergence for both the PI3-kinase dependent and independent insulin signalling pathways

(Kanzaki et al., 2004); aPKCs interact with PDK-1 of the PI3-kinase dependent pathway (Chou et al., 1998;Le Good et al., 1998) in addition to TC10 protein complexes involved in the PI3-kinase independent pathway.

1.1.9 PI3-kinase independent insulin signalling: the TC10 pathway

PI3-kinase and Akt are necessary for GLUT4 translocation (as discussed above) but it has been demonstrated that their activation alone is not sufficient for this process. Studies expressing constitutively active mutants of PI3-kinase can only partially stimulate the translocation of GLUT4 (Martin et al., 1996b) and introduction of cell-permeable derivatives of PtdIns(3,4,5)P3 cannot reproduce the effects of insulin alone (Jiang et al., 1998). Furthermore, PI3-kinase activation is stimulated by several other agonists apart from insulin. Platelet-derived growth factor (PDGF) and interleukin 4 (IL-4) were used to stimulate 3T3-L1 adipocytes and L6 myoblasts, respectively, to see if they could elicit GLUT4 movement (Isakoff et al., 1995). PGDF was able to stimulate its receptor and bring about the activation of PI3-kinase without GLUT4 translocation to the plasma membrane. L6 myotubes overexpressing GLUT4 and IL-4 receptor showed increased phosphorylation of IRS1 and its association with PI3-kinase in response to receptor stimulation, yet PI3- kinase activation was unable to stimulate GLUT4 translocation or glucose uptake

(Isakoff et al., 1995). In addition to PI3-kinase investigations, studies using expression of a kinase-dead Akt, where both S473 and T308 sites have been replaced by alanines (Akt-AA), in 3T3-L1 adipocytes report that, although Akt was inhibited by some 85-90 per cent, glucose uptake is unaffected (Kitamura et al.,

1998). From these and similar results it was concluded that there must be at least one other signalling pathway acting on GLUT4 translocation downstream of insulin and independently of PI3-kinase (Figure.1.4).

Figure.1.4 The TC10 pathway Insulin is able to regulate GSV redistribution to the plasma membrane via an alternative signalling pathway in adipocytes (Chang et al., 2007) and skeletal muscle cells (Patel et al., 2006). This pathway recruits a unique set of proteins to the IR that include APS, Cbl (Liu et al., 2002) and CAP (Chiang et al., 2001), the guanine nucleotide exchange factor C3G (Chiang et al., 2002) and TC10 (Chang et al., 2007). TC10 has also been shown to interact with the phosphoinositide PtdIns3P (Maffucci et al., 2003;Ikonomov et al., 2009a). Activation of the TC10 pathway leads to rearrangements of the actin cytoskeleton (Patel et al., 2006)

Due to its non-reliance on PI3-kinase and involvement of TC10, small GTP-binding proteins expressed in adipose and skeletal muscle (Saltiel and Pessin, 2003), this pathway is either known as the PI3-kinase independent or TC10 pathway

(Figure.1.4), respectively. To summarise this pathway briefly, the IRs, specifically segregated to caveolae, phosphorylate Cbl, a process mediated through the adapter protein APS (Liu et al., 2002). Cbl then recruits CAP to this complex (Chiang et al.,

2001), which also interacts with the lipid raft domain protein flotillin. Cbl also recruits the protein Crk which is constitutively associated with C3G, a guanine nucleotide exchange factor that activates TC10 (Chiang et al., 2001;Chiang et al.,

2002;Saltiel and Pessin;Fecchi et al., 2006). Disruption of any of these interactions leads to GLUT4 translocation being severely reduced or lost completely (Chiang et

48 al., 2001;Liu et al., 2002;Fecchi et al., 2006). Activation of TC10 is specifically achieved by insulin and disruption of its activation interferes with GLUT4 translocation (Chiang et al., 2001;Chang et al., 2007). It is thought that TC10 promotes GLUT4 translocation to the plasma membrane through interactions with the actin cytoskeleton (Saltiel and Pessin, 2003;Patel et al., 2006) which is established as an important component of GLUT4 translocation. It was found that

TC10 could depolymerise cortical filamentous actin (F-actin) beneath the plasma membrane and greatly increase the polymerisation of F-actin in the perinuclear region, a function of TC10 found to be dependent upon neural Wiskott-Aldrich syndrome protein (N-WASP), a regulatory protein of actin (Jiang et al., 2002).

1.1.9.1 The TC10 pathway and PtdIns3P

Interestingly, the levels of the phosphoinositide PtdIns3P have been shown to increase in response to insulin in a TC10 dependent and in a wortmannin-sensitive manner in both L6 myoblasts and 3T3-L1 adipocytes. This increase in PtdIns3P is specifically localised to lipid raft subdomains of the plasma membrane (Maffucci et al., 2003). Furthermore, exogenous delivery of PtdIns3P was able to induce the translocation of both endogenous and overexpressed GLUT4 to the plasma membrane independently of insulin.

PtdIns3P can be produced by both class II and class III PI3-kinases. It is thought the sole class III PI3-kinase, hVps34, is responsible for production of PtdIns3P in endosomes, playing a role in intracellular trafficking; it has also been implicated in nutrient sensing through the mTOR and S6K1 pathway (Backer, 2008). The monomeric class II PI3-kinases are made up of three members: PI3K-C2α, PI3K-

C2β and PI3K-C2γ. Generally, members of the class II PI3-kinases vary in their sensitivity towards the pan-PI3-kinase inhibitors wortmannin and LY294002; for instance, the α-isoform is highly resistant to both wortmannin and LY294002

(Domin et al., 1997;Brown et al., 1999) and the β-isoform exhibits resistance to

LY294002 though not wortmannin (Arcaro et al., 1998). Class II PI3-kinases are able to catalyze the phosphorylation of both PtdIns and phosphatidylinositol 4- phosphate (PtdIns4P) in vitro; they do not appear to show any specificity towards

PtdIns(4,5)P2 (MacDougall et al., 1995) . Although there is evidence to suggest that type C2α might phosphorylate PtdIns(4,5)P2 (Domin et al., 1997).

Recently, it has been shown that the sole in vivo product of PI3K-C2α is PtdIns3P

(Falasca et al., 2007). The same study also found that activation and interaction of

PI3K-C2α at the plasma membrane was mediated by TC10 (Falasca et al., 2007).

They went on to generate L6 myoblasts with stably knocked down PI3K-C2α, and these showed complete inhibition of insulin-induced PtdIns3P synthesis. Under these conditions, insulin-stimulated GLUT4 translocation to the plasma membrane was impaired and insulin-stimulated glucose uptake was partially inhibited (Falasca et al., 2007). The authors commented that the latter observation was interesting as glucose uptake was not fully reduced even with the full inhibition of insulin- stimulated PtdIns3P production.

1.1.9.2 Debated importance of the TC10 pathway

The importance of the TC10 pathway in insulin-stimulated glucose uptake remains controversial. Several studies using siRNA-mediated knockdown and mouse knockout models present contradictory evidence for its importance: firstly, knockdown of TC10b does not affect glucose uptake in adipocytes (Chang et al.,

2007). Secondly, glucose uptake and GLUT4 translocation are unaffected by siRNA- mediated knockdown of Cbl, CAP and CrkII (Mitra et al., 2004;Zhou et al., 2004) whereas siRNA knockdown of Akt attenuates these (Zhou et al., 2004).

Furthermore, APS knockout mice show enhanced insulin sensitivity and hypoinsulinaemia (Minami et al., 2003). Finally, studies performed in muscle cells and adipocytes demonstrate that their requirement for TC10 signalling may be different. Activation of TC10 in muscle is not required for cortical actin

50 rearrangements as shown previously in adipocytes (JeBailey et al., 2004). In summary, the data suggest that the TC10 pathway plays a relatively minor role in insulin-stimulated GLUT4 translocation.

1.2 The phosphoinositides

Several mentions of phosphoinositide lipids have arisen in the introduction so far and this highlights the role multiple phosphoinositides are documented to play in insulin signalling and glucose transport. The phosphoinositide lipids are an essential family of eukaryotic cellular phospholipids. They are all derived from PtdIns by selective mono-, bis- or tris- phosphorylations of its headgroup (see Figure 1.5).

They have a high cellular turnover rate and represent only 2-8% of total cellular phospholipids (Fruman et al., 1998;Pendaries et al., 2005). Despite this they have essential roles in cell function and survival. Indeed, all members of the

phosphoinositide family seem to possess at least some signalling capability and several have well documented roles in a diverse range of cellular events (see Table

1.1: Phosphoinositide amounts, binding motifs and functions). The phosphoinositides achieve this by serving as membrane-localised signalling molecules, functioning as membrane markers that recruit and/or activate signalling effector proteins through specific binding domains. Impaired metabolism of the phosphoinositides by defects in their regulatory proteins can lead to severe consequences. Diseases such as cancer and diabetes can be attributed to aberrant phosphoinositide metabolism (recently reviewed by(Vicinanza et al., 2008;Kok et al., 2009;Logothetis et al., 2010). There is no doubt that this tiny fraction of phospholipids has an enormous impact on mammalian physiology; to cover every facet of phosphoinositide knowledge in detail here would be both exhaustive and unnecessary. Therefore, this part of the introduction will mainly focus on PtdIns5P, covering other relevant phosphoinositide information where necessary.

Table 1.1: Phosphoinositide amounts, binding motifs and functions

PITable 1.2: PhosphoinositideRelative amounts,Binding binding Pathways motifs and and functions Reference(s) amount†* motifs Functions PtdIns5P 1-3% † PH (DOK1 Nuclear signalling, (Rameh et al., 1997;Clarke (0.002)* and DOK2) Insulin signalling et al., 2001;Gozani et al., 2003;Sbrissa et al., PHD (ING2) and GLUT4 translocation? 2004;Jones et al., 2006;Guittard et al., Intracellular 2009;Sarkes and Rameh, trafficking? 2010) PtdIns4P (0.05)* PH, PTB, PX Exocytosis, (D'Angelo et al., Golgi complex 2008;Lemmon, regulation 2008;Kutateladze, 2010) PtdIns3P 1-3%† FYVE, PH, Endocytosis, (Maffucci et al., 2003;Gulati (0.002)* PX Nutrient sensing and Thomas, 2007;Noda et (mTOR, S6K1 al., 2010;Vergne and activation), Deretic, 2010) GLUT4 translocation? Autophagy PtdIns(3,4)P2 0.2% PH, PX T-cell activation (Seminario and Wange, (0.0001)* 2003;Lemmon, 2008;Kutateladze, 2010)

PtdIns(3,5)P2 0.2%† PH, Retrograde (Dove et al., 2002;Friant (0.0001)* PROPPINS trafficking, et al., 2003;Eugster et Multivesicular body al., 2004;Jeffries et al., sorting, 2004;Sbrissa and Shisheva, 2005;Michell et Autophagy al., 2006)

PtdIns(4,5)P2 (0.05)* PH, FERM, Actin cytoskeleton (Lemmon, 2008; ANTH, regulation, Cell Kutateladze et al., 2010;Suh et al., ENTH, PX, migration, GLUT4 2006;Wigoda et al., Tubby, 2010;Roberts-Crowley, et translocation, PTB, PDZ al.,2009;Nawaz et al.,, Ion channel 2009) regulation, CNS function, Ca2+ homeostasis, PtdIns(3,4,5)P3 (<0.0001)* PX, PH, C2 T-Cell activation, (Venkateswarlu et al., Cell migration, 1998;Venkateswarlu et al., ENaC regulation, 1999;Patel et al., Protein trafficking, 2003;Lemmon, 2008;Pochynyuk et al., Cell volume 2008;Yamamoto et al., regulation, CNS, 2008;Arendt et al., GLUT4 exocytosis, 2010;Goebbels et al., 2010;Kutateladze, 2010)

ANTH – AP-180 N-terminal homology, CNS – central nervous system, EnaC – Epithelial sodium channel, ENTH – Epsin N-terminal homology, FERM – F for 4.1 protein, E for ezrin, R for radixin and M for moesin, FYVE – Fab 1 (yeast orthologue of PIKfyve), YOTB, Vac 1 (vesicle transport protein), and EEA1, PH – Pleckstrin Homology, PX – Phox Homology, PHD – Plant homeodomain, PTB – Protein tyrosine binding, PDZ – discovered in post synaptic density protein, Drosophila disc large tumor suppressor and zonula occludens- 1 protein, †In mammalian cells, relative to total phosphoinositides or *erythrocyte phosphatidylserine levels in brackets

1.2.1 Phosphoinositide structure and metabolism

The myo-inositol sugar headgroup of PtdIns contains five free hydroxyl groups

(positions D2 to D6) with a phosphodiester bond at position 1 linking it to diacylglycerol (Figure 1.5). Three of the hydroxyl groups (D3 to D5) are phosphorylated in vivo to form its various derivatives (Michell et al., 2006). The phosphorylations are achieved by families of specific lipid kinases (Figure 1.6), and the ones relevant to this work are described in more detail below. Phosphorylation of a single hydroxyl group can be achieved by kinase action to form the phosphatidylinositol mono-phosphates. Sequential phosphorylations can also take place to form the phosphatidylinositol poly-phosphates such as PtdIns(4,5)P2. The number and position of phosphorylations on the headgroup leads to molecules with very different properties and characteristics. Phosphorylations are reversible due to the action of phosphoinositide phosphatases. Two such phosphatases, PTEN and

SHIP2, have been described previously (Section1.1.5.1)

Figure 1.5: Structure of Phosphatidylinositol. This shows the structure of PtdIns and the potential positions of its myo-inositol head group which may be phosphorylated by specific kinases. These are at the D3, D4 and D5 positions (highlighted in red). The myo-inositol head group is connected to diacylglycerol, made up of two fatty acid chains – Arachidonic acid and Stearic acid – attatched by a phosphate group to glycerol (glycerol-phosphate).

Figure 1.6: Phosphoinositide interconversions by sequential phosphorylations by specific enzymes 1.(MacDougall et al., 1995), 2. & 9.(Schaletzky et al., 2003a), 3.(Sbrissa et al., 1999;Sbrissa et al., 2002), 4.(Pagliarini et al., 2004), 5.(Wong and Cantley, 1994) 6.(Mani et al., 2007), 7.(Sbrissa et al., 1999), 8.(Ikonomov et al., 2009b), 10.(Rameh et al., 1997), 11. (Ungewickell et al., 2005), 12.(Fecchi et al., 2006;Mani et al., 2007), 13.(Loijens et al., 1996), 14.(MacDougall et al., 1995;Saltiel and Pessin, 2003), 15. & 17.(Stephens et al., 1998), 16.(Norris et al., 1995), 18.SHIP2 (Backers et al., 2003), SKIP (Ijuin and Takenawa, 2003), 19.(Fruman et al., 1998;Taylor et al., 2000b;Backers et al., 2003). Dashed lines describe theoretical pathways, unconfirmed either in vivo or in vitro.

1.2.2 PtdIns5P

PtdIns5P was the final phosphoinositide to be identified; it was separated from phosphatidylinositol 4-phosphate (PtdIns4P) by HPLC when Rameh et al. defined a new pathway for PtdIns(4,5)P2 production (Rameh et al., 1997). PtdIns5P is now a new precursor for this important signalling molecule (Table 1.1), not just the highly abundant PtdIns4P as previously thought (Rameh et al., 1997). PtdIns5P is present in small amounts in the cell (~1-3% of total phosphoinositides) and is difficult to distinguish from PtdIns4P using HPLC (Rameh et al., 1997).

1.2.2.1 Measurements of PtdIns5P levels

Since its discovery, interest in PtdIns5P has grown substantially. A specific PtdIns5P mass assay was developed by Morris et al. to investigate the cellular level of this molecule (Morris et al., 2000). With this technique it has been demonstrated that levels of PtdIns5P are constitutively low in resting cells (typically 50-fold lower than levels of PtdIns4P), yet they are altered upon cell exposure to certain stimuli.

For example, increases in PtdIns5P levels occur during the thrombin stimulation of human platelets (Morris et al., 2000), insulin stimulation of adipocytes (Sbrissa et al., 2004), after T-cell receptor stimulation (Guittard et al.2009) and in the nucleus both during the G1 phase of the cell cycle (Clarke et al., 2001) and in response to stress signalling (Jones et al., 2006). Dramatic increases in PtdIns5P levels have also been observed to follow S.flexneri infection of HeLa cells (see below).

Alternatively, certain stimuli have been shown to decrease PtdIns5P levels. Roberts et al. found that its levels decreased by approximately 40% when HeLa cells were stimulated with histamine (Roberts et al., 2005). An improvement on the original

HPLC method of separating out PtdIns5P, giving higher PtdIns5P resolution, has recently been achieved (Sarkes and Rameh, 2010). It can be used to analyse the subcellular amounts of PtdIns5P, showing the highest basal levels of PtdIns5P in the plasma membrane and Golgi fractions (Sarkes and Rameh, 2010).

1.2.2.2 PtdIns5P production

At present, the regulation of PtdIns5P levels is not completely understood. It is not yet known if a specific phosphatidylinositol 5-kinase, able to produce PtdIns5P directly from PtdIns, exists in vivo. Several enzymes have been implicated in the both the production and removal of PtdIns5P, though there is some debate as to whether they regulate this phosphoinositide directly in vivo. The mechanism by which PtdIns5P is produced has not yet been explicitly demonstrated in intact cells

(Lecompte et al., 2008) and there are several possible mechanisms of PtdIns5P

55 production. This mono-phosphoinositide could be potentially produced from PtdIns by either PIKfyve or an unidentified 5-kinase, PtdIns3P then PtdIns(3,5)P2 by

PIKfyve and a 3-phosphatase or PtdIns(4,5)P2 by 4-phosphatases; the most widely accepted theory being that PtdIns5P is indirectly made from PtdIns3P via a

PtdIns(3,5)P2 intermediate.

1.2.2.2.1 PIKfyve: Direct or indirect route to PtdIns5P?

PIKfyve has been shown to produce PtdIns(3,5)P2 in vitro and in vivo from PtdIns3P via phosphorylation at the D5 phosphate (Figure 1.6 and 1.7) (Sbrissa et al.,

1999). It has also been reported to phosphorylate PtdIns at the D5 phosphate to form PtdIns5P in vitro (Sbrissa et al., 2002). The ability of PIKfyve to produce

PtdIns5P from PtdIns in vivo (Sbrissa et al., 1999;Sbrissa et al., 2002) has not been unarguably proven; it has also been suggested that PtdIns5P is produced by myotubularin (MTM) phosphatase action on PtdIns(3,5)P2 (see Figure 1.7).

However, studies have shown that overexpression of PIKfyve can increase the cellular level of PtdIns5P by some 80% in 3T3L1 adipocytes (Sbrissa et al.,

1999;Sbrissa et al., 2002). PIKfyve also plays a role in controlling a PtdIns5P pool in NIH3T3 cells stably expressing the oncogenic tyrosine kinase nucleophosmin anaplastic lymphoma kinase (NPM-ALK) (Coronas et al., 2008). NPM-ALK is detected in most anaplastic large cell lymphomas and causes aberrant activation of phosphoinositide metabolising enzymes, including PI3-kinase. Stable NPM-ALK expression results in elevated PtdIns5P levels compared to control cells (Coronas et al., 2008). When NPM-ALK cells were pre-incubated with curcumin (an inhibitor of

PIKfyve lipid activity –(Ikonomov et al., 2002) a 75 per cent reduction in PtdIns5P levels was observed. Downregulation of PIKfyve by siRNA-mediated knockdown in these cells leads to a 60 per cent reduction of its levels and a corresponding decrease in PtdIns5P when compared to NIH3T3 cells treated with control siRNA

(Coronas et al., 2008).

Figure 1.7: The two suggested routes of PtdIns5P production from PtdIns PtdIns5P production could potentially be achieved by direct phosphorylation of PtdIns to PtdIns5P by PIKfyve (Sbrissa et al., 2002) – green arrow. Alternatively, PIKfyve involvement stems from 5-phosphorylation of PtdIns3P (produced by class II/II PI3-kinase) to produce

PtdIns(3,5)P2, this is followed by D3 dephosphorylation of

PtdIns(3,5)P2 to PtdIns5P by an MTM/MTM related protein (MTMR) – purple arrows.

These data certainly link PIKfyve to PtdIns5P production; however, it is uncertain as

to whether PIKfyve is solely responsible for this (Dove et al., 2009). Although

PtdIns5P levels increase in response to insulin in adipocytes (Sbrissa et al., 2004),

separate studies show that the in vitro measured PIKfyve activity is not significantly

altered by acute insulin stimulation (Ikonomov et al., 2002). An alternative theory

is that the actual role of PIKfyve in PtdIns5P production is to provide PtdIns(3,5)P2

for dephosphorylation by the myotubularins. This argument is convincing, but

should be approached with a certain degree of caution as it involves the interplay of

several phosphoinositides and enzymes. Thus it is not certain whether PIKfyve

increases PtdIns5P by direct production of PtdIns5P or by providing the

PtdIns(3,5)P2 substrate for MTMs.

1.2.2.2.2 The myotubularins

MTMs are a family of lipid phosphatases comprised of MTM1 and the MTM-related

(MTMR) proteins (MTMR1-13 and MTMR14/JUMPY) (Laporte et al., 2003). MTMs were found to dephosphorylate both PtdIns3P and PtdIns(3,5)P2 at the D3 position

(Taylor et al., 2000a;Walker et al., 2001;Schaletzky et al., 2003b). The product of hydrolysis of the latter phosphoinositide upon its dephosphorylation by MTM1, has been identified to be PtdIns5P (Schaletzky et al., 2003b;Tronchere et al., 2004).

Perturbations in the levels of PtdIns5P, PtdIns3P and PtdIns(3,5)P2 have been observed in disease states, such as X-linked myotubular myopathy (XLMTM) and type 4B1 Charcot-Marie-Tooth disease (CMT4B1). These severe inherited degenerative diseases are caused by mutated MTM1 and MTMR2 genes respectively, and lead to a reduction in PtdIns5P and elevated PtdIns3P and

PtdIns(3,5)P2 levels (Tronchere et al., 2004;Dove et al., 2009).

MTMs are considered to be important for PtdIns5P production as expression of an

MTM in different cell lines increases PtdIns5P levels. In Jurkat cells, a cell line with a high basal level of PtdIns(3,5)P2, the overexpression of MTM1 doubles the amount of PtdIns5P mass present in these cells (Tronchere et al., 2004). In addition to this,

PtdIns5P levels increase in response to hyperosmotic shock in L6 myotubes, and this increase is reduced by some 50% upon overexpression of an inactive MTM1 mutant (Tronchere et al., 2004). It is possible, given these rises in PtdIns5P, that

MTMs, especially those shown to utilise PtdIns(3,5)P2, work in tandem with PIKfyve to produce PtdIns5P from the former phosphoinositide.

If this is the case, regulation of PtdIns5P is further complicated as there is a whole other set of enzymes, in addition to PIKfyve regulation (see section 1.2.2.2.1), to consider. Not only this, the regulation of the MTMs themselves is quite complex.

MTM1 and MTMR2, two possible PtdIns(3,5)P2 phosphatases that could produce

PtdIns5P, are clearly regulated via different mechanisms. Despite being two highly

58 similar proteins, using the same substrate and with ubiquitous tissue expression patterns, mutations in both MTM1 and MTMR2 genes cause very different diseases affecting different tissue in the body; XLMTM and CMT4B1, respectively. Functional redundancy of the MTMs must be avoided by some form of regulatory mechanism,

(which could be as simple as differential subcellular localisations – see below). The roles and regulation of each individual MTM in cell development and signalling are still being explored (Berger et al., 2003;Kim et al., 2003;Choudhury et al.,

2006;Robinson et al., 2008;Naughtin et al., 2010). Some of these studies are shedding light on the different domains that might serve to target MTMs to their required location of action. A PH-GRAM domain and a separate coiled-coil module seem to be important in both MTMR2 (Berger et al., 2003) and MTMR6 regulation

(Choudhury et al., 2006). Interestingly, replacing the PH-GRAM or coiled-coil domain of any other MTM with those of MTMR6 gives it MTMR6-like properties i.e.

2+ + being able to achieve inhibition of the Ca activated K channel, KCa3.1, a specific role of MTMR6 (Choudhury et al., 2006).

Another interesting feature that has been discovered regarding the MTM family is that several are catalytically inactive. At least MTMR5 and MTMR9-13 have this feature, yet, they are clearly important in cell regulation. MTMR5 is the best example of this; it has been shown to regulate MTMR2 activity (Kim et al., 2003);

Mutations in MTMR5 lead to CMT4B2 (Senderek et al., 2003) and spermatogenesis is severely affected in male mice deficient for this phosphatase, causing infertility

(Firestein et al., 2002). The importance of catalytically inactive MTMs has also been demonstrated with MTMR13; mutations in MTMR13 lead to CMT4B2-like neuropathy in mice (Robinson et al., 2008). It is thought that the inactive MTMs may serve to regulate their catalytically active counterparts, possibly through substrate interaction or targeting of MTMs (Kim et al., 2003).

1.2.2.2.3 PIP5KI: potential to phosphorylate PtdIns to PtdIns5P?

The type I phosphatidylinositol phosphate (PIP) kinases, the PIP5KIs, utilise the abundant PtdIns4P as their substrate to produce PtdIns(4,5)P2 by phosphorylation at its D5 position. They have been shown to produce PtdIns5P from PtdIns in vitro by 5-kinase activity (Tolias et al., 1998;Sbrissa et al., 1999;Tronchere et al., 2004)

Therefore it is theorised that they possess a related role in vivo, however, this remains to be proven. Transfection of a PIP5KI isoform into Cos-7 cells produces no detectible difference in PtdIns5P levels (Roberts et al., 2005). These enzymes play a well established and much greater role in the production of PtdIns(4,5)P2 as discussed below.

1.2.2.2.4 4-phosphatases: dephosphorylation of PtdIns(4,5)P2 to PtdIns5P

PtdIns5P can also be produced by the dephosphorylation of PtdIns(4,5)P2 at its D4 position by type I and II PtdIns(4,5)P2 4-phosphatases (Ungewickel et al. 2005).

Previous to their discovery, no such mammalian phosphatase had been found, whereas a bacterial 4-phosphatase, IpgD, had been identified for some time and employed in several studies shedding light on PtdIns5P function (Niebuhr et al.,

2002;Carricaburu et al., 2003;Pendaries et al., 2006). Both 4-phosphatase I and II are ubiquitously expressed and localise to late endosomal or lysosomal membranes in epithelial cells (Ungewickell et al., 2005).

The bacterial virulence factor IpgD possesses phosphoinositide 4-phosphatase activity towards PtdIns(4,5)P2, forming PtdIns5P (Niebuhr et al., 2002b;Niebuhr et al., 2002). IpgD is one of the principal virulence factors injected into host cells upon

S.flexneri infection, (Niebuhr et al., 2002). S.flexneri infection of HeLa cells leads to a 30-fold increase in PtdIns5P levels and transfection and expression of IpgD leads to a 6-fold increase in PtdIns5P (Niebuhr et al., 2002). Although this increase in PtdIns5P is pathological, many studies have utilised IpgD to gain further knowledge on the role of PtdIns5P within the cell (Niebuhr et al., 2002;Carricaburu

60 et al., 2003;Ungewickell et al., 2005;Pendaries et al., 2006;Ramel et al.,

2009;Guittard et al. 2009), therefore its potency for producing PtdIns5P is worth mentioning briefly. However, it should be remembered that approaches involving

IpgD-generated PtdIns5P should take into consideration perturbations in

PtdIns(4,5)P2 levels. Introduction of IpgD to mammalian cells leads to a reduction in membrane/cytoskeleton adhesion energy and causes membrane ruffling as seen in normal infection of host cells (Niebuhr et al., 2002;Pendaries et al., 2003). The rearrangements in the actin cytoskeleton are attributed to a drop in PtdIns(4,5)P2 levels, rather than an increase in PtdIns5P, due to PtdIns(4,5)P2‟s well established role in actin cytoskeleton dynamics (Pendaries et al., 2006). The membrane ruffling, however, has been attributed to the massive rise in PtdIns5P (Lecompte et al., 2008).

1.2.2.3 Removal of PtdIns5P

1.2.2.3.1 The role of PIP4KIIs in regulating PtdIns5P

Type II PIP kinases (PIP4KII) and PIP5KI both produce PtdIns(4,5)P2, however, they do so via two distinct mechanisms (Rameh et al., 1997). Unlike the 5-kinase

PIP5KIs, PIP4KII kinases phosphorylate PtdIns5P at the D4 position of the inositol head group. It is now known that PIP4KIIs are able to contribute to PtdIns(4,5)P2 production, however, there is some discussion as to what the main function of these enzymes might be; their main role may be to remove PtdIns5P with the bulk of PtdIns(4,5)P2 being produced by the PIP5IKs.

The PIP4KII kinase family is made up of three isoforms, α, β and γ and they are regulated by their apparent varied tissue and subcellular distributions. In mice,

PIP4KIIβ mRNA is 10-fold higher than that of PIP4KIIα in muscle and heart tissues; suggesting a specialised role for this isoform in these (Clarke et al., 2008). Most of the PIP4KIIβ isoform is found in the nucleus (Clarke et al., 2001;Bultsma et al.,

2010) where it has been shown to regulate a nuclear pool of PtdIns5P (Jones et al.,

2006). It negatively regulates the PtdIns5P rise in this cellular compartment in response to stress signals (see section 1.2.3.1).

PIP4KIIα and γ have principally cytosolic localisations (Itoh et al., 1998;Ciruela et al., 2000;Richardson et al., 2007) and possibly regulate pools of PtdIns5P found in other membrane structures aside from the nucleus (Sarkes and Rameh, 2010).

Recently selective removal of each PIP4KII isoform by RNA interference show that depleting PIPKIIα, but not the other PIP4KII isoforms, significantly enhances stimulated PtdIns5P production in response to tyrosine kinase activation (Wilcox and Hinchliffe, 2008).

To add to the complexity of subcellular regulation of the PIP4KIIs, both PIP4KIIα and β have been shown to heterodimerise (Clarke et al., 2008;(Bultsma et al.,

2010;Wang et al., 2010). HA- and FLAG-tagged PIP4KIIβ immunoprecipitation experiments show that a substantial amount of endogenous PIP4KIIα is also recovered from lysates (Bultsma et al., 2010;Wang et al., 2010) revealing that the two PIP4KIIs may exist as a complex in vivo. It is possible that this interaction might serve to regulate the activity of either PIP4KII. Interestingly, PIP4KIIα has been shown to be up to 2000-fold higher in activity than PIP4KIIβ in vitro and this reflects their activities in vivo (Bultsma et al., 2010). One theory is that a (or the) major function of PIP4KIIβ is to target IIα to the nucleus. This was initially suggested citing the latter‟s higher activity; PIP4KIIβ would serve as a nuclear locator for its more active IIα counterpart (Wang et al., 2010). Indeed, evidence in the spleen, which is enriched with anucleate erythrocytes, shows a greater expression of PIP4KIIα than PIP4KIIβ (Clarke et al., 2008) and it was from erythrocytes and platelets that PIP4KIIα was first purified (Boronenkov and

Anderson, 1995;Divecha et al., 1995). Conversely, skeletal muscle and liver express greater levels of PIP4KIIβ over IIα mRNA (Clarke et al., 2008). One theory is that this may reflect PIP4KIIα/β complex stoichiometry; the two could exist as a trimeric complex comprised of a IIβ homodimer and one IIα monomer as one study

62 showed that IIβ must exist as a homodimer (β/β) and that IIα is detected associated with HA-PIP4KIIβ immunoprecipitates by mass spectrometry. The probability of a β/β complex existing is very high as PIP4KIIβ elutes after immunoprecipitation with a molecular mass between 120-150kDa, whereas monomeric IIβ has a molecular weight of 49kDa (Bultsma et al., 2010). Studies in chicken DT40 cells suggest the complex is a heterodimer of α/β (Wang et al.,

2010), both isoforms are homodimers (α/α; β/β) in solution and each possess a conserved dimerisation site proposed to facilitate the interaction (Rao et al., 1998).

An alternative theory, compatible with the one mentioned earlier, is that either

PIP4KIIα or IIβ are required to modify the others activity. This was put forward in light of the interesting observation that the PIP4KII activity is higher when active

PIPKIIβ, and not inactive PIP4KIIβ, is in complex with endogenous PIP4KIIα. These observations suggest that PIP4KIIα can either dramatically stimulate PIP4KIIβ activity or that PIP4KIIβ is required for PIP4KIIα activation in the PIP4KIIα/β complex (Bultsma et al., 2010). Collectively these findings could warrant reinterpretation of experiments where IIβ expression has been altered (Carricaburu et al., 2003;Lamia et al., 2004) as PIP4KIIβ overexpression could alter IIα localisation. However it is important to note overexpressed PIP4KIIβ does exhibit cytosolic localisation (Ciruela et al., 2000).

1.2.2.3.2 PIP4KII regulation of PtdIns(3,4,5)P3 levels: a role for PtdIns5P?

It is becoming clear that PIP4KIIs have some function in regulating PtdIns(3,4,5)P3 levels and possibly PI3-kinase activity. Previous work has found that mice lacking

PIP4KIIβ are hypersensitive to insulin compared to wild-type litter mates (Lamia et al., 2004). Further to this, it was found that the insulin-mediated activation of Akt was enhanced in skeletal muscle and liver tissue from these PIP4KIIβ null mice, but not in their white adipose tissues.

The mechanism by which PIP4KIIβ decreases insulin sensitivity was not further investigated in this study (Lamia et al., 2004), however, overexpression of PIP4KIIβ had previously been found to produce a small but significant reduction in

PtdIns(3,4,5)P3 levels in response to insulin (Carricaburu et al., 2003). Considering the fact that PtdIns(4,5)P2, the main product of PIP4KII enzyme action, is the substrate for PI3-kinase production of PtdIns(3,4,5)P3, this reduction in

PtdIns(3,4,5)P3 was somewhat paradoxical. Expression of PIP4KIIβ did not reduce

IR or IRS phosphorylation or recruitment of PI3-kinase, suggesting that the effect of PIP4KIIβ is downstream of PI3-kinase (Carricaburu et al., 2003). Moreover, reduction of PtdIns(3,4,5)P3 was accompanied by an increase in PtdIns(3,4)P2 levels suggesting the involvement of a PtdIns(3,4,5)P3-specific 5-phosphatase in these events. Carricaburu et al. concluded that the production of PtdIns(4,5)P2 by

PIP4KIIs phosphorylation of PtdIns5P can regulate insulin signalling by somehow promoting PtdIns(3,4,5)P3 dephosphorylation (Carricaburu et al., 2003).

1.2.2.3.3 PTPMT1

At the time Roberts et al. put forward the theory that PtdIns5P removal was most likely to be carried out by a phosphatase (see Figure 1.7) (Roberts et al., 2005), a novel PTEN-like phosphatase (first known as PLIP until being renamed – see below) had recently been identified (Pagliarini et al., 2004). It was shown to have a highly selective substrate specificity for PtdIns5P when its phosphatase activity was challenged with several phosphoinositides (Pagliarini et al., 2004). The study claims the phosphatase‟s specificity is comparable to PTEN specificity towards

PtdIns(3,4,5)P3. However, they were not able to demonstrate this role in vivo using a PLIP knockdown approach (Pagliarini et al., 2004).

PLIP was later found to be exclusively localised to the inner membrane of mitochondria (Pagliarini et al., 2005), and therefore renamed protein tyrosine phosphatase (PTP) localised to the mitochondrion 1 (PTPMT1). PTPMT1‟s new

64 identity and location posed some rather interesting questions about its functions. In the previous study (Pagliarini et al., 2004) PTPMT1 had been shown to possess poor phosphatase activity towards proteins – which is characteristic of the vast majority of phosphoinositide phosphatases – and high specificity and activity towards

PtdIns5P. As there is little evidence of a PtdIns5P pool being present in the mitochondria so far (so far there is evidence of PtdIns5P pools in the nucleus

(Clarke et al., 2001) plasma membrane, Golgi and smooth endoplasmic reticulum

(SER) seem to be enriched for PtdIns5P (Sarkes and Rameh, 2010)) and considering its poor protein specificity, it asks the question of what the substrate(s) and role(s) of PTPMT1 might be. It has been shown that PTPMT1 is important for

ATP production in and insulin release from pancreatic β-cells (Pagliarini et al.,

2005). PTPMT1 knockdown in the pancreatic insulinoma cell line INS-1-832/13 alters the protein phosphorylation profile of the mitochondrion and significantly enhances ATP production and insulin secretion (Pagliarini et al., 2005).

1.2.3 Potential roles of PtdIns5P

Previously, there has been intense research focused on the roles of phosphoinositides such as PtdIns(4,5)P2 and PtdIns(3,4,5)P3 in various signalling and disease pathways (Pendaries et al., 2005). However, the evidence for the roles of the mono-phosphoinositides as signalling molecules in their own right, and not just as precursor molecules for these further phosphorylated phosphoinositides

(Niebuhr et al., 2002;Maffucci et al., 2003;Sbrissa et al., 2004;Pendaries et al.,

2006;Coronas et al., 2008;Ramel et al., 2009;Guittard et al., 2010), is undeniable.

PtdIns5P is no exception to this. Amidst the debate surrounding its regulation, this molecule has gradually been gaining more research interest. With each new discovery it becomes more and more apparent that PtdIns5P may be an important signalling molecule in several cell signalling pathways including a role in cellular stress pathways and the insulin signal.

1.2.3.1 PtdIns5P in the Nucleus

The presence of phosphoinositides and their regulatory enzymes in the nucleus has been known about for some time; yet, it has been until only recently that their functions in this compartment have begun to emerge (Barlow et al., 2010). The study of their function and regulation in the nucleus appears both fascinating and challenging as there are some interesting features of nuclear phosphoinositides that suggest their regulation is likely to differ somewhat from their cytoplasmic counterparts. For instance, it has been shown that phosphoinositides in nuclear compartments can exist free from any identifiable membrane system (Irvine,

2003).

