DOCSLIB.ORG

3) PDZRN3 E3 Ubiquitin Ligase

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
3) PDZRN3 E3 Ubiquitin Ligase THÈSE PRÉSENTÉE POUR OBTENIR LE GRADE DE DOCTEUR DE L’UNIVERSITÉ DE BORDEAUX ÉCOLE DOCTORALE SCIENCES DE LA VIE ET DE LA SANTE SPÉCIALITÉ BIOLOGIE CELLULAIRE ET PHYSIOPATHOLOGIE Par Raj Nayan SEWDUTH CARACTERISATION DE L’UBIQUITINE LIGASE PDZRN3 EN TANT QUE NOUVEL ACTEUR DES VOIES WNT DANS LA MORPHOGENESE ET L’INTEGRITE VASCULAIRE CHARACTERIZATION OF THE UBIQUITIN LIGASE PDZRN3 AS A NOVEL ACTOR OF WNT PATHWAYS IN VASCULAR MORPHOGENESIS AND INTEGRITY Sous la direction de : Dr Cécile DUPLAA (Directeur de Recherche) Soutenue le 18 Novembre 2014 Membres du jury : Pr Elisabeth Tournier Professeur Des Universités/ Practicien Hosptialier Rapporteur Laserve Hopital Lariboisière/Fernand Vidal – Inserm Dr Stéphane Germain Directeur De Recherche– Collège De France/ Inserm Rapporteur Dr Nathalie Macrez Chargée De Recherche– Institut Des Maladies Neurodégénératives/ Cnrs Examinateur Dr Nathalie Sans Chargée De Recherche– Neurocentre Magendie/ Inserm Invité Characterisation De L’ubiquitine Ligase PDZRN3 En Tant Que Nouvel Acteur Des Voies Wnt Dans La Morphogenese Et L’integrite Vasculaire Résumé : Parmi les récepteurs Frizzled, Frizzled 4 est le seul à avoir un phénotype vasculaire fort. Par criblage, nous avons identifié l’ubiquitine ligase PDZRN3 en tant que nouveau partenaire de la protéine adaptatrice Dvl3 qui agit en aval de Fzd4. En utilisant des modèles murins inductibles, nous montrons que la délétion de PDZRN3 induit une létalité embryonnaire suite à des défauts de vascularisation du sac amniotique ; et que PDZRN3 est requis pour une vascularisation normale de la rétine. De par son activité d’ubiquitine ligase, PDZRN3 induit la prise en charge du complexe Fzd4/ Dvl3 par les vésicules d’endocytose ce qui permet la transduction du signal après fixation du ligand Wnt5a sur le récepteur Fzd4. PDZRN3 régule également le maintien des jonctions des cellules endothéliales et l’intégrité de la barrière hémato-encéphalique. La délétion de PDZRN3 stabilise les microvaisseaux après ischémie cérébrale. PDZRN3 induit la disruption des jonctions serrées et la rupture de la barrière hématoencéphalique en ubiquitinant la protéine d’échafaudage MUPP1. Mots-clés: PDZRN3, Wnt/ Frizzled, endocytose, ubiquitinylation, angiogenèse, permeabilité, developpement, barrière hémato-encéphalique. Characterization Of The Ubiquitin Ligase PDZRN3 As A Novel Actor Of Wnt Pathways In Vascular Morphogenesis And Integrity Abstract : Fzd4 is the only Frizzled receptor that is essential for angiogenesis. By using a yeast two hybrid screening, we have identified the ubiquitin ligase PDZRN3 as a potential partner of the adaptor protein Dvl3 that acts downstream of Fzd4. By using inducible mouse models, we have shown that loss of PDZRN3 leads to early embryo lethality due to vascular defects in the yolk sac when deleted in utero, and is then required during post natal retinal vascularization. PDZRN3 would target the Fzd4/ Dvl3 complex to endosome, leading to signal transduction upon binding of Wnt5a to Fzd4. PDZRN3 also regulates integrity of the blood brain barrier by acting on tight junctions stability. Loss of PDZRN3 stabilizes microvessels after cerebral ischemia. PDZRN3 would induce tight junction disruption and blood brain barrier leakage by ubiquitinylating the scaffolding protein MUPP1. Key words: PDZRN3, Wnt/ Frizzled, endocytosis, ubiquitinylation, angiogenesis, permeability, development, blood brain barrier. Inserm U1034 Adaptation Cardiovasculaire à l’Ischémie 1 Avenue de Magellan, 33600 Pessac 189 REMERCIEMENTS A tous les membres du jury, je vous remercie d’avoir accepté de juger ce travail Je remercie tout le laboratoire pour leur soutien ; Catherine, Béatrice, Myriam, Annabel et Jérome pour leur aide technique ; Christelle pour son aide au niveau administratif ; Aude, Claire, Nathalie, Marie-Lise et Laura pour leur bonne humeur ; Dr Marie-Ange Renault, Pr Pascale Dufourcq et Pr Thierry Couffinhal pour leur conseils et Dr Cécile Duplàa pour son encadrement au cours de ce travail. Un merci aux étudiants en Master qui ont contribué au projet, Béatrice Desmoures, Nicolas Fritsch, Vincent Jecko et Robin Tellier. Je tiens finalement à remercier mes parents et mes amis pour leur support moral. Je remercie tout spécialement Delphine pour son soutien tout le long de ce parcours. 1 TABLE OF CONTENTS REMERCIEMENTS .......................................................................................................................... 1 TABLE OF CONTENTS ................................................................................................................... 2 LIST OF FIGURES ............................................................................................................................ 