DOCSLIB.ORG

Number of Variants in the Exome Sequence of Patient IV-3 with Allele

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Number of Variants in the Exome Sequence of Patient IV-3 with Allele Supplementary material J Med Genet Supplementary Table 1: Number of variants in the exome sequence of patient IV-3 with allele frequency of less than 1% in the public databases: 1000 Genomes, gnomAD and ExAC Browsers and the reason for their negation as the causative mutation. The cause of negation of variants identified by WES Number of variants that were negated Common variants according to our internal laboratory Exome database of 5 the Bedouin population Common variants according to a database of healthy Saudi individuals with 4 LOF in varies genes (Alsalem et al. 2013) Supportive information for negation by low prediction for damage (Omicia score) 8 ( SIFT, PolyPhen, phyloP – Vertebrate, splice prediction) Segregation (the patient IV-9 not presenting variation in homozygosity) 9 Mouse model normal for male fertility ( MGI- Mouse Genome 3 Informatics) Low expression in testis 2 Arafat M, et al. J Med Genet 2020;0:1–10. doi: 10.1136/jmedgenet-2019-106825 Supplementary material J Med Genet Supplementary Table 2: List of variants that were negated by not segregating as expected for a causative mutation in patient IV-9. Positions are according to GRCh37/hg19. Variants identified by WES negated by not segregating as Zygosity in Patient expected for a causative mutation IV-9 1 Chromosome 1:150444609 , c. 3185G>A p. Arg1062His Normal homozygote Regulation Of Nuclear Pre-MRNA Domain Containing 2 (ref allele) (RPRD2) gene. 2 Chromosome 1:156212617, c.168G>A, p. Trp56*, Bone Gamma- Normal homozygote Carboxyglutamate Protein (BGLAP) gene. (ref allele) 3 Chromosome 2:190593090, c. 2975G>A, p. Gly992Glu, Ankyrin Heterozygote And Armadillo Repeat Containing (ANKAR) gene. 4 Chromosome 2:196822038, c. 3025C>T, p. Arg1009*, Dynein Heterozygote Axonemal Heavy Chain 7 (DNAH7) gene. 5 Chromosome2:197559839, c. 1579A>C, p. Met527Leu, Coiled- Heterozygote Coil Domain Containing 150 (CCDC150) gene. 6 Chromosome 2:203948150, c. 893A>G , p. Tyr298Cys, Heterozygote Neurobeachin Like 1 (NBEAL1) gene. 7 Chromosome 2:204161591, c. 1349C>T , p. Ser450Leu, Cytochrome P450 Family 20 Subfamily A Member 1 (CYP20A1) Heterozygote gene. 8 Chromosome 3:73434914, c. 1541A>G , p. Asp514Gly, PDZ Heterozygote Domain Containing Ring Finger 3 (PDZRN3) gene. 9 Chromosome 15:75651960, c. 1948+1G>A, splice donor, Normal homozygote Mannosidase Alpha Class 2C Member 1 (MAN2C1) gene. (ref allele) Arafat M, et al. J Med Genet 2020;0:1–10. doi: 10.1136/jmedgenet-2019-106825 Supplementary material J Med Genet Supplementary Table 3: Full list of the 31 homozygous variants that were negated and the cause of negation. Scores used to compute the omicia score: MutationTaster, Polyphen-2, SIFT, phyloP – Vertebrate, phyloP – Placental and phyloP – Primate. Variants identified by WES negated by presenting with a frequency of more than 3% in the internal laboratory Exome database of the Bedouin population Frequency in Position internal Bedouin oN Gene Change Effect database (72 dbSNP individuals) missense c. 5050C>G chr1:152189055 100% heterozygotes 1 1 HRNR splice site impact rs4845749 p. Arg1684Gly c. 22.2.