Changes in the levels of nuclear PtdIns5P during the cell cycle pointed to the presence of a nuclear pool of PtdIns5P that played a role in nuclear signalling

(Clarke et al., 2001). A separate and later study showed that the tumour suppressor protein, inhibitor of growth protein-2 (ING2), could bind to PtdIns5P and was thus identified as a nuclear receptor for this phosphoinositide (Gozani et al.,

2003). ING2 belongs to a family of ING proteins which regulate many critical cellular responses such as cell proliferation and growth, apoptosis, DNA repair, senescence and angiogenesis (Maher and Helbing, 2009). It is a regulator of p53, a molecule involved in several cellular replication check points, contributing to the maintenance of DNA stability, quality (prevention of replication mistakes) and quantity (preservation of diploidy). The PtdIns5P binding ability of ING2 is facilitated by a plant homeodomain (PHD) motif shown to have a high binding affinity for this phosphoinositide (Gozani et al., 2003). It has been used in several studies looking at PtdIns5P function (Sbrissa et al., 2004;Pendaries et al.,

2006;Guittard et al., 2009). However, a recent study has shown that a 2xPHD-

ING2 construct fails to bind any of the mono-phosphoinositides tested, including

PtdIns5P (Guittard et al., 2010). In light of this, the binding properties of PHDING2 constructs may not be the same as intact ING2.

ING2 expression is upregulated by DNA damaging agents, and overexpression of

ING2 leads to p53 acetylation and apoptosis (Nagashima et al., 2001). ING2 functions and p53 acetylation are disrupted by mutations in the PHD finger that interfere with its PtdIns5P binding ability or by PIP4KIIβ overexpression (Gozani et al., 2003). Complimenting and furthering this study, the work of Jones et al. reported that cellular stressors, such as UV irradiation and oxidative stress, increased the level of PtdIns5P in the nucleus and linked this to an inactivation of

PIP4KIIβ by a MAPK, p38, via S326 phosphorylation (Jones et al. 2006). This rise in

PtdIns5P was able to affect the localisation of ING2 within the nucleus. Elevation of

PtdIns5P levels are also increased by action of type I 4-phosphatase in response to the DNA-damaging agents etoposide and doxorubicin. Relocation of type I 4- phosphatase to the nucleus upon incubation with these agents was followed by a

PtdIns5P increase. An increase in p53 acetylation in these conditions was also recorded (Zou et al., 2007).

1.2.3.2 PtdIns5P and intracellular trafficking

PtdIns5P production and removal are closely linked to the metabolism of several other phosphoinositides: PtdIn3P, PtdIns(3,5)P2 and PtdIns(4,5)P2. PtdIns3P and

PtdIns(3,5)P2 are both present in endosomes and play roles in retrograde trafficking

(Rutherford et al., 2006;Dove et al., 2009). PtdIns(4,5)P2 is present in the plasma membrane where a significant amount of PtdIns5P has been located recently

(Sarkes and Rameh, 2010). Considering the above, it has been hypothesised that

PtdIns5P plays a role in the trafficking between two of these structures – endosomes and the plasma membrane – possibly in exosomes or in secretory lysosomes (Lecompte et al., 2008). It is thought that the observation of PtdIns5P being able to induce GLUT4 translocation (see 1.2.4.2) also supports PtdIns5P‟s potential role in intracellular trafficking. Recently PIP4KIIγ was demonstrated to have a partial Golgi localisation upon expression in kidney cell lines with additional localisation to an unidentified vesicular compartment (Clarke et al., 2008). This

67 compliments previous studies that show endoplasmic reticulum and Golgi localisations of PIP4KIIγ (Itoh et al., 1998). This bacterially expressed recombinant

PIP4KIIγ, unlike PIP4KIIα, had no detectable 4-kinase activity in vitro. However, similar to PIP4KIIβ, this PIP4KIIγ did have the in vitro ability to associate with

PIP4KIIα (Clarke et al., 2008). This work suggests that PIP4KIIγ may help regulate a Golgi-localised pool of PtdIns5P and play a role in vesicle transport in kidney cells.

The very recent finding that, as well as the plasma membrane, SER and Golgi are enriched with PtdIns5P (Sarkes and Rameh, 2010) also compliments the theory of

PtdIns5P serving some role in intracellular trafficking.

1.2.3.3 PtdIns5P and T-Cell activation

A recent study showed that the PH domains of DOK1 and DOK2 proteins (see section 1.1.4.1) possess high binding specificity towards PtdIns5P (Guittard et al.,

2009). DOK1 and DOK2 are involved in T-cell activation and reduction of IL-2 production (Nemorin et al., 2001;Gerard et al., 2003). Interestingly, an increase in

PtdIns5P has been reported following antibody stimulation of a Hut-78 T-cell line and subsequent activation of the TCR (Guittard et al., 2009). It was postulated that there was a possible link between this rise in PtdIns5P and DOK phosphorylation, as

DOK2 phosphorylation follows a similar fold-increase over a similar time course

(Guittard et al., 2009). IpgD overexpression complemented this; an IpgD- generated PtdIns5P increase was found to positively regulate the tyrosine phosphorylation and activation of both DOK proteins. This was not the case in the presence of a phosphatase dead version of IpgD. Furthermore, tyrosine phosphorylation was lost in the presence of PIP4KIIβ overexpression (Guittard et al., 2009).

More recently the DOK5 PH domain has also been shown to bind PtdIns5P with high affinity (Guittard et al., 2010). This domain has been used to further demonstrate

PtdIns5P‟s positive role in T-cell activation by sequestration experiments; PHDOK5

68 domain expression in Hut-78 T-cells blocks some TCR-induced tyrosine phosphorylations including Akt phosphorylation (Guittard et al., 2010).

The DOK experiments are interesting in terms of PtdIns5P and its relationship with insulin signalling, as one theory is that PtdIns5P is able to activate PI3-kinase through regulation of a tyrosine kinase (Pendaries et al., 2006). The T-cell/DOK investigations demonstrate that PtdIns5P most likely plays a role in T-cell activation downstream of PTK receptors through tyrosine phosphorylations. It is possible that those DOK isoforms shown to have a role in insulin signalling, namely IRS5/DOK4 and IRS6/DOK5 could interact with and potentially be regulated by PtdIns5P.

1.2.4 PtdIns5P has a potential role in the insulin signalling pathway

PtdIns5P levels have been shown to rise in both 3T3-L1 adipocytes and CHO-IR cells in response to insulin and exogenously delivered PtdIns5P was able to promote

GLUT4 translocation to the plasma membrane (Sbrissa et al., 2004). This transient rise in PtdIns5P in response to this hormone and effect of PtdIns5P elevation were the first direct data implicating this phosphoinositide in the regulation of the insulin signal. Since then a reasonable amount of data have been presented which implicate PtdIns5P in insulin signal regulation (see 1.2.4).

1.2.4.1 PtdIns5P and insulin-induced actin reorganisation

Heightened levels of PtdIns5P accompany a dramatic reorganisation of the actin cytoskeleton in mammalian cells in response to S.flexneri infection (Niebuhr et al.,

2002;Pendaries et al., 2006). The group of Shisheva have reported a transient increase in PtdIns5P levels also accompanied rapid disassembly of F-actin stress fibres in CHO-IR cells adipocytes when stimulated with insulin (Sbrissa et al.,

2004). To investigate the relationship of PtdIns5P and insulin-induced reorganisation of the actin cytoskeleton, the Shisheva group introduced PtdIns5P into serum starved CHO-IR cells by microinjection. They found that increasing the

69 level of PtdIns5P in this way mimicked the effects of insulin on stress fibre disassembly. Furthermore, other phosphoinositides tested under the same conditions were not able to induce stress fibre breakdown, although the paper does not identify which phosphoinositides were the subject of this particular investigation. The effect of PtdIns5P on actin rearrangements was wortmannin insensitive (Sbrissa et al., 2004) which led to the theory that PtdIns5P might be involved in PI3-Kinase independent events downstream of insulin.

Shisheva also examined the consequence of PtdIns5P sequestration by PHD domains of ING2 and another PHD finger containing protein, ATP-dependent chromatin remodelling factor (ACF). Both proteins were tested in three tandem PHD domain repeat forms. The effect of these 3xPHD proteins on actin stress fibre disassembly in response to insulin was examined in CHO-T cells expressing both proteins. It was found that both peptides profoundly blocked the loss of actin stress fibres in response to insulin (Sbrissa et al., 2004). Whilst, this study indicates a possible role for PtdIns5P in this insulin-induced cytoskeleton restructuring, the binding affinity of ING2-PHD constructs has since been called into question (Guittard et al., 2010) which may mean re-evaluation of these results is required.

1.2.4.2 Effect of PtdIns5P on GLUT4 translocation

Shisheva has also examined the effect of microinjection of PtdIns5P on GLUT4 vesicle dynamics in 3T3-L1 adipocytes and found that not only does PtdIns5P constitute a substantial fraction of total resting phosphoinositdes in these cells, its levels have been shown to rise in response to acute insulin stimulation (Sbrissa et al., 2004). In addition to PtdIns5P, the effects of other PIs on GLUT4 translocation were also investigated. 3T3-L1 cells were transfected with a GLUT4-green fluorescent protein (EGFP-GLUT4) construct and, after twenty-four hours, were subject to microinjection with differing PIs. Single cells were monitored for a period

70 of thirty minutes before stimulation with insulin for another twenty minutes. Under these experimental conditions, it was found that PtdIns5P was the only phosphoinositide that displayed an ability to mimic insulin-stimulation of GLUT4 translocation to the plasma membrane. This result was identified in approximately fifty percent of the cells examined (Sbrissa et al., 2004). It is worth noting the wortmannin sensitivity of GLUT4 translocation in response to exogenous PtdIns5P delivery was not tested (Sbrissa et al., 2004).

Certain findings have suggested PIKfyve may play a role in GLUT4 translocation

(Sbrissa et al., 2004;Ikonomov et al., 2007), which is attributed to its enzymatic activity on phosphoinositides (Ikonomov et al., 2002) and possibly, its generation of PtdIns5P (Sbrissa et al., 2002;Sbrissa et al., 2004). This is supported by the loss of PIKfyve, and a protein involved in its activation (ArPIKfyve), by siRNA knockdown, which correlates with a reduction in insulin stimulated glucose uptake

(Ikonomov et al., 2007). However, the precise role for PIKfyve in GLUT4 translocation, and indeed PtdIns5P production, is still uncertain. In the case of

GLUT4 translocation it seems equal evidence for either a positive or negative role for PIKfyve has been put forward (see section 1.1.7.3).

1.2.4.3 PtdIns5P and PI3-kinase/Akt activity.

PtdIns5P has been shown to increase in cells infected with the intracellular pathogen, S.flexneri (Niebuhr et al., 2002;Pendaries et al., 2006). This is due to the activity of the aforementioned virulence factor IpgD. Pendaries et al. have shown that PtdIns5P colocalises with phosphorylated Akt during the first stages of

S.flexneri infection and that this process specifically requires IpgD (Pendaries et al.,

2006). In addition to this, this group have shown that ectopic expression of IpgD or introduction of a cell permeant PtdIns5P in a variety of cell types cause Akt activation (Pendaries et al., 2006). Moreover, expression of IpgD in HeLa cells caused an increase in PtdIns(3,4,5)P3 levels (Carricaburu et al., 2003). Considering

71 these findings and those of Lamia et al. (that revealed insulin-mediated activation of Akt was enhanced in PIP4KIIβ null mice (Lamia et al., 2004)), it already appears possible that PtdIns5P has a regulatory relationship with Akt.

A theory explaining how PtdIns5P might positively regulate Akt via inhibition of a

PtdIns(3,4,5)P3 phosphatase has been suggested by Carricaburu et al. (Carricaburu et al., 2003). It is based on their observation that PIP4KIIβ overexpression reduces

PtdIns(3,4,5)P3 in cells stimulated with insulin in addition to a correlating decrease in Akt phosphorylation. The identity of this phosphatase remains unknown but a recent study has found that neither SHIP2 or PTEN activities were affected by a

PtdIns5P increase (Ramel et al., 2009).

Regulation of a PtdIns(3,4,5)P3, phosphatase by PtdIns5P is not the only plausible explanation for the apparent ability of PtdIns5P to increase Akt activation. PtdIns5P has been found to modulate the activity of the PP2A phosphatase, which can dephosphorylate Akt, protecting the latter from dephosphorylation by the former protein. In the presence of elevated PtdIns5P levels, PP2A ser/thr phosphatase activity was reduced by up to 75% (Ramel et al., 2009). This is theorised to lead to accumulation of phosphorylated Akt and positively regulate this protein in the insulin signalling pathway.

An interesting theory proposed by Pendaries et al. is that PtdIns5P is somehow involved in the regulation of Akt activation by modulation or activation of PI3- kinase activity. This was initially suggested by data from a time course evaluation of phosphoinositide synthesis in response to S.flexneri infection. From this it was observed that elevated levels of PtdIns5P appeared before PI3-kinase products

(Pendaries et al., 2006). Further investigation revealed that the PI3-kinase involved in this process was the class I A PI3-kinase. IpgD and PtdIns5P production specifically activates class I A PI3-kinase by a mechanism involving tyrosine phosphorylations; the p85 subunit of PI3-kinase was recovered in anti-

72 phosphotyrosine immunoprecipitates from cells infected with S.flexneri, but not from cells infected with the IpgD-deficient mutant (Pendaries et al., 2006). In support of this idea, the insulin mimetic pervanadate, which stimulates tyrosine kinase activity, has also been shown to promote a marked increase of PtdIns5P levels (Wilcox and Hinchliffe, 2008). This pervanadate dependent rise has also been shown to be sensitive to the tyrosine kinase inhibitor AG213 (Wilcox and

Hinchliffe, 2008).

1.3 Summary

PtdIns5P, the latest addition to the phosphoinositide family, has few known physiological stimuli, yet its levels have been shown to transiently rise in adipocytes and CHO-IR cells in response to stimulation with insulin (Sbrissa et al., 2004). This indicates a potential signalling role for PtdIns5P downstream of the insulin receptor, which is further supported by its ability to mimic insulin-induced actin cytoskeleton rearrangements and GLUT4 translocation to the plasma membrane in the absence of this hormone (Sbrissa et al., 2004). To date, other evidence that suggests a role for PtdIns5P in the insulin signal are reports of PtdIns5P involvement in PI3-kinase regulation through a tyrosine kinase (Pendaries et al., 2006) and regulation of a

PtdIns(3,4,5)P3 (Carricaburu et al., 2003) and/or Akt (Ramel et al., 2009) phosphatase(s). All three of these molecules are documented to play important roles in the propagation of the insulin signal to stimulate GLUT4 trafficking to the plasma membrane of both skeletal muscle and adipose cells.

1.4 Aims

The aim of this project is to investigate further the possible role of PtdIns5P in insulin signalling. As the majority of insulin-stimulated glucose uptake in the body is carried out by skeletal muscle, a model of this tissue, differentiated myotubes derived from the rat myoblast cell line L6, was chosen for experimental work. As this cell line had not previously been used in the laboratory, initial work was directed towards characterisation of the cells. Following this, the effect of insulin stimulation on PtdIns5P levels in L6 myotubes was prioritised before further investigation of its role in insulin signalling. The development of several tools to supplement these investigations was also undertaken.

2 : Materials and Methods

2.1 Materials

FENS-1FYVE domain was donated by Dr. Martin Lowe (Manchester University). The

PHDING2 PtdIns5P binding motif was kindly provided by Dr. Nullin Divecha

(Paterson Institute for Cancer Research, Manchester) Vectors containing FRB-HA and YFP-FKBP were donated by Drs Takanari Inoue and Professor Tobias Meyer,

University of Stanford. The Rapalogue Heterodimerisation system was used with the permission of ARIAD Pharmaceuticals. The GRP1-PH domain was provided by

Professor Len Stephens (Babraham Institute, Cambridge) and subcloned into pGEX-

4T1 by Dr. Katherine Hinchliffe. 3xATXPHD-GST was provided by Professor Zoya

Avramova (University of Nebraska-Lincoln) and then cloned into pGEX-4T1 by Dr.

Hinchliffe. Plasmids were purified from E.coli using the QIAGEN® QIAPrep® Spin

Mini kit or HiSpeed® Midi kit. The QIAquick® gel extraction kit and EndoFree®

Plasmid Maxi kit were also from QIAGEN®. PfuUltra™ Hotstart DNA polymerase was from Stratagene. Restriction enzymes and 10x digest buffers were supplied by either New England Biolabs (NEB) or Roche. T4 DNA ligase and 10x buffer were from NEB. DNA sequencing was carried out by the University of Manchester sequencing facilities.

L6 cells were purchased from LGC Promochem, supplied by ATCC™. Dulbecco‟s modified Eagle‟s medium (DMEM) and MEM alpha modification (αMEM) were from

PAA laboratories. FBS (foetal bovine serum) was from Sera Laboratories

International (SLI). PBS (phosphate buffered saline) tablets and Trypsin-EDTA were from Gibco. The BCA™ Protein Assay Kit and Slide-A-Lyzer dialysis cassettes were from Pierce. The Amaxa nucleofector kit was from Lonza. Horse Radish Peroxidase

(HRP)-conjugated anti-goat, anti-mouse and anti-rabbit secondary antibodies were from Dako. Streptavidin Alexa Fluor®633 conjugate, ProLong Gold® anti-fade reagent, goat anti-mouse Alexa Fluor® 488 conjugated antibody, Phalloidin Red

(Alexa Fluor® 568), Phalloidin Green (Alexa Fluor® 488) and nuclease free H2O were from Invitogen. BODIPY® PtdIns5P-diC16, unlabelled PtdIns5P-diC16 and

PtdIns3P-diC16, Lipid Carrier 3 and PIP Strips™ (P-6001) were from Echelon

Biosciences. PtdIns(3,4,5)P3 was from Cayman Biochemicals. Rabbit polyclonal anti-rat GLUT4 (sc-7938), mouse monoclonal anti-glutathione S-transferase (sc-

138) and goat polyclonal anti-actin (sc-1616) were from Santa Cruz Biotechnology.

Goat polyclonal PIP4KIIα antibody (ab10929) was from Abcam. Rabbit polyclonal

PIP4KIIβ antibody (AP8042b) was from Abgent. Mouse monoclonal anti-rat GLUT4 antibody (4670-1725) was from AbD Serotec. Mouse monoclonal anti- phosphotyrosine (clone PY20) antibody (P4110), Tetrabutylammonium sulphate

(TBAS), Triethylamine, Phosphatidylserine (PtdSer), Perchloric acid (PCA), 4-(2- aminoethyl benzenesulfonyl fluoride hydrochloride (AEBSF), leupeptin and EZview™

Red Protein G Affinity Gel beads were from Sigma. Bovine serum albumin (BSA),

Cytochalasin-B and streptavidin were from Fluka-Biochemika (Sigma). All Blue

Precision Plus Protein™ standard was from BioRad. 30% Acrylamide solution was from Fisher. EZ-ECL chemiluminescence HRP detection kit was from Geneflow,

Biological Industries. Hybond-C extra reinforced nitrocellulose membrane, Hybond-

P polyvinylidene difluoride (PVDF) membrane, Hyperfilm™ ECL, Glutathione sepharose™ beads and 2-Deoxy-D-[1-3H]glucose were from Amersham

Biosciences. Scintillation fluid (Ecoscint A) was from National Diagnostics. γ32P ATP was from Perkin-Elmer. Thin Layer Chromatography (TLC) plates were from Merck.

Unless stated, all other reagents were of analytical grade.

2.2 Cell biology techniques

2.2.1 Cell culture

L6 myoblasts were grown in αMEM supplemented with 10% FBS, 100 U/ml penicillin and 100μg/ml streptomycin and maintained at 37ºC, 5% CO2. Myoblasts were passaged twice a week. Briefly, adherent myoblasts were rinsed with sterile 1x

PBS to remove all traces of serum, then incubated with trypsin-EDTA for 5 minutes at 37ºC until all cells detached easily. Trypsinisation was stopped by adding fresh

αMEM. Myoblasts were diluted approximately 1:30 in a new 75cm2 flask. For differentiation to myotubes, the αMEM containing 10% FBS was removed after four days and replaced with αMEM containing 2% FBS, 100 U/ml penicillin and 100μg/ml streptomycin. Myoblasts were then left to differentiate in this low medium for a minimum of four days before experimentation.

HeLa(S3) and AD293 cells were maintained in DMEM containing 10% FBS, 100

U/ml penicillin and 100μg/ml streptomycin. Both cell types were passaged in a similar manner to the L6 myoblasts using a dilution factor of 1:10.

2.2.2 Overexpression of proteins in HeLa(S3) cells and L6

myotubes

HeLa(S3) cells were used for transfection of DNA vectors by nucleofection and calcium phosphate precipitation. L6 myotubes are not amenable to these protocols and therefore are infected with adenovirus to overexpress proteins of interest.

2.2.2.1 Nucleofection

Nucleofection was the transfection protocol used for biochemical assays, such as the PtdIns5P mass assay (see 2.4.2). Transfection was carried out using an Amaxa

Nucleofector® and kit R (both Lonza) according to manufacturer‟s instructions.

Briefly, HeLa(S3) cells, between 70-80% confluent, were trypsinised. A small sample was taken to count cells using a haemocytometer and cell counter. The rest were pelleted by centrifugation at 1,000g for 5 minutes. The pellet was resuspended in Nucleofector® solution to give a cell concentration of 1-2x106 cells/100µl solution. 100µl of cell suspension was transferred to a sterile microfuge tube containing 2µg of the DNA to be transfected. The DNA and cell suspension mix was immediately transferred to an Amaxa certified cuvette and placed in the

Nucleofector®. Cells were nucleofected using a HeLa specific programme (I-13).

After nucleofection, cells were suspended in pre-warmed DMEM and transferred to a

6cm dish which was incubated overnight at 37⁰C.

2.2.2.2 Calcium phosphate precipitation transfection

The HeLa(S3) transfected in this manner were generally used for microscopy work.

Culture medium was renewed immediatedly prior to the procedure. DNA-calcium phosphate precipitates were prepared as follows: 1-3µg of DNA was transferred to a 1.5ml microfuge tube and made up to a total volume of 60µl with addition of

250mM CaCl2. 60µl 2x transfection HBS (274mM NaCl, 10mM KCl, 1.4mM Na2HPO4,

15mM D-glucose, 42mM HEPES, pH precisely 7.07) was pipetted into a separate tube. The DNA-CaCl2 mixture was slowly added to the 2x HBS as air was simultaneously bubbled through the mixture with a separate pipette and tip. The mixture was flicked to mix and left to incubate for 20 minutes to allow precipitation of DNA. DNA precipitates were added dropwise to dishes containing coverslips with simultaneous swirling and incubated for 6-8 hours at 37⁰C. After this cells were glycerol shocked by incubation (15% glycerol in sterile PBS) for 90 seconds. Cells were rapidly washed twice with warm PBS before addition of fresh DMEM/FBS.

Transfected HeLa(S3) were incubated overnight at 37⁰C 5% CO2.

2.2.2.3 Recombinant adenoviral transduction

L6 myotubes were grown and differentiated in 3.5cm dishes. LacZ control and

PIP4KIIα recombinant adenoviruses were made by Dr. Katherine Hinchliffe. YFP-

FKBP-Δ37PTPMT1 and FRB-HA viruses were made as described in the molecular biology section (section 2.3). For transduction of L6 myoblasts, the volume of adenovirus suspension (in sterile PBS) giving the desired multiplicity of infection

(MOI) for each dish of cells (for an MOI of 40 this volume was typically between 1-

4μl) was pipetted into sterile tube containing αMEM containing 2% FBS (1 ml/dish).

Cell culture medium was removed and replaced with 1ml of virus-containing medium and left to incubate for two hours at 37⁰C. Dishes were rocked at regular

79 intervals. After this period, 1ml of fresh αMEM (2% FBS) was added to dishes and cells were incubated for 48 hours at 37⁰C (5% CO2).

2.2.3 Fluorescence microscopy

For fluorescence microscopy all light-sensitive incubations were kept in dark conditions.

2.2.3.1 Fixation

Transfected or transduced cells grown on coverslips were fixed with 4% paraformaldehyde (PFA) in 100mM Na2HPO4 solution (pH 7.4) for an hour at room temperature or overnight at 4⁰C. Fixed cells with auto-fluorescent proteins were washed 5 times in PBS and mounted onto slides with ProLong Gold® anti-fade mounting medium (ProLong Gold®)

2.2.3.2 Immunofluorescence staining

Fixed cells were washed 5 times in PBS before permeabilisation in 0.2% (w/v)

Triton X-100 (in PBS) for 5 minutes. After this coverslips were washed again for 5 times in PBS. Cells were blocked in normal goat serum in PBS (2% NGS-PBS) for 1 hour before incubation with primary antibody in NGS-PBS for a further 1 hour at room temperature or overnight at 4⁰C. Cells were then washed 6 times with PBS over a period of 15 minutes before incubation with species-specific and fluorophore- conjugated secondary antibody for 1 hour. After washing again cells could either be counterstained and/or mounted onto slides with ProLong Gold®. The edges of coverslips were sealed with nail polish. Slides were stored in the dark at 4⁰C.

2.2.3.3 Microscopy

Cells expressing auto-fluorescent proteins or stained using the immunofluorescece protocol described above were viewed under an Axiovision widefield fluorescent

80 microscope. Images were captured using a camera system and QCapture Pro software.

2.2.4 Protein Isolation

For protein isolation, myotubes grown and differentiated in 3.5cm cell culture dishes were used unless otherwise stated. A number of different protein isolation methods were employed, depending on the protocol(s) following lysis.

2.2.4.1 Cell lysis with SDS Sample Buffer

After removal of stimulation medium, 200μl of 2x Sodium Dodecyl Sulphate (SDS) sample buffer (160mM tris HCl pH 6.8, 4% (w/v) SDS, 20% glycerol 10µg/ml bromophenol blue, 5% mercaptoethanol) was immediately added to the dishes.

Cell lysate was scraped from the dish using a rubber cell scraper and transferred to a 1.5ml microfuge tube. This was heated for five minutes at 95⁰C before sonication in a bath sonicator to break up genomic DNA. These two steps were repeated if samples remained viscous.

2.2.4.2 Cell lysis with RIPA buffer

Cell culture or stimulation medium was removed and cells were washed with PBS.

Cells were then incubated with 200µl RIPA buffer (10mM Tris pH 7.2, 150mM NaCl,

1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 5mM EDTA, 1mM AEBSF,

10µg/ml leupeptin) on ice for 10 mins. Lysed cells were then scraped from the surface of the dish and transferred to a 1.5ml microfuge tube then spun at 16,000g for 10 minutes at 4⁰C. Protein sample concentrations were determined according to the manufacturer‟s instructions using the BCA™ Protein Assay Kit (Pierce) or where stated, by Bradford Assay (BioRad).

2.2.5 SDS-Polyacrylamide gel electrophoresis (PAGE)

Unless already prepared in 2x SDS buffer, protein samples were mixed 1:1 (v/v) with 2x SDS sample buffer (160mM Tris HCl pH 6.8, 4% (w/v) SDS, 20% glycerol

10µg/ml bromophenol blue, 5% mercaptoethanol) and boiled at 95⁰C for 5 minutes before loading, with 6µl protein standards (BioRad), onto a 10% acrylamide gel.

The gels consisted of a stacking layer set on top of a separating layer (10% acrylamide). Polymerisation of each layer was initiated by addition of 10% (w/v) ammonium persulfate (APS) and N,N,N‟,N‟-tetramethylemediamine (TEMED) in an air-free environment. After sample loading the gel was run in 1x running buffer

(19mM Tris HCl, 191mM glycine, 3.4mM SDS) at 120-150V.

2.2.6 Coomassie blue staining of polyacrylamide gels

Gels were submerged in coomassie staining solution (0.25% (w/v) coomassie blue

G-250, 50% (v/v) methanol, 10% (v/v) acetic acid and incubated for 30 minutes with gentle agitation. The staining solution was then removed and destaining solution (10% (v/v) methanol, 5% (v/v) acetic acid) was added. This was incubated at room temperature with gentle agitation overnight.

2.2.7 Gel drying

Coomassie stained gels were soaked in a mixture of 40% ethanol and 4% glycerol overnight. Drying was carried out in a Bio-Rad vacuum gel dryer according to manufacturer‟s instructions for 2 hours at 80⁰C.

2.2.8 Western transfer

Proteins separated by SDS-PAGE were transferred from the gel to a PVDF membrane in blotting buffer (25mM tris, 190mM glycine, 20% methanol) in a cooled blotting tank for two hours at 250mA.

2.2.9 Western blotting

PVDF membranes were carefully removed from the transfer apparatus taking care to mark the side facing the gel. To confirm the presence of protein, the membrane was briefly stained with Ponceau Red (0.1% Ponceau (w/v), 5% acetic acid (v/v)).

Non-specific binding sites were blocked in milk-TBS-Tween solution (5% fat free milk, 0.05% tween-20 in tris buffered saline (TBS: 50mM Tris pH 7.4, 140mM NaCl) unless otherwise stated, for one hour. The membrane was then incubated with primary antibody in blocking solution for one hour or overnight at 4ºC. Excess antibody was removed by washing 3 times for 5 minutes with 0.05% Tween-20 in

TBS (TBS-T). The membrane was then incubated with secondary antibody in blocking solution for one hour. The membrane was washed 5 times for 5 minutes with TBS-T to remove any excess secondary antibody. The membrane was then incubated with ECL reagent (Geneflow) for 60 seconds before exposure to chemiluminescence sensitive film for 60 seconds to 15 minutes.

2.2.10 Blot stripping and reprobing

To remove primary and secondary antibodies from blots and reuse the membrane for further analysis, the membrane was incubated in stripping buffer (2% SDS in

PBS with 0.7% β-mercaptoethanol for 30 minutes in a 50⁰C water bath. The membrane was washed thoroughly in PBS (until the smell of β-mercaptoethanol had gone) and blocked in blocking solution then reprobed with antibody (see above).

2.2.11 Cell stimulation and phosphotyrosine

immunoprecipitation

L6 cells were grown and differentiated in 10cm dishes (section 2.2.1). Cells were washed once in 1xHBSS and serum starved in αMEM (~4 hours, no FBS) prior to stimulation with 1μM insulin for 5 minutes at 37ºC. A serum starved unstimulated

83 control was also included. Cells were lysed in 1ml Immunoprecipitation (IP) lysis buffer (50mM Tris pH7.4, 150mM NaCl, 1% Triton-X100, 10% glycerol, 1mM

AEBSF, 10μg/ml leupeptin, 1mM Na3VO4). Lysates were scraped from the dish surface, transferred to 1.5ml microfuge tubes and spun at 16,000g for 10 minutes at 4ºC. The supernatant was removed and divided into two samples in fresh microfuge tubes. 1μl of anti-phosphotyrosine (clone PY20) antibody was added to both tubes, samples were then vortexed and incubated on ice for one hour. After this the samples were spun briefly (~30 seconds) at 4ºC before transfer to microfuge tubes containing 20μl of EZview™ Red Protein G Affinity Gel beads

(Sigma). Beads were prepared by washing twice with IP lysis buffer. The samples and beads were mixed by vigorous agitation and incubated with constant rotation at 4ºC for 2 hours. Beads were then pelleted by spinning at 16,000g for 1 minute at 4ºC and the supernatant removed. Beads were washed twice with ice cold IP wash buffer (50mM Tris pH 7.4, 150mM NaCl, 0.1% Triton-X100, 1mM Na3VO4) and once with ice cold TBS. 20µl of 2x SDS sample buffer was then added to the beads and heated to 95ºC for 5 minutes. Bead samples were run on an 8% polyacrylamide gel. Tyrosine phosphorylated proteins were detected by western blotting using the anti-PY20 antibody.

2.2.12 Carrier-mediated delivery of mono-phosphoinositides

L6 cells were grown and differentiated on ethanol-washed 22x22mm coverslips for

BODIPY® PtdIns5P-diC16 visualisation or detection of PtdIns3P-diC16 by FENS-

1FYVE binding domain. For delivery of unlabelled PtdIns5P-diC16 or PtdIns3P-diC16 cells were grown in either 3.5cm or 6cm tissue culture dishes. Myotubes were washed in 1xPBS then serum starved in serum-free αMEM for ~4 hours prior to delivery of either PtdIns5P-diC16 derivative or PtdIns3P-diC16.

2.2.12.1 Lipid-carrier complex formation

For lipid-carrier complex formation, pre-washed glass tubes were used, these were rinsed well with milli-Q water and blotted dry. Phosphoinositide lipid was vortexed and sonicated before the volume of lipid required to give the desired final working concentration, was pipetted into a tube using a silicon-coated tip (VWR international). The CHCl3:CH3OH:H2O (1:2:0.8) solution used to resuspend and store PtdIns5P-diC16 and PtdIns3P-diC16 was dried off using nitrogen gas. Next lipids were resuspended in 20µl autoclaved dH2O and agitated before addition of the same volume of 100µM carrier (carrier 3, Echelon) in dH2O. The lipid-carrier solution was briefly and gently agitated before incubation for 10 minutes. The lipid- carrier solution was then suspended in either pre-warmed 1x HEPES buffered Saline

(HBS -140mM NaCl, 20mM Na-HEPES pH 7.4, 5mM KCl, 2.5mM MgSO4, 1mM CaCl2)

® in the case of the glucose uptake assays or αMEM for BODIPY PtdIns5P-C16 delivery. 1ml of lipid-carrier HBS was used per dish for glucose uptake.

® 2.2.12.2 Delivery of BODIPY PtdIns5P-diC16

25µl of 50µM lipid-carrier solution in αMEM was added to each coverslip, already covered with 100μl serum-free αMEM, (giving a final concentration of 10μM lipid- carrier complex). The 6-well plate was then rocked gently to ensure even coverage of the coverslip. The coverslips were incubated with the BODIPY® lipid-carrier solution in αMEM over a time course of 5, 10, 15, 20 and 60 minutes to establish the optimum incubation time for lipid incorporation into L6 myotubes. After these incubation periods, unincorporated lipid-carrier complex was removed by washing cells twice with PBS. Cells were fixed in 4% PFA in Na2HPO4 overnight and counterstained with 1:40 Alexa Fluor® 568-conjugated Phalloidin:1x PBS before mounting onto slides with ProLong Gold®.

2.2.13 Plasma membrane lawn preparation

Plasma membrane (PM) lawns were prepared using methods adapted from (Ishiki et al., 2005b). L6 cells were seeded onto ethanol washed coverslips in 6 well plates and grown in αMEM containing 10% FBS before differentiation with αMEM containing 2% FBS. Cells were washed once in 1x PBS prior to serum starvation in serum-free αMEM (~4 hours). Cells were incubated with insulin or lipid-carrier complexes in fresh pre-warmed serum-free medium for 20 minutes at 37ºC.

Unstimulated controls were maintained at 37ºC in fresh serum-free medium. After

20 minutes, medium was removed and coverslips were washed twice in ice-cold

PBS before addition of hypotonic swelling buffer (23mM KCl, 10mM HEPES pH 7.5,

2mM MgCl2, 1mM EGTA) in three quick rinses (approx. 5 seconds each). Each coverslip was then covered with 4ml of breaking buffer (70mM KCl, 30mM HEPES pH 7.5, 5mM MgCl2, 3mM EGTA, 1mM dithiothreitol (DTT), 1mM Na3VO4, 1µM

AEBSF, 10µg/ml leupeptin) and this was repeatedly aspirated up and down with a

P1000 gilson pipette to promote cell breakage. Cell debris was removed by washing twice in breaking buffer and finally twice in PBS. PM lawns were then fixed on coverslips in 4% PFA-100mM Na2HPO4 for 1 hour at room temperature.

2.2.14 Staining PM Lawns for microscopy

PM lawns fixed on coverslips in 4% PFA were first rinsed in PBS five times before blocking in 5% BSA for 1 hour. After this, coverslips were incubated with a mouse anti-GLUT4 antibody (ADb Serotec), at a dilution of 1:500 in 2% BSA for 1 hour.

Coverslips were then washed again five times in PBS before incubation with a

1:1000 anti-mouse AlexaFluor488-conjugated antibody (Molecular Probes,

Invitrogen) in PBS for 1 hour. Coverslips were rinsed in the same manner as before and counterstained with wheatgerm-agglutinin (WGA) (Isakoff et al., 1995)

Texas Red conjugate (W21405 invitrogen), 1:1000 in PBS for 20 minutes. (Isakoff et al., 1995;Bertola et al., 2007),. After washing 5 more times, coverslips were

86 mounted onto slides with ProLong Gold and coverslips were sealed with nail polish.

All blocking and incubation stages were carried out at room temperature.

Coverslips were kept in the dark as much as possible during staining with secondary antibody and counterstaining. Slides were stored in the dark at 4ºC.

2.2.15 Quantifying GLUT4 present on PM lawns

Plasma membrane lawns were subsequently visualised on a widefield microscope using a 100x objective and 7 fields per condition were selected at random to be recorded (representative images are shown in figure 3.6 and Figure 4.8: PtdIns5P promotes increased GLUT4 association with the plasma membrane.). As GLUT4 appeared punctuate, it was possible to quantify the amount of GLUT4 using Pixcavator software (Intellegent Perception software), which quantifies areas of fluorescence of a set pixel amount (kept constant throughout the entire Pixcavator analysis step).

The sum of fluorescent spots representing GLUT4 signal from each field was used as one data point for statistical analysis (see section 2.5)

2.3 Molecular biology techniques

2.3.1 Transformation

Competent E.coli cells were defrosted on ice. DNA was transferred to pre-cooled sterile microfuge tubes prior to addition of 200µl E.coli suspension. Bacteria and

DNA were incubated on ice for 30 minutes before heat shock in a 42⁰C water bath for 45 seconds. After heat shock E.coli were incubated on ice for two minutes before addition of 800-1000μl LB-broth (10g/l tryptone, 10g/l NaCl and 5g/l yeast extract), and transferral to a 37⁰C shaker incubator for 1 hour. Transformed bacteria were spread onto pre-warmed antibiotic-containing agar plates (LB plus

1% agar) and incubated overnight at 37⁰C.

2.3.2 DNA isolation

DNA for PCR or transfection was purified from bacterial cultures by QIAprep® mini- prep or HiSpeed® midi-prep kits (Qiagen) respectively, according to kit instructions.

2.3.3 Agarose gel electrophoreisis

0.8% to 1.5% (w/v) agarose was dissolved in 0.5x TBE (70mM Tris, 90mM boric acid, 0.2% v/v 0.5M EDTA pH8.0). The gel was run in 0.5x TBE. DNA was visualised by ethidium bromide staining and exposure to UV light.

2.3.4 Restriction digests

Restriction digests were set up with 1μg DNA and 1 unit restriction enzyme(s) in a total volume of 50µl of optimum 1x restriction digest buffer. In the case of double digests where enzymes had dissimilar cutting efficiencies in the same buffer, sequential restriction digests were performed. Restriction digests were incubated for 1-2 hours or overnight at 37⁰C.

2.3.5 Gel purification

After separation by agarose gel electrophoresis DNA bands were visualised by UV.