5 ABBREVIATIONS ........................................................................................................................... 10 AVANT-PROPOS ............................................................................................................................. 12 INTRODUCTION ............................................................................................................................ 14 CHAPTER I. WNT SIGNALING AND ANGIOGENESIS ........................................................................... 15 1) The Wnt pathways ............................................................................................................... 15 a) The Wnt pathways .......................................................................................................... 16 b) Wnt (wingless-type MMTV integration site family) Factors ......................................... 19 c) Fzd receptors ................................................................................................................... 24 d) Coreceptors of Fzd proteins ............................................................................................ 28 e) Downstream effectors of Wnt signaling ......................................................................... 32 2) Wnt signaling as a regulator of vascular development ...................................................... 37 a) Wnt signaling is implicated in angiogenesis during development and in pathology ...... 37 b) Molecular mechanisms of regulation of angiogenesis/cell migration by Wnt signaling 46 CHAPTER II. REGULATION OF WNT SIGNALING BY ENDOCYTOSIS AND UBIQUITINYLATION.............. 51 1) Endocytosis as a regulator of Wnt signaling ...................................................................... 51 a) Role of the early endosome in signal transduction ......................................................... 51 b) Role of the early endosome in Wnt signaling ................................................................. 52 c) Caveolin and Clathrin mediated endocytosis would regulate balance between Wnt pathways ........................................................................................................................................ 53 d) Role of the endocytosis in Wnt signaling during development ...................................... 55 2) Ubiquitinylation as a regulator of Wnt signaling ............................................................... 56 a) Role of ubiquitylation in protein stability or function .................................................... 56 b) Ubiquitinylation of Fzd proteins ..................................................................................... 57 c) Ubiquitinylation of Dvl proteins ..................................................................................... 58 d) Ubiquitinylation of catenin ......................................................................................... 60 3) PDZRN3 E3 ubiquitin ligase .............................................................................................. 61 a) Identification of PDZRN3 ............................................................................................... 61 b) Structure and Function of PDZRN3 E3 ubiquitin ligase ................................................ 62 c) PDZRN3 is a member of the LNX family of protein ..................................................... 64 CHAPTER III.WNT SIGNALING AND VASCULAR INTEGRITY ............................................................... 65 1) Wnt signaling regulates endothelial permeability in the Blood brain barrier ................... 65 a) Wnt signaling as a regulator of brain vessels permeability ............................................ 65 b) Wnt signaling as a regulator of brain vessels function in pathologies ............................ 69 2) Molecular mechanisms of regulation of vascular permeability by Wnt signaling ............. 71 a) Structure of the tight junctions ........................................................................................ 71 b) Interplay between catenin and ZO1 ........................................................................... 73 c) Interplay between c-Jun and ZO2 ................................................................................... 75 3) MUPP1 acts as a bridge between TJ and Wnt signaling ................................................... 77 2 a) MUPP1 is important for tight junctions stability ............................................................ 77 b) MUPP1 acts as a scaffold in the Crumbs complex ......................................................... 78 c) MUPP1 as a bridge between Tight Junctions and Crumbs complex .............................. 80 METHODS .......................................................................................................................................