% chr1:175129924 in-frame deletion 2 2 KIAA0040 217_225delAAGAAGAAG heterozygotes rs150137790 p. Lys73_Lys75del 45.8% c. 195C>A chr1:175129955 heterozygotes 3 3 KIAA0040 missense rs3208835 8.33% homozygotes p. Asn65Lys ZNF717 chr3:75788152 c. 622A>G missense 36.1% rs76179262 heterozygotes 4 p. Thr208Ala 6.94% chr14:106091355 c. 539A>T heterozygotes 5 IGHG4 missense rs376761875 p. Tyr180Phe 1.38% homozygotes Variants identified by WES negated by presenting with a frequency of more than 2% in the database of healthy Saudi individuals with LOF in the listed genes (Alsalem et al. 2013) Position No Gene Change Effect dbSNP c. 2003C>T chr1:110884030 1 1 RBM15 missense 2.6% heterozygotes rs150900331 p. Ala668Val c. 1703G>C chr1:158639328 2 SPTA1 missense 2.6% heterozygotes rs200829664 p. Arg568Pro Arafat M, et al. J Med Genet 2020;0:1–10. doi: 10.1136/jmedgenet-2019-106825 Supplementary material J Med Genet c. 167A>C chr15:76254253 3 3 NRG4 missense 3.9% heterozygotes rs768230628 p. Gln56Pro c. 2408A>T chr2:167289012 4 SCN7A missense 6.5% heterozygotes rs148715564 p. Asp803Val Supportive information for negating variants identified by WES by low prediction for damage (Omicia score) Omicia Score Position No Gene Change Effect Polyphen SIFT dbSNP 2 2 c. 466C>T 0.472 chr1:117663358 1 1 TRIM45 missense rs139632476 p. His156Tyr 0.5 0.054 c. 1550C>T 0.166 2 TCHHL1* chr1:152058608 missense p. Thr517Ile 0.649 0.271 c. 1103C>T 0.223 chr1:155002634 3 3 DCST2 missense rs138589439 p. Ala368Val 0.288 0.349 c. 4068T>A 0.095 4 4 IQGAP3 chr1:156502807 missense p. Asp1356Glu 0.332 1 c. 380G>A 0.561 chr1:184041317 5 TSEN15 missense rs184488794 p. Arg127Gln 0.011 0.435 c. 3040G>A 0.144 chr2:219508199 6 ZNF142 missense rs201639604 p. Glu1014Lys 0 0.64 c. 979G>T 0.052 7 STOML1 chr15:74277024 missense p. Ala327Ser 0 0.83 c. 438G>C 0.636 chr16:77465249 8 ADAMTS18* missense rs151326659 p. Gln146His 0.197 0.174 c. 252A>T missense 0.056 9 CRYGC chr2:208994165 p. Gln84His splice site impact 0 1 c. 230T>C 0.243 chr14:106552409 10 IGHV3-9 missense rs140101036 p. Ile77Thr - - Variants identified by WES Negated by not being homozygous in patient IV-9 Arafat M, et al. J Med Genet 2020;0:1–10. doi: 10.1136/jmedgenet-2019-106825 Supplementary material J Med Genet Omicia Score Position No Gene Change Effect Polyphen SIFT dbSNP 2 2 c. 3185G>A 0.914 chr1:150444609 1 1 RPRD2 missense rs201638526 p. Arg1062His 0.999 0 c. 168G>A 0.623 chr1:156212617 2 2 BGLAP stop gained rs768282982 p. Trp56* - - c. 2975G>A 0.884 chr2:190593090 3 3 ANKAR missense rs139078107 p. Gly992Glu - 0 c. 3025C>T 0.475 chr2:196822038 4 4 DNAH7 stop gained rs371925699 p. Arg1009* - - c. 1579A>C missense 0.188 chr2:197559839 5 5 CCDC150 rs199761560 p. Met527Leu splice site impact 0.001 0.775 c. 893A>G 0.708 6 NBEAL1 chr2:203948150 missense p. Tyr298Cys 0.911 0 c. 1349C>T 0.336 7 CYP20A1 chr2:204161591 missense p. Ser450Leu 0.229 0.008 c. 1541A>G 0.896 chr3:73434914 8 PDZRN3 missense rs763924260 p. Asp514Gly 0.973 0.003 splice donor 0.584 9 9 MAN2C1 chr15:75651960 c. 1948+1G>A splice site impact - - Variants identified by WES negated by the Mouse model presenting with normal male fertility ( MGI- Mouse Genome Informatics Omicia Score Position No Gene Change Effect Polyphen SIFT dbSNP 2 2 c. 188C>G 0.421 chr1:146057424 1 1 NBPF11 missense rs781994456 p. Ser63Cys - - 0.8 c. -478_- 2 2 FAM78B chr1:166136070 splice donor 