Gel containing the relevant DNA bands was cut from the rest of the gel using a fresh razor blade and transferred to sterile 1.5ml microfuge tubes. DNA was purified using a QIAquick® Gel Extraction kit (Qiagen) according to kit instructions.

2.3.6 Ligation

Inserts obtained by PCR amplification and digested with the required restriction enzymes were incubated with the vector of choice employing the molar ratio of 1:3

(insert:vector) in 1x T4 DNA ligase buffer. Ligation was achieved by the addition of

2000 units of T4 DNA ligase (Roche) and incubation overnight at 15⁰C. Ligations

88 were transformed into competent E.coli. Control ligations were performed using cut vector alone.

2.3.7 Primer design

Primers for cloning were designed by first identifying suitable restriction sequences

(e.g. those that did not overlap with previously cloned sequences and would not cut the insert sequence elsewhere). Primer sequences adhered to the following formula to achieve a suitable melting temperature:

Tm (⁰C) = 4 (NC+NG) + 2(NA+NT)

(Where N indicates the number of cytosine (C), guanidine (G), adenine (A) and thymidine (T) bases in the annealing sequence.)

Depending on the restriction enzyme several base pairs were added to the start of the sequence to ensure the success of restriction digests (see section 2.3.4).

2.3.8 Polymerase chain reaction

DNA sequences for insertion into vectors were amplified by polymerase chain reaction (PCR) using Pfu Hotstart DNA polymerase. Reactions were made up to a final volume of 50µl with water and as well as Pfu, contained in total 100ng/µl template DNA, 100ng/µl forwards and reverse primers and 25mM of each dNTP.

Pfu was added after a 5 minute denaturation step at 95⁰C, the rest of the PCR protocol generally proceeded as follows: 30 cycles of 95⁰C denaturation for 30 seconds, Primer Tm -5⁰C for 30 seconds for primer annealing and a 1 minute extension step at 72⁰C for targets ≤ 1Kb. For targets >1Kb a 1 minute per Kb rule was adhered to. In the case of degenerative PCR more cycles were added (up to a total of 40 cycles) and a lower annealing temperature employed to allow binding of the mismatched primer (lower temperature was typically <62⁰C and ≥55⁰C).

2.3.9 Degenerative PCR generation of 2xPHD-ING2 6A K/R

construct pGEX-4T1 vector carrying a GST-tagged tandem repeat of the PHD domain from

ING2 (2xPHD-ING2) was transformed into BL21 E.coli. Degenerative PCR was used to produce a null-binding mutant of the 2xPHD-ING2 construct. Three lysine residues (K73, 75 and 76) and three arginine residues (R78, 79 and 81) were substituted with six alanine residues. These lysine and arginines have been demonstrated to be necessary, but not sufficient, for PtdIns5P binding (Gozani et al., 2003).

Primers for degenerative PCR (see table 2.1) were designed to bind to the first repeat of the 2xPHD-ING2 sequence with the exception of several bases in the downstream primer sequence corresponding to the residues to be substituted with

Restrictio Product Primer pair sequence from 5‟ to 3‟ n Site Vector (in bold) 1xPHDING2 6AK/R CCCCTGGGATCCGCATCC BamHI (K73,75,76 pGEX-4T1 A, CGAATTCCGCCGCTGCTGCCTCCGCTGCT R78,79,81A GTCGCTTCGGTACTTTTG EcoRI ) CGAATTCGCATCCCCTGTCGAGTTTG EcoRI

2xPHD- ATCGGTCGACTCACGCCGCTGCTGCCTCC pGEX-4T1 ING2 6AKR G SalI

GAGAATTCCTACCACCGCATCGACCCC Δ37PTPMT1 EcoRI

(YFP-FKBP- ATATGTCGACCCATACATACATCATGTCTT pEYFP-C1 Δ37PTPMT1 TGAAATGAC SalI generation)

YFP-FKBP- GGCCGCGGCCGCATCATGTCTTTGAAATG Δ37PTPMT1 ACAAAAG NotI pShuttle- (Adenoviru CMV s GGGGTACCACCATGGTGAGCAAGGGC KpnI generation) GGCGTCGACACCATGGGATGTATAAAATC AAA SalI pShuttle- FRB-HA CMV CCCAAGCTTTTATGCGTAGTCTGGTACGT HindIII

Table 2.1: Primer sequences used to amplify template regions of DNA and incorporate desired restriction sites For each product, forwards primers are listed first followed by reverse primers and restriction sites are shown underlined in bold. In the case of the 1xPHDING2 6AKR reverse primer, sites of mutagenesis during degenerative PCR are highlighted in grey.

incorporated the necessary base changes to replace the desired residues with alanines. The single PHD domain containing the 6A K/R mutant amplified by this round of PCR was then ligated into pGEX-4T1. The presence of substituted alanines was confirmed by DNA sequencing. Further primers were designed to incorporate an upstream EcoRI site and downstream SalI site during a second round of PCR.

This PCR product was ligated into pGEX-4T1 vector already containing the 1xPHD

6A K/R sequence. alanine (highlighted in grey, Table 2.1). During PCR the reverse primer

2.3.10 Expression of fusion proteins

Rosetta™ E.coli transformed with pGEX-4T1 vectors expressing recombinant proteins were streaked and grown on agar plates (containing 50µg/ml ampicillin).

From plates, one colony was picked and used to inoculate 50ml of LB containing

50μg/ml ampicillin. This was grown up overnight by incubation at 37ºC with shaking. This overnight culture was used to inoculate 450ml LB broth (50μg/ml ampicillin) and grown at 37ºC (with shaking) until the OD600nm was ≥0.6. At this stage a pre-induction sample was taken and the rest of the culture was induced with 0.1mM Isopropyl β-D-1-thiogalactopyranoside (IPTG) and incubated at room temperature for 6 hours (with shaking). After this incubation stage a post- induction sample was taken. The rest of the cells were then centrifuged at 6,000g for 25 minutes at 4ºC. Pellets were either lysed immediately or stored at -80ºC

91 until needed. For cell lysis, bacterial pellets were resuspended in ice-cold wash buffer (50mM Tris pH 8.0, 150mM NaCl, 5mM MgCl2) and centrifuged at 6,000g for

15 minutes at 4ºC. The remaining pellet was resuspended in lysis buffer (50mM

Tris pH 8.0, 150mM NaCl, 5mM MgCl2, 1% Triton-X, 1% Tween-20, 1mM AEBSF and 10μg/ml leupeptin) on ice. Using a MSE Soniprep 150 probe sonicator, the cell suspension was sonicated on ice for 10x 30 second periods with a 60 second rest period between each. The resulting lysate was then centrifuged at 8,000g for 20 minutes at 4ºC to pellet insoluble material. The supernatant was decanted into a new 50ml tube and kept on ice. An insoluble pellet sample and a soluble supernatant sample were taken at this stage. Glutathione sepharose beads were placed in a 50ml tube and washed three times in wash buffer before addition of the soluble lysate and incubation at 4⁰C for 4 hours with constant rotation. After this incubation period, the beads and lysate were spun at 2,000g for 5 minutes at 4ºC to pellet the beads. The supernantant was then reserved and a sample of beads was taken as a binding sample. The rest of the beads were loaded onto a column and washed with 10 column volumes of wash buffer and 10 column volumes of

PBS. The bound 2xPHD-ING2-GST proteins were released from the beads by adding elution buffer (10mM glutathione in 50mM Tris pH 8.0 with 1mM AEBSF and

10μg/ml leupeptin) six times with a 5 minute interval between each addition.

Individual fractions were collected in fresh microfuge tubes each time. The elutions, along with the binding, soluble, insoluble, pre- and post-induction samples were run on 10% acrylamide gels. Proteins were visualised by coomassie staining (see

2.2.6).

2.3.11 Clean up and biotinylation of 2xPHD-ING2 and its null-

binding mutant 2xPHD-ING2 6A K/R

2.3.11.1 Dialysis and concentration

Dialysis of the fractions containing 2xPHD-ING2-GST protein was carried out overnight at 4⁰C in Slide-A-Lyzer dialysis cassettes (Pierce) suspended in ice-cold

1xPBS (with several buffer changes). Samples were then transferred to Centriprep

Ultracel YM-10 concentration devices (Millipore) and spun at 3,000g for 10 minutes at 4⁰C. A small sample of each protein was then assayed using the BCA™ protein assay kit (Pierce).

2.3.11.2 Biotinylation

Biotinylation was carried out using the BiotinTag™ micro-biotinylation kit (Sigma).

Briefly, 1mg/ml BAC-SulfoNHS in 0.1M sodium phosphate buffer, pH 7.2 (0.6%

DMSO (v/w) added first to help resuspension) was incubated with protein samples

(3.3mg/ml) at a molar ratio of 13:1 BAC-SulfoNHS:Protein. This was incubated for

30 minutes at room temperature with gentle stirring. Labelled protein was isolated using the G-50 Sephadex Micro-spin column provided with the kit. After biotinylation, PHDING2 proteins were mixed 1:1 in glycerol and stored at -20⁰C.

Protein concentration was assayed by BCA™ assay kit

2.4 Biochemical assays

2.4.1 2 Deoxy-D-glucose uptake assay

Glucose uptake experiments were carried using methods adapted from the literature (Kraegen et al., 1993;Robinson et al., 1993;Chen et al., 2005;Bertola et al., 2007). L6 myotubes were grown and differentiated in 3.5cm dishes. Prior to the assay, cells were washed once in 1x PBS before serum starvation in serum-free

αMEM for ~4 hours. After the starvation period, cells were washed once with HBS

93 pre-warmed to 37ºC. Experiments were carried out in HBS. After 20 minutes incubation with or without stimulation with 100nM insulin, 500µl 2x deoxy-glucose

(DOG) solution containing 2mM unlabelled 2-deoxy-D-glucose and 2µCi/ml 2- deoxy-D-[1-3H]-glucose in HBS was added to the cells for 10 minutes and plates were kept at 37ºC. After 10 minutes, glucose uptake was stopped and unincorporated radioactivity removed by immediate removal of the DOG solution and rapid washing three times with ice-cold HBS. Myotubes were then lysed in

300µl 0.1% Triton-X, 0.1% SDS in PBS for 30 minutes under constant agitation.

The cell lysates were scraped from the dish and transferred to scintillation vials. A further 200µl of the 0.1% Triton-X, 0.1% SDS lysis buffer was used to wash the dishes of any residual lysate, this was then transferred to the relevant scintillation vial. Scintillation fluid (EcoScint A) was then added to the lysates and incorporated radiation was measured by scintillation counting. Non-specific glucose uptake was determined in the presence of 10µM cytochalasin-B (pre-incubated for 30 minutes and present throughout). Incubation with cytochalasin B prevents further insertion of both GLUTs 1 and 4 to the plasma membrane by arresting cytoskeletal rearrangements and preventing their translocation. Its presence enables the measurement of basal glucose uptake (Chen et al., 2005). All experiments were carried out in triplicate and results were normalised to protein amount determined by the BCA™ protein assay.

2.4.2 PtdIns5P mass assay

The method for PtdIns5P mass assay described here was adapted from (Morris et al., 2000) and (Roberts et al., 2005).

2.4.2.1 Lipid Extraction

Lipids were extracted by two-phase lipid extraction (see Figure 2.1 and(Bligh and

Dyer, 1959) L6 myotubes were grown and differentiated in 6cm dishes. Cells were washed in 1x PBS and serum starved for ~4 hours in serum-free αMEM before

Figure 2.1: Two-phase lipid extraction

In step (i) L6 myotubes in 6cm dishes are lysed (1.) with 1.2M HCl and the lysate transferred to tube #1, the dish is then rinsed with (2.) CH3OH and this is also added to tube #1. 3. CHCl3 is then added to tube #1 and this solubilses the lipids and separates them from the rest of the cell lysate, this is the organic lower phase. This is transferred to tube #2 in step (ii). 4. TUP (theoretical upper phase) is then added to tube #2 which further separates the lipids from any carried over lysate, the lower phase from this tube is transferred to tube #3 in step (iii). 5. TLP (theoretical lower phase) is added to tube #1 and this is transferred to tube #2 in step (iv). The resulting lower phase is then collected in tube #3 in step (v). These latter transfer steps (iv and v) help to increase the yield of extracted lipid.

stimulation. Dishes were then placed on ice and the reaction stopped by removal of medium by aspiration. Following this, cells were washed in ice-cold PBS then lysed in 450µl 1.2M HCl. The cell lysates were scraped from the dish and with the HCl, transferred to 1.5 ml microfuge tubes (#1). Dishes were further rinsed with 600µl methanol and this was transferred to the same microfuge tubes. 500µl of chloroform was then added to the tubes before all samples were agitated well using a vortex mixer and spun at 16,000g for 1 minute. The lipids were extracted using a two-phase method (Bligh and Dyer, 1959) in which the mixture in the tubes separates into an aqueous upper phase and a lower organic phase, containing the lipids The lower organic phase were carefully transferred to new microfuge tubes

(#2) and 900µl theoretical upper phase ((TUP) 3:48:47 (v/v), CHCl3: CH3OH: 1M

HCl) added, vortexed and spun at 16,000g for 1 minute. The resulting lower phase were carefully transferred to fresh microfuge tubes (#3). 450µl theoretical lower phase ((TLP) 86:14:1 (v/v), CHCl3: CH3OH:1M HCl) was added to the first tubes

(#1) containing the original upper phase and interface proteins. These were then

95 vortexed, spun and the lower phase transferred to the second microfuge tubes

(#2). These were again vortexed and spun and the lower phase transferred to the final microfuge tubes (#3) already containing the previously obtained lower phase.

Lipid samples were dried down in a vacuum centrifuge for 60 minutes and when necessary stored under nitrogen gas at -20ºC to prevent unwanted oxidation of the lipids.

2.4.2.2 Purification of phosphoinositides

Neomycin-coated beads were prepared as described by (Schacht, 1978). 50µl suspensions of neomycin beads were placed in glass vials. They were prepared for purification of phosphoinositides by spinning at 4,000g for 30 seconds and washing once with 400µl 5:10:2 (v/v), CHCl3: CH3OH: H2O, once with 5:10:2 CHCl3:

CH3OH:0.5M formate and once again with the first solution. After spinning the beads and removing the last wash with a Hamilton syringe, they were resuspended in 50µl formate buffer (5:10:2 (v/v) CHCl3: CH3OH: ammonium formate (final concentration: 50mM)). Dried lipid samples obtained from lipid extraction were resuspended in 600µl formate buffer and some of this was reserved for a phosphorus assay (see 2.4.3). Resuspended lipid samples were incubated with the beads for 1 hour. After this, samples were spun at 4,000g for 1 minute and the supernatant carefully removed and discarded. The beads were then washed twice with 50mM formate buffer. The phosphoinositides were then eluted by adding

400µl freshly prepared triethylbicarbonate (TEAB) made up of 2:6:3 (v/v) CHCl3:

CH3OH: 2M triethylamine, giving a final concentration of 0.55M triethylamine.

Triethylamine solution is prepared by bubbling CO2 through a mixture of 14ml H2O and 36ml triethylamine. PtdSer was also added to the TEAB to a final concentration of 14.25µM; this acts as an inert carrier for the elution step. For phosphoinositide elution, the beads were incubated for 1 hour, spun again at 4,000g and the supernatant transferred to a microfuge tube and reserved. Another 100µl TEAB-

PtdSer was added to the beads and the elution procedure repeated. The resulting

96 supernatant was pooled with the first and the samples placed in a vacuum centrifuge overnight to ensure complete drying of the lipids.

2.4.2.3 Radiolabelling of PtdIns5P

The dried lipids were resuspended in 50μl diethylether, then, 50μl tris-HCl pH 7.4 was added. This was sonicated, briefly centrifuged and shaken to redistribute. A vacuum centrifuge was used to remove the diethylether which evaporated after 7 minutes centrifugation. 30μl PIP kinase buffer (50mM tris-HCl pH 7.4, 80mM KCl,

10mM Mg-acetate, 2mM EGTA) along with 2μl of a bacterially expressed human recombinant PIP4KIIα (0.1μg from a glycerol stock diluted to 10μg protein/ml with

PIP kinase buffer) were then added to each of the samples. PIP4KIIα specifically phosphorylates PtdIns5P to PtdIns(4,5)P2 by addition of a phosphate group at the

D4 position of the inositol ring. Phosphorylation of PtdIns5P was initiated by addition of 2μCi γ32P ATP (Perkin Elmer) and 5μM ATP (Sigma) to each sample.

Samples were incubated at 30ºC overnight after which 500μl 1:1 (v/v) CHCl3:

CH3OH with 1μl/ml Folch lipids (a preparation of phosphoinositides from porcine brain – Sigma) was added to quench enzymatic activity. The samples were then split into upper and lower phases by addition of 125μl 2.4M HCl, vortexing well and spinning briefly. The lower phases were removed and placed into fresh microfuge tubes and 400μl TUP was added to each of these. The lipids were then extracted using the two-phase method described above (section 2.4.2.1). However, instead of 450μl TLP, 150μl chloroform was added to tube #1, during the second round of lower phase extractions. The resulting lipid extracts were dried in a vacuum centrifuge for ~1 hour.

2.4.2.4 Thin layer chromatography

A thin layer chromatography (TLC) tank, lined with Whatman 3MM chromatography paper, was equilibrated with 28:40:10:6 (v/v) CHCl3:CH3OH:H2O:Ammonia solution for 2 hours. Silica-coated TLC plates (Merck) were dipped in 50% (v/v) CH3OH, 1%

(w/v) potassium oxalate, 2% EGTA and dried in an oven at 110ºC for at least 1 hour before use. Dried lipid samples were resuspended in 25μl CHCl3 and slowly spotted onto the origin, 2cm from the bottom of the plate. A further 10μl CHCl3 was added to the sample tubes and spotted at the same points to make sure all traces of lipids had been spotted on the plate. Once all the spots had dried the plate was carefully placed in the TLC tank and left to run undisturbed for 1-2 hours, until the solvent line had progressed further than 16cm up the plate. The plate was then removed from the tank and left to dry in a fume hood before being covered with clingfilm and exposed to a phosphoimaging plate overnight. The phosphoimaging plate was then removed and read by a FujiFilm FLA 3000 radioisotope imager. The intensities of the PtdIns(4,5)P2 spots were measured using AIDA software and normalised to amount of lipid phosphate obtained by phosphorus assay (see section 2.4.3). The TLC plate was further exposed to X-ray sensitive film overnight at -80ºC to record an image of the TLC plate – this low temperature is required for optimum function of the radio-signal enhancing screen in the imaging cassette.

2.4.3 Phosphorus assay

Three 30μl aliquots of lipid samples (from lipid extraction) resuspended in formate buffer were placed in glass tubes and dried at 100ºC for 1 hour. Standards of

0.25μg and 0.5μg phosphorus (from a stock of 100µg P/ml HNa2O4P) were also prepared in glass tubes. 220μl 70% perchloric acid was then added to each glass tube in the fume hood and incubated at 170ºC for 1 hour. After this, samples were left to cool before a mixture of 1ml H2O, 600μl 0.833% ammonium molybdate and

200μl 10% ascorbic acid was added to each of the tubes and incubated at 100ºC for 7 minutes. The samples were left to cool before transferral to cuvettes. The absorbance of the samples was read at 820nm using H2O as a reference solution.

2.4.4 PtdIns(3,4,5)P3 Assay

A protein-lipid overlay method has been used to detect PtdIns(3,4,5)P3 in several publications (Furutani et al., 2006 and Guillou et al.,2007a and b). These methods were adapted to measure PtdIns(3,4,5)P3 extracted from L6 myotubes.

2.4.4.1 Lipid extraction

L6 myotubes were grown in 3.5cm dishes. Following stimulation, reactions were terminated by removal of medium and immediate addition of 250µl 1M HCl whilst on ice. Cells were scraped from the dish surface, and with HCl, transferred to 2ml microfuge tubes. Dishes were then rinsed with 680ul HCl-methanol containing

TBAS solution (1M HCl:Methanol:5M TBAS) and this was transferred to the same tube as the HCl lysates. 1ml of CHCl3 was then added to split the samples into two phases and agitated vigorously using a vortex mixer before spinning at 10,000g for five minutes. Lipids were extracted using the two-phase lipid extraction protocol

(see section 2.4.2.1) with the following modifications to the theoretical lower and upper phases: lower phase: 0.8:1:2 Methanol:Chloroform:TBAS-Na2EDTA (0.1M

HCl, 5mM TBAS, 5mM Na2EDTA). Upper phase: 1:1.35:2.65 TBAS-

Na2EDTA:Methanol:Chloroform. Lower phases were pooled and dried under vacuum at 37⁰C.

2.4.4.2 Neomycin purification of phosphoinositides

Purification of phosphoinositides from the lipid extract was achieved using the same method as the PtdIns5P mass assay (section 2.4.2.2) with the minor modification of

PtdSer being excluded from the TEAB elution buffer. The phosphoinositide extract was dried down overnight under vacuum at 37⁰C.

2.4.4.3 Protein-lipid overlay assay

Dried phosphoinositide extracts were resuspended in 200:100:1 (v/v/v)

Chloroform:Methanol:1.2M HCL and spotted onto a reinforced nitrocellulose membrane (Amersham). Non-specific binding was prevented by blocking in 2% BSA in TBS-T for one hour. The membrane was then incubated overnight at 4⁰C with

0.5μg/ml of purified and bacterially expressed GST-tagged GRP-1-PH domain

(prepared as described in section 2.3.10), a specific PtdIns(3,4,5)P3 binding construct (Venkateswarlu et al. 1998). The bound protein was detected by incubation with anti-GST antibody (1:500) in 2% BSA TBS-T and (after washing)

HRP-conjugated secondary antibody (1:2000) followed by incubation with ECL reagents and exposure to chemiluminescence sensitive film. The intensity of each

PtdIns(3,4,5)P3 spot detected on the film was measured by 2D densitometry using AIDA software , including those of a standard curve from 0-200 pmol PtdIns(3,4,5)P3. The amount of PtdIns(3,4,5)P3 in pmols in each sample was then calculated and this was normalised to total lipid phosphate. Data was then expressed as a percentage of T0 average

2.5 Statistical analyses

At the conclusion of assay experiments, data was grouped under each experimental condition, (i.e. unstimulated, 100nM insulin stimulated). Mean and mean standard error (S.E.M.) were calculated using the whole data (i.e. mean and S.E.M. were not calculated for each individual experiment, typically performed in triplicate).

Therefore, each n number represents an individual data point. Experimental groups were then compared using an unpaired, two-tailed Students t-test via Prism® software (GraphPad Software Inc.) to calculate P values and test for significance.

100

3 Results I: Characterisation of L6 Myotubes

101

For several decades the L6 skeletal muscle cell line has proved to be a very useful system for studying aspects of skeletal muscle biology, including insulin-stimulated glucose uptake (Bechtel, 1979;Graber and Woodworth, 1986;Mitsumoto et al.,

1991;Balogh et al., 1993;Robinson et al., 1993;Tsakiridis et al., 1995;Wang et al.,

1999). In this field in particular, the rat L6 cell line has the advantage over other skeletal muscle cell lines such as mouse C2C12. Whilst reaching a lower stage of differentiation than C2C12, lacking the cross-striations and T-tubules the latter achieves (Portier et al., 1999), only L6 myocytes express functional GLUT4, a significant characteristic due to the properties of GLUT4 as discussed in the introduction (section 1.1).

Cell lines, such as L6, make possible the investigation of the direct effects of isolated factors (such as insulin) on a genetically identical population of skeletal muscle cells. They therefore have some benefit over in vivo assessment of insulin- stimulated glucose uptake or glucose uptake observed in ex vivo preparations of skeletal muscle. However, this advantage is at the expense of a loss of some skeletal muscle characteristics (Portier et al., 1999). As the L6 cell line was a novel cell line in the research group, first employed for use in this project, it was principally important to establish the skeletal muscle characteristics, insulin- sensitivity and glucose uptake capability exhibited by the L6 myotubes used here.

3.1 L6 myoblasts display morphological differentiation to multinucleate myotubes

L6 myoblasts (Figure 3.1 A and D) were cultured and grown in αMEM containing

10% FBS until reaching high confluency (90-100 %). When myoblasts were seeded at a 1:10 dilution, desired confluency was usually achieved on or by the fourth day after culturing (Figure 3.1 A), the serum concentration was then dropped to 2% to induce differentiation.

102

Figure 3.1 Morphological differentiation of L6 myoblasts to multinucleate myotubes. A-C shows L6 myocytes at 4 (A), 8 (B) and 14 days (C) after passage on a light microscope (40x magnification). Myoblasts are grown in 10% FBS-containing αMEM until day four (A) or until cells are approximately 100% confluent. At this point this medium is replaced by 2% FBS- containing αMEM to induce differentiation (B and C). To distinguish multinucleate cells from those containing single nuclei, myoblasts (D) and myotubes (E and F) were incubated with Texas-Red conjugated wheatgerm-agglutinin (1:250) on ice before fixation and counterstaining with DAPI. Images were taken on an widefield fluorescence microscope using the x100 objective. Scale bars shown are 20µM. Images are representative of the whole cell population. White arrows have been used to indicate and emphasise the presence of DAPI stained nuclei.

103

The cells were then grown for at least ten days after this initial change of medium and changes in morphology were observed and recorded (Figure 3.1 A-C).

Morphologically, successful differentiation of myocytes is characterised by cell alignment, elongation, fusion and formation of multinucleated myotubes (Yaffe,

1969). The L6 myoblasts used throughout this project display such morphological changes over a period of ten days (figure 3.1 A-C), developing into elongated cell structures during this time. In addition to this dramatic change in appearance, plasma membrane staining with wheatgerm-agglutinin whilst counterstaining with the DAPI nuclear stain, shows they become multinucleate (figure 3.1, E and F).

3.2 Myotubes are molecularly distinct from myoblasts

In addition to these significant morphological changes, myoblasts undergo alterations in gene and protein expression during the differentiation process

(Graber and Woodworth, 1986;Mitsumoto et al., 1991;Balogh et al., 1993), modifying their molecular expression profile as they become functionally specialised. To examine initially whether the L6 cells used in this project reached a higher level of molecular differentiation, the expression of GLUT4 was examined.

To assess the relative levels of GLUT4 expression in myotubes compared to myoblasts, immunoblotting for GLUT4 was done with cell lysates from fourteen- day-old and four-day-old cells respectively (Figure 3.2). It was found that both myoblasts and myotubes express GLUT4; however, the latter expresses much higher levels of this protein. This indicates that the myotubes used here are not only morphologically distinct from myoblasts, they are molecularly distinct also.

104

Figure 3.2: Western blot showing GLUT4 expression in both L6 myoblasts and myotubes. L6 myoblast (4 days after passage) and myotube (14 days after passage) lysates were separated by SDS-PAGE and transferred to PVDF membrane. After blocking of non- specific binding sites, the membrane was incubated with anti-GLUT4 antibody before detection with HRP-conjugated secondary antibody and chemiluminescence (upper panel). The membrane was then stripped and re-probed with anti-actin antibody before detection in the same manner (lower panel).

105

3.3 Tyrosine phosphorylation is enhanced in L6 myotubes stimulated with insulin

Along with morphology and GLUT4 expression, the insulin-sensitivity and insulin- signalling properties of the myotubes used in this project also needed to be characterised. The introductory chapter of this thesis overviewed the major signalling events in the PI3-kinase dependent insulin-signalling cascade involved in

Figure 3.3 Enhanced tyrosine phosphorylation in L6 myotubes in response to 1μM insulin. L6 myotubes were serum-starved for 4 hours before incubation with or without 1µM insulin for 5 minutes. Tyrosine phosphorylated proteins were immunoprecipitated from cell lysates using an anti-phosphotyrosine antibody (as described in section 2.2.11). Immunoprecipitates were separated by SDS-PAGE before western transfer and immunoblotting with the same antibody used in the immunoprecipitation step. This was followed by detection with a HRP-conjugated secondary antibody and enhanced chemiluminescence reagent. Arrows shown indicate protein candidates of prominent bands (FAK = focal adhesion kinase) and the presence of the heavy and light chains of the immunoprecipitating antibody. Protein amounts were normalised by loading the same amount of protein extract (as calculated using results from the the BCATM protein assay).

106 glucose uptake. It showed that many of these events involve activation of effector proteins via tyrosine phosphorylation. To examine whether and to what extent protein tyrosine phosphorylation occurs in L6 myotubes in response to insulin, an anti-phosphotyrosine antibody was used to immunoprecipitate proteins possessing phosphorylated tyrosine residues. Immunoprecipitation was carried out using lysates of myotubes incubated with or without 1μM insulin for 5 minutes at 37⁰C following serum-starvation for 4 hours. After immunoblotting, using the immunoprecipitating antibody for the primary antibody, an enhanced level of tyrosine phosphorylation was detected in the myotubes stimulated with insulin

(Figure 3.3). Prominent bands at around 95, 120 and 180 kDa were seen in the precipitates from the insulin stimulated cells. The 95kDa and 180kDa proteins are most likely to be the β subunit of the IR and one of the IRS proteins, namely IRS-1 respectively. These two proteins are covered in some detail in the introductory chapter. The very prominent band at 120kDa (which has undergone bleaching due to an abundance of ECL substrate) is most like to represent focal adhesion kinase

(FAK). FAK is a plentiful skeletal muscle protein that undergoes phosphorylation in response to insulin (Goel and Dey, 2002) Interestingly FAK has been very recently reported to interact with a PI3-kinase (Itoh et al., 2010), but this interaction was not looked at here.

3.4 Insulin stimulation of class I PI3-kinase in L6 myotubes

As discussed in section 1.1.5, class I PI3-kinase activation follows activation of the insulin receptor and its insulin receptor substrates by tyrosine phosphorylation.

The most direct way of showing PI3-kinase activation is to measure the levels of its product, PtdIns(3,4,5)P3, but doing so is made difficult by the low relative amounts of PtdIns(3,4,5)P3 in comparison to other phosphoinositides (Guillou et al., 2007b).

For example, even in circumstances of heightened activation of the PI3-kinase pathway, the level of PtdIns(3,4,5)P3 only amounts to ~5% of total polyphosphoinositides. Indirect measurements of PI3-kinase activation, such as

107 looking at the activation of its downstream effector, Akt or subcellular localisation of green fluorescent protein (GFP)-tagged PH domain probes, prove to be extremely useful (Gray et al., 1999;Hagren and Tengholm, 2006;Donahue et al., 2007) but are not directly proportional to PtdIns(3,4,5)P3 amount. This is important to consider as current theories on PI3-kinase activation suggest the amount and duration of PtdIns(3,4,5)P3 production to be unique to the type of PI3-kinase activation (i.e. activation by PDGF versus insulin -(Tengholm and Meyer, 2002).

Currently the methods of directly measuring PtdIns(3,4,5)P3 consist of

3 32 radiolabelling of the phosphoinositide either by [ H]inositol or [ P]Pi followed by detection using HPLC (Kelly et al., 1992;Arcaro and Wymann, 1993), detection with commercially available ELISA kits (Costa et al., 2007) or detection by protein-lipid overlay using a PtdIns(3,4,5)P3 specific binding domain (Guillou et al., 2007a). The latter method makes possible the detection of PtdIns(3,4,5)P3 in just a few days in the absence of HPLC availability and avoids the cost of expensive ELISA kits. It employs a recombinant GST-tagged GRP1 PH domain which binds PtdIns(3,4,5)P3 specifically when the lipid is spotted onto PVDF membrane (Guillou et al.,

2007a)and see also section. 2.4.4). This binding protein can be prepared cheaply and easily by expression in E.coli and subsequent purification. To profile

PtdIns(3,4,5)P3‟s response to insulin in L6 myotubes, samples were serum-starved and incubated with or without insulin for a range of time points (see figure 3.4) before lipid extraction, phosphoinositide purification and then protein-lipid overlay

(Figure 3.5 A and B). Levels of PtdIns(3,4,5)P3 significantly increased 4.6-fold above basal by the 2-minute time-point (± 1.3-fold) and continued to remain elevated for at least another 13 minutes; the 15-minute time-point shows levels of

PtdIns(3,4,5)P3 6.9-fold above basal (± 2.7-fold,). Interestingly, the 10-minute time point shows a more modest PtdIns(3,4,5)P3 elevation (3.7-fold above basal, ±

1.4-fold). The level of PtdIns(3,4,5)P3 drops back to one comparable to that of basal by 20 minutes (0.3-fold increase ± 0.13-fold, n=5).

108

B *

** *†

Figure 3.4 PtdIns(3,4,5,)P3 increase in response to insulin in L6 myotubes over a 30 minute time course. L6 myotubes were serum starved for 4 hours prior to stimulation with 100nM insulin from 0-30 minutes. Lipids were then extracted and phosphoinositides purified from this using neomycin bead purification (see chapter 2, section 2.4.4) The phosphoinositide extract was then spotted onto reinforced PVDF membrane and PtdIns(3,4,5)P3 detected using the GST- tagged GRP1-PH domain and in a protein overlay experiment (a representative image is shown in A). Mean data from all experiments are expressed as a percentage of T0 average (B). Error bars represent S.E.M. **P<0.01, n=6, *†P<0.05, n=6, * P<0.05, n=4.

109

3.5 L6 myotubes show enhanced Akt phosphorylation in

response to stimulation with insulin.

After activation of PI3-kinase and subsequent production of PtdIns(3,4,5)P3, the phosphoinositide acts by recruiting Akt to the plasma membrane where it undergoes activation (as discussed in 1.1.6). Briefly, Akt undergoes phosphorylation on two amino acid residues, S473 and T308 in response to agonists and subsequent PI3-kinase activation in many tissues. To assess whether this specifically occurs in response to insulin in L6 myotubes, immunoblotting for phosphorylated S473 and T308 was carried out using lysates from unstimulated myotubes or those stimulated with 100nM insulin for 5 minutes (figure 3.5). A protein loading control using an antibody against all three isoforms of Akt (pan-Akt)

Figure 3.5: 100nM insulin enhances Akt phosphorylation on both S473 and T308 residues in L6 myoblasts. Western blots showing Akt phosphorylation after serum-starvation and 5 minutes insulin stimulation (100nM) using anti-phospho-S473 (top panel) and anti-phospho-thr308 (central panel) to show both S473 and thr308 phosphorylation respectively. A protein loading control using an antibody against all three isoforms of Akt (pan-Akt) was included (bottom panel); for this, each blot was stripped and re-probed with the pan-Akt antibody. The blot shown is representative of both S473 and T308 re-probed blots.

110 was also done after stripping and re-blocking each blot. Both residues were found to be phosphorylated upon insulin stimulation (figure 3.5, top and central panels).

This was not due to a difference in Akt levels between the samples as the protein loading control showed a similar intensity of bands representing pan-Akt from both unstimulated insulin and insulin stimulated samples (figure 3.5, bottom panel).

3.6 Insulin induces GLUT4 translocation to the plasma membrane in L6 myotubes

The acute effect of insulin stimulation of skeletal muscle and adipose tissue is the rapid increase in their capacity to take up glucose. This is fundamentally achieved on a cellular level by the increased presence of GLUT4 at the plasma membrane.

Looking at the general presence of GLUT4 at the plasma membrane is a good indicator of the insulin-sensitivity and glucose uptake capability of a cell population.

Furthermore, as the entirety of the insulin signal has yet to be made clear, possessing a method of measuring GLUT4 translocation, i.e. an end-stage „product‟ of insulin stimulation, supports any previous upstream signal characterisation or

„input‟ of insulin stimulation.

There are several ways of assessing GLUT4 translocation, with some being more difficult than others or dependent upon resources not yet commercially available.

However, the basic principal of such methods remain the same, they each provide a way of differentiating cytosolic GLUT4 from plasma membrane associated GLUT4.

One way this can be achieved is to remove the cytosolic component of a population of sample cells grown on coverslips by swelling and breaking them open using hypotonic buffers and vigorous agitation (see section 2.2.13). This protocol describes the initial stages of GLUT4 translocation assessment by plasma membrane lawn preparation, a method which is sometimes used in the field of

GLUT4 dynamics (Martin et al., 1998;Sweeney et al., 1999;Rudich et al.,

2003;Sweeney et al., 2004;Ishiki et al., 2005a).

111

Here, after stimulation with or without 100nM insulin prior to lawn preparation and fixation, lawns were then stained using an anti-GLUT4 antibody (monoclonal mouse antibody, AdB Serotech) followed by a FITC-conjugated secondary antibody.

(±0.55-fold) over basal (see figure 3.6).

To check the coverage and presence of plasma membrane after the lawn preparation process, control experiments were also performed where coverslips were incubated with a plasma membrane stain, wheatgerm-agglutinin conjugated with Texas-Red. The majority of plasma membrane coverage on several coverslips was first assessed by eye before several images were recorded; a representative image is shown in figure 3.6 C. This control confirms the presence of plasma membrane lawn which covers over 95% of the coverslip post-lawn production and supports the analytical method of random field selection and whole field GLUT4 quantification.

3.7 Glucose uptake in response to both 100nM and 1μM

insulin

To complete a comprehensive characterisation of the L6 myotubes used in this project their glucose uptake in response to insulin stimulation needed to be investigated. At the outset of this project no previous glucose uptake measurements had been performed by the research group, so extensive work was done to set up a working glucose uptake assay (section 2.4.1) using protocols described in the literature (Kraegen et al., 1993;Robinson et al., 1993;

112

Figure 3.6: Insulin enhances GLUT4 translocation to the plasma membrane. L6 myotubes were starved for 4 hours prior to stimulation with or without 100nM insulin. This was followed by plasma membrane lawn preparation and staining with anti-GLUT4 antibody and then FITC-conjugated secondary antibody (as described in section 2.2.14). Panels A and B show representative images of lawns from untreated and insulin-stimulated myotubes (scale bar represents 30μm). Panel C also shows a representative image of lawns stained with the plasma membrane stain, Texas-red conjugated wheatgerm- agglutinin. All were viewed using a widefield fluorescent microscope under 100x objective. Panel D shows the average of quantified GLUT4 fluorescent areas from lawns of untreated (-) and 100nM insulin-stimulated (+) myotubes. Data is representative of two experiments, where 7 fields were selected at random for quantification from each experiment. Error bars represent S.E.M, (**P<0.01, n=14).

113

(Kraegen et al., 1993;Robinson et al., 1993;Sweeney et al., 2004;Chen et al.,

2005;Bertola et al., 2007). Using 100nM and 1μM concentrations of insulin, serum- starved myotubes were stimulated for 20 minutes to assess their responding levels of glucose uptake enhancement. It was found that stimulation with 100nM insulin produced a response 2-fold larger than basal (± 0.18-fold) where stimulation with

1μM insulin produced a response of 2.2-fold above basal (± 0.48-fold). These similar responses highlight the efficacy of the 100nM concentration of insulin at increasing glucose uptake, which is supported by its predominant use in the literature. (Robinson et al., 1993;Sweeney et al., 1999;Sweeney et al., 2004;Ishiki et al., 2005a;Chang et al., 2007). The 100nM concentration of insulin was used for all glucose uptake assays after this initial characterisation experiment in this project.

