Role of PDZ-Binding Motif from West Nile Virus NS5 Protein on Viral
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Systematic Screening for Potential Therapeutic Targets in Osteosarcoma Through a Kinome-Wide CRISPR-Cas9 Library
Cancer Biol Med 2020. doi: 10.20892/j.issn.2095-3941.2020.0162 ORIGINAL ARTICLE Systematic screening for potential therapeutic targets in osteosarcoma through a kinome-wide CRISPR-Cas9 library Yuanzhong Wu*, Liwen Zhou*, Zifeng Wang, Xin Wang, Ruhua Zhang, Lisi Zheng, Tiebang Kang Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou 510060, China ABSTRACT Objective: Osteosarcoma is the most common primary malignant bone tumor. However, the survival of patients with osteosarcoma has remained unchanged during the past 30 years, owing to a lack of efficient therapeutic targets. Methods: We constructed a kinome-targeting CRISPR-Cas9 library containing 507 kinases and 100 nontargeting controls and screened the potential kinase targets in osteosarcoma. The CRISPR screening sequencing data were analyzed with the Model-based Analysis of Genome-wide CRISPR/Cas9 Knockout (MAGeCK) Python package. The functional data were applied in the 143B cell line through lenti-CRISPR-mediated gene knockout. The clinical significance of kinases in the survival of patients with osteosarcoma was analyzed in the R2: Genomics Analysis and Visualization Platform. Results: We identified 53 potential kinase targets in osteosarcoma. Among these targets, we analyzed 3 kinases, TRRAP, PKMYT1, and TP53RK, to validate their oncogenic functions in osteosarcoma. PKMYT1 and TP53RK showed higher expression in osteosarcoma than in normal bone tissue, whereas TRRAP showed no significant difference. High expression of all 3 kinases was associated with relatively poor prognosis in patients with osteosarcoma. Conclusions: Our results not only offer potential therapeutic kinase targets in osteosarcoma but also provide a paradigm for functional genetic screening by using a CRISPR-Cas9 library, including target design, library construction, screening workflow, data analysis, and functional validation. -
Transcriptome Analyses of Rhesus Monkey Pre-Implantation Embryos Reveal A
Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Transcriptome analyses of rhesus monkey pre-implantation embryos reveal a reduced capacity for DNA double strand break (DSB) repair in primate oocytes and early embryos Xinyi Wang 1,3,4,5*, Denghui Liu 2,4*, Dajian He 1,3,4,5, Shengbao Suo 2,4, Xian Xia 2,4, Xiechao He1,3,6, Jing-Dong J. Han2#, Ping Zheng1,3,6# Running title: reduced DNA DSB repair in monkey early embryos Affiliations: 1 State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 2 Key Laboratory of Computational Biology, CAS Center for Excellence in Molecular Cell Science, Collaborative Innovation Center for Genetics and Developmental Biology, Chinese Academy of Sciences-Max Planck Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China 3 Yunnan Key Laboratory of Animal Reproduction, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 4 University of Chinese Academy of Sciences, Beijing, China 5 Kunming College of Life Science, University of Chinese Academy of Sciences, Kunming, Yunnan 650204, China 6 Primate Research Center, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, China * Xinyi Wang and Denghui Liu contributed equally to this work 1 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press # Correspondence: Jing-Dong J. Han, Email: [email protected]; Ping Zheng, Email: [email protected] Key words: rhesus monkey, pre-implantation embryo, DNA damage 2 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press ABSTRACT Pre-implantation embryogenesis encompasses several critical events including genome reprogramming, zygotic genome activation (ZGA) and cell fate commitment. -
Download Validation Data