472+17delGGGGC... - - Arafat M, et al. J Med Genet 2020;0:1–10. doi: 10.1136/jmedgenet-2019-106825 Supplementary material J Med Genet PMS1 0.252 3 3 chr2:190670372 c. 316-6 C>A splice region - - *Low expression in testis Reference: Alsalem AB, Halees AS, Anazi S, Alshamekh S, Alkuraya FS. Autozygome sequencing expands the horizon of human knockout research and provides novel insights into human phenotypic variation. PLoS Genet 2013;9:e1004030. Arafat M, et al. J Med Genet 2020;0:1–10. doi: 10.1136/jmedgenet-2019-106825.
Load more

Recommended publications
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name E3 ubiquitin-protein ligase PDZRN3 Gene Symbol Pdzrn3 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.3111 Ensembl Gene ID ENSRNOG00000005632 Entrez Gene ID 312607 Assay Information Unique Assay ID qRnoCIP0047702 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000039201 Amplicon Context Sequence CAAAGATTCCTTCACTGGAGGATCCATCTTGATTGTCCACACAGGGCCGGCCAC CAATGATATTGAATCCCAGGGAGCCAGAGTCCCGATGCAGGACAAGAGTCACAC TTTTGGTCTCTTC Amplicon Length (bp) 91 Chromosome Location 4:198408551-198415479 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 90 R2 0.9995 cDNA Cq 23.15 cDNA Tm (Celsius) 83.5 gDNA Cq 42.04 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Pdzrn3, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Trajectory and Uniqueness of Mutational Signatures in Yeast Mutators
    Trajectory and uniqueness of mutational signatures in yeast mutators Sophie Loeilleta,b, Mareike Herzogc, Fabio Pudduc, Patricia Legoixd, Sylvain Baulanded, Stephen P. Jacksonc, and Alain G. Nicolasa,b,1 aInstitut Curie, Paris Sciences et Lettres Research University, CNRS, UMR3244, 75248 Paris Cedex 05, France; bSorbonne Universités, Université Pierre et Marie Curie Paris 06, CNRS, UMR3244, 75248 Paris Cedex 05, France; cWellcome/Cancer Research UK Gurdon Institute and Department of Biochemistry, Cambridge CB2 1QN, United Kingdom; and dICGex NGS Platform, Institut Curie, 75248 Paris Cedex 05, France Edited by Richard D. Kolodner, Ludwig Institute for Cancer Research, La Jolla, CA, and approved August 24, 2020 (received for review June 2, 2020) The acquisition of mutations plays critical roles in adaptation, evolution, known (5, 15, 16). Here, we conducted a reciprocal functional ap- senescence, and tumorigenesis. Massive genome sequencing has proach to inactivate one or several genes involved in distinct ge- allowed extraction of specific features of many mutational landscapes nome maintenance processes (replication, repair, recombination, but it remains difficult to retrospectively determine the mechanistic oxidative stress response, or cell-cycle progression) in Saccharomy- origin(s), selective forces, and trajectories of transient or persistent ces cerevisiae diploids, establish the genome-wide mutational land- mutations and genome rearrangements. Here, we conducted a pro- scapes of mutation accumulation (MA) lines, explore the underlying spective reciprocal approach to inactivate 13 single or multiple evolu- mechanisms, and characterize the dynamics of mutation accumu- tionary conserved genes involved in distinct genome maintenance lation (and disappearance) along single-cell bottleneck passages. processes and characterize de novo mutations in 274 diploid Saccharo- myces cerevisiae mutation accumulation lines.