Figure 3.7: L6 myotubes glucose uptake in response to 100nM and 1μM concentrationsof insulin. After 4 hours serum starvation, L6 myotubes were stimulated with 100nM or 1μM Insulin or

left with no insulin stimulation for 20 minutes. After incubation with a 3H deoxy-glucose cocktail for 10 minutes before thorough washing and cell lysis, glucose uptake was

determined by scintillation counting. Counts were converted to pmols of glucose and this was normalised to protein concentration. Data shown is the average mean of 9 results and

error bars representative of S.E.M. *P<0.05, n=9.

114

3.8 Summary of results I

The L6 rat skeletal muscle cell line has been frequently used to investigate the mechanisms involved in glucose uptake in skeletal muscle tissues (Mitsumoto et al.,

1991;Robinson et al., 1993;Rudich et al., 2003;Sweeney et al., 2004;Antonescu et al., 2008b) but had not previously been used by this research group. Therefore, it was important to build on knowledge found in the literature through characterisation of the cell line‟s differentiation, signalling and glucose uptake capabilities for this project.

Morphological differentiation was confirmed by DAPI staining of multi-nucleate myotubes (figure 3.1) and supported by the observation that GLUT4 expression increases after differentiation (figure 3.2). This is in agreement with an earlier study that investigated the expression of different muscle cell markers in both L6 myoblasts and myotubes (Mitsumoto et al., 1991).

Differentiated L6 myotubes display activation of major components of the PI3- kinase dependent arm of the insulin signalling pathway to GLUT4 mobilisation. For instance, they undergo a massive enhancement of tyrosine phosphorylation in response to 1μM insulin (figure 3.3) and show an increase in PtdIns(3,4,5)P3 production and Akt phosphorylation at the lower concentration of 100nM insulin.

This concentration of insulin also significantly enhances glucose uptake in L6 myotubes. These observations are in agreement with the literature (Robinson et al.,

1993;Tsakiridis et al., 1995;Wang et al., 1999), which confirms the use of the L6 cell line in this project as a reliable skeletal muscle cell model.

115

4 Results II: Investigating a potential role for PtdIns5P in insulin stimulated events in L6 myotubes

116

PtdIns5P was first introduced in section 1.2.2 of the opening chapter of this thesis, in which several key points regarding this phosphoinositide were discussed. It was highlighted that PtdIns5P is the least well-characterised member of the phosphoinositide family and that presently few physiological stimuli are known to alter its levels. One physiological stimulus however, is the pleiotropic hormone insulin, found to transiently increase PtdIns5P levels in 3T3-L1 adipocytes and CHO-

IR cells (Sbrissa et al., 2004). The same study also showed that exogenously delivered PtdIns5P by microinjection into single adipocyte and CHO cells, in the absence of insulin, caused increased presence of GLUT4 at the plasma membrane and actin cytoskeleton rearrangements respectively (Sbrissa et al., 2004).

These results strongly suggested a role for PtdIns5P in insulin-stimulated glucose uptake. Presently, however, it remains to be seen if increased PtdIns5P positively affects glucose uptake in the absence of insulin in any cell type including skeletal muscle cells. The lack of knowledge concerning PtdIns5P‟s behaviour in response to insulin in skeletal muscle is a significant issue due to the importance of this tissue in whole body glucose homeostasis. The main aim of this project is to further study PtdIns5P‟s prospective role in insulin-stimulated glucose uptake, using a skeletal muscle model to do so (see Aims, section 1.4).

4.1 PtdIns5P increases in response to insulin in L6 myotubes

PtdIns5P levels were measured by PtdIns5P mass assay in differentiated L6 myotubes after serum-starvation and either 100nM insulin stimulation or no stimulation. Cells were initially stimulated for 10 minutes as this was the optimum time point for PtdIns5P increase in 3T3- L1 adipocytes and CHO-IR cells (Sbrissa et al., 2004). It was found that PtdIns5P increased 2-fold above basal at this time point (±0.31,) (figure 4.1 A). Subsequently, stimulation with 1μM insulin was carried out, but this failed to provoke a further increase in PtdIns5P levels (2-fold,

±0.26). Therefore 100nM was used as the standard

117

Figure 4.1: Insulin increases PtdIns5P in L6 myotubes. L6 myotubes were serum-starved for 4 hours prior to stimulation with either 100nM or no insulin stimulation for 10 minutes (A and B – where A shows a representative TLC image used to quantify PtdIns5P mass.) or with 100nM insulin over a time course of 20 minutes (C, showing a representative data set from three experiments).. Data were normalised to total lipid phosphate and either expressed as an average percentage of resting PtdIns5P levels (B, P<0.05, n=9) or converted to pmols PtdIns5P, determined from PtdIns5P standards (C). Error bars show S.E.M. *P<0.05 (n=9), **P<0.01 (n=6) *** P<0.001 (n=15).

118 concentration of insulin for stimulating a PtdIns5P response throughout the rest of the project in agreement with results found in adipocytes (Sbrissa et al., 2004).

To further examine the nature of the PtdIns5P response to insulin, PtdIns5P levels were measured after stimulation with 100nM insulin at several time points over a time course of 20 minutes (figure 4.1 B). PtdIns5P levels increased by 2.1-fold

(±0.29) by five minutes and remained elevated at 10 minutes (1.8-fold ±0.2) before starting to drop at 15 minutes and significantly dipping below basal at the 20 minute time point which may represent a period of PtdIns5P „recovery‟, where the removal of PtdIns5P by a phosphatase or kinase (see section 1.2.2.3) now outbalances its production.

4.2 The effect of PIP4KIIα overexpression on glucose uptake in L6 myotubes

To investigate the effects of PtdIns5P removal in L6 myotubes a PIP4KII isoform was overexpressed in these cells. Overexpression of PIP4KIIs is a useful tool in investigating the consequences of PtdIns5P removal in cells, for example, overexpression of PIP4KIIβ has been used to investigate the effects of PtdIns5P removal on Akt activation in CHO-IR cells (Carricaburu et al., 2003). However, as

PIP4KIIβ has a predominantly nuclear localisation (Jones et al., 2006;Bultsma et al., 2010;Wang et al., 2010) the results obtained with this approach may not accurately reflect PtdIns5Ps signalling properties at the plasma membrane.

Therefore, an adenoviral delivery system to drive the expression of PIP4KIIα was used here as this isoform has a cytoplasmic localisation and is significantly more active than PIP4KIIβ (Jones et al., 2006;Bultsma et al., 2010;Wang et al., 2010).

119

4.2.1 Optimisation of multiplicity of infection for adenoviral

infection of L6 myotubes

Myotubes were infected with adenoviral vector carrying FLAG tagged PIP4KIIα using several MOIs and left to incubate for 24 hours. The cells were then lysed and lysates separated by SDS-PAGE and transferred to PVDF membrane before probing with anti-FLAG antibody. The resulting western blot (figure 4.2) showed that expression of PIP4KIIα could be achieved at all MOIs tested, seeming to peak at a

MOI of 40. This MOI was used to infect myotubes in all further experiments using adenoviral expression of PIP4KIIα.

Figure 4.2: Overexpression of PIP4KIIα with increasing MOI L6 myotubes were infected for 24 hours with adenoviral vector driving the expression of FLAG-tagged PIP4KIIα. PIP4KIIα was detected with anti-FLAG primary antibody (top panel). A protein loading control was also performed after stripping the blot and re-probing using an anti-actin antibody (lower panel).

4.2.2 PIP4KIIα Overexpression results in attenuated PtdIns5P

levels in the presence of Insulin

L6 myotubes were infected with adenovirus expressing either FLAG-tagged

PIP4KIIα or a LacZ control construct, using an MOI of 40 over a period of 24 hours.

120

After this myotubes were serum-starved for 4 hours prior to stimulation with 100nM insulin for 10 minutes or no stimulation before PtdIns5P mass assay. It was found that whilst LacZ infected cells still produced a PtdIns5P increase in response to insulin compared to basal (1.6-fold, ±0.2, P<0.05 n=7), the response was abolished in cells infected with PIP4KIIα (figure 4.3). This result confirmed that adenoviral overexpression of PIP4KIIα was a reliable method for PtdIns5P reduction in the presence of insulin in L6 myotubes.

4.2.3 PIP4KIIα overexpression abolishes insulin-stimulated

glucose uptake in L6 myotubes

Myotubes were infected in the same manner as in section 0 above. Following infection they were serum-starved for 4 hours before measurement of glucose uptake in the presence and absence of 100nM insulin. Overexpression of PIP4KIIα impaired insulin-stimulated glucose uptake as no significant increase in uptake was observed in the presence of insulin and PIP4KIIα in comparison to just PIP4KIIα

(figure 4.4).

4.3 Increasing PtdIns5P levels in the absence of insulin by carrier-mediated lipid delivery and its effect on glucose uptake

To investigate the possible effect of PtdIns5P increase in the absence of insulin a way of promoting increased levels of this phosphoinositide in L6 myotubes was required. As the exact way endogenous PtdIns5P production is achieved remains unclear (as discussed previously in 1.2.2.2), a lipid carrier system to deliver exogenous PtdIns5P to the cell interior was chosen (Carricaburu et al.,

2003;Pendaries et al., 2006). This system uses an amphipathic carrier molecule,

Carrier 3 (Echelon), that forms micelle complexes with mono-phosphoinositides

121

% PtdIns5 %

(Relative to LacZ basal) LacZ to (Relative

Figure 4.3: Overexpression of PIP4KIIα abolishes the rise PtdIns5P levels in response to insulin stimulation. L6 myotubes were infected with adenoviral vectors driving the expression of PIP4KIIα or LacZ for 24 hours prior to 4 hours serum starvation and stimulation with 100nM insulin for 10 minutes. Following this PtdIns5P levels were measured by PtdIns5P mass assay and normalised to total lipid phosphate. Data were expressed as a percentage of basal average, error bars represent S.E.M (*P<0.05, n=7-9).

% PtdIns5 % (Relative to LacZ basal) LacZ to (Relative

Figure 4.4: Overexpression of PIP4KIIα impairs insulin-stimulated glucose uptake in response to insulin. L6 myotubes were infected with adenoviral vectors expressing PIP4KIIα or LacZ for 24 hours prior to serum starvation and 20 minutes stimulation with or without insulin. Myotubes were then subject to glucose uptake assay. Data were expressed as a percentage of basal glucose uptake average and error bars represent S.E.M (**P<0.01, n=9).

122 which, when incubated with cells, are able to pass into the plasma membrane and deliver their lipid cargo. As this technique had not been carried out by the group before, some optimisation was required.

4.3.1 Delivery of BODIPY™ labelled PtdIns5P to the myotube cell

interior

Firstly, it was important to determine an optimum incubation time for effective delivery of the lipid-carrier complex to myotubes. To do this, 10µM of BODIPY™ labelled PtdIns5P-diC16 (Echelon) was incubated with Unlabelled Carrier 3 for 10 minutes before incubation with L6 myotubes grown on coverslips over a time course of 60 minutes. Cells were then viewed using a widefield fluorescence microscope (figure 4.5, A-F).

BODIPY™ fluorescence was detected in all time points apart from T0, but peaked at

20 minutes (figure 4.5, D). The 20 minutes time point was chosen for further investigation into the possible metabolism of this exogenous PtdIns5P source. It was equally important to check that PtdIns5P levels were elevated at a given time point by PtdIns5P mass assay, as fluorescent BODIPY™ signal may not be representative of PtdIns5P levels once it gained access to the cell interior due to the

possible rapid metabolism of the lipid (Huang et al., 2007).

4.3.2 Delivery of unlabelled PtdIns5P into L6 myotubes successfully

raises its levels

Two doses of PtdIns5P (5 and 10µM) were used to examine the success of PtdIns5P delivery to L6 myotubes. Unlabelled PtdIns5P was delivered using the same method as BODIPY™ labelled PtdIns5P but in 60mm dishes and for only 20 minutes. Both 5 and 10µM doses effectively raised the PtdIns5P levels 3-fold (±0.3) and 4.25-fold

(±0.75, P<0.05, n=3) above basal respectively (figure 4.6).

123

4.3

Figure 4.5: Time course of BODIPY™ PtdIns5P carrier-mediated delivery. Myotubes grown on coverslips were either incubated in serum-free medium (A) or with serum-free medium containing 10µM PtdIns5P-carrier complex for 5 (B), 10 (C), 20 (D), 30 (E) or 60 (F) minutes. Cells were then fixed with 4% PFA before mounting onto slides and viewing under 20x objective on a widefield fluorescence microscope.

Figure 4.6: PtdIns5P mass assay measurements of PtdIns5P Levels after incubation with 5 and 10µM PtdIns5P-carrier complex. L6 myotubes, grown in 60mm dishes, were incubated with 5 or 10µM PtdIns5P-carrier complex or carrier alone for 20 minutes. A control condition with no PtdIns5P or carrier incubation was also included. Cells were then lysed and subjected to PtdIns5P mass assay. Data were normailsed to total lipid phosphate before being expressed as a percentage of basal average. Error bars represent S.E.M (n=3-6). *** P<0.001, n=6, * P<0.05, n=3.

124

A carrier only control was also included to examine the effects carrier alone may have on PtdIns5P levels but no difference between this and basal was seen. The

5µM dose was used in into further experiments as, although the 10µM concentration produced a larger PtdIns5P accumulation, the 5μM dose gave a significant 3-fold increase over basal. This increase was similar to the insulin- stimulated endogenous rise in PtdIns5P seen in section 3.1, figure 3.1.

4.3.3 Increasing PtdIns5P levels by carrier-mediated delivery

enhances glucose uptake in L6 myotubes

After establshing PtdIns5P levels could be elevated by carrier-mediated delivery, its possible effect on glucose uptake in the absence of insulin was investigated.

Following serum-starvation, myotubes grown in 35mm dishes were left unstimulated or incubated with either 100nM insulin or 5µM PtdIns5P-carrier complex for 20 minutes; glucose uptake was then measured. Interestingly,

PtdIns5P delivery gave rise to a 2.25-fold increase in glucose uptake when compared to glucose uptake in the presence of carrier alone (±0.1, P<0.01, n=17, see figure 4.7). PtdIns5P delivery produced a glucose uptake response similar in magnitude to that of 100nM insulin (2.8-fold above basal, ±0.27, P<0.001, n=13).

4.4 Carrier-mediated delivery of PtdIns5P increases plasma membrane association of GLUT4

To see if raising PtdIns5P levels by carrier-mediated delivery could bring about increased GLUT4 association with the plasma membrane, GLUT4 presence at the plasma membrane was analysed after delivery of PtdIns5P. Following serum- starvation, myotubes were left unstimulated or either stimulated with 100nM insulin or incubated with 5μM PtdIns5P for 20 minutes. A carrier only control was also carried out by incubation with Carrier 3 for the same amount of time. Lawns were stained using an antibody against GLUT4 (AbD Serotech) and the presence of

125

Figure 4.7: Carrier-delivered exogenous PtdIns5P enhances glucose uptake in

the absence of insulin in L6 myotubes.

L6 Myotubes were serum-starved for 4 hours prior to stimulation with insulin, incubation with 5μM PtdIns5P-carrier complex, carrier only or no stimulation. Glucose uptake was then measured by glucose uptake assay. Data were normalised to protein content and expressed as percentage of basal average glucose uptake. Errors bars represent S.E.M (**P<0.01, ***P<0.001, n=5-17).

GLUT4 was detected by a FITC-conjugated secondary antibody and widefield fluorescence microscopy. GLUT4 signal was calculated as described in methods section 2.2.15 (figure 4.8 D). It was found that incubation with PtdIns5P could promote GLUT4 association with the plasma membrane (figure 4.8 D and E) above

GLUT4 plasma membrane association in the presence of Carrier 3 (figure 4.8 B and

E).

4.5 The effect of increasing PtdIns3P levels by carrier- mediated delivery on glucose uptake in L6 myotubes

It was important to examine whether the ability of PtdIns5P to promote glucose uptake in L6 myotubes was specific to PtdIns5P, or whether another mono-

phosphoinositide could provoke enhanced glucose uptake in the absence of insulin

126

Figure 4.8: PtdIns5P promotes increased GLUT4 association with the plasma membrane. L6 myotubes were either left unstimulated (A) stimulated with 100nM insulin (C) or either incubated with Carrier 3 alone (B) or PtdIns5P-carrier complex (D). (Scale bar is representative of 30μm). Presence of GLUT4 was quantified from 2 separate experiment (n=14) and expressed as mean values (E). Error bars represent S.E.M. (*P<0.05).

127 to look at this, it was decided to see if PtdIns3P, another phosphoinositide previously implicated in insulin signalling (Maffucci et al., 2003), could enhance

glucose uptake when delivered to myotubes by carrier-mediated delivery.

4.5.1 Delivery of PtdIns3P to L6 myotubes has no effect on glucose

uptake

L6 myotubes were serum starved for 4 hours before stimulation with or without

100nM insulin or incubation with PtdIns3P-carrier complex for 20 minutes.

Following this glucose uptake was measured and results, normalised to protein content, were expressed as a percentage of basal average (figure 4.9). It was found that whilst the expected response to 100nM insulin was present no change in glucose uptake could be observed in the myotubes incubated with PtdIns3P (100% of basal, ±18%, n=12).

Figure 4.9: Carrier-mediated delivery of PtdIns3P does not affect glucose uptake. L6 myotubes were serum-starved prior to stimulation with or without 100nM insulin or incubation with 5μM PtdIns3P for 20 minutes before glucose uptake assay measurements. Data were normalised to protein amount and expressed as a percentage of basal average glucose uptake. Error bars are representative of S.E.M. (*P<0.05, n=9- 12).

128

4.5.2 Detection of PtdIns3P carrier-mediated delivery with GFP-

FENS-1-FYVE PtdIns3P binding domain

To examine whether this inability of PtdIns3P to enhance glucose uptake was likely to be due to unsuccessful delivery of PtdIns3P, changes in the localisation of a

PtdIns3P binding domain upon PtdIns3P delivery were monitored (Maffucci et al.,

2003). A GFP-tagged PtdIns3P binding construct, containg the FYVE domain of

FENS (FYVE domain containing protein localised to endosomes)-1, was employed.

The single FYVE domain of FENS-1 binds to PtdIns3P with high specificity over other phosphoinositides (Ridley et al., 2001;Sankaran et al., 2001) and this was used to qualitatively detect PtdIns3P, and any changes upon its localisation following delivery, within the cell.

Myoblasts grown on coverslips were transfected with vector carrying GFP-FENS-1-

FYVE using TurboFect™ (Fermentas) transfection reagent and left to incubate for

24 hours. Following this, myoblasts were incubated with or without PtdIns3P- carrier complex for 20 minutes before cell fixation and mounting on slides. GFP controls, with and without PtdIns3P-carrier complex incubation were also carried out and all slides were imaged using a widefield fluorescence microscope.It was found that in the absence of PtdIns3P delivery, the GFP-FENS-1-FYVE domain showed punctate localisation (figure 4.10, A), likely to be endosomal localisation as this is the typical localisation of endogenous FENS-1 (Ridley et al. 2001) However, upon PtdIns3P delivery, the punctate localisation changed to a more evenly diffuse localisation with possible cytosolic localisation (figure 4.10, B). This was GFP-FENS-

1-FYVE specific as PtdIns3P delivery did not affect the localisation of a GFP control

(figure 4.10 C and D).

129

Figure 4.10: Localisation of GFP-FENS-1-FYVE changes upon carrier-mediated

delivery of exogenous PtdIns3P.

L6 myoblasts grown on coverslips were transfected with constructs expressing either GFP-FENS-1-FYVE (A and B) or GFP alone (C and D). Following this, myoblasts were either incubated in fresh serum-free medium (A and C) or with serum-free medium containing 5μM PtdIns3P-carrier complex (B and D) for 20 minutes. Cells were fixed in 4% PFA and coverslips mounted on slides before viewing with a widefield fluorescence microscope using a 63x objective. Scale bar shows 30μm. Images are representative of successfully transfected cell populations.

4.6 PtdIns5P enhancement of glucose uptake is wortmannin- sensitive

Several studies have indicated a role for PtdIns5P in the regulation of PI3-kinase signalling (Carricaburu et al., 2003;Pendaries et al., 2006;Ramel et al., 2009), prompted by findings that the bacterial phosphatase IpgD, which was known to be required for Akt activation upon bacterial invasion, is a PtdIns(4,5)P2 phosphatasethat produces PtdIns5P (Niebuhr et al., 2002). Indeed, an inhibitory role of PtdIns5P on a PtdIns(3,4,5)P3 specific phosphatase has been suggested, that could lead to accumulation of PtdIns(3,4,5)P3, activation of Akt and hypersensitivity

130 to insulin (Carricaburu et al., 2003). Here 100nM wortmannin, a concentration known to inhibit class I PI3-kinase (as well as PI3K2Cβ and class III PI3-kinase), was used to determine if PtdIns5P induced enhancement of glucose uptake was linked to PI3-kinase activation. Glucose uptake assays were carried out after incubation with or without 100nM insulin, following pre-incubation with the inhibitor or not respectively (figure 4.11). It was found that whilst PtdIns5P promoted glucose uptake in the absence of wortmannin (2.8-fold above basal, ±0.1), the inhibitor‟s presence abolished the effect of PtdIns5P delivery on glucose uptake

(figure 4.11). This suggests that PtdIns5P is most likely acting in a PI3-kinase dependent manner

Figure 4.11: PtdIns5P enhancement of glucose uptake is wortmannin -

sensitive.

Serum-starved L6 myotubes were pre-incubated with 100nM wortmannin for 30 minutes, then either stimulated with 100nM insulin or incubated with 5μM PtdIns5P

in the presence or absence of wortmannin for 20 minutes before glucose uptake assay. A basal control in the absence of wortmannin was also carried out. Data were normalised to protein amount and expressed as percentage average of basal. Error bars show S.E.M, (n=10-17). *P<0.05, ***P<0.001 and not significant (n.s.) compared to basal.

131

4.7 PtdIns5P enhanced glucose uptake is sensitive to the tyrosine kinase inhibitor Tyrphostin AG213

Work published at the beginning and during this project suggests that the effect of

PtdIns5P increase on glucose uptake is linked to the PI3-kinase dependent insulin- signalling pathway; the mechanism behind this is unclear (Carricaburu et al., 2003;

Pendaries et al., 2006). Other findings in the literature have suggested that one way PtdIns5P may interact with the PI3-kinase pathway is by activation of a tyrosine kinase (Pendaries et al., 2006). Here, the protein tyrosine kinase inhibitor, tyrphostin AG213 was used to see if PtdIns5P enhancement of glucose uptake could be inhibited by its presence.

L6 myotubes were serum-starved for 4 hours, and for the last hour, myotubes were also pre-incubated with 500µM AG213. Myotubes were then either left unstimulated or incubated with 5μM PtdIns5P-carrier complex for 20 minutes in the absence or continued presence of the inhibitor before glucose uptake assay. No change in basal glucose uptake was observed in the presence of this concentration of AG213, but a reduction in the amount of glucose uptake was seen in its presence after incubation with PtdIns5P-carrier complex (figure 4.12).

4.8 PtdIns5P delivery activates Akt phosphorylation on both T308 and S473 residues

Several studies show that PtdIns5P somehow positively affects Akt phosphorylation in systems where PtdIns5P levels are raised (Carricaburu et al., 2003;Lamia et al.,

2004;Pendaries et al., 2006;Ramel et al., 2009). Therefore, Akt phosphorylation was examined in myotubes in the presence of PtdIns5P-carrier complex over a time course ranging from 20-30 minutes. This range was chosen due to the incubation time required to see an increase in BODIPY™ PtdIns5P signal in the original optimisation experiments (figure 4.5).

132

Figure 4.12: Enhancement of glucose uptake by PtdIns5P delivery is sensitive to the protein tyrosine kinase inhibitor Tyrphostin-AG213. Serum-starved L6 myotubes were pre-incubated with 500µM AG213 for 1 hour. Myotubes were then either left unstimulated or incubated with 5μM PtdIns5P-carrier complex for 20 minutes in the continued presence of 500µM AG213 before glucose uptake assay. Data were normailsed to protein amount and expressed as a percentage of basal average. Error bars represent S.E.M (n=9) *P<0.05..

Figure 4.13 Akt phosphorylation on both S473 and T308 is enhanced by delivery of PtdIns5P. Serum starved L6 myotubes were incubated with 5μM PtdIns5P -carrier complex over a time course ranging from 20-30 minutes. Phosphorylated residues of Akt were the detected by western blot using anti-phospho-S473 (A) and anti-phospho-T308 (B) antibodies before incubation with HRP-conjugated secondary antibody and visualisation using chemiluminescence. Each blot was then stripped and re-probed using an antibody against all Akt isoforms (PanAkt – B and D). Blots are representative of two experiments.

133

Myotubes were then lysed and proteins separated using SDS-PAGE before PVDF membrane transfer and western blotting with phospho-specific antibodies. Akt phosphorylation on both S473 and T308 residues was enhanced following carrier- mediated delivery of PtdIns5P (figure 4.13, A and C respectively), and this enhancement was most pronounced at the 25 minute time point on both residues.

4.8.1 Comparison of PtdIns5P-induced and insulin-induced Akt

phosphorylation

To compare PtdIns5P-induced S473 phosphorylation with insulin-induced S473 phosphorylation, a time course of 5μM PtdIns5P carrier-mediated delivery was carried out in L6 myotubes. This was compared with a positive, 5 minute, 100nM insulin control, by western blotting (figure 4.14). The PtdIns5P time course included

5μM PtdIns5P Time (minutes)

S473

Figure 4.14: 5μM PtdIns5P induced versus 100nM insulin-induce Akt S473 phosphorylation. Serum starved L6 myotubes were incubated with 5μM PtdIns5P -carrier complex over a time course ranging from 0-30 minutes and compared to a 5 minute insulin stimulated positive control by western blotting. Phosphorylated residues of Akt were then detected by western blot using anti-phospho-S473 antibody before incubation with HRP-conjugated secondary antibody and visualisation using chemiluminescence. experiments. Loading amount was controlled for by BCATM assay. No pan-Akt controls were performed.

134 the 5 minute time point for direct comparison with the insulin-stimulated positive control. The disparity between PtdIns5P-induced and insulin-induced Akt S473 production is quite clear (figure 4.14), with less S473 signal even at the highest time points of PtdIns5P delivery (20 and 30 minutes). What is interesting is that

Akt S473 phosphorylation does appear to slowly accumulate over the course of 30 minutes from a barely detectable level at T0 (figure 4.14)

4.9 Discussion of results II

The findings of work presented in this chapter support a role for PtdIns5P in insulin stimulated glucose uptake. This is based on several pieces of experimental evidence: first, a transient rise in PtdIns5P level is observed upon insulin stimulation in L6 myotubes; second, a reduction in PtdIns5P, from expression of

PIP4KIIα (figure 4.3) is linked to attenuation of glucose uptake (figure 4.6); third, a carrier-mediated PtdIns5P increase brings about enhanced glucose uptake and this is likely to be PtdIns5P specific as PtdIns3P delivery does not enhance glucose uptake (figure 4.6 and 4.9 respectively); finally, PtdIns5P was able to bring about increased association of GLUT4 with the plasma membrane (figure 4.8).

The rise in PtdIns5P in response to insulin seen here supports previous findings in

3T3-L1 adipocytes and CHO-IR cells, which show a 20-30 minute transient rise in this phosphoinositide in response to this stimulus (Sbrissa et al., 2004).

Interestingly, the time course recorded here, unlike the latter results, shows a significant decrease below basal at the 20 minute time point (figure 4.2). This could be unique to L6 myotubes but could also reflect the need of a larger range of time points or lengthier time courses in other cell types. As to the cause of this decrease, it is possible that the pathway of PtdIns5P removal, whether achieved by kinase or phosphatase, may remain active for sometime after PtdIns5P depletion.

135

PtdIns5P reduction correlates with the attenuation of glucose uptake in response to insulin in the presence of overexpressed PIP4KIIα (figures 4.3 and 4.4).

Overexpression of another PIP4KII isoform, PIP4KIIβ has been shown to have an inhibitory effect on Akt phosphorylation which is linked to a decrease in

PtdIns(3,4,5)P3 levels in insulin stimulated cells or cells expressing activated PI3- kinase. (Carricaburu et al., 2003). Interestingly, PI3-kinase association with IRS1 and the plasma membrane, downstream of the insulin receptor, was unaffected in these conditions (Carricaburu et al., 2003).

Several phosphoinositides have been implicated in inserting GLUT4 into the plasma membrane (Maffucci et al, 2003, Berwick et al, 2004, Ishiki et al, 2005b) including

PtdIns5P (Sbrissa et al, 2004). In the latter study, PtdIns5P microinjection into single 3T3-L1 adipocytes was able to mimic insulin in translocating EGFP-GLUT4 to the cell surface; it caused relocation of GLUT4 to the plasma membrane in 50% of adipocytes subsequently found to be insulin responsive. Importantly, it was found that PtdIns5P was the only phosphoinositide tested that could achieve this; amongst others, those tested included PtdIns3P, PtdIns(3,5)P2 and PtdIns(3,4,5)P3

(Sbrissa et al, 2004). This study was the first to implicate PtdIns5P having a direct role in insulin-triggered events, however, the glucose uptake ability of 3T3-L1 adipocytes microinjected with PtdIns5P was not established; it could not therefore be said whether the translocated GLUT4 was fully functional at the plasma membrane. This would have been very difficult to show on a single cell level in this case.

Here, glucose uptake and GLUT4 plasma membrane association could be analysed after PtdIns5P delivery to a large population of cells simultaneously (figure 4.7 and

4.8 respectively). The data suggest PtdIns5P is capable of triggering the association of a fully functional GLUT isoform to the plasma membrane as an increase in glucose uptake was seen after 20 minutes incubation (figure 4.7). This isoform was likely to be GLUT4 as PtdIns5P caused its increased association with the plasma

136 membrane (figure 4.8) although the two could not be directly linked in this study due to the nature of the assays performed.

As mentioned above, other phosphoinositides, namely PtdIns3P and

PtdIns(3,4,5)P3, have been implicated in insertion of GLUT4 to the plasma membrane (Maffucci et al., 2003;Berwick et al., 2004;Sweeney et al., 2004;Ishiki et al., 2005a;Funaki et al., 2006). However, evidence suggests that these phosphoinositides are necessary but not sufficient for insertion of fully functional

GLUT4 to the plasma membrane (Sweeney et al., 2004;Ishiki et al., 2005a).

Indeed, work carried out here shows that exogenous PtdIns3P delivery could not reproduce the effect of PtdIns5P on glucose uptake (figure 4.9). Additionally, this was not due to unsuccessful delivery of PtdIns3P as incubation with PtdIns3P- carrier complex could bring about the relocation of a PtdIns3P probe (figure 4.10).

Here myoblasts were used due to the difficulty of transiently transfecting myotubes and the lack of an adenoviral vector containing GFP-FENS-1-FYVE. GFP-FENS-1-

FYVE shows endosomal-like localisation both here and in other studies (Ridley et al., 2001). If PtdIns3P or any of the other phosphoinositides tested by the study could not achieve this alone, how then, may PtdIns5P achieve insertion of active

GLUT4 and increased glucose uptake?

One possibility is that PtdIns5P acts far upstream of GLUT4 translocation, helping to regulate earlier steps in the insulin-signal transduction pathway. This is suggested by the implication of a role for PtdIns5P in PI3-kinase/Akt activation. The study into the relationship between PtdIns5P and Akt activation has been largely driven by the use of the bacterial phosphatase IpgD, (Niebuhr et al., 2002). Several studies using this phosphatase have reported that PtdIns5P is able to activate Akt (Carricaburu et al., 2003 and Pendaries et al., 2006) or prolong its activation (Ramel et al., 2009).

Indeed, the study here finds that carrier-mediated delivery of PtdIns5P can promote Akt activation in L6 myotubes (figure 4.13) in agreement with other work that has previously found delivery of a short-chain PtdIns5P to HeLa cells can

137 achieve this (Pendaries et al., 2006). However, there is some disparity between the amount of PtdIns5P-induced glucose uptake (figure 4.7) and Akt S473 phosphorlation (figure 4.14). Indeed, figure 4.14 shows that the S473 from all

PtdIns5P time points appeared much lower than the level of S473 phosphorylation seen at 5 minutes insulin-stimulation. It could be, that much less Akt phosphorylation is required than is induced by 100nM insulin to induced glucose uptake; hence why 5μM PtdIns5P may be able to induce a level of glucose uptake similar to insulin (figure 4.7).

An increase in PtdIns5P has also been linked to activation of class I PI3-kinase signalling either via a mechanism involving tyrosine phosphorylations (Pendaries et al., 2006) or one where PtdIns5P inhibits a PtdIns(3,4,5)P3 (Carricaburu et al.,

2003) or Akt phosphatase (Ramel et al., 2009). The former is a possibility as a tyrosine kinase inhibitor used here, successfully inhibited PtdIns5P driven enhanced glucose uptake (figure 4.12). This PtdIns5P enhancement of glucose uptake is also sensitive to the pan-PI3-kinase inhibitor wortmannin; with the presence of the inhibitor attenuating PtdIns5P enhanced glucose uptake as much as its effect on insulin-stimulated glucose uptake (figure 4.11) possibly implying the involvement of class I PI3-kinase, although use of more specific inhibitors should be considered in future to exclude the class II PI3-kinase, PI3K-C2β, and class III PI3-kinase.

Interestingly the study in adipocytes and CHO-IR cells showed the PtdIns5P rise to be wortmannin resistant (Sbrissa et al., 2004). Not only this, the rearrangements of the actin cytoskeleton seen in single CHO-IR cells in response to both insulin and

PtdIns5P microinjection were also largely wortmannin resistant. However this research did not address whether GLUT4 translocation, seen in response to

PtdIns5P microinjection was affected by the inhibitor in the same way. All the above considered, If GLUT4 translocation is sensitive to wortmannin – as found in the case of glucose uptake here – yet PtdIns5P production is not, this suggests that the rise of PtdIns5P in response to insulin may be produced upstream of a PI3-kinase, but it

138 affects events downstream of and dependent on this. It is a possibility therefore that PtdIns5P may have other roles in the insulin response, not just PI3-kinase activation via a tyrosine kinase.

139

5 Results III: Development of tools for further investigation of PtdIns5P’s role in insulin signalling

140

The challenge of studying PtdIns5P is made difficult by the lack of specific investigative tools for this phosphoinositide and the difficulty in separating it from

PtdIns4P (Rameh et al., 1997). Protocols for measuring its levels are lengthy and labour intensive and there are limited ways of purposefully altering and detecting them in vitro. The use of an inducible system to either increase or decrease

PtdIns5P at specific localisations in the cell would be invaluable to its study; specifically at the plasma membrane in this project. This would make possible the study of the plasma membrane pool of PtdIns5P in isolation and distinguish its functions from those in the nucleus (Clarke et al., 2001), Golgi and SER (Sarkes and Rameh, 2010).

In recent times, PtdIns5P binding domains have been identified in diverse proteins, namely the PHD domains of ING2 and ATX (Gozani et al., 2003 and Avarez-

Venagas et al., 2001 respectively). Indeed the ING2 PHD domain has proved useful in visualising what is considered to be the plasma membrane pool of

PtdIns5P in cells containing IpgD (Pendaries et al., 2006). The applications of a reliable PtdIns5P binding domain are varied and would significantly add to the repertoire of techniques available to study this enigmatic phosphoinositide.

5.1 Attempted development of a PtdIns5P binding protein for multiple applications

The current method for measuring PtdIns5P by mass assay is difficult and time- consuming, involving the use of 32P. It would be beneficial to develop an alternative method of assaying PtdIns5P amount, which involves fewer steps and does not require work with a radioactive isotope. Non-radioactive assays for the quantification of PtdIns(4,5)P2 and PtdIns(3,4,5)P3, that rely on specific bindingproteins detectable by HRP-conjugated antibodies and ECL reagent, have recently been developed (Furutani et al., 2006;Guillou et al., 2007a). Also several studies make use of PtdIns5P sequestration by specific binding proteins as a tool to

141

A determine its functions (Sbrissa et al., 2004;Pendaries et al., 2006;Guittard et al., 2009). An attempt to develop a binding protein for use in these methods was made

here, involving the expression of a putative PtdIns5P-binding protein construct,

GST-3xATX-PHD, (Alvarez-Venegas et al., 2006) generated and cloned into the

expression vector pGEX-4T1 (BD Biosciences) by Dr. Katherine Hinchliffe. Cloning

was verified by DNA sequencing before use in this project. The expressed GST-

3xATX-PHD construct produces a triple repeat of the PHD domain of ATX tagged

with GST for protein purification and detection.

B Initial attempts to express soluble GST-3xATX-PHD protein were made in the

presence of 2mM β-mercaptoethanol and 5nM ZnCl2. These conditions were

expected to provide a more favourable folding environment for this protein. The

2+ inclusion of ZnCl2 was to provide a source of Zn ions due to the fact PHD domains

contain a zinc finger motif that coordinates this ion (Alvarez-Venegas et al., 2006).

As the PHD domain also contains multiple cysteine residues (Alvarez-Venegas et

al., 2006), the reducing agent, β-mercaptoethanol, was included to prevent

formation of disulphide bridges. This expression condition was compared to one

without the presence of β-mercaptoethanol and zinc. Both conditions yielded the

same amount of soluble protein (figure 5.1 A) and the use of β-mercaptoethanol

and zinc were concluded to be unnecessary.

After establishing expression of soluble GST-3xATX-PHD in Rosetta™ E. coli

purification of the protein began. The majority of the protein was insoluble but

eluted fractions 2, 3 and 4 obtained by purification were found to contain protein of

the correct molecular weight (figure 5.1 B). These fractions were then combined,

run on a 10% acrylamide gel and visualised by western blotting using an anti-GST

antibody to confirm the presence of the GST tag (Figure 5.1 C). The specificity of

the purified GST-3xATX-PHD protein for PtdIns5P was assessed in a protein overlay

experiment using a PIP Strip membrane (Echelon Biosciences).