Load more

Recommended publications
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name E3 ubiquitin-protein ligase PDZRN3 Gene Symbol Pdzrn3 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.3111 Ensembl Gene ID ENSRNOG00000005632 Entrez Gene ID 312607 Assay Information Unique Assay ID qRnoCIP0047702 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000039201 Amplicon Context Sequence CAAAGATTCCTTCACTGGAGGATCCATCTTGATTGTCCACACAGGGCCGGCCAC CAATGATATTGAATCCCAGGGAGCCAGAGTCCCGATGCAGGACAAGAGTCACAC TTTTGGTCTCTTC Amplicon Length (bp) 91 Chromosome Location 4:198408551-198415479 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 90 R2 0.9995 cDNA Cq 23.15 cDNA Tm (Celsius) 83.5 gDNA Cq 42.04 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Pdzrn3, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Pdzrn3 Is Required for Pronephros Morphogenesis in Xenopus Laevis SILVIA MARRACCI, ALBERTO VANGELISTI, VITTORIA RAFFA, MASSIMILIANO ANDREAZZOLI and LUCIANA DENTE*
    Int. J. Dev. Biol. 60: 57-63 (2016) doi: 10.1387/ijdb.150381ld www.intjdevbiol.com pdzrn3 is required for pronephros morphogenesis in Xenopus laevis SILVIA MARRACCI, ALBERTO VANGELISTI, VITTORIA RAFFA, MASSIMILIANO ANDREAZZOLI and LUCIANA DENTE* Laboratory of Cell and Developmental Biology, Dept. of Biology, University of Pisa, Pisa, Italy ABSTRACT Pdzrn3, a multidomain protein with E3-ubiquitin ligase activity, has been reported to play a role in myoblast and osteoblast differentiation and, more recently, in neuronal and endo- thelial cell development. The expression of the pdzrn3 gene is developmentally regulated in vari- ous vertebrate tissues, including muscular, neural and vascular system. Little is known about its expression during kidney development, although genetic polymorphisms and alterations around the human pdzrn3 chromosomal region have been found to be associated with renal cell carcino- mas and other kidney diseases. We investigated the pdzrn3 spatio-temporal expression pattern in Xenopus laevis embryos by in situ hybridization. We focused our study on the development of the pronephros, which is the embryonic amphibian kidney, functionally similar to the most primitive nephric structures of human kidney. To explore the role of pdzrn3 during renal morphogenesis, we performed loss-of-function experiments, through antisense morpholino injections and analysed the morphants using specific pronephric markers. Dynamic pdzrn3 expression was observed in embryonic tissues, such as somites, brain, eye, blood islands, heart, liver and pronephros. Loss of function experiments resulted in specific alterations of pronephros development. In particular, at early stages, pdzrn3 depletion was associated with a reduction of the pronephros anlagen and later, with perturbations of the tubulogenesis, including deformation of the proximal tubules.
    [Show full text]
  • Role of PDZ-Binding Motif from West Nile Virus NS5 Protein on Viral
    www.nature.com/scientificreports OPEN Role of PDZ‑binding motif from West Nile virus NS5 protein on viral replication Emilie Giraud1*, Chloé Otero del Val2, Célia Caillet‑Saguy2, Nada Zehrouni2, Cécile Khou5, Joël Caillet4, Yves Jacob3, Nathalie Pardigon5 & Nicolas Wolf2 West Nile virus (WNV) is a Flavivirus, which can cause febrile illness in humans that may progress to encephalitis. Like any other obligate intracellular pathogens, Flaviviruses hijack cellular protein functions as a strategy for sustaining their life cycle. Many cellular proteins display globular domain known as PDZ domain that interacts with PDZ‑Binding Motifs (PBM) identifed in many viral proteins. Thus, cellular PDZ‑containing proteins are common targets during viral infection. The non‑structural protein 5 (NS5) from WNV provides both RNA cap methyltransferase and RNA polymerase activities and is involved in viral replication but its interactions with host proteins remain poorly known. In this study, we demonstrate that the C‑terminal PBM of WNV NS5 recognizes several human PDZ‑ containing proteins using both in vitro and in cellulo high‑throughput methods. Furthermore, we constructed and assayed in cell culture WNV replicons where the PBM within NS5 was mutated. Our results demonstrate that the PBM of WNV NS5 is important in WNV replication. Moreover, we show that knockdown of the PDZ‑containing proteins TJP1, PARD3, ARHGAP21 or SHANK2 results in the decrease of WNV replication in cells. Altogether, our data reveal that interactions between the PBM of NS5 and PDZ‑containing proteins afect West Nile virus replication. Arboviruses include numerous human and animal pathogens that are important global health threats responsible for arboviroses.