PrimePCR™Assay Validation Report Gene Information Gene Name E3 ubiquitin-protein ligase PDZRN3 Gene Symbol Pdzrn3 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.3111 Ensembl Gene ID ENSRNOG00000005632 Entrez Gene ID 312607 Assay Information Unique Assay ID qRnoCIP0047702 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000039201 Amplicon Context Sequence CAAAGATTCCTTCACTGGAGGATCCATCTTGATTGTCCACACAGGGCCGGCCAC CAATGATATTGAATCCCAGGGAGCCAGAGTCCCGATGCAGGACAAGAGTCACAC TTTTGGTCTCTTC Amplicon Length (bp) 91 Chromosome Location 4:198408551-198415479 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 90 R2 0.9995 cDNA Cq 23.15 cDNA Tm (Celsius) 83.5 gDNA Cq 42.04 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Pdzrn3, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
The Biomarkers of Key Mirnas and Target Genes Associated with Acute Myocardial Infarction
The biomarkers of key miRNAs and target genes associated with acute myocardial infarction Qi Wang1, Bingyan Liu2,3, Yuanyong Wang4, Baochen Bai1, Tao Yu3 and Xian–ming Chu1,5 1 Department of Cardiology, The Affiliated hospital of Qingdao University, Qingdao, China 2 School of Basic Medicine, Qingdao University, Qingdao, China 3 Institute for Translational Medicine, Qingdao University, Qingdao, China 4 Department of Thoracic Surgery, Affiliated Hospital of Qingdao University, Qingdao, China 5 Department of Cardiology, The Affiliated Cardiovascular Hospital of Qingdao University, Qingdao, China ABSTRACT Background. Acute myocardial infarction (AMI) is considered one of the most prominent causes of death from cardiovascular disease worldwide. Knowledge of the molecular mechanisms underlying AMI remains limited. Accurate biomarkers are needed to predict the risk of AMI and would be beneficial for managing the incidence rate. The gold standard for the diagnosis of AMI, the cardiac troponin T (cTnT) assay, requires serial testing, and the timing of measurement with respect to symptoms affects the results. As attractive candidate diagnostic biomarkers in AMI, circulating microRNAs (miRNAs) are easily detectable, generally stable and tissue specific. Methods. The Gene Expression Omnibus (GEO) database was used to compare miRNA expression between AMI and control samples, and the interactions between miRNAs and mRNAs were analysed for expression and function. Furthermore, a protein-protein interaction (PPI) network was constructed. The miRNAs identified in the bioinformatic analysis were verified by RT-qPCR in an H9C2 cell line. The miRNAs in plasma samples from patients with AMI (n D 11) and healthy controls (n D 11) were used to construct Submitted 23 December 2019 receiver operating characteristic (ROC) curves to evaluate the clinical prognostic value Accepted 14 April 2020 of the identified miRNAs. -
Circular RNA Hsa Circ 0005114‑Mir‑142‑3P/Mir‑590‑5P‑ Adenomatous
ONCOLOGY LETTERS 21: 58, 2021 Circular RNA hsa_circ_0005114‑miR‑142‑3p/miR‑590‑5p‑ adenomatous polyposis coli protein axis as a potential target for treatment of glioma BO WEI1*, LE WANG2* and JINGWEI ZHAO1 1Department of Neurosurgery, China‑Japan Union Hospital of Jilin University, Changchun, Jilin 130033; 2Department of Ophthalmology, The First Hospital of Jilin University, Jilin University, Changchun, Jilin 130021, P.R. China Received September 12, 2019; Accepted October 22, 2020 DOI: 10.3892/ol.2020.12320 Abstract. Glioma is the most common type of brain tumor APC expression with a good overall survival rate. UALCAN and is associated with a high mortality rate. Despite recent analysis using TCGA data of glioblastoma multiforme and the advances in treatment options, the overall prognosis in patients GSE25632 and GSE103229 microarray datasets showed that with glioma remains poor. Studies have suggested that circular hsa‑miR‑142‑3p/hsa‑miR‑590‑5p was upregulated and APC (circ)RNAs serve important roles in the development and was downregulated. Thus, hsa‑miR‑142‑3p/hsa‑miR‑590‑5p‑ progression of glioma and may have potential as therapeutic APC‑related circ/ceRNA axes may be important in glioma, targets. However, the expression profiles of circRNAs and their and hsa_circ_0005114 interacted with both of these miRNAs. functions in glioma have rarely been studied. The present study Functional analysis showed that hsa_circ_0005114 was aimed to screen differentially expressed circRNAs (DECs) involved in insulin secretion, while APC was associated with between glioma and normal brain tissues using sequencing the Wnt signaling pathway. In conclusion, hsa_circ_0005114‑ data collected from the Gene Expression Omnibus database miR‑142‑3p/miR‑590‑5p‑APC ceRNA axes may be potential (GSE86202 and GSE92322 datasets) and explain their mecha‑ targets for the treatment of glioma. -