142

B C

Figure 5.1: Optimisation of GST-3xATX-PHD expression and purification. (A) GST-3xATX-PHD expression was induced with the addition of 0.1mM IPTG, with (+) and without (-) 5nM zinc and 2mM β-mercaptoethanol present. Total cellular proteins from uninduced bacteria and proteins from the soluble lysate were separated on a 10% polyacrylamide gel and visualised by western blotting using an anti-GST antibody (1:500). Predicted molecular weight of GST-3xATX-PHD is 55kDa. (B) GST-3xATX-PHD protein was expressed in the presence of 0.1mM IPTG. Total cell proteins from uninduced and induced bacteria, proteins from soluble lysate and insoluble pellet, proteins from supernatant after GST-binding and eluted fractions were separated on a 10% polyacrylamide gel and stained with coomassie blue. (C) Eluted fractions 2, 3 and 4 were combined and run on a 10% polyacryamide gel and visualised by western blotting with an anti-GST antibody (1:500).

143

Unfortunately, the protein did not bind to PtdIns5P or any other lipid present on the membrane (results not shown).

5.2 Development of the PHD domain of ING2 for use in this project

The ING2 PHD finger has been shown to bind PtdIns5P with high specificity and that repeated domains bind tightly to low levels of PtdIns5P spotted onto PVDF membrane (Gozani et al., 2003) and subsequently used in several studies (Sbrissa et al., 2004;Pendaries et al., 2006;Guittard et al., 2009). A rise in PtdIns5P levels, produced by infection with S.flexneri, has been successfully visualised at the plasma membrane in HeLa cells, in vitro, using a biotinylated GST-tagged tandem repeat of the domain, 2xPHD-ING2 (Pendaries et al., 2006). Here, the biotinylated

GST-tagged 2xPHD-ING construct was planned to be used to visualise PtdIns5P in

L6 myotubes after stimulation with insulin compared to unstimulated control myotubes. However, at the start of this project it emerged that the ING2 PHD domain binds to histone H3 at lysine 4 (Peña et al., 2006;Shi et al., 2006).

Therefore, it was necessary to make a PtdIns5P null-binding mutant, to address the problem of non-specific binding and separate histone from PtdIns5P binding.

5.2.1 Generation of a PtdIns5P null-binding mutant of 2xPHD-ING2

Mutations of ING2 PHD finger residues show that three lysine and three arginine residues are of great importance for PtdIns5P binding (Gozani et al., 2003). In an attempt to produce a null-binding mutant of the 2xPHD-ING2 construct (figure 5.2

A), these residues were replaced with alanines using degenerative PCR (figure 5.2

B) giving 2xPHD-ING2 6A K/R. Success of degenerative PCR was verified by DNA sequencing before expression of vectors in Rosetta™ E.coli overnight at room temperature (figure 5.2 C). Following this, the expressed proteins were purified before biotinylation (see sections 2.3.9, 2.3.10 and 2.3.11).

144

Figure 5.2: Overview of 2xPHD-ING2 and PtdIns5P null-binding mutant 2xPHD- ING2 6A K/R and their expression and purification (A) schematic diagram of GST-tagged 2xPHD-ING2. (B) Sequence of one repeat of 2xPHD-ING2 with residues to be replaced by alanines by degenerative PCR highlighted in blue. (C) Expression of both constructs induced by 0.5mM IPTG after 24 hours incubation at room temperature detected by anti-GST antibody (Santa Cruz).

145

5.2.2 Examining the binding affinities of both 2xPHD-ING2 and

2xPHD-ING2 6A K/R

To check whether 2xPHD-ING2 6A K/R was a successful PtdIns5P null-binding mutant, PIP Strips (Echelon Biosciences) were incubated with either 2xPHD-ING2 or

2xPHD-ING2 6A K/R and tagged GST was detected by antibodies. Upon visualisation using chemiluminescence, it was discovered that 2xPHD-ING2 6A K/R did not bind to any of the phospholipids present (result not shown). Interestingly, the 2xPHD-ING2 construct, which is well documented to bind PtdIns5P (Gozani et al., 2003) did not, in the work carried out here, bind this particular phosphoinositide on the PIP Strip (figure 5.3 B). However, it did bind to PtdIns4P.

To check this result was not due to a faulty PIP Strip, 100pmol of all three monophosphoinositides were spotted onto PVDF membrane, and after blocking in

BSA-PBS, incubated with 100μg/μl of either construct. This confirmed that the PHD construct prepared and used in this project bound to PtdIns4P with tight affinity, whereas there was no PtdIns5P binding detected (figure 5.3 C, top panel). The

PtdIns4P binding properties of this construct were abolished by the replacement of the key lysine and arginine residues with alanine (5.3 C, lower panel). This binding construct was not used in any further experiments as PtdIns4P was not relevant to the investigation.

5.3 Development of a chemically inducible PtdIns5P removal system

A chemically inducible system for the removal of PtdIns(4,5)P2 has been used to investigate its involvement in regulating KCNQ channels (Suh et al., 2006). It was first developed for use in studies looking at the role of Cdc42 or WASP in filopodium formation without the need for upstream signals (Castellano et al., 1999). Since then, this system has been used in other studies to look at the roles of very different molecules (Inoue et al., 2005;Suh et al., 2006). Simply, in the case of the

146

Figure 5.3: Assessment of the phosphoinositide binding properties of 2xPHD- ING2. (A) Schematic of a PIP Strip membrane (from Echelon Biosciences) showing the positions of phospholipids present on the membrane (B) PIP Strip after incubation with 100μg/μl GST-tagged 2xPHD-ING2 in 1% BSA in PBS for 2 hours. (C) PtdIns3P, PtdIns4P and PtdIns5P were spotted onto PVDF membrane before blocking and incubation with 100μg/μl of either 2xPHD-ING2 (top panel) or 2xPHD-ING2 6A K/R (lower panel) and detection of GST with antibodies and chemiluminescence.

147

KCNQ studies, the system allowed for the inducible translocation of a yeast inositol polyphosphate 5-phosphatase (Inp54p), that specifically cleaves the phosphate at the 5-position of PtdIns(4,5)P2 to the plasma membrane upon the addition of a specific drug. This was facilitated by the heterodimerisation of protein domains from

FK506 Binding Protein (FKBP), which the phosphatase is fused to, and a rapamycin binding domain of mTOR (FRB) constitutively associated with the plasma membrane by the addition of the immunosuppressant rapamycin (Spencer et al., 1993) or an analogue called iRAP (Inoue et al., 2005). Here, this system was adapted in an attempt to produce a recruitable PtdIns5P-specific phosphatase in the hope this would shed more light on PtdIns5P‟s interplay in insulin signalling. In this case, the

PtdIns5P phosphatase, PTPMT1 (Pagliarini et al., 2004;Pagliarini et al., 2005), see also chapter 1, section 1.2.2.3.3) was employed (see figure 5.4).

5.3.1 Deletion of the N-terminal mitochondrial targeting region of

PTPMT1

PTPMT1 was first identified as PLIP (see chapter 1, section 1.2.2.3.3), and was shown to have a very high substrate specificity for PtdIns5P with 5-phosphatase activity (Pagliarini et al., 2004). Later, it was reported that this protein exclusively resides in mitochondria (hence the current naming) and that this localisation is conferred by an N-terminal motif of 37 amino acids recognised by a mitochondrial translocase (Pagliarini et al., 2005). This N-terminal region first had to be removed during the cloning of the phosphatase onto the end of the YFP-FKBP sequence to produce YFP-FKBP-Δ37PTPMT1.

5.3.2 YFP-FKBP-Δ37PTPMT1 is successfully excluded from

mitochondria

To examine whether the deletion of the first 37 amino acids of PTPMT1 had successfully prevented mitochondrial targeting of the construct, HeLa(S3) cells transiently expressing YFP-FKBP-Δ37PTPMT1 were counterstained with the

148

Figure 5.4: The chemically inducible FKBP and FRB heterodimerisation system. (A) Membrane targeted FRB-HA (left panel) and cytosolic YFP-FKBP (right panel) expressed in HeLa(S3) cells can be dimerised upon addition of either rapamycin (not shown) or iRAP (B). If a PtdIns5P 5-phosphatase is fused to the FKBP domain, such as PTPMT1 lacking its mitochondrial targeting motif (Δ37PTPMT1), this should remove

PtdIns5P present in the plasma membrane. (figure adapted from Suh et al., 2006). (Suh et al., 2006)

149

Figure 5.5: Deletion of the N-terminal mitochondrial targeting motif of

PTPMT1 excludes it from the mitochondria.

HeLa(S3) cells transfected with YFP-FKBP-Δ37PTPMT1 (PTPMT1 lacking the mitochondrial targeting motif) were incubated with MitoTracker® Red before fixation and visualisation on a Leica confocal microscope using a 63x objective. Images shown are from one z-slice through the centre of the cell showing mitochondria in red and YFP-FKBP-Δ37PTPMT1 in green for contrast. Scale bar is representative of 5μm.

mitochondrial stain MitoTracker® Red. Upon visualisation YFP-FKBP-Δ37PTPMT1 and mitochondria could clearly be identified and did not show any colocalisation;

YFP-FKBP-Δ37PTPMT1 displayed a cytosolic localisation (figure 5.5)

5.3.3 Heterodimerisation of YFP-FKBP-Δ37PTPMT1 with FRB-HA

HeLa(S3) cells transfected with both YFP-FKBP-Δ37PTPMT1 and FRB-HA were either incubated with 5μM rapamycin or DMSO (vehicle control) for 10 minutes. Cells were then fixed, stained for HA and visualised using a widefield fluorescence microscope. In the cells incubated with DMSO alone, FRB-HA could be seen localised to the plasma membrane whereas YFP-FKBP-Δ37PTPMT1 remained cytosolic. However, in the cells incubated with rapamycin, colocalisation of YFP and

150

HA signal could be seen at the plasma membrane, indicating successful heterodimerisation of both protein constructs (Figure 5.6).

Figure 5.6: Addition of rapamycin causes heterodimerisation of YFP- FKBP-Δ37PTPMT1 with membrane localised FRB-HA. HeLa(S3) cells transfected with both YFP-FKBP-Δ37PTPMT1 and FRB-HA were either incubated with DMSO (upper panels) or rapamycin (lower panels) for 10 minutes. Cells were then fixed and visualised on widefield fluorescent microscope using a 100x objective. FRB-HA is shown in red and YFP-FKBP-Δ37PTPMT1 in green for contrast.

5.3.4 The effect of rapamycin induced relocation of YFP-FKBP-

Δ37PTPMT1 to the plasma membrane in pervanadate treated

HeLa(S3) cells

To examine the efficacy of the heterodimerisation system, its effects on the

PtdIns5P response to stimulation with 500μM pervanadate was first looked at in

HeLa(S3) cells. This proof-of-principle approach was taken initially to gain an idea of whether the heterodimerisation system would be successful at lowering PtdIns5P levels when packaged in a viral expression system and expressed in L6 myotubes,

(subsequently to be stimulated with insulin.) Pervanadate is a phospho-tyrosine phosphatase inhibitor which enhances tyrosine phosphatase levels and is well

151 known for its use as an insulin mimetic (Heffetz et al., 1990). Recently, pervanadate was shown to markedly increase PtdIns5P levels (Wilcox and

Hinchliffe, 2008).

5.3.4.1 Rapamycin does not affect the pervanadate generated increase in

PtdIns5P levels in HeLa(S3) cells

For the proof-of-principle experiments, rapamycin was used instead of the more inert analogue, iRAP. Before the PtdIns5P pervanadate response was examined in the presence of the heterodimerisation constructs, the affect of rapamycin on this response alone was first investigated. HeLa(S3) cells stimulated with 500μM pervanadate or left unstimulated were incubated with either DMSO alone or rapamycin for 10 minutes. The presence of rapamycin did not affect PtdIns5P levels in response to pervanadate (figure 5.7).

Figure 5.7: Rapamycin does not affect the pervanadate-stimulated rise in PtdIns5P in HeLa cells.. HeLa(S3) cells were left unstimulated or stimulated with 500μM pervanadate (PV) for 20 minutes before incubation with either DMSO or 5μM rapamycin (Rap). Data were expressed as percentage of DMSO-incubated control, error bars represent S.E.M, *P<0.05, n=6.

152

5.3.4.2 The effects of Rapamycin induced YPF-FKBP-Δ37PTPMT1 and FRB-

HA heterodimerisation on PtdIns5P levels in pervanadate

stimulated HeLa(S3) cells

HeLa(S3) cells were nucleofected to 50-60% expression efficiency with DNA constructs expressing YPF-FKBP-Δ37PTPMT1 and FRB-HA and left for 24 hours prior to stimulation with 500μM pervanadate for 20 minutes. After this cells were incubated with either 5μM rapamycin or an equal amount of DMSO for 10 minutes before measurement of PtdIns5P levels by PtdIns5P mass assay (figure 5.8). Cells incubated with pervanadate and DMSO showed a significant rise in PtdIns5P levels compared to those incubated with just DMSO alone (n=6). Conversely cells incubated with pervanadate and rapamycin showed an abolition of the PtdIns5P response to pervanadate as no significant rise in PtdIns5P was seen in these cells compared to those incubated with rapamycin only (n=6).

Figure 5.8: The YFP-FKBP-Δ37PTPMT1 and FRB-HA heterodimerisation system athe PtdIns5P rise in response to pervanadate. HeLa cells were nucleofected with YFP-FKBP-Δ37PTPMT1 and FRB-HA and left for a further 24 hours before 20 minutes stimulation with 500μM pervanadate (PV) followed by incubation with either DMSO or 5μM rapamycin (Rap). Data were expressed as a percentage of DMSO-incubated control. Error bars show S.E.M, *P<0.05, n=6.

153

5.4 Discussion of results III

At the start of the project, there were limited tools for investigating PtdIns5P and its role in insulin-stimulated glucose uptake. Here, the development and adaptation of new or similar pre-existing tools has been described. Some have proved unsuccessful, as in the cases of the GST-3xATX protein that failed to bind to

PtdIns5P (not shown) and the 2xPHD-ING2 protein which showed no affinity for

PtdIns5P but for PtdIns4P instead (figure 5.3 B and C). This contradicts several reports in the literature that either show PHD domain constructs bind to PtdIns5P with high affinity (Gozani et al., 2003) or that utilise PHD domain constructs as tools to investigate PtdIns5P function (Sbrissa et al., 2004;Pendaries et al., 2006).

The PtdIns4P binding properties of 2xPHD-ING2 reported here compliments very recent work that shows this binding construct fails to bind to PtdIns5P (Guittard et al., 2010).In light of this, it may be the case that the findings of previous studies, which rely on PHD-ING2 binding constructs, need reinterpretation. One tool that has great potential and reached a more advanced stage of development in this project was the heterodimerisation system for the removal of PtdIns5P (Figure 5.4-

8). Not only was the system successful at relocating a PtdIns5P 5-phosphatase to the plasma membrane, it worked to abolish the PtdIns5P increase observed in response to a normally potent PtdIns5P stimulus, pervanadate, (Wilcox and

Hinchliffe, 2008) in a system that targets the plasma membrane (Castellano et al.,

1999). This is significant in terms of PtdIns5P localisation as it correlates with reports of a plasma membrane pool of PtdIns5P; very recently, advanced HPLC techniques have identified this (Sarkes and Rameh, 2010). Other evidence also suggests that PtdIns5P may be present at the plasma membrane; this phosphoinositide acts on the regulation of Akt phosphorylation (Pendaries et al.,

2006;Ramel et al., 2009) and/or activates PI3-kinase here (Pendaries et al., 2006).

Also, an inhibitory role for PtdIns5P on PtdIns(3,4,5)P3 specific phosphatases at the

154 plasma membrane has been proposed in PIP4KIIβ deficient cells (Carricaburu et al.,

2003).

For further advancement of the heterodimerisation tool in the future, a way of expressing both YFP-FKBP-Δ37PTPMT1 and FRB-HA in L6 myotubes would be required. This could be done by packaging the constructs into adenoviral vectors and driving their expression by viral infection. The phosphatase activity of the

Δ37PTPMT1 construct also needs to be investigated for completion. This could be done by immunoprecipitating the phosphatase from cell lysates and testing this in vitro with synthetic diC16 PtdIns5P and measuring phosphate release by malachite green assay.

However if the system is set up in L6 myotubes in future, there is still the question of whether it can attenuate the PtdIns5P increase and then glucose uptake in the presence of insulin, as it did to reduce PtdIns5P increase seen in the presence of pervanadate. If so, it would seem the heterodimerisation tool could be useful for many studies regarding PtdIns5P‟s signalling role at the plasma membrane. (Sarkes and Rameh, 2010) (Carricaburu et al., 2003;Pendaries et al., 2006;Sarkes and

Rameh, 2010)..

155

6 General Discussion

156

At the outset of this project, very little was known about the physiological role of

PtdIns5P. Few physiological stimuli that alter PtdIns5P levels had been identified, but of those that were, insulin was shown to produce an increase in the levels of

PtdIns5P in adipocytes and CHO-IR cells (Sbrissa et al., 2004). This project has confirmed a similar rise in PtdIns5P in response to insulin in a well-characterised skeletal muscle cell model. This suggests that an increase in PtdIns5P levels might be a ubiquitous feature of tissues involved in glucose disposal in response to insulin.

6.1 How might insulin increase PtdIns5P levels?

There is no definitive model on for PtdIns5P production, basal or otherwise (Figure

6.1) as discussed in section 1.2.2.2 of the opening chapter. Work within this

Figure 6.1: Current potential mechanisms of PtdIns5P production and removal.

Arrows highlighted in green and red are currently the most established pathways for production and removal (respectively) in the research group (Wilcox and Hinchliffe, 2008 and unpublished data). However, up- or down-regulation of any of these pathways could potentially contribute to the stimulation of PtdIns5P levels by insulin, which still requires investigation.

157 research group, performed by Dr. Katherine Hinchliffe, has shown that MTMR6 and

MTMR7 are likely to contribute to the pervanadate stimulated PtdIns5P pool in

HeLa(S3) cells. siRNA knockdown of MTM/Rs in HeLa(S3) did not affect the pervanadate-stimulated rise in PtdIns5P (Wilcox and Hinchliffe, 2008) in response to insulin unless MTMR6 and MTMR7 were targeted (unpublished data). This suggests that the PIKfyve-MTM/R route can contributes to PtdIns5P production within the cell environment, at least in terms of the pervanadate response in

HeLa(S3) cells. The involvement of PIKfyve was not investigated in Dr. Hinchliffe‟s studies but is implicated by them as the MTM/Rs require PtdIns(3,5)P2 for production of PtdIns5P. MTM/Rs must work in tandem with a PI5-kinase to provide their PtdIns(3,5)P2 substrate. This is most likely to be PIKfyve as it can produce

PtdIns(3,5)P2 from PtdIns3P (Sbrissa et al., 1999). The PIKfyve-MTM/R model of

PtdIns5P production in relation to insulin-stimulated PtdIns5P increase has not been investigated by this project. MTM/Rs are ubiquitously expressed and present in skeletal muscle tissue; whether MTMR6 and MTMR7 are present in L6 myotubes however, remains to be confirmed.

Another theory suggests PIKfyve is directly responsible for producing PtdIns5P in vivo as it has been show to produce PtdIns5P from PtdIns in vitro (Ikonomov et al.

2009, Sbrissa et al., 1999). PIKfyve has also been shown to become enzymatically active upon insulin stimulation (Berwick et al., 2004), so it is a potential candidate for insulin stimulated PtdIns5P production. Incubation of anti-PIKfyve immunoprecipitates with 100nM of the PIKfyve selective inhibitor, YM201636, inhibits PtdIns5P production in a lipid kinase assay. Preliminary experiments carried out in this thesis used YM201636 to further examine the mechanism of insulin- stimulated PtdIns5P production in L6 myotubes. No noticeable change in insulin- stimulated PtdIns5P levels (100nM insulin) were observed in the presence of 800nM

YM201636 compared to insulin-stimulation alone. It is possible that YM201636 was used at a sub-optimal concentration for this set of experiments in the L6 cell type.

158

However, several groups have used this concentration of PIKfyve and reported almost full inhibition of glucose uptake in 3T3-L1 adipocytes (Ikonomov et al.,

2009) and Akt S473 phosphorylation in 3T3-L1 adipocytes (Ikonomov et al., 2009) and NIH3T3 cells (Jefferies et al., 2008). Without complete data, it is hard to say why no change in PtdIns5P production was observed. It is a possibility that the population of cells used in this experiment failed to elicit a typical and significant

PtdIns5P increase in the presence of insulin (ie. The cells were unresponsive to challenge with insulin). In consideration of the above and given the preliminary nature of the experiments, results concerning the role of PIKfyve involvement in insulin-stimulated PtdIns5P production are inconclusive. Whatever, the nature of these preliminary negative results it would be useful for anyone continuing with this or embarking on similar project(s) to revisit such an experiment in future.

Given the several potential routes of PtdIns5P production and removal (figure 6.1), and considering what is currently known about the nature and function of the

PtdIns5P insulin response, it would be impractical to rule out any particular pathway in favour of another at present. For instance, PIP4KIIs, the family of kinase isoforms involved in PtdIns5P removal, may contribute to substantial

PtdIns5P increases simply by their inhibition. Take the role of PIP4KIIβ in the nucleus in response to UV and oxidative stress for example (Jones et al., 2006); the stress-activated protein kinase, p38, inhibits PIP4KIIβ by S326 phosphorylation in response to these stressors, which in turn approximately causes a three-fold rise in PtdIns5P levels. PtdIns5P generated in this manner is thought to positively regulate ING2 and p53 function in the nuclear response to cellular stress (see section 1.2.3.1 of the introduction).

6.2 Discussion of PtdIns5P’s role in insulin signalling

The study by Shisheva and co-workers in 3T3-L1 adipocytes (Sbrissa et al., 2004) initially asked the question of what purpose might an insulin induced increase in

159

PtdIns5P serve? It went on to suggest that a role for PtdIns5P in GLUT4 translocation was the answer i.e. the authors showed that increasing PtdIns5P levels in single adipocytes by microinjection led to increased presence of the transporter at the plasma membrane (Sbrissa et al., 2004). A similar result was obtained in this project using carrier-mediated delivery of PtdIns5P in L6 myotubes

(figure 4.8). However, this project has shown for the first time that a rise in

PtdIns5P levels in the absence of insulin causes an increase in glucose uptake

(figure 4.7). Further to this, PtdIns5P seems to be necessary for glucose uptake as overexpression of PIP4KIIα not only abolishes the insulin induced PtdIns5P rise

(figure 4.3) but also glucose uptake (figure 4.4). These results together highlight the strong possibility of PtdIns5P playing an essential role in insulin signalling and insulin-stimulated glucose uptake by an unknown mechanism.

6.2.1 Possible mechanisms of PtdIns5P action on glucose uptake

6.2.1.1 :Does PtdIns5P activate a PI3-kinase?

The theory behind PtdIns5P‟s activation of class IA PI3-kinase is that elevated levels of this phosphoinositide regulate an unidentified tyrosine kinase able to activate class IA PI3-kinase (Pendaries et al., 2006) – see also figure 6.2 an introductory section 1.2.4.3). Here, initial pharmacological studies showed the glucose uptake response to exogenous PtdIns5P delivery to be sensitive to the PI3- kinase inhibitor wortmannin (Figure 4.11). Whilst this is in line with the PI3-kinase

IA activation theory, it does not rule out any of the other class PI3-kinases that show wortmannin sensitivity, such as class III PI3-kinase and the class II PI3- kinase PIK-C2β. However, PIK-C2β is only poorly activated in response to insulin in

CHO-IR cells (Brown et al., 1999). Pendaries and co-workers also found that the effect of PtdIns5P on PI3-kinase and Akt activation was sensitive to incubation with the tyrosine kinase inhibitor Herbimycin A (Pendaries et al. 2006) this strongly inhibited PI3-kinase-dependent Akt

160

Figure 6.2: Existing mechanistic theories concerning PtdIns5P’s action on insulin-stimulated events.

The figure shows three mechanisms which warrant consideration when examining how PtdIns5P might take its action on glucose uptake via insulin-stimulated events. Pathway A implicates PtdIns5P in PI3-kinase activation, probably via a tyrosine kinase as reported in Pendaries et al., 2006. Pathway B, first described in Carricaburu et al., 2003 proposes

that enhanced PtdIns5P levels serve to inhibit a PtdIns(3,4,5)P3 phosphatase and this is needed for propagation of the insulin signal. The recent findings that elevated PtdIns5P levels can inhibit PP2A phosphatase and its action on Akt (Ramel et al., 2009) pose the possibility that insulin-stimulated PtdIns5P may take action via route C. Arrows refer to upregulation of targets, blunted arrows indicate inhibitory mechanisms and minus signs in boxes indicate where these inhibitory mechanisms are thought to be relieved by enhanced PtdIns5P levels.

phosphorylation. Here, the hypothesis that PtdIns5P may regulate PI3-kinase activation via a tyrosine kinase was tested initially by using the AG213 tyrosine kinase inhibitor. Data show AG213 can inhibit PtdIns5P-enhanced glucose uptake

(figure 4.12). However, AG213 is also able to inhibit many tyrosine kinases including the PGDF receptor, PKC and AMPK at concentrations above the mM range

(Dvir et al., 1991). Any pathway involving tyrosine kinases yet unrelated to insulin- stimulated glucose uptake cannot readily be excluded considering these data alone.

161

AMPK is a prime example of this; as AMPK is an integral signalling component of the contraction-stimulated glucose uptake pathway (section 1.1.2) and that a high concentration of AG213 was used here, PtdIns5P signalling through AMPK, and ultimately contraction signalling, cannot be excluded

The use of alternative tyrosine kinase inhibitors could be used to confirm the results found here with AG213. Experiments looking at whether PtdIns5P delivery could enhance tyrosine phosphorylation in L6 myotubes were also carried out. However, these proved inconclusive as enhanced tyrosine phosphorylation was not observed even in the insulin-stimulated control population of myotubes in this particular experiment (results not shown), despite insulin successfully enhancing tyrosine phosphorylation in a previous experiment (figure 3.3). The work of the Shisheva group in adipocytes (Sbrissa et al., 2004) suggests that PtdIns5P acts in the promotion of GLUT4 translocation in a wortmannin insensitive manner (although

GLUT4 translocation in the presence of wortmannin wasn‟t directly tested).

However, the findings presented in this thesis show that the effects of synthetic

PtdIns5P on glucose uptake are sensitive to this inhibitor (Figure1). To further assess the plausibility of the PI3-kinase activation theory, measurements of insulin- stimulated PtdIns(3,4,5)P3 levels, in the presence of PIP4KIIα overexpression or exogenous PtdIns5P delivery, were planned but required more time to complete than available.

Phosphorylation on both S473 and T308 sites of Akt was enhanced for the full 30 minutes of a carrier-delivered PtdIns5P time course (figures 4.13 and 4.14).

PtdIns5P activation of a class IA PI3-kinase would subsequently increase Akt activation, which would be a simple explanation for this observation. However, it would seem that the mode of PtdIns5P‟s action on Akt is not as straightforward as this. There are two suggestions as to how a PtdIns5P increase could affect the Akt signal (apart from PI3-kinase IA activation): the PtdIns(3,4,5)P3 signal could be prolonged by PtdIns5P inhibition of a PtdIns(3,4,5)P3 phosphatase increasing Akt

162 phosphorylation or PtdIns5P may inhibit an Akt-specific phosphatase, leading to the accumulation of phosphorylated Akt.

6.2.1.2 Does PtdIns5P take its action via inhibition of a PtdIns(3,4,5)P3 or

Akt phosphatase?

Increased PtdIns5P levels, using a variety of methods, have been shown to enhance PtdIns(3,4,5)P3 levels and Akt activation (Carricacaburu et al., 2003,

Pendaries et al., 2006, Ramel et al., 2009). Currently, there are two theories as to how PtdIns5P may enhance PtdIns(3,4,5)P3 levels, even so, the two are not mutually exclusive. The first theory implicates PtdIns5P in PI3-kinase activation (as discussed in section 6.2.1.1 above). The other proposes that PtdIns5P serves to inhibit dephosphorylation of class IA PI3-kinase‟s product, PtdIns(3,4,5)P3, by inhibiting the activity of a PtdIns(3,4,5)P3 phosphatase and prolonging the

PtdIns(3,4,5)P3 signal (figure 6.2, pathway B). This theory was first suggested by

Carricaburu and co-workers, who further proposed that a PtdIns(3,4,5)P3 5- phosphatase was a more plausible candidate for the role of PtdIns5P. The observation that PIP4KIIβ overexpression did not decrease PtdIns(3,4)P2 levels rules out PTEN, both a PtdIns(3,4,5)P3 and PtdIns(3,4)P2 3-phosphatase. The candidate 5-phosphatase could either be SHIP2 or SKIP, but was not further investigated (Carricaburu et al., 2003). A recent study by Ramel et al. suggests that PtdIns5P cannot affect the phosphatase activities of either PTEN or SHIP2

(Ramel et al., 2009), however, they did not look at SKIP activity.

The fundamental problem with the PtdIns(3,4,5)P3 phosphatase theory is that it would not explain the increased level of glucose uptake observed here upon carrier- mediated delivery of PtdIns5P; i.e. it would take a considerable amount of

PtdIns(3,4,5)P3 accumulation, in the absence of insulin, to trigger a similar level of glucose uptake to that produced by insulin-stimulation, (figure 4.7). It is more likely that the level of PtdIns(3,4,5)P3 needed to instigate glucose uptake requires

163 activation of class IA PI3-kinase (possibly in addition to inhibition of a

PtdIns(3,4,5)P3 phosphatase). If PtdIns5P does downregulate a phosphatase, the two theories – phosphatase inhibition and PI3-kinase activation – working together is more plausible in the context of the glucose uptake result presented in section

4.3.3, (figure 4.7).

Work looking at how a PtdIns5P decrease impacts upon PtdIns(3,4,5)P3 production in response to insulin could be done using the existing PTPMT1 heterodimerisation system if it can be successfully transferred to L6 myotubes (see chapter 5). First it would need to be established as to whether this system can deplete PtdIns5P in the presence of insulin in this cell type as it did in the HeLa(S3) cells (figure 5.8). Again depletion of PtdIns(3,4,5)P3 production could indicate PtdIns5P’s involvement in

PI3-kinase activation. The heterodimerisation system would also be used to further support the conclusions of the glucose uptake experiments performed on PIP4KIIα overexpressing cells (figure 4.7). This would also rule out any question of the observed effects of PIP4KIIα overexpression being due to PtdIns3P removal – as

PIP4KIIs have been shown to phosphorylate this phosphoinositide in vitro (see

Introduction) – due to PTPMT1 being specific for PtdIns5P (Pagliarini et al., 2004) .

Regarding inhibition of an Akt phosphatase, The latter hypothesis was proposed in a recent study by Ramel et al (Ramel et al., 2009) where PtdIns5P inhibition of PP2A leads to increased Akt phosphorylation. It was also found that the inhibitory affect of IpgD overexpression on PP2A activity was blunted by some 50% in cells expressing PIP4KIIβ. This phosphatase was previously shown to dephosphorylate

Akt at both T308 and Ser 473 sites (Ugi et al. 2004). It is also possible that PHLPP, which dephosphorylates the S473 site, can be regulated by PtdIns5P, the study conducted by Ramel et al. could not formally rule out this phosphatase but speculated that because phosphorylation of both S473 and T308 residues was maintained, inhibition of PP2A, which acts upon both sites of phosphorylation, was most likely (Ramel et al., 2009).

164

Like the PtdIns(3,4,5)P3 phosphatase theory, the Akt phosphatase model would not explain why the effects of PtdIns5P delivery on glucose uptake, in the absence of insulin, are so similar to 100nM insulin. The discussion for the disparity between

PtdIns5P-induced glucose uptake levels and phospho-S473 has already been discussed in section 4.9, so will not be revisited here in great detail. Taken with the phospho-Akt result in figure 4.13, the glucose uptake assay results in the presence of PtdIns5P (figure 4.7) suggest an increase of Akt phosphorylation rather than inhibition of its dephosphorylation due to the size of the response. However, results found here reveal that the PtdIns5P-induced phospho-S473 appeared to increase gradually and consistently over a 30 minute time course. Considering this, the gradual accumulation of PtdIns5P-induced Akt phosphorylation (figure 4.14) could mean, mechanistically speaking, that PtdIns5P action on Akt phosphorylation might work through inhibition of an Akt or PtdIns(3,4,5)P3 phosphatase (Figure 6.2, pathway C). This is because the steady accumulation profile of phospho-S473 is more indicative of phosphatase inhibition, rather than the activation of an insulin- signalling kinase, which would give a more instant phospho-S473 „response‟.

This study attempted to look at PP2A activity in response to PtdIns5P delivery.

However, it was not possible in the time since the release of the PP2A study (Ramel et al., 2009), to successfully isolate enough of the phosphatase to assess PP2A activity by a phosphatase assay. Therefore, the study here can neither confirm nor rule out the possibility of PtdIns5P playing a role in prolongation of the Akt signal by protecting Akt from dephosphorylation by PP2A.

Alternative approaches to test this hypothesis could include the use of a PP2A- specific inhibitor or phosphatase-dead PP2A mutant. Either of these would determine whether the PtdIns5P induced accumulation of phospho-S473, seen in figures 4.13 and 4.14, was due to the inhibition of PP2A activity. To explain briefly, if Akt S473 phosphorylation still occurred in response to PtdIns5P delivery following

PP2A pre-inhibition, or in the presence of inactive PP2A, PP2A could then be ruled

165 out as a PtdIns5P effector. There is a broad range of PP2A inhibitors available:

Okadaic acid and calyculin A are both known to inhibit PP2A activity, though these also block ERK5 activation (Garcia et al., 2002) and Okadaic acid also inhibits PP1

(Favre et al., 1997) a related protein phosphatase. Cantharidin, a toxin secreted by certain types of beetle, has also been demonstrated to inhibit PP2A, but only has a slightly lower IC50 value for PP1 (Fan et al., 2010). Lastly, fostriecin, an antitumor antibiotic produced by Streptomyces pulveraceus, is a strong inhibitor of PP2A (IC50

3.2 nM) and a weak inhibitor of PP1 (IC50 131 μM). Fostriecin has no apparent effect on the activity of PP2B (Walsh et al., 1997).

6.2.1.3 GLUT4 dynamics in L6 skeletal muscle: A different perspective on

PtdIns5P’s potential mechanism of action

All of the theories discussed above (sections 6.2.1.1 and 6.2.1.2) seem far removed from the L6 myotube setting – even results found in 3T3-L1 adipocytes do not truly represent what may be happening in the L6 cell. As discussed in the opening chapter (section 1.1.2), recent evidence has prompted re-evaluation of existing models of GLUT4 translocation in L6 myotubes. Any work investigating GLUT4 translocation and glucose uptake in skeletal muscle should take into account that this occurs via an inhibition of endocytosis whereas insulin-stimulated GLUT4 translocation in 3T3-L1 adipocytes occurs via a stimulation of exocytosis

(Fazakerley et al., 2010).

So what does this new evidence mean for PtdIns5P and its potential action on glucose uptake? To start with, focusing all research efforts on the earlier events of the insulin-signalling pathway (i.e. class IA PI3-kinase activation, Akt phosphorylation) instead of looking at downregulation of GLUT4 endocytosis, may limit the research scope in terms of PtdIns5P‟s role in the insulin-response of L6 myotubes. As discussed earlier, reduction of GLUT4 endocytosis is a common mechanism in both the insulin and contractile response of muscle; could PtdIns5P

166 have a role in the latter pathway? It would be interesting to examine the effect of an AMPK agonist, such as AICAR, on PtdIns5P production in L6 myotubes to begin to answer this question.

It is difficult to say how PtdIns5P might affect GLUT4 endocytosis, but it is interesting that this phosphoinositide has been shown to be produced, at least in vitro, by PIKfyve or by PIKfyve cooperation with MTM/Rs. PIKfyve is interesting here as it is also thought to be associated with GSVs as it colocalises with IRAP, a protein with identical trafficking patterns to GLUT4 (Berwick et al. 2004). PtdIns5P could be produced by PIKfyve at this localisation and help facilitate the inhibition of endocytosis at the site of the GSV. This is all very speculative, however it is worth bearing in mind that the plasma membrane might not be the only site of PtdIns5P action with regards to the insulin signal.

6.3 Future directions

There has been substantial progress made by this project in terms of setting up the research group for researching PtdIns5P (and other phosphoinositides) in L6 myotubes. However, many questions still remain (see sections 6.2.1.1, 6.2.1.2 and

6.2.1.3). If the project had been extended, there are several experiments that would be done to begin to address these questions. The first set of experiments would be to revisit the PtdIns5P-enhanced glucose uptake and its apparent wortmannin sensitivity, using an inhibitor more specific for class IA PI3-kinase. The main pharmacological candidate here is the class IA p110α isoform-specific inhibitor

Compound 15e (IC50 = 0.002 μM), (Hayakawa et al., 2006;Folkes et al., 2008).

PI3-kinase catalytic subunit p110α has been shown to be most important for insulin signalling (Chaussade et al., 2007) and would make a good target to assess the dependency of PtdIns5P-induced glucose uptake on a class IA PI3-kinase isoform here.

167

To address whether PtdIns5P may potentially work in alternative pathways, the additive effect of PtdIns5P delivery in the presence of insulin could be visited. This would first be assessed by glucose uptake. If PtdIns5P did potentially act in a second pathway, then a further increase in glucose uptake on top of insulin stimulation observed. A single preliminary additive experiment was performed, though these results were preliminary, no additive effect was seen in any of the experiments; indicating PtdIns5P acts within the insulin signalling pathway.

It would also be interesting to see how AICAR, the AMPK agonist affects PtdIns5P levels. There is evidence that L6 myotubes contain two discrete pools of cycling

GLUT4 (Fazakerley et al. 2010) as AMPK agonists are able to raise the recycling pool from 75% with insulin stimulation alone to 88%. It would be of high importance to see in the PtdIns5P rise seen in this project (figure 4.7) was exclusive for insulin and rule out the contraction pathway, another pathway that is of great significance in the GLUT4 dynamics of L6 myotubes.

Finally, the movement of GLUT4 to the cell surface could be assessed with GFP- tagged GLUT4 (Ishiki et al., 2005a;Antonescu et al., 2008b) rather than the use of plasma membrane lawns.