    [Show full text]
  • Supplementary Table 1 Double Treatment Vs Single Treatment
    Supplementary table 1 Double treatment vs single treatment Probe ID Symbol Gene name P value Fold change TC0500007292.hg.1 NIM1K NIM1 serine/threonine protein kinase 1.05E-04 5.02 HTA2-neg-47424007_st NA NA 3.44E-03 4.11 HTA2-pos-3475282_st NA NA 3.30E-03 3.24 TC0X00007013.hg.1 MPC1L mitochondrial pyruvate carrier 1-like 5.22E-03 3.21 TC0200010447.hg.1 CASP8 caspase 8, apoptosis-related cysteine peptidase 3.54E-03 2.46 TC0400008390.hg.1 LRIT3 leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 1.86E-03 2.41 TC1700011905.hg.1 DNAH17 dynein, axonemal, heavy chain 17 1.81E-04 2.40 TC0600012064.hg.1 GCM1 glial cells missing homolog 1 (Drosophila) 2.81E-03 2.39 TC0100015789.hg.1 POGZ Transcript Identified by AceView, Entrez Gene ID(s) 23126 3.64E-04 2.38 TC1300010039.hg.1 NEK5 NIMA-related kinase 5 3.39E-03 2.36 TC0900008222.hg.1 STX17 syntaxin 17 1.08E-03 2.29 TC1700012355.hg.1 KRBA2 KRAB-A domain containing 2 5.98E-03 2.28 HTA2-neg-47424044_st NA NA 5.94E-03 2.24 HTA2-neg-47424360_st NA NA 2.12E-03 2.22 TC0800010802.hg.1 C8orf89 chromosome 8 open reading frame 89 6.51E-04 2.20 TC1500010745.hg.1 POLR2M polymerase (RNA) II (DNA directed) polypeptide M 5.19E-03 2.20 TC1500007409.hg.1 GCNT3 glucosaminyl (N-acetyl) transferase 3, mucin type 6.48E-03 2.17 TC2200007132.hg.1 RFPL3 ret finger protein-like 3 5.91E-05 2.17 HTA2-neg-47424024_st NA NA 2.45E-03 2.16 TC0200010474.hg.1 KIAA2012 KIAA2012 5.20E-03 2.16 TC1100007216.hg.1 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 7.43E-03 2.15 TC0400012977.hg.1 SH3D19
    [Show full text]
  • The Pdx1 Bound Swi/Snf Chromatin Remodeling Complex Regulates Pancreatic Progenitor Cell Proliferation and Mature Islet Β Cell
    Page 1 of 125 Diabetes The Pdx1 bound Swi/Snf chromatin remodeling complex regulates pancreatic progenitor cell proliferation and mature islet β cell function Jason M. Spaeth1,2, Jin-Hua Liu1, Daniel Peters3, Min Guo1, Anna B. Osipovich1, Fardin Mohammadi3, Nilotpal Roy4, Anil Bhushan4, Mark A. Magnuson1, Matthias Hebrok4, Christopher V. E. Wright3, Roland Stein1,5 1 Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 2 Present address: Department of Pediatrics, Indiana University School of Medicine, Indianapolis, IN 3 Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 4 Diabetes Center, Department of Medicine, UCSF, San Francisco, California 5 Corresponding author: [email protected]; (615)322-7026 1 Diabetes Publish Ahead of Print, published online June 14, 2019 Diabetes Page 2 of 125 Abstract Transcription factors positively and/or negatively impact gene expression by recruiting coregulatory factors, which interact through protein-protein binding. Here we demonstrate that mouse pancreas size and islet β cell function are controlled by the ATP-dependent Swi/Snf chromatin remodeling coregulatory complex that physically associates with Pdx1, a diabetes- linked transcription factor essential to pancreatic morphogenesis and adult islet-cell function and maintenance. Early embryonic deletion of just the Swi/Snf Brg1 ATPase subunit reduced multipotent pancreatic progenitor cell proliferation and resulted in pancreas hypoplasia. In contrast, removal of both Swi/Snf ATPase subunits, Brg1 and Brm, was necessary to compromise adult islet β cell activity, which included whole animal glucose intolerance, hyperglycemia and impaired insulin secretion. Notably, lineage-tracing analysis revealed Swi/Snf-deficient β cells lost the ability to produce the mRNAs for insulin and other key metabolic genes without effecting the expression of many essential islet-enriched transcription factors.