    [Show full text]
  • 3256.Full.Pdf
    Negative epistasis between natural variants of the Saccharomyces cerevisiae MLH1 and PMS1 genes results in a defect in mismatch repair Julie Akiko Heck, Juan Lucas Argueso, Zekeriyya Gemici, Richard Guy Reeves*, Ann Bernard, Charles F. Aquadro, and Eric Alani† Department of Molecular Biology and Genetics, Cornell University, Ithaca, NY 14853 Communicated by Thomas D. Petes, University of North Carolina, Chapel Hill, NC, December 20, 2005 (received for review June 22, 2005) In budding yeast, the MLH1-PMS1 heterodimer is the major MutL The influences of epistatic interactions on a wide variety of homolog complex that acts to repair mismatches arising during traits and processes have garnered increasing attention (14–17). DNA replication. Using a highly sensitive mutator assay, we ob- Few examples, however, have been characterized in molecular served that Saccharomyces cerevisiae strains bearing the S288c- detail. Here we show that the strain-dependent MMR pheno- strain-derived MLH1 gene and the SK1-strain-derived PMS1 gene types observed previously for site-specific mlh1 mutants were displayed elevated mutation rates that conferred a long-term due in part to an underlying defect between wild-type MMR fitness cost. Dissection of this negative epistatic interaction using genes from S288c and SK1. We identified the specific amino acid S288c-SK1 chimeras revealed that a single amino acid polymor- polymorphisms in MLH1 and PMS1, whose combined effect in phism in each gene accounts for this mismatch repair defect. Were hybrid strains leads to an elevation in mutation rate and a these strains to cross in natural populations, segregation of alleles generalized reduction in long-term fitness.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • DF6906-PMS1 Antibody
    Affinity Biosciences website:www.affbiotech.com order:[email protected] PMS1 Antibody Cat.#: DF6906 Concn.: 1mg/ml Mol.Wt.: 106kDa Size: 50ul,100ul,200ul Source: Rabbit Clonality: Polyclonal Application: WB 1:500-1:2000, IHC 1:50-1:200, ELISA(peptide) 1:20000-1:40000 *The optimal dilutions should be determined by the end user. Reactivity: Human,Rat Purification: The antiserum was purified by peptide affinity chromatography using SulfoLink™ Coupling Resin (Thermo Fisher Scientific). Specificity: PMS1 Antibody detects endogenous levels of total PMS1. Immunogen: A synthesized peptide derived from human PMS1, corresponding to a region within the internal amino acids. Uniprot: P54277 Description: PMS1 belongs to the DNA mismatch repair mutL/hexB family. It is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in PMS1 cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other proteins involved in the HNPCC phenotype, which is also known as Lynch syndrome (1). Storage Condition and Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM Buffer: NaCl, 0.02% sodium azide and 50% glycerol.Store at -20 °C.Stable for 12 months from date of receipt. Western blot analysis of Hela whole cell lysates, using PMS1 Antibody. The lane on the left was treated with the antigen- specific peptide. 1 / 2 Affinity Biosciences website:www.affbiotech.com order:[email protected] DF6906 at 1/100 staining Human esophageal cancer by IHC-P. The sample was formaldehyde fixed and a heat mediated antigen retrieval step in citrate buffer was performed.