168

7 References

169

ADOCHIO, R. L., LEITNER, J. W., GRAY, K., DRAZNIN, B. & CORNIER, M. A. 2009. Early responses of insulin signaling to high-carbohydrate and high-fat overfeeding. Nutr Metab (Lond), 6, 37. AGUIRRE, V., UCHIDA, T., YENUSH, L., DAVIS, R. & WHITE, M. F. 2000. The c-Jun NH2-terminal Kinase Promotes Insulin Resistance during Association with Insulin Receptor Substrate-1 and Phosphorylation of Ser307. Journal of Biological Chemistry, 275, 9047-9054. ALESSI, D. R., JAMES, S. R., DOWNES, C. P., HOLMES, A. B., GAFFNEY, P. R. J., REESE, C. B. & COHEN, P. 1997. Characterization of a 3-phosphoinositide- dependent protein kinase which phosphorylates and activates protein kinase B[alpha]. Current Biology, 7, 261-269. ALVAREZ-VENEGAS, R., SADDER, M., HLAVACKA, A., BALUSKA, F., XIA, Y., LU, G., FIRSOV, A., SARATH, G., MORIYAMA, H., DUBROVSKY, J. G. & AVRAMOVA, Z. 2006. The Arabidopsis homolog of trithorax, ATX1, binds phosphatidylinositol 5-phosphate, and the two regulate a common set of target genes. Proc Natl Acad Sci U S A, 103, 6049-54. ANTONESCU, C. N., DIAZ, M., FEMIA, G., PLANAS, J. V. & KLIP, A. 2008a. Clathrin- dependent and independent endocytosis of glucose transporter 4 (GLUT4) in myoblasts: regulation by mitochondrial uncoupling. Traffic, 9, 1173-90. ANTONESCU, C. N., RANDHAWA, V. K. & KLIP, A. 2008b. Dissecting GLUT4 traffic components in L6 myocytes by fluorescence-based, single-cell assays. Methods Mol Biol, 457, 367-78. ARAKI, E., LIPES, M. A., PATTI, M.-E., BRUNING, J. C., HAAG III, B., JOHNSON, R. S. & KAHN, C. R. 1994. Alternative pathway of insulin signalling in mice with targeted disruption of the IRS-1 gene. Nature, 372, 186-190. ARCARO, A., VOLINIA, S., ZVELEBIL, M. J., STEIN, R., WATTON, S. J., LAYTON, M. J., GOUT, I., AHMADI, K., DOWNWARD, J. & WATERFIELD, M. D. 1998. Human phosphoinositide 3-kinase C2beta, the role of calcium and the C2 domain in enzyme activity. J Biol Chem, 273, 33082-90. ARCARO, A. & WYMANN, M. P. 1993. Wortmannin is a potent phosphatidylinositol 3-kinase inhibitor: the role of phosphatidylinositol 3,4,5-trisphosphate in neutrophil responses. Biochem J, 296 ( Pt 2), 297-301. ARENDT, K. L., ROYO, M., FERNANDEZ-MONREAL, M., KNAFO, S., PETROK, C. N., MARTENS, J. R. & ESTEBAN, J. A. 2010. PIP3 controls synaptic function by maintaining AMPA receptor clustering at the postsynaptic membrane. Nat Neurosci, 13, 36-44. BACKER, J. M. 2008. The regulation and function of Class III PI3Ks: novel roles for Vps34. Biochem J, 410, 1-17. BACKERS, K., BLERO, D., PATERNOTTE, N., ZHANG, J. & ERNEUX, C. 2003. The termination of PI3K signalling by SHIP1 and SHIP2 inositol 5-phosphatases. Adv Enzyme Regul, 43, 15-28. BAE, S. S., CHO, H., MU, J. & BIRNBAUM, M. J. 2003. Isoform-specific Regulation of Insulin-dependent Glucose Uptake by Akt/Protein Kinase B. Journal of Biological Chemistry, 278, 49530-49536. BAILYES, E. M., NAVÉ, B. T., SOOS, M. A., ORR, S. R., HAYWARD, A. C. & SIDDLE, K. 1997. Insulin receptor/IGF-I receptor hybrids are widely distributed in mammalian tissues: quantification of individual receptor species by selective immunoprecipitation and immunoblotting. Biochem. J., 327, 209-215. BALOGH, S., NAUS, C. C. & MERRIFIELD, P. A. 1993. Expression of gap junctions in cultured rat L6 cells during myogenesis. Dev Biol, 155, 351-60. BANDYOPADHYAY, G., KANOH, Y., SAJAN, M. P., STANDAERT, M. L. & FARESE, R. V. 2000. Effects of Adenoviral Gene Transfer of Wild-Type, Constitutively Active, and Kinase-Defective Protein Kinase C-{lambda} on Insulin- Stimulated Glucose Transport in L6 Myotubes. Endocrinology, 141, 4120- 4127.

170

BANDYOPADHYAY, G. K., YU, J. G., OFRECIO, J. & OLEFSKY, J. M. 2005. Increased p85/55/50 Expression and Decreased Phosphotidylinositol 3-Kinase Activity in Insulin-Resistant Human Skeletal Muscle. Diabetes, 54, 2351-2359. BARLOW, C. A., LAISHRAM, R. S. & ANDERSON, R. A. 2010. Nuclear phosphoinositides: a signaling enigma wrapped in a compartmental conundrum. Trends in Cell Biology, 20, 25-35. BECHTEL, P. J. 1979. Identification of a high molecular weight actin-binding protein in skeletal muscle. J Biol Chem, 254, 1755-8. BERGER, P., SCHAFFITZEL, C., BERGER, I., BAN, N. & SUTER, U. 2003. Membrane association of myotubularin-related protein 2 is mediated by a pleckstrin homology-GRAM domain and a coiled-coil dimerization module. Proc Natl Acad Sci U S A, 100, 12177-82. BERTOLA, A., BONNAFOUS, S., CORMONT, M., ANTY, R., TANTI, J.-F., TRAN, A., LE MARCHAND-BRUSTEL, Y. & GUAL, P. 2007. Hepatocyte Growth Factor Induces Glucose Uptake in 3T3-L1 Adipocytes through A Gab1/Phosphatidylinositol 3-Kinase/Glut4 Pathway. Journal of Biological Chemistry, 282, 10325-10332. BERWICK, D. C., DELL, G. C., WELSH, G. I., HEESOM, K. J., HERS, I., FLETCHER, L. M., COOKE, F. T., TAVARE, J. M. 2004. Protein kinase B phosphorylation of PIKfyve regulates the trafficking of GLUT4 vesicles. J Cell Sci, 117, 5985-93. BLAZER-YOST, B. L., ESTERMAN, M. A. & VLAHOS, C. J. 2003. Insulin-stimulated trafficking of ENaC in renal cells requires PI 3-kinase activity. AJP - Cell Physiology, 284, C1645-1653. BLIGH, E. G. & DYER, W. J. 1959. A rapid method of total lipid extraction and purification. Can J Biochem Physiol, 37, 911-7. BORNEMANN, A., PLOUG, T. & SCHMALBRUCH, H. 1992. Subcellular localization of GLUT4 in nonstimulated and insulin-stimulated soleus muscle of rat. Diabetes, 41, 215-221. BRACHMANN, S. M., UEKI, K., ENGELMAN, J. A., KAHN, R. C. & CANTLEY, L. C. 2005. Phosphoinositide 3-Kinase Catalytic Subunit Deletion and Regulatory Subunit Deletion Have Opposite Effects on Insulin Sensitivity in Mice. Molecular and Cellular Biology, 25, 1596-1607. BROWN, R. A., DOMIN, J., ARCARO, A., WATERFIELD, M. D. & SHEPHERD, P. R. 1999. Insulin activates the alpha isoform of class II phosphoinositide 3- kinase. J Biol Chem, 274, 14529-32. BRUSS, M. D., ARIAS, E. B., LIENHARD, G. E. & CARTEE, G. D. 2005. Increased phosphorylation of Akt substrate of 160 kDa (AS160) in rat skeletal muscle in response to insulin or contractile activity. Diabetes, 54, 41-50. BRYANT, N. J., GOVERS, R. & JAMES, D. E. 2002. Regulated transport of the glucose transporter GLUT4. Nat Rev Mol Cell Biol, 3, 267-277. BULTSMA, Y., KEUNE, W. J. & DIVECHA, N. 2010. PIP4Kbeta interacts with and modulates nuclear localization of the high-activity PtdIns5P-4-kinase isoform PIP4Kalpha. Biochem J, 430, 223-35. CAI, D., DHE-PAGANON, S., MELENDEZ, P. A., LEE, J. & SHOELSON, S. E. 2003. Two new substrates in insulin signaling, IRS5/DOK4 and IRS6/DOK5. J Biol Chem, 278, 25323-30. CALERA, M. R., MARTINEZ, C., LIU, H., JACK, A. K. E., BIRNBAUM, M. J. & PILCH, P. F. 1998. Insulin Increases the Association of Akt-2 with Glut4-containing Vesicles. Journal of Biological Chemistry, 273, 7201-7204. CARLSON, C. J., WHITE, M. F. & RONDINONE, C. M. 2004. Mammalian target of rapamycin regulates IRS-1 serine 307 phosphorylation. Biochem Biophys Res Commun, 316, 533-9. CARRICABURU, V., LAMIA, K. A., LO, E., FAVEREAUX, L., PAYRASTRE, B., CANTLEY, L. C. & RAMEH, L. E. 2003. The phosphatidylinositol (PI)-5-phosphate 4- kinase type II enzyme controls insulin signaling by regulating PI-3,4,5- trisphosphate degradation. Proc Natl Acad Sci U S A, 100, 9867-72.

171

CARVALHO, E., ELIASSON, B., WESSLAU, C. & SMITH, U. 2000a. Impaired phosphorylation and insulin-stimulated translocation to the plasma membrane of protein kinase B/Akt in adipocytes from Type II diabetic subjects. Diabetologia, 43, 1107-1115. CARVALHO, E., RONDINONE, C. & SMITH, U. 2000b. Insulin resistance in fat cells from obese Zucker rats - Evidence for an impaired activation and translocation of protein kinase B and glucose transporter 4. Molecular and Cellular Biochemistry, 206, 7-16. CASAMAYOR, A., MORRICE, N. A. & ALESSI, D. R. 1999. Phosphorylation of Ser- 241 is essential for the activity of 3-phosphoinositide-dependent protein kinase-1: identification of five sites of phosphorylation in vivo. Biochem J, 342 ( Pt 2), 287-92. CASTELLANO, F., MONTCOURRIER, P., GUILLEMOT, J.-C., GOUIN, E., MACHESKY, L., COSSART, P. & CHAVRIER, P. 1999. Inducible recruitment of Cdc42 or WASP to a cell-surface receptor triggers actin polymerization and filopodium formation. Current biology : CB, 9, 351-361. CHADT, A., LEICHT, K., DESHMUKH, A., JIANG, L. Q., SCHERNECK, S., BERNHARDT, U., DREJA, T., VOGEL, H., SCHMOLZ, K., KLUGE, R., ZIERATH, J. R., HULTSCHIG, C., HOEBEN, R. C., SCHURMANN, A., JOOST, H.-G. & AL- HASANI, H. 2008. Tbc1d1 mutation in lean mouse strain confers leanness and protects from diet-induced obesity. Nat Genet, 40, 1354-1359. CHANG, L., CHIANG, S.-H. & SALTIEL, A. R. 2007. TC10{alpha} Is Required for Insulin-Stimulated Glucose Uptake in Adipocytes. Endocrinology, 148, 27- 33. CHAUSSADE, C., REWCASTLE, G. W., KENDALL, J. D., DENNY, W. A., CHO, K., GRONNING, L. M., CHONG, M. L., ANAGNOSTOU, S. H., JACKSON, S. P., DANIELE, N. & SHEPHERD, P. R. 2007. Evidence for functional redundancy of class IA PI3K isoforms in insulin signalling. Biochem J, 404, 449-58. CHEATHAM, B., VLAHOS, C. J., CHEATHAM, L., WANG, L., BLENIS, J., KAHN, C. R. 1994. Phosphatidylinositol 3-kinase activation is required for insulin stimulation of pp70 S6 kinase, DNA synthesis, and glucose transporter translocation. Mol Cell Biol, 14, 4902-11. CHEN, J., LU, G. & WANG, Q. J. 2005. Protein kinase C-independent effects of protein kinase D3 in glucose transport in L6 myotubes. Mol Pharmacol, 67, 152-62. CHEN, W. S., XU, P. Z., GOTTLOB, K., CHEN, M. L., SOKOL, K., SHIYANOVA, T., RONINSON, I., WENG, W., SUZUKI, R., TOBE, K., KADOWAKI, T. & HAY, N. 2001. Growth retardation and increased apoptosis in mice with homozygous disruption of the Akt1 gene. Genes Dev, 15, 2203-8. CHEN, Y. T., HOLCOMB, C. & MOORE, H. P. 1993. Expression and localization of two low molecular weight GTP-binding proteins, Rab8 and Rab10, by epitope tag. Proc Natl Acad Sci U S A, 90, 6508-12. CHIANG, S. H., BAUMANN, C. A., KANZAKI, M., THURMOND, D. C., WATSON, R. T., NEUDAUER, C. L., MACARA, I. G., PESSIN, J. E. & SALTIEL, A. R. 2001. Insulin-stimulated GLUT4 translocation requires the CAP-dependent activation of TC10. Nature, 410, 944-8. CHIANG, S. H., HOU, J. C., HWANG, J., PESSIN, J. E. & SALTIEL, A. R. 2002. Cloning and functional characterization of related TC10 isoforms, a subfamily of Rho proteins involved in insulin-stimulated glucose transport. J Biol Chem, 277, 13067-73. CHO, H., MU, J., KIM, J. K., THORVALDSEN, J. L., CHU, Q., CRENSHAW, E. B., III, KAESTNER, K. H., BARTOLOMEI, M. S., SHULMAN, G. I. & BIRNBAUM, M. J. 2001a. Insulin Resistance and a Diabetes Mellitus-Like Syndrome in Mice Lacking the Protein Kinase Akt2 (PKBbeta ). Science, 292, 1728-1731. CHO, H., THORVALDSEN, J. L., CHU, Q., FENG, F. & BIRNBAUM, M. J. 2001b. Akt1/PKBalpha is required for normal growth but dispensable for maintenance of glucose homeostasis in mice. J Biol Chem, 276, 38349-52.

172

CHOU, M. M., HOU, W., JOHNSON, J., GRAHAM, L. K., LEE, M. H., CHEN, C.-S., NEWTON, A. C., SCHAFFHAUSEN, B. S. & TOKER, A. 1998. Regulation of protein kinase C [zeta] by PI 3-kinase and PDK-1. Current Biology, 8, 1069- 1078. CHOUDHURY, P., SRIVASTAVA, S., LI, Z., KO, K., ALBAQUMI, M., NARAYAN, K., COETZEE, W. A., LEMMON, M. A. & SKOLNIK, E. Y. 2006. Specificity of the myotubularin family of phosphatidylinositol-3-phosphatase is determined by the PH/GRAM domain. J Biol Chem, 281, 31762-9. CIRUELA, A., HINCHLIFFE, K. A., DIVECHA, N. & IRVINE, R. F. 2000. Nuclear targeting of the beta isoform of type II phosphatidylinositol phosphate kinase (phosphatidylinositol 5-phosphate 4-kinase) by its alpha-helix 7. Biochem J, 346 Pt 3, 587-91. CLARKE, J. H., EMSON, P. C. & IRVINE, R. F. 2008. Localization of phosphatidylinositol phosphate kinase II{gamma} in kidney to a membrane trafficking compartment within specialized cells of the nephron. AJP - Renal Physiology, 295, F1422-1430. CLARKE, J. H., LETCHER, A. J., D'SANTOS C, S., HALSTEAD, J. R., IRVINE, R. F. & DIVECHA, N. 2001. Inositol lipids are regulated during cell cycle progression in the nuclei of murine erythroleukaemia cells. Biochem J, 357, 905-10. CONG, L. N., CHEN, H., LI, Y., ZHOU, L., MCGIBBON, M. A., TAYLOR, S. I., QUON, M. J., HILL, M. M., CLARK, S. F., TUCKER, D. F., BIRNBAUM, M. J., JAMES, D. E., MACAULAY, S. L., KOHN, A. D., SUMMERS, S. A. & ROTH, R. A. 1997. Physiological role of Akt in insulin-stimulated translocation of GLUT4 in transfected rat adipose cells. Mol Endocrinol, 11, 1881-90. COOKE, F. T. 2002. Phosphatidylinositol 3,5-bisphosphate: metabolism and function. Archives of Biochemistry and Biophysics, 407, 143-151. CORONAS, S., LAGARRIGUE, F., RAMEL, D., CHICANNE, G., DELSOL, G., PAYRASTRE, B. & TRONCHERE, H. 2008. Elevated levels of PtdIns5P in NPM- ALK transformed cells: implication of PIKfyve. Biochem Biophys Res Commun, 372, 351-5. COSTA, C., BARBERIS, L., AMBROGIO, C., MANAZZA, A. D., PATRUCCO, E., AZZOLINO, O., NEILSEN, P. O., CIRAOLO, E., ALTRUDA, F., PRESTWICH, G. D., CHIARLE, R., WYMANN, M., RIDLEY, A. & HIRSCH, E. 2007. Negative feedback regulation of Rac in leukocytes from mice expressing a constitutively active phosphatidylinositol 3-kinase gamma. Proceedings of the National Academy of Sciences of the United States of America, 104, 14354-9. CROWDER, R. J., ENOMOTO, H., YANG, M., JOHNSON, E. M. & MILBRANDT, J. 2004. Dok-6, a Novel p62 Dok Family Member, Promotes Ret-mediated Neurite Outgrowth. Journal of Biological Chemistry, 279, 42072-42081. CURRIE, R. A., WALKER, K. S., GRAY, A., DEAK, M., CASAMAYOR, A., DOWNES, C. P., COHEN, P., ALESSI, D. R. & LUCOCQ, J. 1999. Role of phosphatidylinositol 3,4,5-trisphosphate in regulating the activity and localization of 3-phosphoinositide-dependent protein kinase-1. Biochem J, 337 ( Pt 3), 575-83. CUSHMAN, S. W. & WARDZALA, L. J. 1980. Potential mechanism of insulin action on glucose transport in the isolated rat adipose cell. Apparent translocation of intracellular transport systems to the plasma membrane. Journal of Biological Chemistry, 255, 4758-4762. CZECH, M. P. 1982. Structural and functional homologies in the receptors for insulin and the insulin-like growth factors. Cell, 31, 8-10. CZECH, M. P., CHAWLA, A., WOON, C. W., BUXTON, J., ARMONI, M., TANG, W., JOLY, M. & CORVERA, S. 1993. Exofacial epitope-tagged glucose transporter chimeras reveal COOH-terminal sequences governing cellular localization. J Cell Biol, 123, 127-35.

173

D'ANGELO, G., VICINANZA, M., DI CAMPLI, A. & DE MATTEIS, M. A. 2008. The multiple roles of PtdIns(4)P -- not just the precursor of PtdIns(4,5)P2. J Cell Sci, 121, 1955-63. DAWSON, K., AVILES-HERNANDEZ, A., CUSHMAN, S. W. & MALIDE, D. 2001. Insulin-Regulated Trafficking of Dual-Labeled Glucose Transporter 4 in Primary Rat Adipose Cells. Biochemical and Biophysical Research Communications, 287, 445-454. DEFRONZO, R. A., JACOT, E., JEQUIER, E., MAEDER, E., WAHREN, J. & FELBER, J. P. 1981. The effect of insulin on the disposal of intravenous glucose. Results from indirect calorimetry and hepatic and femoral venous catheterization. Diabetes, 30, 1000-1007. DIABETESUK 2010. Diabetes in the UK 2010: Key statistics on Diabetes, available at: http://www.diabetes.org.uk/Documents/Reports/Diabetes_in_the_UK_2010. pdf DOBSON, S. P., LIVINGSTONE, C., GOULD, G. W. & TAVARE, J. M. 1996. Dynamics of insulin-stimulated translocation of GLUT4 in single living cells visualised using green fluorescent protein. FEBS Lett, 393, 179-84. DOMIN, J., PAGES, F., VOLINIA, S., RITTENHOUSE, S. E., ZVELEBIL, M. J., STEIN, R. C. & WATERFIELD, M. D. 1997. Cloning of a human phosphoinositide 3- kinase with a C2 domain that displays reduced sensitivity to the inhibitor wortmannin. Biochem J, 326 ( Pt 1), 139-47. DONAHUE, A. C., KHARAS, M. G. & FRUMAN, D. A. 2007. Measuring Phosphorylated Akt and Other Phosphoinositide 3-kinase-Regulated Phosphoproteins in Primary Lymphocytes. In: BROWN, H. A. (ed.) Methods in Enzymology. Academic Press. DONG, S., CORRE, B., FOULON, E., DUFOUR, E., VEILLETTE, A., ACUTO, O. & MICHEL, F. 2006. T cell receptor for antigen induces linker for activation of T cell-dependent activation of a negative signaling complex involving Dok-2, SHIP-1, and Grb-2. J Exp Med, 203, 2509-18. DOVE, S. K., DONG, K., KOBAYASHI, T., WILLIAMS, F. K. & MICHELL, R. H. 2009. Phosphatidylinositol 3,5-bisphosphate and Fab1p/PIKfyve underPPIn endo- lysosome function. Biochem J, 419, 1-13. DOVE, S. K., MCEWEN, R. K., MAYES, A., HUGHES, D. C., BEGGS, J. D. & MICHELL, R. H. 2002. Vac14 Controls PtdIns(3,5)P2 Synthesis and Fab1-Dependent Protein Trafficking to the Multivesicular Body. Current biology, 12, 885-893. DUGANI, C. B. & KLIP, A. 2005. Glucose transporter 4: cycling, compartments and controversies. EMBO reports, 6, 1137-42. DVIR, A., MILNER, Y., CHOMSKY, O., GILON, C., GAZIT, A. & LEVITZKI, A. 1991. The inhibition of EGF-dependent proliferation of keratinocytes by tyrphostin tyrosine kinase blockers. The Journal of Cell Biology, 113, 857-865. EGUEZ, L., LEE, A., CHAVEZ, J. A., MIINEA, C. P., KANE, S., LIENHARD, G. E. & MCGRAW, T. E. 2005. Full intracellular retention of GLUT4 requires AS160 Rab GTPase activating protein. Cell metabolism, 2, 263-272. EICKHOLT, B. J., AHMED, A. I., DAVIES, M., PAPAKONSTANTI, E. A., PEARCE, W., STARKEY, M. L., BILANCIO, A., NEED, A. C., SMITH, A. J. H., HALL, S. M., HAMERS, F. P., GIESE, K. P., BRADBURY, E. J. & VANHAESEBROECK, B. 2007. Control of Axonal Growth and Regeneration of Sensory Neurons by the p110δ PI 3-Kinase. PLoS ONE, 2, e869. ELCHEBLY, M., PAYETTE, P., MICHALISZYN, E., CROMLISH, W., COLLINS, S., LOY, A. L., NORMANDIN, D., CHENG, A., HIMMS-HAGEN, J., CHAN, C.-C., RAMACHANDRAN, C., GRESSER, M. J., TREMBLAY, M. L. & KENNEDY, B. P. 1999. Increased Insulin Sensitivity and Obesity Resistance in Mice Lacking the Protein Tyrosine Phosphatase-1B Gene. Science, 283, 1544-1548. EUGSTER, A., PECHEUR, E.-I., MICHEL, F., WINSOR, B., LETOURNEUR, F. & FRIANT, S. 2004. Ent5p Is Required with Ent3p and Vps27p for Ubiquitin-

174

dependent Protein Sorting into the Multivesicular Body. Mol. Biol. Cell, 15, 3031-3041. EVANS, D. J., MURRAY, R. & KISSEBAH, A. H. 1984. Relationship between skeletal muscle insulin resistance, insulin-mediated glucose disposal, and insulin binding. Effects of obesity and body fat topography. J Clin Invest, 74, 1515- 25. FALASCA, M., HUGHES, W. E., DOMINGUEZ, V., SALA, G., FOSTIRA, F., FANG, M. Q., CAZZOLLI, R., SHEPHERD, P. R., JAMES, D. E. & MAFFUCCI, T. 2007. The role of phosphoinositide 3-kinase C2alpha in insulin signaling. J Biol Chem, 282, 28226-36. FAN, W., VAN VUUREN, D., GENADE, S. & LOCHNER, A. 2010. Kinases and phosphatases in ischaemic preconditioning: a re-evaluation. Basic Research in Cardiology, 105, 495-511. FANTIN, V. R., WANG, Q., LIENHARD, G. E. & KELLER, S. R. 2000. Mice lacking insulin receptor substrate 4 exhibit mild defects in growth, reproduction, and glucose homeostasis. AJP - Endocrinology and Metabolism, 278, E127-133. FARESE, R. V. 2002. Function and dysfunction of aPKC isoforms for glucose transport in insulin-sensitive and insulin-resistant states. AJP - Endocrinology and Metabolism, 283, E1-11. FARESE, R. V., SAJAN, M. P. & STANDAERT, M. L. 2005a. Atypical protein kinase C in insulin action and insulin resistance. Biochem. Soc. Trans., 33, 350-353. FARESE, R. V., SAJAN, M. P. & STANDAERT, M. L. 2005b. Insulin-sensitive protein kinases (atypical protein kinase C and protein kinase B/Akt): actions and defects in obesity and type II diabetes. Exp Biol Med (Maywood), 230, 593- 605. FAVRE, B., TUROWSKI, P., & HEMMINGS, B.A. 1997. Differential Inhibition and Posttranslational Modification of Protein Phosphatase 1 and 2A in MCF7 Cells Treated with Calyculin-A, Okadaic Acid, and Tautomycin. J. Biol. Chem.,272, 13856-13863. FAZAKERLEY, D. J., HOLMAN, G. D., MARLEY, A., JAMES, D. E., STÖCKLI, J. & COSTER, A. C. F. 2010. Kinetic Evidence for Unique Regulation of GLUT4 Trafficking by Insulin and AMP-activated Protein Kinase Activators in L6 Myotubes. J. Biol. Chem., 285, 1653-1660. FECCHI, K., VOLONTE, D., HEZEL, M. P., SCHMECK, K. & GALBIATI, F. 2006. Spatial and temporal regulation of GLUT4 translocation by flotillin-1 and caveolin-3 in skeletal muscle cells. FASEB J., 05-4661fje. FIRESTEIN, R., NAGY, P. L., DALY, M., HUIE, P., CONTI, M. & CLEARY, M. L. 2002. Male infertility, impaired spermatogenesis, and azoospermia in mice deficient for the pseudophosphatase Sbf1. J Clin Invest, 109, 1165-72. FOLKES, A.J., AHMADI, K., ALDERTON, W. K., ALIX, S., BAKER, S.J., BOX, G., CHUCKOWREE, I.S., CLARKE, P.A., DEPLEDGE, P., ECCLES, S.A., FREIDMAN, L.S., HAYES, A., HANCOX, T., KUGENDRADAS, A., LENSUN, L., MOORE, P., OLIVERO, A.G., PANG, J., PATEL, S., PERGL-WILSON, G. H., RAYNAUD, F.I., ROBSON, A., SAGHIR, N., SALPHATI, L., SOHAL, S., ULTSCH, M.H., VALENTI, M., WALLWEBER, H.J.A., CHI WAN, N., WEISMANN, C., WORKMAN, P., ZHYVOLOUP, A., ZVELEBIL, M.J. & SHUTTLEWORTH, S.J. The identification of 2-(1H-indazol-4-yl)-6-(4-methanesulfonyl-piperazin-1- ylmethyl)-4-morpholin-4-yl-thieno[3,2-d] pyrimidine (GDC-0941) as a potent, selective, orally bioavailable inhibitor of class I PI3 kinase for the treatment of cancer. 2008. J. Med. Chem., 51 (18), 5522–5532. FORAN, P. G. P., FLETCHER, L. M., OATEY, P. B., MOHAMMED, N., DOLLY, J. O. & TAVARÉ, J. M. 1999. Protein Kinase B Stimulates the Translocation of GLUT4 but Not GLUT1 or Transferrin Receptors in 3T3-L1 Adipocytes by a Pathway Involving SNAP-23, Synaptobrevin-2, and/or Cellubrevin. Journal of Biological Chemistry, 274, 28087-28095. FOUKAS, L. C., CLARET, M., PEARCE, W., OKKENHAUG, K., MEEK, S., PESKETT, E., SANCHO, S., SMITH, A. J. H., WITHERS, D. J. & VANHAESEBROECK, B.

175

2006. Critical role for the p110[alpha] phosphoinositide-3-OH kinase in growth and metabolic regulation. Nature, 441, 366-370. FRANKE, T. F., KAPLAN, D. R., CANTLEY, L. C. & TOKER, A. 1997. Direct regulation of the Akt proto-oncogene product by phosphatidylinositol-3,4-bisphosphate. Science, 275, 665-8. FRASCA, F., PANDINI, G., SCALIA, P., SCIACCA, L., MINEO, R., COSTANTINO, A., GOLDFINE, I. D., BELFIORE, A. & VIGNERI, R. 1999. Insulin receptor isoform A, a newly recognized, high-affinity insulin-like growth factor II receptor in fetal and cancer cells. Mol Cell Biol, 19, 3278-88. FRATTALI, A. L., TREADWAY, J. L. & PESSIN, J. E. 1992. Transmembrane signaling by the human insulin receptor kinase. Relationship between intramolecular beta subunit trans- and cis-autophosphorylation and substrate kinase activation. J Biol Chem, 267, 19521-8. FRIANT, S., PÉCHEUR, E.-I., EUGSTER, A., MICHEL, F., LEFKIR, Y., NOURRISSON, D. & LETOURNEUR, F. 2003. Ent3p Is a PtdIns(3,5)P2 Effector Required for Protein Sorting to the Multivesicular Body. Developmental cell, 5, 499-511. FRIAS, M. A., THOREEN, C. C., JAFFE, J. D., SCHRODER, W., SCULLEY, T., CARR, S. A. & SABATINI, D. M. 2006. mSin1 Is Necessary for Akt/PKB Phosphorylation, and Its Isoforms Define Three Distinct mTORC2s. Current Biology, 16, 1865-1870. FRIEDMAN, J. E., DUDEK, R. W., WHITEHEAD, D. S., DOWNES, D. L., FRISELL, W. R., CARO, J. F. & DOHM, G. L. 1991. Immunolocalization of glucose transporter GLUT4 within human skeletal muscle. Diabetes, 40, 150-4. FRUMAN, D. A., MEYERS, R. E. & CANTLEY, L. C. 1998. Phosphoinositide kinases. Annu Rev Biochem, 67, 481-507. FRY, M. J., PANAYOTOU, G., DHAND, R., RUIZ-LARREA, F., GOUT, I., NGUYEN, O., COURTNEIDGE, S. A. & WATERFIELD, M. D. 1992. Purification and characterization of a phosphatidylinositol 3-kinase complex from bovine brain by using phosphopeptide affinity columns. Biochem J, 288 ( Pt 2), 383-93. FUNAI, K. & CARTEE, G. D. 2009. Inhibition of contraction-stimulated AMP- activated protein kinase inhibits contraction-stimulated increases in PAS- TBC1D1 and glucose transport without altering PAS-AS160 in rat skeletal muscle. Diabetes, 58, 1096-104. FUNAKI, M., DIFRANSICO, L. & JANMEY, P. A. 2006. PI 4,5-P2 stimulates glucose transport activity of GLUT4 in the plasma membrane of 3T3-L1 adipocytes. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, 1763, 889- 899. FURUTANI, M., TSUJITA, K., ITOH, T., IJUIN, T. & TAKENAWA, T. 2006. Application of phosphoinositide-binding domains for the detection and quantification of specific phosphoinositides. Anal Biochem, 355, 8-18. GAO, T., FURNARI, F. & NEWTON, A. C. 2005. PHLPP: a phosphatase that directly dephosphorylates Akt, promotes apoptosis, and suppresses tumor growth. Mol Cell, 18, 13-24. GARCIA, L., GARCIA, F., LLORENS, F., UNZETA, M., ITARTE, E. & GÓMEZ, N. 2002. PP1/PP2A phosphatases inhibitors okadaic acid and calyculin A block ERK5 activation by growth factors and oxidative stress. FEBS Letters, 523, 90-94. GARCIA, Z., KUMAR, A., MARQUES, M., CORTES, I. & CARRERA, A. C. 2006. Phosphoinositide 3-kinase controls early and late events in mammalian cell division. EMBO J, 25, 655-661. GAROFALO, R. S., ORENA, S. J., RAFIDI, K., TORCHIA, A. J., STOCK, J. L., HILDEBRANDT, A. L., COSKRAN, T., BLACK, S. C., BREES, D. J., WICKS, J. R., MCNEISH, J. D. & COLEMAN, K. G. 2003. Severe diabetes, age- dependent loss of adipose tissue, and mild growth deficiency in mice lacking Akt2/PKB beta. J Clin Invest, 112, 197-208. GAULLIER, J. M., SIMONSEN, A., D'ARRIGO, A., BREMNES, B., STENMARK, H. & AASLAND, R. 1998. FYVE fingers bind PtdIns(3)P. Nature, 394, 432-3.

176

GEERING, B., CUTILLAS, P. R., NOCK, G., GHARBI, S. I. & VANHAESEBROECK, B. 2007. Class IA phosphoinositide 3-kinases are obligate p85-p110 heterodimers. Proceedings of the National Academy of Sciences, 104, 7809- 7814. GEMBAL, M., GILON, P. & HENQUIN, J. C. 1992. Evidence that glucose can control insulin release independently from its action on ATP-sensitive K+ channels in mouse B cells. The Journal of Clinical Investigation, 89, 1288-1295. GEORGE, S., ROCHFORD, J. J., WOLFRUM, C., GRAY, S. L., SCHINNER, S., WILSON, J. C., SOOS, M. A., MURGATROYD, P. R., WILLIAMS, R. M., ACERINI, C. L., DUNGER, D. B., BARFORD, D., UMPLEBY, A. M., WAREHAM, N. J., DAVIES, H. A., SCHAFER, A. J., STOFFEL, M., O'RAHILLY, S. & BARROSO, I. 2004. A Family with Severe Insulin Resistance and Diabetes Due to a Mutation in AKT2. Science, 304, 1325-1328. GERAGHTY, K. M., CHEN, S., HARTHILL, J. E., IBRAHIM, A. F., TOTH, R., MORRICE, N. A., VANDERMOERE, F., MOORHEAD, G. B., HARDIE, D. G. & MACKINTOSH, C. 2007. Regulation of multisite phosphorylation and 14-3-3 binding of AS160 in response to IGF-1, EGF, PMA and AICAR. Biochem J, 407, 231-41. GERARD, A., FAVRE, C., GARCON, F., NEMORIN, J.-G., DUPLAY, P., PASTOR, S., COLLETTE, Y., OLIVE, D. & NUNES, J. A. 2003. Functional interaction of RasGAP-binding proteins Dok-1 and Dok-2 with the Tec protein tyrosine kinase. Oncogene, 23, 1594-1598. GIRAUD, J., LESHAN, R., LEE, Y. H. & WHITE, M. F. 2004. Nutrient-dependent and insulin-stimulated phosphorylation of insulin receptor substrate-1 on serine 302 correlates with increased insulin signaling. J Biol Chem, 279, 3447-54. GOEBBELS, S., OLTROGGE, J. H., KEMPER, R., HEILMANN, I., BORMUTH, I., WOLFER, S., WICHERT, S. P., MOBIUS, W., LIU, X., LAPPE-SIEFKE, C., ROSSNER, M. J., GROSZER, M., SUTER, U., FRAHM, J., BORETIUS, S. & NAVE, K. A. 2010. Elevated phosphatidylinositol 3,4,5-trisphosphate in glia triggers cell-autonomous membrane wrapping and myelination. J Neurosci, 30, 8953-64. GOEL, H. L. & DEY, C. S. 2002. Focal adhesion kinase tyrosine phosphorylation is associated with myogenesis and modulated by insulin. Cell Prolif, 35, 131- 42. GONZALEZ, E. & MCGRAW, T. E. 2009. Insulin-modulated Akt subcellular localization determines Akt isoform-specific signaling. Proceedings of the National Academy of Sciences, 106, 7004-7009. GOODISON, S., KENNA, S. & ASHCROFT, S. J. 1992. Control of insulin gene expression by glucose. Biochem J, 285 ( Pt 2), 563-8. GOVERS, R., COSTER, A. C. F. & JAMES, D. E. 2004. Insulin Increases Cell Surface GLUT4 Levels by Dose Dependently Discharging GLUT4 into a Cell Surface Recycling Pathway. Molecular and Cellular Biology, 24, 6456-6466. GOZANI, O., KARUMAN, P., JONES, D. R., IVANOV, D., CHA, J., LUGOVSKOY, A. A., BAIRD, C. L., ZHU, H., FIELD, S. J., LESSNICK, S. L., VILLASENOR, J., MEHROTRA, B., CHEN, J., RAO, V. R., BRUGGE, J. S., FERGUSON, C. G., PAYRASTRE, B., MYSZKA, D. G., CANTLEY, L. C., WAGNER, G., DIVECHA, N., PRESTWICH, G. D. & YUAN, J. 2003. The PHD finger of the chromatin- associated protein ING2 functions as a nuclear phosphoinositide receptor. Cell, 114, 99-111. GRABER, S. G. & WOODWORTH, R. C. 1986. Myoglobin expression in L6 muscle cells. Role of differentiation and heme. J Biol Chem, 261, 9150-4. GRAY, A., VAN DER KAAY, J. & DOWNES, C. P. 1999. The pleckstrin homology domains of protein kinase B and GRP1 (general receptor for phosphoinositides-1) are sensitive and selective probes for the cellular detection of phosphatidylinositol 3,4-bisphosphate and/or phosphatidylinositol 3,4,5-trisphosphate in vivo. Biochem. J., 344, 929-936.