    [Show full text]
  • Cell Leukemia Virus Tax Oncoprotein
    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.25.457680; this version posted August 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Interactome and structural basis for targeting the human T- cell leukemia virus Tax oncoprotein Sibusiso B. Maseko1, Inge Van Molle2, Karim Blibek1, Christoph Gorgulla3-5, Julien Olivet1, Jeremy Blavier1, Charlotte Vandermeulen1, Stéphanie Skupiewski1, Deeya Saha1, Thandokuhle Ntombela6, Julianne Lim7, Frederique Lembo8, Aurelie Beauvois9, Malik Hamaidia9, Jean-Paul Borg8, Pascale Zimmermann8,10, Frank Delvigne11, Luc Willems9,11, Johan Van Weyenbergh12, Dae-Kyum Kim7, 13-15, Franck Dequiedt16, Haribabu Arthanari3-5, Alexander N. Volkov2,17,*, Jean-Claude Twizere1,11,18,* 1Laboratory of Viral Interactomes, Unit of Molecular Biology of Diseases, GIGA Institute, University of Liege, Liège, Belgium. 2VIB-VUB Center for Structural Biology, Flemish Institute of Biotechnology (VIB), Pleinlaan 2, Brussels, Belgium. 3Department of Biological Chemistry and Molecular Pharmacology, Blavatnik Institute, Harvard Medical School, Boston, MA, USA. 4Department of Physics, Faculty of Arts and Sciences, Harvard University, Cambridge, MA, USA. 5Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA, USA. 6Catalysis and Peptide Research Unit, School of Health Sciences, University of KwaZulu Natal, Durban 4001, South Africa. 7Center for Personalized Medicine, Roswell Park Comprehensive Cancer Cen- ter, Buffalo, New York, USA. 8Aix Marseille Univ, CNRS, INSERM, Institut Paoli-Calmettes, CRCM, Equipe labellisée Ligue ‘Cell polarity, Cell signaling and Cancer, Marseille, France. 9Laboratory of Cellular and Molecular Epigenetics, Cancer Unit, GIGA Institute, University of Liege, Liege, Belgium. 10Department of Human Genetics, KU Leuven, Belgium.
    [Show full text]
  • LNX1/LNX2 Proteins: Functions in Neuronal Signalling and Beyond
    Neuronal Signaling (2018) 2 NS20170191 https://doi.org/10.1042/NS20170191 Review Article LNX1/LNX2 proteins: functions in neuronal signalling and beyond Paul W. Young School of Biochemistry and Cell Biology, Cork Neuroscience Centre, SynBioCentre, University College Cork, Cork, Ireland Correspondence: Paul W. Young ([email protected]) Ligand of NUMB Protein X1 and X2 (LNX1 and LNX2) are E3 ubiquitin ligases, named for their ability to interact with and promote the degradation of the cell fate determinant protein NUMB. On this basis they are thought to play a role in modulating NUMB/NOTCH signalling during processes such as cortical neurogenesis. However, LNX1/2 proteins can bind, via their four PDZ (PSD95, DLGA, ZO-1) domains, to an extraordinarily large number of other proteins besides NUMB. Many of these interactions suggest additional roles for LNX1/2 proteins in the nervous system in areas such as synapse formation, neurotransmission and regulating neuroglial function. Twenty years on from their initial discovery, I discuss here the putative neuronal functions of LNX1/2 proteins in light of the anxiety-related phenotype of double knockout mice lacking LNX1 and LNX2 in the central nervous system (CNS). I also review what is known about non-neuronal roles of LNX1/2 proteins, including their roles in embryonic patterning and pancreas development in zebrafish and their possible involvement in colorectal cancer (CRC), osteoclast differentiation and immune function in mammals. The emerging picture places LNX1/2 proteins as potential regulators of multiple cellular signalling processes, but in many cases the physiological significance of such roles remains only partly validated and needs to be considered in the context of the tight control of LNX1/2 protein levels in vivo.