    [Show full text]
  • Regulation of Neuronal Gene Expression and Survival by Basal NMDA Receptor Activity: a Role for Histone Deacetylase 4
    The Journal of Neuroscience, November 12, 2014 • 34(46):15327–15339 • 15327 Cellular/Molecular Regulation of Neuronal Gene Expression and Survival by Basal NMDA Receptor Activity: A Role for Histone Deacetylase 4 Yelin Chen,1 Yuanyuan Wang,1 Zora Modrusan,3 Morgan Sheng,1 and Joshua S. Kaminker1,2 Departments of 1Neuroscience, 2Bioinformatics and Computational Biology, and 3Molecular Biology, Genentech Inc., South San Francisco, California 94080 Neuronal gene expression is modulated by activity via calcium-permeable receptors such as NMDA receptors (NMDARs). While gene expression changes downstream of evoked NMDAR activity have been well studied, much less is known about gene expression changes that occur under conditions of basal neuronal activity. In mouse dissociated hippocampal neuronal cultures, we found that a broad NMDAR antagonist, AP5, induced robust gene expression changes under basal activity, but subtype-specific antagonists did not. While some of the gene expression changes are also known to be downstream of stimulated NMDAR activity, others appear specific to basal NMDARactivity.ThegenesalteredbyAP5treatmentofbasalcultureswereenrichedforpathwaysrelatedtoclassIIahistonedeacetylases (HDACs), apoptosis, and synapse-related signaling. Specifically, AP5 altered the expression of all three class IIa HDACs that are highly expressed in the brain, HDAC4, HDAC5, and HDAC9, and also induced nuclear accumulation of HDAC4. HDAC4 knockdown abolished a subset of the gene expression changes induced by AP5, and led to neuronal death under
    [Show full text]
  • Negative Epistasis Between Natural Variants of the Saccharomyces Cerevisiae MLH1 and PMS1 Genes Results in a Defect in Mismatch Repair
    Negative epistasis between natural variants of the Saccharomyces cerevisiae MLH1 and PMS1 genes results in a defect in mismatch repair Julie Akiko Heck, Juan Lucas Argueso, Zekeriyya Gemici, Richard Guy Reeves*, Ann Bernard, Charles F. Aquadro, and Eric Alani† Department of Molecular Biology and Genetics, Cornell University, Ithaca, NY 14853 Communicated by Thomas D. Petes, University of North Carolina, Chapel Hill, NC, December 20, 2005 (received for review June 22, 2005) In budding yeast, the MLH1-PMS1 heterodimer is the major MutL The influences of epistatic interactions on a wide variety of homolog complex that acts to repair mismatches arising during traits and processes have garnered increasing attention (14–17). DNA replication. Using a highly sensitive mutator assay, we ob- Few examples, however, have been characterized in molecular served that Saccharomyces cerevisiae strains bearing the S288c- detail. Here we show that the strain-dependent MMR pheno- strain-derived MLH1 gene and the SK1-strain-derived PMS1 gene types observed previously for site-specific mlh1 mutants were displayed elevated mutation rates that conferred a long-term due in part to an underlying defect between wild-type MMR fitness cost. Dissection of this negative epistatic interaction using genes from S288c and SK1. We identified the specific amino acid S288c-SK1 chimeras revealed that a single amino acid polymor- polymorphisms in MLH1 and PMS1, whose combined effect in phism in each gene accounts for this mismatch repair defect. Were hybrid strains leads to an elevation in mutation rate and a these strains to cross in natural populations, segregation of alleles generalized reduction in long-term fitness.