177

GRIMM, J., SACHS, M., BRITSCH, S., DI CESARE, S., SCHWARZ-ROMOND, T., ALITALO, K. & BIRCHMEIER, W. 2001. Novel p62dok family members, dok-4 and dok-5, are substrates of the c-Ret receptor tyrosine kinase and mediate neuronal differentiation. J Cell Biol, 154, 345-54. GUERTIN, D. A., STEVENS, D. M., THOREEN, C. C., BURDS, A. A., KALAANY, N. Y., MOFFAT, J., BROWN, M., FITZGERALD, K. J. & SABATINI, D. M. 2006. Ablation in Mice of the mTORC Components raptor, rictor, or mLST8 Reveals that mTORC2 Is Required for Signaling to Akt-FOXO and PKC[alpha], but Not S6K1. Developmental cell, 11, 859-871. GUILHERME, A., EMOTO, M., BUXTON, J. M., BOSE, S., SABINI, R., THEURKAUF, W. E., LESZYK, J. & CZECH, M. P. 2000. Perinuclear Localization and Insulin Responsiveness of GLUT4 Requires Cytoskeletal Integrity in 3T3-L1 Adipocytes. Journal of Biological Chemistry, 275, 38151-38159. GUILLOU, H., LÉCUREUIL, C., ANDERSON, K. E., SUIRE, S., FERGUSON, G. J., ELLSON, C. D., GRAY, A., DIVECHA, N., HAWKINS, P. T. & STEPHENS, L. R. 2007a. Use of the GRP1 PH domain as a tool to measure the relative levels of PtdIns(3,4,5)P3 through a protein-lipid overlay approach. Journal of Lipid Research, 48, 726-732. GUILLOU, H., STEPHENS, L. R. & HAWKINS, P. T. 2007b. Quantitative Measurement of Phosphatidylinositol 3,4,5-trisphosphate. In: BROWN, H. A. (ed.) Methods in Enzymology. Academic Press. GUITTARD, G., GERARD, A., DUPUIS-CORONAS, S., TRONCHERE, H., MORTIER, E., FAVRE, C., OLIVE, D., ZIMMERMANN, P., PAYRASTRE, B. & NUNES, J. A. 2009. Cutting edge: Dok-1 and Dok-2 adaptor molecules are regulated by phosphatidylinositol 5-phosphate production in T cells. J Immunol, 182, 3974-8. GUITTARD, G., MORTIER, E., TRONCHERE, H., FIRAGUAY, G., GERARD, A., ZIMMERMANN, P., PAYRASTRE, B. & NUNES, J. A. 2010. Evidence for a positive role of PtdIns5P in T-cell signal transduction pathways. FEBS Lett, 584, 2455-60. GULATI, P. & THOMAS, G. 2007. Nutrient sensing in the mTOR/S6K1 signalling pathway. Biochem Soc Trans, 35, 236-8. HAGREN, O. I. & TENGHOLM, A. 2006. Glucose and insulin synergistically activate phosphatidylinositol 3-kinase to trigger oscillations of phosphatidylinositol 3,4,5-trisphosphate in beta-cells. J Biol Chem, 281, 39121-7. HAH, J. S., RYU, J. W., LEE, W., KIM, B. S., LACHAAL, M., SPANGLER, R. A. & JUNG, C. Y. 2002. Transient Changes in Four GLUT4 Compartments in Rat Adipocytes during the Transition, Insulin-Stimulated To Basal: Implications for the GLUT4 Trafficking Pathway†. Biochemistry, 41, 14364-14371. HARA, K., YONEZAWA, K., SAKAUE, H., ANDO, A., KOTANI, K., KITAMURA, T., KITAMURA, Y., UEDA, H., STEPHENS, L., JACKSON, T. R., ET AL., OKADA, T., KAWANO, Y., SAKAKIBARA, T., HAZEKI, O. & UI, M. 1994. 1- Phosphatidylinositol 3-kinase activity is required for insulin-stimulated glucose transport but not for RAS activation in CHO cells. Essential role of phosphatidylinositol 3-kinase in insulin-induced glucose transport and antilipolysis in rat adipocytes. Studies with a selective inhibitor wortmannin. Proc Natl Acad Sci U S A, 91, 7415-9. HARRINGTON, L. S., FINDLAY, G. M., GRAY, A., TOLKACHEVA, T., WIGFIELD, S., REBHOLZ, H., BARNETT, J., LESLIE, N. R., CHENG, S., SHEPHERD, P. R., GOUT, I., DOWNES, C. P. & LAMB, R. F. 2004. The TSC1-2 tumor suppressor controls insulin–PI3K signaling via regulation of IRS proteins. The Journal of Cell Biology, 166, 213-223. HARRIS, M. I., KLEIN, R., WELBORN, T. A. & KNUIMAN, M. W. 1992. Onset of NIDDM occurs at least 4-7 yr before clinical diagnosis. Diabetes Care, 15, 815-819. HAYAKAWA, M., KAIZAWA, H., MORITOMO, H., KOIZUMI, T., OHISHI, T., OKADA, M., OHTA, M., TSUKAMOTO, S., PARKER, P., WORKMAN. P., WATERFIELD,

178

M. Synthesis and biological evaluation of 4-morpholino-2-phenylquinazolines and related derivatives as novel PI3 kinase p110alpha inhibitors. 2006. Bioorg. Med. Chem. 14, 6847-58. HED, R., LINDBLAD, L. E., NYGREN, A. & SUNDBLAD, L. 1977. Forearm glucose uptake during glucose tolerance tests in chronic alcoholics. Scandinavian Journal of Clinical & Laboratory Investigation, 37, 229-233. HEFFETZ, D., BUSHKIN, I., DROR, R. & ZICK, Y. 1990. The insulinomimetic agents H2O2 and vanadate stimulate protein tyrosine phosphorylation in intact cells. Journal of Biological Chemistry, 265, 2896-2902. HILL, E. V., HUDSON, C. A., VERTOMMEN, D., RIDER, M. H. & TAVARE, J. M. 2010. Regulation of PIKfyve phosphorylation by insulin and osmotic stress. Biochem Biophys Res Commun, 2010, 27. HILL, M. M., CLARK, S. F., TUCKER, D. F., BIRNBAUM, M. J., JAMES, D. E., MACAULAY, S. L., KOHN, A. D., SUMMERS, S. A. & ROTH, R. A. 1999. A role for protein kinase Bbeta/Akt2 in insulin-stimulated GLUT4 translocation in adipocytes. Expression of a constitutively active Akt Ser/Thr kinase in 3T3- L1 adipocytes stimulates glucose uptake and glucose transporter 4 translocation. Mol Cell Biol, 19, 7771-81. HOEKSTRA, D., TYTECA, D. & VAN IJZENDOORN, S. C. D. 2004. The subapical compartment: a traffic center in membrane polarity development. J Cell Sci, 117, 2183-2192. HOLMAN, G. D., LO LEGGIO, L. & CUSHMAN, S. W. 1994. Insulin-stimulated GLUT4 glucose transporter recycling. A problem in membrane protein subcellular trafficking through multiple pools. Journal of Biological Chemistry, 269, 17516-17524. HOOSHMAND-RAD, R., HAJKOVA, L., KLINT, P., KARLSSON, R., VANHAESEBROECK, B., CLAESSON-WELSH, L. & HELDIN, C. H. 2000. The PI 3-kinase isoforms p110(alpha) and p110(beta) have differential roles in PDGF- and insulin- mediated signaling. Journal of Cell Science, 113, 207-214. HOWLETT, K. F., MATHEWS, A., GARNHAM, A. & SAKAMOTO, K. 2008. The effect of exercise and insulin on AS160 phosphorylation and 14-3-3 binding capacity in human skeletal muscle. Am J Physiol Endocrinol Metab, 294, E401-7. HUANG, S. & CZECH, M. P. 2007. The GLUT4 Glucose Transporter. Cell metabolism, 5, 237-252. HUANG, W., ZHANG, H., DAVRAZOU, F., KUTATELADZE, T. G., SHI, X., GOZANI, O. & PRESTWICH, G. D. 2007. Stabilized Phosphatidylinositol-5-Phosphate Analogues as Ligands for the Nuclear Protein ING2: Chemistry, Biology, and Molecular Modeling. Journal of the American Chemical Society, 129, 6498- 6506. HUBBARD, S. R. 1997. Crystal structure of the activated insulin receptor tyrosine kinase in complex with peptide substrate and ATP analog. EMBO J, 16, 5572-5581. IJUIN, T. & TAKENAWA, T. 2003. SKIP Negatively Regulates Insulin-Induced GLUT4 Translocation and Membrane Ruffle Formation. Molecular and Cellular Biology, 23, 1209-1220. IJUIN, T., YU, Y. E., MIZUTANI, K., PAO, A., TATEYA, S., TAMORI, Y., BRADLEY, A. & TAKENAWA, T. 2008. Increased insulin action in SKIP heterozygous knockout mice. Mol Cell Biol, 28, 5184-95. IKONOMOV, O. C., SBRISSA, D., DONDAPATI, R. & SHISHEVA, A. 2007. ArPIKfyve- PIKfyve interaction and role in insulin-regulated GLUT4 translocation and glucose transport in 3T3-L1 adipocytes. Exp Cell Res, 313, 2404-16. IKONOMOV, O. C., SBRISSA, D., FENNER, H. & SHISHEVA, A. 2009a. PIKfyve- ArPIKfyve-Sac3 core complex: contact sites and their consequence for Sac3 phosphatase activity and endocytic membrane homeostasis. J Biol Chem, 284, 35794-806. IKONOMOV, O. C., SBRISSA, D., IJUIN, T., TAKENAWA, T. & SHISHEVA, A. 2009b. Sac3 is an insulin-regulated phosphatidylinositol 3,5-bisphosphate

179

phosphatase: gain in insulin responsiveness through Sac3 down-regulation in adipocytes. J Biol Chem, 284, 23961-71. IKONOMOV, O. C., SBRISSA, D., MLAK, K. & SHISHEVA, A. 2002. Requirement for PIKfyve enzymatic activity in acute and long-term insulin cellular effects. Endocrinology, 143, 4742-54. IKONOMOV, O. C., SBRISSA, D. & SHISHEVA, A. 2009c. YM201636, an inhibitor of retroviral budding and PIKfyve-catalyzed PtdIns(3,5)P2 synthesis, halts glucose entry by insulin in adipocytes. Biochem Biophys Res Commun, 382, 566-70. INOUE, T., HEO, W. D., GRIMLEY, J. S., WANDLESS, T. J. & MEYER, T. 2005. An inducible translocation strategy to rapidly activate and inhibit small GTPase signaling pathways. Nat Meth, 2, 415-418. IRVINE, R. F. 2003. Nuclear lipid signalling. Nat Rev Mol Cell Biol, 4, 349-60. ISAKOFF, S. J., TAHA, C., ROSE, E., MARCUSOHN, J., KLIP, A., 1995. The inability of phosphatidylinositol 3-kinase activation to stimulate GLUT4 translocation indicates additional signaling pathways are required for insulin-stimulated glucose uptake. Proc Natl Acad Sci U S A, 92, 10247-51. ISHIKI, M., RANDHAWA, V. K., POON, V., JEBAILEY, L. & KLIP, A. 2005a. Insulin regulates the membrane arrival, fusion, and C-terminal unmasking of glucose transporter-4 via distinct phosphoinositides. J Biol Chem, 280, 28792-802. ISHIKURA, S., BILAN, P. J. & KLIP, A. 2007. Rabs 8A and 14 are targets of the insulin-regulated Rab-GAP AS160 regulating GLUT4 traffic in muscle cells. Biochemical and Biophysical Research Communications, 353, 1074-1079. ITOH, N., NAKAYAMA, M., NISHIMURA, T., FUJISUE, S., NISHIOKA, T., WATANABE, T. & KAIBUCHI, K. 2010. Identification of focal adhesion kinase (FAK) and phosphatidylinositol 3-kinase (PI3-kinase) as Par3 partners by proteomic analysis. Cytoskeleton, 67, 297-308. ITOH, T., IJUIN, T. & TAKENAWA, T. 1998. A Novel Phosphatidylinositol-5- phosphate 4-Kinase (Phosphatidylinositol-phosphate Kinase IIγ) Is Phosphorylated in the Endoplasmic Reticulum in Response to Mitogenic Signals. Journal of Biological Chemistry, 273, 20292-20299. JACINTO, E., FACCHINETTI, V., LIU, D., SOTO, N., WEI, S., JUNG, S. Y., HUANG, Q., QIN, J. & SU, B. 2006. SIN1/MIP1 maintains rictor-mTOR complex integrity and regulates Akt phosphorylation and substrate specificity. Cell, 127, 125-37. JEBAILEY, L., RUDICH, A., HUANG, X., DI CIANO-OLIVEIRA, C., KAPUS, A. & KLIP, A. 2004. Skeletal muscle cells and adipocytes differ in their reliance on TC10 and Rac for insulin-induced actin remodeling. Mol Endocrinol, 18, 359-72. JEDRYCHOWSKI, M. P., GARTNER, C. A., GYGI, S. P., ZHOU, L., HERZ, J., KANDROR, K. V. & PILCH, P. F. 2010. Proteomic Analysis of GLUT4 Storage Vesicles Reveals LRP1 to Be an Important Vesicle Component and Target of Insulin Signaling. Journal of Biological Chemistry, 285, 104-114. JEFFERIES, H. B., COOKE, F. T., JAT, P., BOUCHERON, C., KOIZUMI, T., HAYAKAWA, M., KAIZAWA, H., OHISHI, T., WORKMAN, P., WATERFIELD, M. D. & PARKER, P. J. 2008. A selective PIKfyve inhibitor blocks PtdIns(3,5)P(2) production and disrupts endomembrane transport and retroviral budding. EMBO Rep, 9, 164-70. JEFFRIES, T. R., DOVE, S. K., MICHELL, R. H. & PARKER, P. J. 2004. PtdIns-specific MPR Pathway Association of a Novel WD40 Repeat Protein, WIPI49. Mol. Biol. Cell, 15, 2652-2663. JHUN, B. H., RAMPAL, A. L., LIU, H., LACHAAL, M. & JUNG, C. Y. 1992. Effects of insulin on steady state kinetics of GLUT4 subcellular distribution in rat adipocytes. Evidence of constitutive GLUT4 recycling. J Biol Chem, 267, 17710-5.

180

JIANG, L., FAN, J., BAI, L., WANG, Y., CHEN, Y., YANG, L., CHEN, L. & XU, T. 2008. Direct quantification of fusion rate reveals a distal role for AS160 in insulin- stimulated fusion of GLUT4 storage vesicles. J Biol Chem, 283, 8508-16. JIANG, T., SWEENEY, G., RUDOLF, M. T., KLIP, A., TRAYNOR-KAPLAN, A. & TSIEN, R. Y. 1998. Membrane-permeant esters of phosphatidylinositol 3,4,5- trisphosphate. J Biol Chem, 273, 11017-24. JIANG, Z. Y., CHAWLA, A., BOSE, A., WAY, M. & CZECH, M. P. 2002. A phosphatidylinositol 3-kinase-independent insulin signaling pathway to N- WASP/Arp2/3/F-actin required for GLUT4 glucose transporter recycling. J Biol Chem, 277, 509-15. JIANG, Z. Y., ZHOU, Q. L., COLEMAN, K. A., CHOUINARD, M., BOESE, Q. & CZECH, M. P. 2003. Insulin signaling through Akt/protein kinase B analyzed by small interfering RNA-mediated gene silencing. Proceedings of the National Academy of Sciences of the United States of America, 100, 7569-7574. JIMENEZ, C., HERNANDEZ, C., PIMENTEL, B. & CARRERA, A. C. 2002. The p85 regulatory subunit controls sequential activation of phosphoinositide 3- kinase by Tyr kinases and Ras. J Biol Chem, 277, 41556-62. JONES, D. R., BULTSMA, Y., KEUNE, W. J., HALSTEAD, J. R., ELOUARRAT, D., MOHAMMED, S., HECK, A. J., D'SANTOS, C. S. & DIVECHA, N. 2006. Nuclear PtdIns5P as a transducer of stress signaling: an in vivo role for PIP4Kbeta. Mol Cell, 23, 685-95. JUNUTULA, J. R., DE MAZIERE, A. M., PEDEN, A. A., ERVIN, K. E., ADVANI, R. J., VAN DIJK, S. M., KLUMPERMAN, J. & SCHELLER, R. H. 2004. Rab14 Is Involved in Membrane Trafficking between the Golgi Complex and Endosomes. Mol. Biol. Cell, 15, 2218-2229. KANE, S., SANO, H., LIU, S. C., ASARA, J. M., LANE, W. S., GARNER, C. C. & LIENHARD, G. E. 2002. A method to identify serine kinase substrates. Akt phosphorylates a novel adipocyte protein with a Rab GTPase-activating protein (GAP) domain. J Biol Chem, 277, 22115-8. KANZAKI, M., MORA, S., HWANG, J. B., SALTIEL, A. R. & PESSIN, J. E. 2004. Atypical protein kinase C (PKCδ/λ) is a convergent downstream target of the insulin-stimulated phosphatidylinositol 3-kinase and TC10 signaling pathways. The Journal of Cell Biology, 164, 279-290. KATOME, T., OBATA, T., MATSUSHIMA, R., MASUYAMA, N., CANTLEY, L. C., GOTOH, Y., KISHI, K., SHIOTA, H. & EBINA, Y. 2003. Use of RNA interference-mediated gene silencing and adenoviral overexpression to elucidate the roles of AKT/protein kinase B isoforms in insulin actions. J Biol Chem, 278, 28312-23. KATZ, E. B., STENBIT, A. E., HATTON, K., DEPINHOT, R. & CHARRON, M. J. 1995. Cardiac and adipose tissue abnormalities but not diabetes in mice deficient in GLUT4. Nature, 377, 151-155. KAZLAUSKAS, A. & COOPER, J. A. 1990. Phosphorylation of the PDGF receptor beta subunit creates a tight binding site for phosphatidylinositol 3 kinase. EMBO J, 9, 3279-86. KELLER, S. R., SCOTT, H. M., MASTICK, C. C., AEBERSOLD, R. & LIENHARD, G. E. 1995. Cloning and Characterization of a Novel Insulin-regulated Membrane Aminopeptidase from Glut4 Vesicles. Journal of Biological Chemistry, 270, 23612-23618. KELLERER, M., LAMMERS, R., ERMEL, B., TIPPMER, S., VOGT, B., OBERMAIER- KUSSER, B., ULLRICH, A. & HARING, H. U. 1992. Distinct alpha-subunit structures of human insulin receptor A and B variants determine differences in tyrosine kinase activities. Biochemistry, 31, 4588-96. KELLY, K. L., RUDERMAN, N. B. & CHEN, K. S. 1992. Phosphatidylinositol-3-kinase in isolated rat adipocytes. Activation by insulin and subcellular distribution. Journal of Biological Chemistry, 267, 3423-3428. KERN, M., WELLS, J. A., STEPHENS, J. M., ELTON, C. W., FRIEDMAN, J. E., TAPSCOTT, E. B., PEKALA, P. H. & DOHM, G. L. 1990. Insulin responsiveness

181

in skeletal muscle is determined by glucose transporter (Glut4) protein level. Biochem J, 270, 397-400. KIDO, Y., BURKS, D. J., WITHERS, D., BRUNING, J. C., KAHN, C. R., WHITE, M. F. & ACCILI, D. 2000. Tissue-specific insulin resistance in mice with mutations in the insulin receptor, IRS-1, and IRS-2. The Journal of Clinical Investigation, 105, 199-205. KIM, J., JAHNG, W. J., DI VIZIO, D., LEE, J. S., JHAVERI, R., RUBIN, M. A., SHISHEVA, A. & FREEMAN, M. R. 2007. The phosphoinositide kinase PIKfyve mediates epidermal growth factor receptor trafficking to the nucleus. Cancer Res, 67, 9229-37. KIM, S. A., VACRATSIS, P. O., FIRESTEIN, R., CLEARY, M. L. & DIXON, J. E. 2003. Regulation of myotubularin-related (MTMR)2 phosphatidylinositol phosphatase by MTMR5, a catalytically inactive phosphatase. Proc Natl Acad Sci U S A, 100, 4492-7. KIM, Y. B., PERONI, O. D., FRANKE, T. F. & KAHN, B. B. 2000. Divergent regulation of Akt1 and Akt2 isoforms in insulin target tissues of obese Zucker rats. Diabetes, 49, 847-856. KING, P., PEACOCK, I. & DONNELLY, R. 1999. The UK Prospective Diabetes Study (UKPDS): clinical and therapeutic implications for type 2 diabetes. British Journal of Clinical Pharmacology, 48, 643-648. KIRWAN, J. P., VARASTEHPOUR, A., JING, M., PRESLEY, L., SHAO, J., FRIEDMAN, J. E. & CATALANO, P. M. 2004. Reversal of Insulin Resistance Postpartum Is Linked to Enhanced Skeletal Muscle Insulin Signaling. Journal of Clinical Endocrinology Metabolism, 89, 4678-4684. KITAMURA, T., OGAWA, W., SAKAUE, H., HINO, Y., KURODA, S., TAKATA, M., MATSUMOTO, M., MAEDA, T., KONISHI, H., KIKKAWA, U. & KASUGA, M. 1998. Requirement for Activation of the Serine-Threonine Kinase Akt (Protein Kinase B) in Insulin Stimulation of Protein Synthesis but Not of Glucose Transport. Mol. Cell. Biol., 18, 3708-3717. KLAUS, F., GEHRING, E. M., ZURN, A., LAUFER, J., LINDNER, R., STRUTZ- SEEBOHM, N., TAVARE, J. M., ROTHSTEIN, J. D., BOEHMER, C., PALMADA, M., GRUNER, I., LANG, U. E., SEEBOHM, G. & LANG, F. 2009. Regulation of the Na(+)-coupled glutamate transporter EAAT3 by PIKfyve. Neurochem Int, 54, 372-7. KOHN, A. D., SUMMERS, S. A., BIRNBAUM, M. J. & ROTH, R. A. 1996a. Expression of a constitutively active Akt Ser/Thr kinase in 3T3-L1 adipocytes stimulates glucose uptake and glucose transporter 4 translocation. J Biol Chem, 271, 31372-8. KOHN, A. D., TAKEUCHI, F. & ROTH, R. A. 1996b. Akt, a pleckstrin homology domain containing kinase, is activated primarily by phosphorylation. J Biol Chem, 271, 21920-6. KOK, K., GEERING, B. & VANHAESEBROECK, B. 2009. Regulation of phosphoinositide 3-kinase expression in health and disease. Trends in Biochemical Sciences, 34, 115-127. KRAEGEN, E. W., SOWDEN, J. A., HALSTEAD, M. B., CLARK, P. W., RODNICK, K. J., CHISHOLM, D. J. & JAMES, D. E. 1993. Glucose transporters and in vivo glucose uptake in skeletal and cardiac muscle: fasting, insulin stimulation and immunoisolation studies of GLUT1 and GLUT4. Biochem J, 295 ( Pt 1), 287-93. KUBOTA, N., KUBOTA, T., ITOH, S., KUMAGAI, H., KOZONO, H., TAKAMOTO, I., MINEYAMA, T., OGATA, H., TOKUYAMA, K., OHSUGI, M., SASAKO, T., MOROI, M., SUGI, K., KAKUTA, S., IWAKURA, Y., NODA, T., OHNISHI, S., NAGAI, R., TOBE, K., TERAUCHI, Y., UEKI, K. & KADOWAKI, T., 2008. Dynamic Functional Relay between Insulin Receptor Substrate 1 and 2 in Hepatic Insulin Signaling during Fasting and Feeding. Cell Metab. 8(1), 49- 64.

182

KURIG, B., SHYMANETS, A., BOHNACKER, T., PRAJWAL, BROCK, C., AHMADIAN, M. R., SCHAEFER, M., GOHLA, A., HARTENECK, C., WYMANN, M. P., JEANCLOS, E. & NÜRNBERG, B. 2009. Ras is an indispensable coregulator of the class IB phosphoinositide 3-kinase p87/p110γ. Proceedings of the National Academy of Sciences, 106, 20312-20317. KUROSU, H., MAEHAMA, T., OKADA, T., YAMAMOTO, T., HOSHINO, S.-I., FUKUI, Y., UI, M., HAZEKI, O. & KATADA, T. 1997. Heterodimeric Phosphoinositide 3-Kinase Consisting of p85 and p110β Is Synergistically Activated by the βγ Subunits of G Proteins and Phosphotyrosyl Peptide. Journal of Biological Chemistry, 272, 24252-24256. KUTATELADZE, T. G. 2010. Translation of the phosphoinositide code by PI effectors. Nat Chem Biol, 6, 507-513. LAMIA, K. A., PERONI, O. D., KIM, Y. B., RAMEH, L. E., KAHN, B. B. & CANTLEY, L. C. 2004. Increased insulin sensitivity and reduced adiposity in phosphatidylinositol 5-phosphate 4-kinase beta-/- mice. Mol Cell Biol, 24, 5080-7. LAPORTE, J., BEDEZ, F., BOLINO, A. & MANDEL, J.-L. 2003. Myotubularins, a large disease-associated family of cooperating catalytically active and inactive phosphoinositides phosphatases. Human Molecular Genetics, 12, R285- R292. LARANCE, M., RAMM, G., STÖCKLI, J., VAN DAM, E. M., WINATA, S., WASINGER, V., SIMPSON, F., GRAHAM, M., JUNUTULA, J. R., GUILHAUS, M. & JAMES, D. E. 2005. Characterization of the Role of the Rab GTPase-activating Protein AS160 in Insulin-regulated GLUT4 Trafficking. Journal of Biological Chemistry, 280, 37803-37813. LE GOOD, J. A., ZIEGLER, W. H., PAREKH, D. B., ALESSI, D. R., COHEN, P. & PARKER, P. J. 1998. Protein Kinase C Isotypes Controlled by Phosphoinositide 3-Kinase Through the Protein Kinase PDK1. Science, 281, 2042-2045. LECOMPTE, O., POCH, O. & LAPORTE, J. 2008. PtdIns5P regulation through evolution: roles in membrane trafficking? Trends Biochem Sci, 33, 453-60. LEE, A. D., HANSEN, P. A. & HOLLOSZY, J. O. 1995. Wortmannin inhibits insulin- stimulated but not contraction-stimulated glucose transport activity in skeletal muscle. FEBS Letters, 361, 51-54. LEMMON, M. A. 2008. Membrane recognition by phospholipid-binding domains. Nat Rev Mol Cell Biol, 9, 99-111. LENEY, S. E., TAVARE, J. M., 2009. The molecular basis of insulin-stimulated glucose uptake: signalling, trafficking and potential drug targets. J Endocrinol, 203, 1-18. LEVINE, R. & GOLDSTEIN, M. S. 1958. On the mechanism of action of insulin. Hormoner, 11, 2-22. LIU, J., KIMURA, A., BAUMANN, C. A. & SALTIEL, A. R. 2002. APS Facilitates c-Cbl Tyrosine Phosphorylation and GLUT4 Translocation in Response to Insulin in 3T3-L1 Adipocytes. Mol. Cell. Biol., 22, 3599-3609. LIU, S. C. H., WANG, Q., LIENHARD, G. E. & KELLER, S. R. 1999. Insulin Receptor Substrate 3 Is Not Essential for Growth or Glucose Homeostasis. Journal of Biological Chemistry, 274, 18093-18099. LIU, X.-J., HE, A.-B., CHANG, Y.-S. & FANG, F.-D. 2006. Atypical protein kinase C in glucose metabolism. Cellular Signalling, 18, 2071-2076. LOGOTHETIS, D. E., PETROU, V. I., ADNEY, S. K. & MAHAJAN, R. 2010. Channelopathies linked to plasma membrane phosphoinositides. Pflugers Arch, 460, 321-41. LOIJENS, J. C., BORONENKOV, I. V., PARKER, G. J. & ANDERSON, R. A. 1996. The phosphatidylinositol 4-phosphate 5-kinase family. Adv Enzyme Regul, 36, 115-40. LUND, S., HOLMAN, G. D., SCHMITZ, O. & PEDERSEN, O. 1995. Contraction stimulates translocation of glucose transporter GLUT4 in skeletal muscle

183

through a mechanism distinct from that of insulin. Proceedings of the National Academy of Sciences of the United States of America, 92, 5817- 5821. LUO, M., LANGLAIS, P., YI, Z., LEFORT, N., DE FILIPPIS, E. A., HWANG, H., CHRIST-ROBERTS, C. Y. & MANDARINO, L. J. 2007. Phosphorylation of Human Insulin Receptor Substrate-1 at Serine 629 Plays a Positive Role in Insulin Signaling. Endocrinology, 148, 4895-4905. LUO, M., REYNA, S., WANG, L., YI, Z., CARROLL, C., DONG, L. Q., LANGLAIS, P., WEINTRAUB, S. T. & MANDARINO, L. J. 2005. Identification of Insulin Receptor Substrate 1 Serine/Threonine Phosphorylation Sites Using Mass Spectrometry Analysis: Regulatory Role of Serine 1223. Endocrinology, 146, 4410-4416. MACDOUGALL, L. K., DOMIN, J. & WATERFIELD, M. D. 1995. A family of phosphoinositide 3-kinases in Drosophila identifies a new mediator of signal transduction. Current biology : CB, 5, 1404-1415. MAFFUCCI, T., BRANCACCIO, A., PICCOLO, E., STEIN, R. C. & FALASCA, M. 2003. Insulin induces phosphatidylinositol-3-phosphate formation through TC10 activation. The EMBO journal, 22, 4178-89. MAHER, S. K. & HELBING, C. C. 2009. Modulators of Inhibitor of Growth (ING) Family Expression in Development and Disease. Current Drug Targets, 10, 392-405. MALIDE, D., DWYER, N. K., BLANCHETTE-MACKIE, E. J. & CUSHMAN, S. W. 1997. Immunocytochemical evidence that GLUT4 resides in a specialized translocation post-endosomal VAMP2-positive compartment in rat adipose cells in the absence of insulin. J Histochem Cytochem, 45, 1083-96. MANI, M., LEE, S. Y., LUCAST, L., CREMONA, O., DI PAOLO, G., DE CAMILLI, P. & RYAN, T. A. 2007. The dual phosphatase activity of synaptojanin1 is required for both efficient synaptic vesicle endocytosis and reavailability at nerve terminals. Neuron, 56, 1004-18. MARTIN, L. B., SHEWAN, A., MILLAR, C. A., GOULD, G. W. & JAMES, D. E. 1998. Vesicle-associated Membrane Protein 2 Plays a Specific Role in the Insulin- dependent Trafficking of the Facilitative Glucose Transporter GLUT4 in 3T3- L1 Adipocytes. Journal of Biological Chemistry, 273, 1444-1452. MARTIN, O. J., LEE, A. & MCGRAW, T. E. 2006. GLUT4 Distribution between the Plasma Membrane and the Intracellular Compartments Is Maintained by an Insulin-modulated Bipartite Dynamic Mechanism. Journal of Biological Chemistry, 281, 484-490. MARTIN, S., TELLAM, J., LIVINGSTONE, C., SLOT, J. W., GOULD, G. W. & JAMES, D. E. 1996a. The glucose transporter (GLUT-4) and vesicle-associated membrane protein-2 (VAMP-2) are segregated from recycling endosomes in insulin-sensitive cells. J Cell Biol, 134, 625-35. MARTIN, S. S., HARUTA, T., MORRIS, A. J., KLIPPEL, A., WILLIAMS, L. T. & OLEFSKY, J. M. 1996b. Activated phosphatidylinositol 3-kinase is sufficient to mediate actin rearrangement and GLUT4 translocation in 3T3-L1 adipocytes. J Biol Chem, 271, 17605-8. MASHIMA, R., HISHIDA, Y., TEZUKA, T. & YAMANASHI, Y. 2009. The roles of Dok family adapters in immunoreceptor signaling. Immunol Rev, 232, 273-85. MAUVAIS-JARVIS, F., UEKI, K., FRUMAN, D. A., HIRSHMAN, M. F., SAKAMOTO, K., GOODYEAR, L. J., IANNACONE, M., ACCILI, D., CANTLEY, L. C. & KAHN, C. R. 2002. Reduced expression of the murine p85α subunit of phosphoinositide 3-kinase improves insulin signaling and ameliorates diabetes. The Journal of Clinical Investigation, 109, 141-149. MCCLAIN, D. A. 1991. Different ligand affinities of the two human insulin receptor splice variants are reflected in parallel changes in sensitivity for insulin action. Mol Endocrinol, 5, 734-9. MCTERNAN, P. G., HARTE, A. L., ANDERSON, L. A., GREEN, A., SMITH, S. A., HOLDER, J. C., BARNETT, A. H., EGGO, M. C. & KUMAR, S. 2002. Insulin and

184

Rosiglitazone Regulation of Lipolysis and Lipogenesis in Human Adipose Tissue In Vitro. Diabetes, 51, 1493-1498. MEYRE, D., FARGE, M., LECOEUR, C., PROENCA, C., DURAND, E., ALLEGAERT, F., TICHET, J., MARRE, M., BALKAU, B., WEILL, J., DELPLANQUE, J. & FROGUEL, P. 2008. R125W coding variant in TBC1D1 confers risk for familial obesity and contributes to linkage on chromosome 4p14 in the French population. Human Molecular Genetics, 17, 1798-1802. MICHELL, R. H., HEATH, V. L., LEMMON, M. A. & DOVE, S. K. 2006. Phosphatidylinositol 3,5-bisphosphate: metabolism and cellular functions. Trends Biochem Sci, 31, 52-63. MIINEA, C. P., SANO, H., KANE, S., SANO, E., FUKUDA, M., PERANEN, J., LANE, W. S. & LIENHARD, G. E. 2005. AS160, the Akt substrate regulating GLUT4 translocation, has a functional Rab GTPase-activating protein domain. Biochem J, 391, 87-93. MINAMI, A., ISEKI, M., KISHI, K., WANG, M., OGURA, M., FURUKAWA, N., HAYASHI, S., YAMADA, M., OBATA, T., TAKESHITA, Y., NAKAYA, Y., BANDO, Y., IZUMI, K., MOODIE, S. A., KAJIURA, F., MATSUMOTO, M., TAKATSU, K., TAKAKI, S. & EBINA, Y. 2003. Increased Insulin Sensitivity and Hypoinsulinemia in APS Knockout Mice. Diabetes, 52, 2657-2665. MITRA, P., ZHENG, X. & CZECH, M. P. 2004. RNAi-based analysis of CAP, Cbl, and CrkII function in the regulation of GLUT4 by insulin. J Biol Chem, 279, 37431-5. MITSUMOTO, Y., BURDETT, E., GRANT, A. & KLIP, A. 1991. Differential expression of the GLUT1 and GLUT4 glucose transporters during differentiation of L6 muscle cells. Biochem Biophys Res Commun, 175, 652-9. MOLLER, D. E., YOKOTA, A., CARO, J. F. & FLIER, J. S. 1989. Tissue-specific expression of two alternatively spliced insulin receptor mRNAs in man. Mol Endocrinol, 3, 1263-9. MORRIS, J. B., HINCHLIFFE, K. A., CIRUELA, A., LETCHER, A. J. & IRVINE, R. F. 2000. Thrombin stimulation of platelets causes an increase in phosphatidylinositol 5-phosphate revealed by mass assay. FEBS Lett, 475, 57-60. MOSTHAF, L., GRAKO, K., DULL, T. J., COUSSENS, L., ULLRICH, A. & MCCLAIN, D. A. 1990. Functionally distinct insulin receptors generated by tissue-specific alternative splicing. EMBO J, 9, 2409-13. MOULE, K., S., EDGELL, J., N., WELSH, I., G., DIGGLE, A., T., FOULSTONE, J., E., HEESOM, J., K., PROUD, G., C., DENTON & M., R. 1995. Multiple signalling pathways involved in the stimulation of fatty acid and glycogen synthesis by insulin in rat epididymal fat cells. Biochem. J., 311(2):595-601. MOXLEY, R. T., 3RD, GRIGGS, R. C., GOLDBLATT, D., VANGELDER, V., HERR, B. E. & THIEL, R. 1978. Decreased insulin sensitivity of forearm muscle in myotonic dystrophy. J Clin Invest, 62, 857-67. MURETTA, J. M., ROMENSKAIA, I. & MASTICK, C. C. 2008. Insulin Releases Glut4 from Static Storage Compartments into Cycling Endosomes and Increases the Rate Constant for Glut4 Exocytosis. Journal of Biological Chemistry, 283, 311-323. NAGASHIMA, M., SHISEKI, M., MIURA, K., HAGIWARA, K., LINKE, S. P., PEDEUX, R., WANG, X. W., YOKOTA, J., RIABOWOL, K. & HARRIS, C. C. 2001. DNA damage-inducible gene p33ING2 negatively regulates cell proliferation through acetylation of p53. Proceedings of the National Academy of Sciences of the United States of America, 98, 9671-9676. NAKASHIMA, N., SHARMA, P. M., IMAMURA, T., BOOKSTEIN, R. & OLEFSKY, J. M. 2000. The Tumor Suppressor PTEN Negatively Regulates Insulin Signaling in 3T3-L1 Adipocytes. Journal of Biological Chemistry, 275, 12889-12895. NAUGHTIN, M. J., SHEFFIELD, D. A., RAHMAN, P., HUGHES, W. E., GURUNG, R., STOW, J. L., NANDURKAR, H. H., DYSON, J. M. & MITCHELL, C. A. 2010. The

185

myotubularin phosphatase MTMR4 regulates sorting from early endosomes. J Cell Sci, 123, 3071-83. NEMORIN, J. G., LAPORTE, P., BERUBE, G. & DUPLAY, P. 2001. p62dok negatively regulates CD2 signaling in Jurkat cells. J Immunol, 166, 4408-15. NG, Y., RAMM, G., LOPEZ, J. A. & JAMES, D. E. 2008. Rapid Activation of Akt2 Is Sufficient to Stimulate GLUT4 Translocation in 3T3-L1 Adipocytes. Cell metabolism, 7, 348-356. NHS 2007. NHS Confederation (2007a). Key statistics on the NHS London: NHS Confederation. NIEBUHR, K., GIURIATO, S., PEDRON, T., PHILPOTT, D. J., GAITS, F., SABLE, J., SHEETZ, M. P., PARSOT, C., SANSONETTI, P. J. & PAYRASTRE, B. 2002. Conversion of PtdIns(4,5)P2 into PtdIns(5)P by the S.flexneri effector IpgD reorganizes host cell morphology. EMBO J, 21, 5069-5078. NODA, T., MATSUNAGA, K., TAGUCHI-ATARASHI, N., YOSHIMORI, T., FILIMONENKO, M., ISAKSON, P., FINLEY, K. D., ANDERSON, M., JEONG, H., MELIA, T. J., BARTLETT, B. J., MYERS, K. M., BIRKELAND, H. C., LAMARK, T., KRAINC, D., BRECH, A., STENMARK, H., SIMONSEN, A. & YAMAMOTO, A. 2010. Regulation of membrane biogenesis in autophagy via PI3P dynamics. The selective macroautophagic degradation of aggregated proteins requires the PI3P-binding protein Alfy. Semin Cell Dev Biol, 21, 671-6. NORRIS, F. A., AUETHAVEKIAT, V. & MAJERUS, P. W. 1995. The isolation and characterization of cDNA encoding human and rat brain inositol polyphosphate 4-phosphatase. J Biol Chem, 270, 16128-33. ONO, H., KATAGIRI, H., FUNAKI, M., ANAI, M., INUKAI, K., FUKUSHIMA, Y., SAKODA, H., OGIHARA, T., ONISHI, Y., FUJISHIRO, M., KIKUCHI, M., OKA, Y. & ASANO, T. 2001. Regulation of Phosphoinositide Metabolism, Akt Phosphorylation, and Glucose Transport by PTEN (Phosphatase and Tensin Homolog Deleted on Chromosome 10) in 3T3-L1 Adipocytes. Molecular Endocrinology, 15, 1411-1422. OSBORNE, S. L., WEN, P. J., BOUCHERON, C., NGUYEN, H. N., HAYAKAWA, M., KAIZAWA, H., PARKER, P. J., VITALE, N. & MEUNIER, F. A. 2008. PIKfyve negatively regulates exocytosis in neurosecretory cells. J Biol Chem, 283, 2804-13. PAGLIARINI, D. J., WILEY, S. E., KIMPLE, M. E., DIXON, J. R., KELLY, P., WORBY, C. A., CASEY, P. J. & DIXON, J. E. 2005. Involvement of a mitochondrial phosphatase in the regulation of ATP production and insulin secretion in pancreatic beta cells. Mol Cell, 19, 197-207. PAGLIARINI, D. J., WORBY, C. A. & DIXON, J. E. 2004. A PTEN-like phosphatase with a novel substrate specificity. J Biol Chem, 279, 38590-6. PAPAKONSTANTI, E. A., ZWAENEPOEL, O., BILANCIO, A., BURNS, E., NOCK, G. E., HOUSEMAN, B., SHOKAT, K., RIDLEY, A. J. & VANHAESEBROECK, B. 2008. Distinct roles of class IA PI3K isoforms in primary and immortalised macrophages. Journal of Cell Science, 121, 4124-4133. PARK, C. R. & JOHNSON, L. H. 1955. Effect of Insulin on Transport of Glucose and Galactose Into Cells of Rat Muscle and Brain. AJP - Legacy, 182, 17-23. PATEL, N., HUANG, C. & KLIP, A. 2006. Cellular location of insulin-triggered signals and implications for glucose uptake. Pflugers Arch, 451, 499-510. PATEL, N., RUDICH, A., KHAYAT, Z. A., GARG, R. & KLIP, A. 2003. Intracellular segregation of phosphatidylinositol-3,4,5-trisphosphate by insulin-dependent actin remodeling in L6 skeletal muscle cells. Mol Cell Biol, 23, 4611-26. PATKI, V., LAWE, D. C., CORVERA, S., VIRBASIUS, J. V. & CHAWLA, A. 1998. A functional PtdIns(3)P-binding motif. Nature, 394, 433-434. PATTI, M.-E., SUN, X.-J., BRUENING, J. C., ARAKI, E., LIPES, M. A., WHITE, M. F. & KAHN, C. R. 1995. 4PS/Insulin Receptor Substrate (IRS)-2 Is the Alternative Substrate of the Insulin Receptor in IRS-1-deficient Mice. Journal of Biological Chemistry, 270, 24670-24673.