    [Show full text]
  • Identification and Functional Annotation of Genes
    animals Article Identification and Functional Annotation of Genes Related to Horses’ Performance: From GWAS to Post-GWAS Thayssa O. Littiere 1 , Gustavo H. F. Castro 1, Maria del Pilar R. Rodriguez 1 , Cristina M. Bonafé 1, Ana F. B. Magalhães 1, Rafael R. Faleiros 2, João I. G. Vieira 1, Cassiane G. Santos 1 and Lucas L. Verardo 1,* 1 Department of Animal Science, Universidade Federal dos Vales do Jequitinhonha e Mucuri, Diamantina 39100-000, Brazil; [email protected] (T.O.L.); [email protected] (G.H.F.C.); [email protected] (M.d.P.R.R.); [email protected] (C.M.B.); [email protected] (A.F.B.M.); [email protected] (J.I.G.V.); [email protected] (C.G.S.) 2 EQUINOVA Research Group, Universidade Federal de Minas Gerais, Belo Horizonte 31270-901, Brazil; [email protected] * Correspondence: [email protected]; Tel.: +55-38-3532-8514 Received: 15 May 2020; Accepted: 8 July 2020; Published: 10 July 2020 Simple Summary: It is assumed that The athletic performance of horses is influenced by a large number of genes; however, to date, not many genomic studies have been performed to identify candidate genes. In this study we performed a systematic review of genome-wide association studies followed by functional analyses aiming to identify The most candidate genes for horse performance. We were successful in identifying 669 candidate genes, from which we built biological process networks. Regulatory elements (transcription factors, TFs) of these genes were identified and used to build a gene–TF network.
    [Show full text]
  • Number of Variants in the Exome Sequence of Patient IV-3 with Allele
    Supplementary material J Med Genet Supplementary Table 1: Number of variants in the exome sequence of patient IV-3 with allele frequency of less than 1% in the public databases: 1000 Genomes, gnomAD and ExAC Browsers and the reason for their negation as the causative mutation. The cause of negation of variants identified by WES Number of variants that were negated Common variants according to our internal laboratory Exome database of 5 the Bedouin population Common variants according to a database of healthy Saudi individuals with 4 LOF in varies genes (Alsalem et al. 2013) Supportive information for negation by low prediction for damage (Omicia score) 8 ( SIFT, PolyPhen, phyloP – Vertebrate, splice prediction) Segregation (the patient IV-9 not presenting variation in homozygosity) 9 Mouse model normal for male fertility ( MGI- Mouse Genome 3 Informatics) Low expression in testis 2 Arafat M, et al. J Med Genet 2020;0:1–10. doi: 10.1136/jmedgenet-2019-106825 Supplementary material J Med Genet Supplementary Table 2: List of variants that were negated by not segregating as expected for a causative mutation in patient IV-9. Positions are according to GRCh37/hg19. Variants identified by WES negated by not segregating as Zygosity in Patient expected for a causative mutation IV-9 1 Chromosome 1:150444609 , c. 3185G>A p. Arg1062His Normal homozygote Regulation Of Nuclear Pre-MRNA Domain Containing 2 (ref allele) (RPRD2) gene. 2 Chromosome 1:156212617, c.168G>A, p. Trp56*, Bone Gamma- Normal homozygote Carboxyglutamate Protein (BGLAP) gene. (ref allele) 3 Chromosome 2:190593090, c. 2975G>A, p. Gly992Glu, Ankyrin Heterozygote And Armadillo Repeat Containing (ANKAR) gene.
    [Show full text]
  • Genomic Regions Associated with Performance in Racing Line of Quarter Horses
    Livestock Science 211 (2018) 42–51 Contents lists available at ScienceDirect Livestock Science journal homepage: www.elsevier.com/locate/livsci Genomic regions associated with performance in racing line of Quarter T Horses ⁎ G.L. Pereiraa, , L.A. Chardulob, J.A.IIV. Silvab, R. Fariaa, R.A. Curib a Department of Animal Science, College of Agriculture and Veterinary Science, São Paulo State University (UNESP), access route Paulo Donato Castellane, 14884-900 Jaboticabal, São Paulo, Brazil b Department of Animal Breeding and Nutrition, College of Veterinary and Animal Science, São Paulo State University (UNESP), Rubião Junior District, 18618-970 Botucatu, São Paulo, Brazil ARTICLE INFO ABSTRACT Keywords: Quarter Horses breed for rancing are able to run short distances faster than any other breed. Although in Brazil Candidate gene the effective number of animals in the racing line is relatively smaller compared to the other lines, its economic Enrichment analysis importance is substantial. Despite economic and scientific interest in this athletic trait, few efforts have been Equine genotyping array made to better understand the genetic and physiological mechanisms underlying this trait. The objective of this Quantitative trait loci study was to perform genome-wide association studies (GWAS) in Quarter Horses of the racing line using equine single nucleotide polymorphism (SNP) genotyping chips for prospecting chromosome regions, genes and poly- morphisms related to maximum speed index. Genotypic and phenotypic data from 305 horses genotyped with the 54 k or 65 k chip were used. Additional 187 not genotyped animal with SI record were added in the study, for a total of 492 animals and 620 horses in the pedigree used for the GWAS analysis GWAS was performed by the single-step genomic best linear unbiased prediction (ssGBLUP) method using two approaches: ssGWAS1 in which only SNP effects are recalculated at each iteration, and ssGWAS2 in which SNP effects are recalculated from updated genomic estimated breeding values (GEBVs) at each iteration.