Blood-Based Biomarkers for Predicting the Risk for Five-Year Incident Coronary Heart Disease in the Framingham Heart Study Via Machine Learning
G C A T T A C G G C A T genes Article Blood-Based Biomarkers for Predicting the Risk for Five-Year Incident Coronary Heart Disease in the Framingham Heart Study via Machine Learning Meeshanthini V. Dogan 1,2,3,*, Steven R. H. Beach 4, Ronald L. Simons 5, Amaury Lendasse 6,7, Brandan Penaluna 8 and Robert A. Philibert 1,2,3,8 1 Department of Biomedical Engineering, University of Iowa, Iowa City, IA 52242, USA; [email protected] 2 Cardio Diagnostics LLC, 2500 Crosspark Road, Coralville, IA 52241, USA 3 Department of Psychiatry, University of Iowa, Iowa City, IA 52242, USA 4 Department of Psychology, University of Georgia, Athens, GA 30602, USA; [email protected] 5 Department of Sociology, University of Georgia, Athens, GA 30606, USA; [email protected] 6 Information and Logistics Technology Department, University of Houston, Houston, TX 77004, USA; [email protected] 7 Department of Business Management and Analytics, Arcada University of Applied Sciences, 00560 Helsinki, Finland 8 Behavioral Diagnostics LLC, 2500 Crosspark Road, Coralville, IA 52241, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-319-353-4986 Received: 15 November 2018; Accepted: 12 December 2018; Published: 18 December 2018 Abstract: An improved approach for predicting the risk for incident coronary heart disease (CHD) could lead to substantial improvements in cardiovascular health. Previously, we have shown that genetic and epigenetic loci could predict CHD status more sensitively than conventional risk factors. Herein, we examine whether similar machine learning approaches could be used to develop a similar panel for predicting incident CHD. -
Downloaded from [266]
Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes. -
Orally Administered Glucosylceramide Improves the Skin Barrier Function by Upregulating Genes Associated with the Tight Junction and Cornified Envelope Formation
110215 (251) Biosci. Biotechnol. Biochem., 75 (8), 110215-1–8, 2011 Orally Administered Glucosylceramide Improves the Skin Barrier Function by Upregulating Genes Associated with the Tight Junction and Cornified Envelope Formation y Ritsuro IDETA, Tomohiro SAKUTA, Yusuke NAKANO, and Taro UCHIYAMA Shiseido Functional Food Research and Development Center, 2-12-1 Fukuura, Kanazawa-ku, Yokohama 236-8643, Japan Received March 18, 2011; Accepted May 9, 2011; Online Publication, August 7, 2011 [doi:10.1271/bbb.110215] Dietary glucosylceramide improves the skin barrier mammalian skin barrier function through their role as function. We used a microarray system to analyze the intracellular lipids.6) The skin barrier is essential for mRNA expression in SDS-treated dorsal skin of the protecting against physical stimuli, thermal challenge, hairless mouse to elucidate the molecular mechanisms ultraviolet light (UV), chemical substances and micro- involved. The transepidermal water loss of mouse skin organisms, as well as for preventing water loss.7) The was increased by the SDS treatment, this increase being barrier function is mainly localized in the stratum significantly reduced by a prior oral administration of corneum (SC) which is formed in the outermost layer of glucosylceramides. The microarray-evaluated mRNA the epidermis and consists of the cornified envelope expressionAdvance ratio showed a statistically significant View in- (CE) and intercellular multilamellar lipids. CE forms crease in the expression of genes related to the cornified a highly durable and flexible barrier8) comprising a envelope and tight junction formation when compared 15-nm-thick structure composed of such insoluble with all genes in the glucosylceramide-fed/SDS-treated proteins as involucrin, loricrin, and small proline-rich mouse skin. -
Profiling Data
Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8 -
Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia. -
1 Supporting Information for a Microrna Network Regulates
Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.