186

PAZ, K., LIU, Y.-F., SHORER, H., HEMI, R., LEROITH, D., QUAN, M., KANETY, H., SEGER, R. & ZICK, Y. 1999. Phosphorylation of Insulin Receptor Substrate-1 (IRS-1) by Protein Kinase B Positively Regulates IRS-1 Function. Journal of Biological Chemistry, 274, 28816-28822. PECK, G. R., YE, S., PHAM, V., FERNANDO, R. N., MACAULAY, S. L., CHAI, S. Y. & ALBISTON, A. L. 2006. Interaction of the Akt Substrate, AS160, with the Glucose Transporter 4 Vesicle Marker Protein, Insulin-Regulated Aminopeptidase. Molecular Endocrinology, 20, 2576-2583. PEÑA, P. V., DAVRAZOU, F., SHI, X., WALTER, K. L., VERKHUSHA, V. V., GOZANI, O., ZHAO, R. & KUTATELADZE, T. G. 2006. Molecular mechanism of histone H3K4me3 recognition by plant homeodomain of ING2. Nature, 442, 100- 103. PENDARIES, C., TRONCHERE, H., ARBIBE, L., MOUNIER, J., GOZANI, O., CANTLEY, L., FRY, M. J., GAITS-IACOVONI, F., SANSONETTI, P. J. & PAYRASTRE, B. 2006. PtdIns5P activates the host cell PI3-kinase/Akt pathway during Shigella flexneri infection. EMBO J, 25, 1024-34. PENDARIES, C., TRONCHERE, H., PLANTAVID, M. & PAYRASTRE, B. 2003. Phosphoinositide signaling disorders in human diseases. FEBS Lett, 546, 25- 31. PENDARIES, C., TRONCHERE, H., RACAUD-SULTAN, C., GAITS-IACOVONI, F., CORONAS, S., MANENTI, S., GRATACAP, M. P., PLANTAVID, M. & PAYRASTRE, B. 2005. Emerging roles of phosphatidylinositol monophosphates in cellular signaling and trafficking. Adv Enzyme Regul, 45, 201-14. PILCH, P. F. 2008. The mass action hypothesis: formation of Glut4 storage vesicles, a tissue-specific, regulated exocytic compartment. Acta Physiologica, 192, 89-101. POCHYNYUK, O., BUGAJ, V. & STOCKAND, J. D. 2008. Physiologic regulation of the epithelial sodium channel by phosphatidylinositides. Curr Opin Nephrol Hypertens, 17, 533-40. PORTIER, G. L., BENDERS, A. G., OOSTERHOF, A., VEERKAMP, J. H. & VAN KUPPEVELT, T. H. 1999. Differentiation markers of mouse C2C12 and rat L6 myogenic cell lines and the effect of the differentiation medium. In Vitro Cell Dev Biol Anim, 35, 219-27. PROUD, C. G. 2006. Regulation of protein synthesis by insulin. Biochem. Soc. Trans., 34, 213-216. QUON, M. J., GUERRE-MILLO, M., ZARNOWSKI, M. J., BUTTE, A. J., EM, M., CUSHMAN, S. W. & TAYLOR, S. I. 1994. Tyrosine kinase-deficient mutant human insulin receptors (Met1153-->Ile) overexpressed in transfected rat adipose cells fail to mediate translocation of epitope-tagged GLUT4. Proc Natl Acad Sci U S A, 91, 5587-91. RALSTON, E. & PLOUG, T. 1996. GLUT4 in cultured skeletal myotubes is segregated from the transferrin receptor and stored in vesicles associated with TGN. J Cell Sci, 109 ( Pt 13), 2967-78. RAMEH, L. E., TOLIAS, K. F., DUCKWORTH, B. C. & CANTLEY, L. C. 1997. A new pathway for synthesis of phosphatidylinositol-4,5-bisphosphate. Nature, 390, 192-6. RAMEL, D., LAGARRIGUE, F., DUPUIS-CORONAS, S., CHICANNE, G., LESLIE, N., GAITS-IACOVONI, F., PAYRASTRE, B. & TRONCHERE, H. 2009. PtdIns5P protects Akt from dephosphorylation through PP2A inhibition. Biochem Biophys Res Commun, 387, 127-31. RAMM, G., LARANCE, M., GUILHAUS, M. & JAMES, D. E. 2006. A role for 14-3-3 in insulin-stimulated GLUT4 translocation through its interaction with the RabGAP AS160. J Biol Chem, 281, 29174-80. RAO, V. D., MISRA, S., BORONENKOV, I. V., ANDERSON, R. A. & HURLEY, J. H. 1998. Structure of type IIbeta phosphatidylinositol phosphate kinase: a protein kinase fold flattened for interfacial phosphorylation. Cell, 94, 829-39.

187

RAVICHANDRAN, L. V., ESPOSITO, D. L., CHEN, J. & QUON, M. J. 2001. Protein Kinase C-δ Phosphorylates Insulin Receptor Substrate-1 and Impairs Its Ability to Activate Phosphatidylinositol 3-Kinase in Response to Insulin. Journal of Biological Chemistry, 276, 3543-3549. RICHARDSON, J. P., WANG, M., CLARKE, J. H., PATEL, K. J. & IRVINE, R. F. 2007. Genomic tagging of endogenous type IIbeta phosphatidylinositol 5- phosphate 4-kinase in DT40 cells reveals a nuclear localisation. Cell Signal, 19, 1309-14. RIDLEY, S. H., KTISTAKIS, N., DAVIDSON, K., ANDERSON, K. E., MANIFAVA, M., ELLSON, C. D., LIPP, P., BOOTMAN, M., COADWELL, J., NAZARIAN, A., ERDJUMENT-BROMAGE, H., TEMPST, P., COOPER, M. A., THURING, J. W. J. F., LIM, Z. Y., HOLMES, A. B., STEPHENS, L. R. & HAWKINS, P. T. 2001. FENS-1 and DFCP1 are FYVE domain-containing proteins with distinct functions in the endosomal and Golgi compartments. Journal of Cell Science, 114, 3991-4000. ROACH, W. G., CHAVEZ, J. A., MIINEA, C. P. & LIENHARD, G. E. 2007. Substrate specificity and effect on GLUT4 translocation of the Rab GTPase-activating protein Tbc1d1. Biochem J, 403, 353-8. ROBERTS, H. F., CLARKE, J. H., LETCHER, A. J., IRVINE, R. F. & HINCHLIFFE, K. A. 2005. Effects of lipid kinase expression and cellular stimuli on phosphatidylinositol 5-phosphate levels in mammalian cell lines. FEBS Lett, 579, 2868-72. ROBINSON, F. L., NIESMAN, I. R., BEISWENGER, K. K. & DIXON, J. E. 2008. Loss of the inactive myotubularin-related phosphatase Mtmr13 leads to a Charcot- Marie-Tooth 4B2-like peripheral neuropathy in mice. Proc Natl Acad Sci U S A, 105, 4916-21. ROBINSON, L. J., PANG, S., HARRIS, D. S., HEUSER, J. & JAMES, D. E. 1992. J. Cell Biol., 117, 1181. ROBINSON, R., ROBINSON, L. J., JAMES, D. E. & LAWRENCE, J. C., JR. 1993. Glucose transport in L6 myoblasts overexpressing GLUT1 and GLUT4. J Biol Chem, 268, 22119-26. ROGLIC, G., UNWIN, N., BENNETT, P. H., MATHERS, C., TUOMILEHTO, J., NAG, S., CONNOLLY, V. & KING, H. 2005. The Burden of Mortality Attributable to Diabetes. Diabetes Care, 28, 2130-2135. RUDICH, A., KONRAD, D., TOROK, D., BEN-ROMANO, R., HUANG, C., NIU, W., GARG, R. R., WIJESEKARA, N., GERMINARIO, R. J., BILAN, P. J. & KLIP, A. 2003. Indinavir uncovers different contributions of GLUT4 and GLUT1 towards glucose uptake in muscle and fat cells and tissues. Diabetologia, 46, 649-58. RUSSELL, D. S., GHERZI, R., JOHNSON, E. L., CHOU, C. K. & ROSEN, O. M. 1987. The protein-tyrosine kinase activity of the insulin receptor is necessary for insulin-mediated receptor down-regulation. Journal of Biological Chemistry, 262, 11833-11840. RUTHERFORD, A. C., TRAER, C., WASSMER, T., PATTNI, K., BUJNY, M. V., CARLTON, J. G., STENMARK, H. & CULLEN, P. J. 2006. The mammalian phosphatidylinositol 3-phosphate 5-kinase (PIKfyve) regulates endosome-to- TGN retrograde transport. J Cell Sci, 119, 3944-57. SALTIEL, A. R. & PESSIN, J. E. 2003. Insulin signaling in microdomains of the plasma membrane. Traffic, 4, 711-6. SANKARAN, V. G., KLEIN, D. E., SACHDEVA, M. M. & LEMMON, M. A. 2001. High- Affinity Binding of a FYVE Domain to Phosphatidylinositol 3-Phosphate Requires Intact Phospholipid but Not FYVE Domain Oligomerization†. Biochemistry, 40, 8581-8587. SANO, H., EGUEZ, L., TERUEL, M. N., FUKUDA, M., CHUANG, T. D., CHAVEZ, J. A., LIENHARD, G. E. & MCGRAW, T. E. 2007. Rab10, a target of the AS160 Rab GAP, is required for insulin-stimulated translocation of GLUT4 to the adipocyte plasma membrane. Cell Metab, 5, 293-303.

188

SANO, H., KANE, S., SANO, E., Mı INEA, C. P., ASARA, J. M., LANE, W. S., GARNER, C. W. & LIENHARD, G. E. 2003. Insulin-stimulated Phosphorylation of a Rab GTPase-activating Protein Regulates GLUT4 Translocation. Journal of Biological Chemistry, 278, 14599-14602. SANO, H., ROACH, W. G., PECK, G. R., FUKUDA, M. & LIENHARD, G. E. 2008. Rab10 in insulin-stimulated GLUT4 translocation. Biochem J, 411, 89-95. SARBASSOV, D. D., GUERTIN, D. A., ALI, S. M. & SABATINI, D. M. 2005. Phosphorylation and Regulation of Akt/PKB by the Rictor-mTOR Complex. Science, 307, 1098-1101. SARKES, D. & RAMEH, L. E. 2010. A novel HPLC-based approach makes possible the spatial characterization of cellular PtdIns5P and other phosphoinositides. Biochem J, 428, 375-84. SATOH, S., NISHIMURA, H., CLARK, A. E., KOZKA, I. J., VANNUCCI, S. J., SIMPSON, I. A., QUON, M. J., CUSHMAN, S. W. & HOLMAN, G. D. 1993. Use of bismannose photolabel to elucidate insulin-regulated GLUT4 subcellular trafficking kinetics in rat adipose cells. Evidence that exocytosis is a critical site of hormone action. J Biol Chem, 268, 17820-9. SAVKUR, R. S., PHILIPS, A. V. & COOPER, T. A. 2001. Aberrant regulation of insulin receptor alternative splicing is associated with insulin resistance in myotonic dystrophy. Nat Genet, 29, 40-7. SBRISSA, D., IKONOMOV, O. C., DEEB, R. & SHISHEVA, A. 2002. Phosphatidylinositol 5-phosphate biosynthesis is linked to PIKfyve and is involved in osmotic response pathway in mammalian cells. J Biol Chem, 277, 47276-84. SBRISSA, D., IKONOMOV, O. C. & SHISHEVA, A. 1999. PIKfyve, a mammalian ortholog of yeast Fab1p lipid kinase, synthesizes 5-phosphoinositides. Effect of insulin. J Biol Chem, 274, 21589-97. SBRISSA, D., IKONOMOV, O. C., STRAKOVA, J. & SHISHEVA, A. 2004. Role for a novel signaling intermediate, phosphatidylinositol 5-phosphate, in insulin- regulated F-actin stress fiber breakdown and GLUT4 translocation. Endocrinology, 145, 4853-65. SBRISSA, D. & SHISHEVA, A. 2005. Acquisition of unprecedented phosphatidylinositol 3,5-bisphosphate rise in hyperosmotically stressed 3T3- L1 adipocytes, mediated by ArPIKfyve-PIKfyve pathway. J Biol Chem, 280, 7883-9. SCHACHT, J. 1978. Purification of polyphosphoinositides by chromatography on immobilized neomycin. J Lipid Res, 19, 1063-7. SCHALETZKY, J., DOVE, S. K., SHORT, B., LORENZO, O., CLAGUE, M. J. & BARR, F. A. 2003a. Phosphatidylinositol-5-Phosphate Activation and Conserved Substrate Specificity of the Myotubularin Phosphatidylinositol 3- Phosphatases. Current Biology, 13, 504-509. SCHALETZKY, J., DOVE, S. K., SHORT, B., LORENZO, O., CLAGUE, M. J. & BARR, F. A. 2003b. Phosphatidylinositol-5-phosphate activation and conserved substrate specificity of the myotubularin phosphatidylinositol 3- phosphatases. Curr Biol, 13, 504-9. SEEBOHM, G., STRUTZ-SEEBOHM, N., BIRKIN, R., DELL, G., BUCCI, C., SPINOSA, M. R., BALTAEV, R., MACK, A. F., KORNIYCHUK, G., CHOUDHURY, A., MARKS, D., PAGANO, R. E., ATTALI, B., PFEUFER, A., KASS, R. S., SANGUINETTI, M. C., TAVARE, J. M. & LANG, F. 2007. Regulation of Endocytic Recycling of KCNQ1/KCNE1 Potassium Channels. Circ Res, 100, 686-692. SEINO, S., SEINO, M., NISHI, S. & BELL, G. I. 1989. Structure of the human insulin receptor gene and characterization of its promoter. Proceedings of the National Academy of Sciences of the United States of America, 86, 114-118. SEMINARIO, M. C. & WANGE, R. L. 2003. Lipid phosphatases in the regulation of T cell activation: living up to their PTEN-tial. Immunological Reviews, 192, 80- 97.

189

SENDEREK, J., BERGMANN, C., WEBER, S., KETELSEN, U. P., SCHORLE, H., RUDNIK-SCHONEBORN, S., BUTTNER, R., BUCHHEIM, E. & ZERRES, K. 2003. Mutation of the SBF2 gene, encoding a novel member of the myotubularin family, in Charcot-Marie-Tooth neuropathy type 4B2/11p15. Hum Mol Genet, 12, 349-56. SHARMA, N., ARIAS, E. B. & CARTEE, G. D. 2010. Rapid reversal of insulin- stimulated AS160 phosphorylation in rat skeletal muscle after insulin exposure. Physiol Res, 59, 71-8. SHI, X., HONG, T., WALTER, K. L., EWALT, M., MICHISHITA, E., HUNG, T., CARNEY, D., PEÑA, P., LAN, F., KAADIGE, M. R., LACOSTE, N., CAYROU, C., DAVRAZOU, F., SAHA, A., CAIRNS, B. R., AYER, D. E., KUTATELADZE, T. G., SHI, Y., CÔTÉ, J., CHUA, K. F. & GOZANI, O. 2006. ING2 PHD domain links histone H3 lysine 4 methylation to active gene repression. Nature, 442, 96- 99. SHISHEVA, A. 2008. Phosphoinositides in insulin action on GLUT4 dynamics: not just PtdIns(3,4,5)P3. Am J Physiol Endocrinol Metab, 295, E536-44. SHOJAIEFARD, M., STRUTZ-SEEBOHM, N., TAVARE, J. M., SEEBOHM, G. & LANG, F. 2007. Regulation of the Na(+), glucose cotransporter by PIKfyve and the serum and glucocorticoid inducible kinase SGK1. Biochem Biophys Res Commun, 359, 843-7. SLOT, J. W., GEUZE, H. J., GIGENGACK, S., LIENHARD, G. E. & JAMES, D. E. 1991. Immuno-localization of the insulin regulatable glucose transporter in brown adipose tissue of the rat. J Cell Biol, 113, 123-35. SMITH, R. M., CHARRON, M. J., SHAH, N., LODISH, H. F. & JARETT, L. 1991. Immunoelectron microscopic demonstration of insulin-stimulated translocation of glucose transporters to the plasma membrane of isolated rat adipocytes and masking of the carboxyl-terminal epitope of intracellular GLUT4. Proceedings of the National Academy of Sciences of the United States of America, 88, 6893-6897. STANDAERT, M. L., ORTMEYER, H. K., SAJAN, M. P., KANOH, Y., BANDYOPADHYAY, G., HANSEN, B. C. & FARESE, R. V. 2002. Skeletal Muscle Insulin Resistance in Obesity-Associated Type 2 Diabetes in Monkeys Is Linked to a Defect in Insulin Activation of Protein Kinase C-δ/λ/ι. Diabetes, 51, 2936-2943. STEPHENS, L., ANDERSON, K., STOKOE, D., ERDJUMENT-BROMAGE, H., PAINTER, G. F., HOLMES, A. B., GAFFNEY, P. R., NBSP, J, REESE, C. B., MCCORMICK, F., TEMPST, P., COADWELL, J. & HAWKINS, P. T. 1998. Protein Kinase B Kinases That Mediate Phosphatidylinositol 3,4,5-Trisphosphate-Dependent Activation of Protein Kinase B. Science, 279, 710-714. STOCKLI, J., DAVEY, J. R., HOHNEN-BEHRENS, C., XU, A., JAMES, D. E. & RAMM, G. 2008. Regulation of Glucose Transporter 4 Translocation by the Rab Guanosine Triphosphatase-Activating Protein AS160/TBC1D4: Role of Phosphorylation and Membrane Association. Mol Endocrinol, 22, 2703-2715. STOCKLI, J., FAZAKERLEY, D. J., COSTER, A. C., HOLMAN, G. D. & JAMES, D. E. 2010. Muscling in on GLUT4 kinetics. Commun Integr Biol, 3, 260-2. STOKOE, D., STEPHENS, L. R., COPELAND, T., GAFFNEY, P. R. J., REESE, C. B., PAINTER, G. F., HOLMES, A. B., MCCORMICK, F. & HAWKINS, P. T. 1997. Dual Role of Phosphatidylinositol-3,4,5-trisphosphate in the Activation of Protein Kinase B. Science, 277, 567-570. STONE, S., ABKEVICH, V., RUSSELL, D. L., RILEY, R., TIMMS, K., TRAN, T., TREM, D., FRANK, D., JAMMULAPATI, S., NEFF, C. D., ILIEV, D., GRESS, R., HE, G., FRECH, G. C., ADAMS, T. D., SKOLNICK, M. H., LANCHBURY, J. S., GUTIN, A., HUNT, S. C. & SHATTUCK, D. 2006. TBC1D1 is a candidate for a severe obesity gene and evidence for a gene/gene interaction in obesity predisposition. Human Molecular Genetics, 15, 2709-2720. STRATTON, I. M., ADLER, A. I., NEIL, H. A. W., MATTHEWS, D. R., MANLEY, S. E., CULL, C. A., HADDEN, D., TURNER, R. C. & HOLMAN, R. R. 2000. Association

190

of glycaemia with macrovascular and microvascular complications of type 2 diabetes (UKPDS 35): prospective observational study. BMJ, 321, 405-412. STRUTZ-SEEBOHM, N., SHOJAIEFARD, M., CHRISTIE, D., TAVARE, J., SEEBOHM, G. & LANG, F. 2007. PIKfyve in the SGK1 mediated regulation of the creatine transporter SLC6A8. Cell Physiol Biochem, 20, 729-34. STUART, C. A., HOWELL, M. E., ZHANG, Y. & YIN, D. 2009. Insulin-stimulated translocation of glucose transporter (GLUT) 12 parallels that of GLUT4 in normal muscle. J Clin Endocrinol Metab, 94, 3535-42. STUART, C. A., YIN, D., HOWELL, M. E., DYKES, R. J., LAFFAN, J. J. & FERRANDO, A. A. 2006. Hexose transporter mRNAs for GLUT4, GLUT5, and GLUT12 predominate in human muscle. Am J Physiol Endocrinol Metab, 291, E1067- 73. SUH, B. C., INOUE, T., MEYER, T. & HILLE, B. 2006. Rapid chemically induced changes of PtdIns(4,5)P2 gate KCNQ ion channels. Science, 314, 1454-7. SUZUKI, K. & KONO, T. 1980. Evidence that insulin causes translocation of glucose transport activity to the plasma membrane from an intracellular storage site. Proc Natl Acad Sci U S A, 77, 2542-5. SWEENEY, G., GARG, R. R., CEDDIA, R. B., LI, D., ISHIKI, M., SOMWAR, R., FOSTER, L. J., NEILSEN, P. O., PRESTWICH, G. D., RUDICH, A. & KLIP, A. 2004. Intracellular delivery of phosphatidylinositol (3,4,5)-trisphosphate causes incorporation of glucose transporter 4 into the plasma membrane of muscle and fat cells without increasing glucose uptake. J Biol Chem, 279, 32233-42. SWEENEY, G., SOMWAR, R., RAMLAL, T., VOLCHUK, A., UEYAMA, A. & KLIP, A. 1999. An Inhibitor of p38 Mitogen-activated Protein Kinase Prevents Insulin- stimulated Glucose Transport but Not Glucose Transporter Translocation in 3T3-L1 Adipocytes and L6 Myotubes. Journal of Biological Chemistry, 274, 10071-10078. TAMEMOTO, H., KADOWAKI, T., TOBE, K., YAGI, T., SAKURA, H., HAYAKAWA, T., TERAUCHI, Y., UEKI, K., KABURAGI, Y., SATOH, S., SEKIHARA, H., YOSHIOKA, S., HORIKOSHI, H., FURUTA, Y., IKAWA, Y., KASUGA, M., YAZAKI, Y. & AIZAWA, S. 1994. Insulin resistance and growth retardation in mice lacking insulin receptor substrate- 1. Nature, 372, 182-186. TANIGUCHI, C. M., EMANUELLI, B. & KAHN, C. R. 2006. Critical nodes in signalling pathways: insights into insulin action. Nat Rev Mol Cell Biol, 7, 85-96. TANNER, L. I. & LIENHARD, G. E. 1987. Insulin elicits a redistribution of transferrin receptors in 3T3-L1 adipocytes through an increase in the rate constant for receptor externalization. J Biol Chem, 262, 8975-80. TAYLOR, E. B., AN, D., KRAMER, H. F., YU, H., FUJII, N. L., ROECKL, K. S., BOWLES, N., HIRSHMAN, M. F., XIE, J., FEENER, E. P. & GOODYEAR, L. J. 2008. Discovery of TBC1D1 as an insulin-, AICAR-, and contraction- stimulated signaling nexus in mouse skeletal muscle. J Biol Chem, 283, 9787-96. TAYLOR, G. S., MAEHAMA, T. & DIXON, J. E. 2000a. Myotubularin, a protein tyrosine phosphatase mutated in myotubular myopathy, dephosphorylates the lipid second messenger, phosphatidylinositol 3-phosphate. Proceedings of the National Academy of Sciences of the United States of America, 97, 8910-8915. TAYLOR, V., WONG, M., BRANDTS, C., REILLY, L., DEAN, N. M., COWSERT, L. M., MOODIE, S. & STOKOE, D. 2000b. 5' phospholipid phosphatase SHIP-2 causes protein kinase B inactivation and cell cycle arrest in glioblastoma cells. Mol Cell Biol, 20, 6860-71. TENGHOLM, A. & MEYER, T. 2002. A PI3-Kinase Signaling Code for Insulin- Triggered Insertion of Glucose Transporters into the Plasma Membrane. Current Biology, 12, 1871-1876.

191

TERAUCHI, Y., IWAMOTO, K., TAMEMOTO, H., KOMEDA, K., ISHII, C., KANAZAWA, Y., ASANUMA, N., AIZAWA, T., AKANUMA, Y., YASUDA, K., KODAMA, T., TOBE, K., YAZAKI, Y. & KADOWAKI, T. 1997. Development of non-insulin- dependent diabetes mellitus in the double knockout mice with disruption of insulin receptor substrate-1 and beta cell glucokinase genes. Genetic reconstitution of diabetes as a polygenic disease. J Clin Invest, 99, 861-6. THONG, F. S. L., DUGANI, C. B. & KLIP, A. 2005. Turning Signals On and Off: GLUT4 Traffic in the Insulin-Signaling Highway. Physiology, 20, 271-284. TOLIAS, K. F., RAMEH, L. E., ISHIHARA, H., SHIBASAKI, Y., CHEN, J., PRESTWICH, G. D., CANTLEY, L. C. & CARPENTER, C. L. 1998. Type I Phosphatidylinositol-4-phosphate 5-Kinases Synthesize the Novel Lipids Phosphatidylinositol 3,5-Bisphosphate and Phosphatidylinositol 5-Phosphate. Journal of Biological Chemistry, 273, 18040-18046. TREMBLAY, F., BRÛLÉ, S., HEE UM, S., LI, Y., MASUDA, K., RODEN, M., SUN, X. J., KREBS, M., POLAKIEWICZ, R. D., THOMAS, G. & MARETTE, A. 2007. Identification of IRS-1 Ser-1101 as a target of S6K1 in nutrient- and obesity-induced insulin resistance. Proceedings of the National Academy of Sciences, 104, 14056-14061. TRONCHERE, H., LAPORTE, J., PENDARIES, C., CHAUSSADE, C., LIAUBET, L., PIROLA, L., MANDEL, J. L. & PAYRASTRE, B. 2004. Production of phosphatidylinositol 5-phosphate by the phosphoinositide 3-phosphatase myotubularin in mammalian cells. J Biol Chem, 279, 7304-12. TSAKIRIDIS, T., MCDOWELL, H., WALKER, T., DOWNES, C., HUNDAL, H., VRANIC, M. & KLIP, A. 1995. Multiple roles of phosphatidylinositol 3-kinase in regulation of glucose transport, amino acid transport, and glucose transporters in L6 skeletal muscle cells. Endocrinology, 136, 4315-4322. TSCHOPP, O., YANG, Z. Z., BRODBECK, D., DUMMLER, B. A., HEMMINGS- MIESZCZAK, M., WATANABE, T., MICHAELIS, T., FRAHM, J. & HEMMINGS, B. A. 2005. Essential role of protein kinase B gamma (PKB gamma/Akt3) in postnatal brain development but not in glucose homeostasis. Development, 132, 2943-54. UEKI, K., ALGENSTAEDT, P., MAUVAIS-JARVIS, F. & KAHN, C. R. 2000. Positive and negative regulation of phosphoinositide 3-kinase-dependent signaling pathways by three different gene products of the p85alpha regulatory subunit. Mol Cell Biol, 20, 8035-46. UEKI, K., FRUMAN, D. A., BRACHMANN, S. M., TSENG, Y.-H., CANTLEY, L. C. & KAHN, C. R. 2002. Molecular Balance between the Regulatory and Catalytic Subunits of Phosphoinositide 3-Kinase Regulates Cell Signaling and Survival. Molecular and Cellular Biology, 22, 965-977. UEKI, K., KONDO, T. & KAHN, C. R. 2004. Suppressor of cytokine signaling 1 (SOCS-1) and SOCS-3 cause insulin resistance through inhibition of tyrosine phosphorylation of insulin receptor substrate proteins by discrete mechanisms. Mol Cell Biol, 24, 5434-46. UEYAMA, A., YAWORSKY, K. L., WANG, Q., EBINA, Y. & KLIP, A. 1999. GLUT-4myc ectopic expression in L6 myoblasts generates a GLUT-4-specific pool conferring insulin sensitivity. Am J Physiol, 277, E572-8. UGI, S., IMAMURA, T., MAEGAWA, H., EGAWA, K., YOSHIZAKI, T., SHI, K., OBATA, T., EBINA, Y., KASHIWAGI, A. & OLEFSKY, J. M. 2004. Protein phosphatase 2A negatively regulates insulin's metabolic signaling pathway by inhibiting Akt (protein kinase B) activity in 3T3-L1 adipocytes. Mol Cell Biol, 24, 8778- 89. UNGEWICKELL, A., HUGGE, C., KISSELEVA, M., CHANG, S. C., ZOU, J., FENG, Y., GALYOV, E. E., WILSON, M. & MAJERUS, P. W. 2005. The identification and characterization of two phosphatidylinositol-4,5-bisphosphate 4- phosphatases. Proc Natl Acad Sci U S A, 102, 18854-9.

192

VANHAESEBROECK, B., GUILLERMET-GUIBERT, J., GRAUPERA, M. & BILANGES, B. 2010. The emerging mechanisms of isoform-specific PI3K signalling. Nat Rev Mol Cell Biol, 11, 329-341. VANHAESEBROECK, B., LEEVERS, S. J., AHMADI, K., TIMMS, J., KATSO, R., DRISCOLL, P. C., WOSCHOLSKI, R., PARKER, P. J. & WATERFIELD, M. D. 2001. Synthesis and function of 3-phosphorylated inositol lipids. Annu Rev Biochem, 70, 535-602. VENKATESWARLU, K., GUNN-MOORE, F., TAVARE, J. M. & CULLEN, P. J. 1999. EGF- and NGF-stimulated translocation of cytohesin-1 to the plasma membrane of PC12 cells requires PI 3-kinase activation and a functional cytohesin-1 PH domain. J Cell Sci, 112 ( Pt 12), 1957-65. VENKATESWARLU, K., OATEY, P. B., TAVARE, J. M. & CULLEN, P. J. 1998. Insulin- dependent translocation of ARNO to the plasma membrane of adipocytes requires phosphatidylinositol 3-kinase. Curr Biol, 8, 463-6. VERGNE, I. & DERETIC, V. 2010. The role of PI3P phosphatases in the regulation of autophagy. FEBS Lett, 584, 1313-8. VICINANZA, M., D'ANGELO, G., CAMPLI, D., A., MATTEIS, D. & A., M. 2008. Phosphoinositides as regulators of membrane trafficking in health and disease, Cell Mol Life Sci. 65(18):2833-41. VINCIGUERRA, M. & FOTI, M. 2006. PTEN and SHIP2 phosphoinositide phosphatases as negative regulators of insulin signalling. Archives Of Physiology And Biochemistry, 112, 89-104. VOLIOVITCH, H., SCHINDLER, D. G., HADARI, Y. R., TAYLOR, S. I., ACCILI, D. & ZICK, Y. 1995. Tyrosine Phosphorylation of Insulin Receptor Substrate-1 in Vivo Depends upon the Presence of Its Pleckstrin Homology Region. Journal of Biological Chemistry, 270, 18083-18087. WALKER, D. M., URBÉ, S., DOVE, S. K., TENZA, D., RAPOSO, G. & CLAGUE, M. J. 2001. Characterization of MTMR3: an inositol lipid 3-phosphatase with novel substrate specificity. Current Biology, 11, 1600-1605. WALSH, A. H., CHENG, A. & HONKANEN, R. E. 1997. Fostriecin, an antitumor antibiotic with inhibitory activity against serine/threonine protein phosphatases types 1 (PP1) and 2A (PP2A), is highly selective for PP2A. FEBS Lett, 416, 230-4. WANG, J., BARBRY, P., MAIYAR, A. C., ROZANSKY, D. J., BHARGAVA, A., LEONG, M., FIRESTONE, G. L. & PEARCE, D. 2001. SGK integrates insulin and mineralocorticoid regulation of epithelial sodium transport. AJP - Renal Physiology, 280, F303-313. WANG, M., BOND, N. J., LETCHER, A. J., RICHARDSON, J. P., LILLEY, K. S., IRVINE, R. F. & CLARKE, J. H. 2010. Genomic tagging reveals a random association of endogenous PtdIns5P 4-kinases IIalpha and IIbeta and a partial nuclear localization of the IIalpha isoform. Biochem J, 430, 215-21. WANG, Q., SOMWAR, R., BILAN, P. J., LIU, Z., JIN, J., WOODGETT, J. R. & KLIP, A. 1999. Protein kinase B/Akt participates in GLUT4 translocation by insulin in L6 myoblasts. Mol Cell Biol, 19, 4008-18. WATSON, R. T. & PESSIN, J. E. 2007. GLUT4 translocation: The last 200 nanometers. Cellular Signalling, 19, 2209-2217. WEI, M. L., BONZELIUS, F., SCULLY, R. M., KELLY, R. B. & HERMAN, G. A. 1998. GLUT4 and Transferrin Receptor Are Differentially Sorted Along the Endocytic Pathway in CHO Cells. The Journal of Cell Biology, 140, 565-575. WHITE, M. F. 2002. IRS proteins and the common path to diabetes. AJP - Endocrinology and Metabolism, 283, E413-422. WILCOX, A. & HINCHLIFFE, K. A. 2008. Regulation of extranuclear PtdIns5P production by phosphatidylinositol phosphate 4-kinase 2[alpha]. FEBS Letters, 582, 1391-1394. WILDEN, P. A., SIDDLE, K., HARING, E., BACKER, J. M., WHITE, M. F. & KAHN, C. R. 1992. The role of insulin receptor kinase domain autophosphorylation in

193

receptor-mediated activities. Analysis with insulin and anti-receptor antibodies. J Biol Chem, 267, 13719-27. WITHERS, J., D., GUTIERREZ, S., J., TOWERY, H., BURKS, REN, J.-M., PREVIS, S., ZHANG, Y., BERNAL, D., PONS, SHULMAN, I., G., BONNER-WEIR, WHITE & F., M. 1998. Nature Disruption of IRS-2 causes type 2 diabetes in mice. Nature, 391, 900-904. WONG, K. & CANTLEY, L. C. 1994. Cloning and characterization of a human phosphatidylinositol 4-kinase. J Biol Chem, 269, 28878-84. WOOD, I. S. & TRAYHURN, P. 2003. Glucose transporters (GLUT and SGLT): expanded families of sugar transport proteins. British Journal of Nutrition, 89, 3-9. YAFFE, D. 1969. Cellular aspects of muscle differentiation in vitro. Curr Top Dev Biol, 4, 37-77. YAMAMOTO, S., ICHISHIMA, K. & EHARA, T. 2008. Regulation of volume-regulated outwardly rectifying anion channels by phosphatidylinositol 3,4,5- trisphosphate in mouse ventricular cells. Biomed Res, 29, 307-15. YANG, J. & HOLMAN, G. D. 1993. Comparison of GLUT4 and GLUT1 subcellular trafficking in basal and insulin-stimulated 3T3-L1 cells. J Biol Chem, 268, 4600-3. YANG, J. & HOLMAN, G. D. 2005. Insulin and Contraction Stimulate Exocytosis, but Increased AMP-activated Protein Kinase Activity Resulting from Oxidative Metabolism Stress Slows Endocytosis of GLUT4 in Cardiomyocytes. Journal of Biological Chemistry, 280, 4070-4078. YANG, W.-C., GHIOTTO, M., BARBARAT, B. & OLIVE, D. 1999. The Role of Tec Protein-tyrosine Kinase in T Cell Signaling. Journal of Biological Chemistry, 274, 607-617. ZHAO, J. J., CHENG, H., JIA, S., WANG, L., GJOERUP, O. V., MIKAMI, A. & ROBERTS, T. M. 2006. The p110α isoform of PI3K is essential for proper growth factor signaling and oncogenic transformation. Proceedings of the National Academy of Sciences, 103, 16296-16300. ZHOU, Q. L., PARK, J. G., JIANG, Z. Y., HOLIK, J. J., MITRA, P., SEMIZ, S., GUILHERME, A., POWELKA, A. M., TANG, X., VIRBASIUS, J. & CZECH, M. P. 2004. Analysis of insulin signalling by RNAi-based gene silencing. Biochem Soc Trans, 32, 817-21. ZOU, J., MARJANOVIC, J., KISSELEVA, M. V., WILSON, M. & MAJERUS, P. W. 2007. Type I phosphatidylinositol-4,5-bisphosphate 4-phosphatase regulates stress-induced apoptosis. Proc Natl Acad Sci U S A, 104, 16834-9.

194