    [Show full text]
  • Mouse Models of Human Claudin-Associated Disorders: Benefits and Limitations
    International Journal of Molecular Sciences Review Mouse Models of Human Claudin-Associated Disorders: Benefits and Limitations Murat Seker 1 , Cármen Fernández-Rodríguez 2, Luis Alfonso Martínez-Cruz 2 and Dominik Müller 1,* 1 Department of Pediatric Gastroenterology, Nephrology and Metabolism, Charité—Universitätsmedizin Berlin, Charité, 13353 Berlin, Germany; [email protected] 2 ClC BioGUNE, Bizkaia Science and Technology Park, 801A, 48160 Derio, Spain; [email protected] (C.F.-R.); [email protected] (L.A.M.-C.) * Correspondence: [email protected] Received: 15 October 2019; Accepted: 2 November 2019; Published: 5 November 2019 Abstract: In higher organisms, epithelia separate compartments in order to guarantee their proper function. Such structures are able to seal but also to allow substances to pass. Within the paracellular pathway, a supramolecular structure, the tight junction transport is largely controlled by the temporospatial regulation of its major protein family called claudins. Besides the fact that the expression of claudins has been identified in different forms of human diseases like cancer, clearly defined mutations in the corresponding claudin genes have been shown to cause distinct human disorders. Such disorders comprise the skin and its adjacent structures, liver, kidney, the inner ear, and the eye. From the phenotype analysis, it has also become clear that different claudins can cause a complex phenotype when expressed in different organs. To gain deeper insights into the physiology and pathophysiology of claudin-associated disorders, several mouse models have been generated. In order to model human disorders in detail, they have been designed either as full knockouts, knock-downs or knock-ins by a variety of techniques.
    [Show full text]
  • Data-Driven and Knowledge-Driven Computational Models of Angiogenesis in Application to Peripheral Arterial Disease
    DATA-DRIVEN AND KNOWLEDGE-DRIVEN COMPUTATIONAL MODELS OF ANGIOGENESIS IN APPLICATION TO PERIPHERAL ARTERIAL DISEASE by Liang-Hui Chu A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland March, 2015 © 2015 Liang-Hui Chu All Rights Reserved Abstract Angiogenesis, the formation of new blood vessels from pre-existing vessels, is involved in both physiological conditions (e.g. development, wound healing and exercise) and diseases (e.g. cancer, age-related macular degeneration, and ischemic diseases such as coronary artery disease and peripheral arterial disease). Peripheral arterial disease (PAD) affects approximately 8 to 12 million people in United States, especially those over the age of 50 and its prevalence is now comparable to that of coronary artery disease. To date, all clinical trials that includes stimulation of VEGF (vascular endothelial growth factor) and FGF (fibroblast growth factor) have failed. There is an unmet need to find novel genes and drug targets and predict potential therapeutics in PAD. We use the data-driven bioinformatic approach to identify angiogenesis-associated genes and predict new targets and repositioned drugs in PAD. We also formulate a mechanistic three- compartment model that includes the anti-angiogenic isoform VEGF165b. The thesis can serve as a framework for computational and experimental validations of novel drug targets and drugs in PAD. ii Acknowledgements I appreciate my advisor Dr. Aleksander S. Popel to guide my PhD studies for the five years at Johns Hopkins University. I also appreciate several professors on my thesis committee, Dr. Joel S. Bader, Dr.
    [Show full text]