    [Show full text]
  • University of Alberta
    University of Alberta Tripartite-motif family members in the White Pekin duck (Anas platyrhynchos) modulate antiviral gene expression by Alysson Heather Blaine A thesis submitted to the Faculty of Graduate Studies and Research in partial fulfillment of the requirements for the degree of Master of Science in Physiology, Cell and Developmental Biology Biological Sciences ©Alysson Heather Blaine Fall 2013 Edmonton, Alberta Permission is hereby granted to the University of Alberta Libraries to reproduce single copies of this thesis and to lend or sell such copies for private, scholarly or scientific research purposes only. Where the thesis is converted to, or otherwise made available in digital form, the University of Alberta will advise potential users of the thesis of these terms. The author reserves all other publication and other rights in association with the copyright in the thesis and, except as herein before provided, neither the thesis nor any substantial portion thereof may be printed or otherwise reproduced in any material form whatsoever without the author's prior written permission. Abstract Wild waterfowl, including mallard ducks, are the natural reservoir of avian influenza A virus and are resistant to highly pathogenic strains. This is primarily due to the robust innate immune response of ducks. Shortly after exposure to both highly pathogenic (A/Viet Nam/1203/04 (H5N1)) and low pathogenic (A/mallard/BC/500/05 (H5N2)) avian influenza, many immune genes are upregulated including members of the diverse tripartite-motif (TRIM) family. TRIM proteins have species-specific antiviral roles in a variety of viral infections. I have identified a contig of TRIM genes located adjacent to the MHC locus in the White Pekin duck (Anas platyrhynchos) genome.
    [Show full text]
  • PMS2 Antibody / PMS1 Homolog 2 (RQ4366)
    PMS2 Antibody / PMS1 homolog 2 (RQ4366) Catalog No. Formulation Size RQ4366 0.5mg/ml if reconstituted with 0.2ml sterile DI water 100 ug Bulk quote request Availability 1-3 business days Species Reactivity Human Format Antigen affinity purified Clonality Polyclonal (rabbit origin) Isotype Rabbit IgG Purity Antigen affinity purified Buffer Lyophilized from 1X PBS with 2% Trehalose and 0.025% sodium azide UniProt P54278 Localization Nucleus Applications Western blot : 0.5-1ug/ml Direct ELISA : 0.1-0.5ug/ml Limitations This PMS2 antibody is available for research use only. Western blot testing of human HeLa cell lysate with BCMA antibody at 0.5ug/ml. Expected molecular weight: 96-110 kDa. Description Mismatch repair endonuclease PMS2 is an enzyme that in humans is encoded by the PMS2 gene. The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome.
    [Show full text]
  • Pdzrn3 Is Required for Pronephros Morphogenesis in Xenopus Laevis SILVIA MARRACCI, ALBERTO VANGELISTI, VITTORIA RAFFA, MASSIMILIANO ANDREAZZOLI and LUCIANA DENTE*
    Int. J. Dev. Biol. 60: 57-63 (2016) doi: 10.1387/ijdb.150381ld www.intjdevbiol.com pdzrn3 is required for pronephros morphogenesis in Xenopus laevis SILVIA MARRACCI, ALBERTO VANGELISTI, VITTORIA RAFFA, MASSIMILIANO ANDREAZZOLI and LUCIANA DENTE* Laboratory of Cell and Developmental Biology, Dept. of Biology, University of Pisa, Pisa, Italy ABSTRACT Pdzrn3, a multidomain protein with E3-ubiquitin ligase activity, has been reported to play a role in myoblast and osteoblast differentiation and, more recently, in neuronal and endo- thelial cell development. The expression of the pdzrn3 gene is developmentally regulated in vari- ous vertebrate tissues, including muscular, neural and vascular system. Little is known about its expression during kidney development, although genetic polymorphisms and alterations around the human pdzrn3 chromosomal region have been found to be associated with renal cell carcino- mas and other kidney diseases. We investigated the pdzrn3 spatio-temporal expression pattern in Xenopus laevis embryos by in situ hybridization. We focused our study on the development of the pronephros, which is the embryonic amphibian kidney, functionally similar to the most primitive nephric structures of human kidney. To explore the role of pdzrn3 during renal morphogenesis, we performed loss-of-function experiments, through antisense morpholino injections and analysed the morphants using specific pronephric markers. Dynamic pdzrn3 expression was observed in embryonic tissues, such as somites, brain, eye, blood islands, heart, liver and pronephros. Loss of function experiments resulted in specific alterations of pronephros development. In particular, at early stages, pdzrn3 depletion was associated with a reduction of the pronephros anlagen and later, with perturbations of the tubulogenesis, including deformation of the proximal tubules.
    [Show full text]