Mouse Models of Human Claudin-Associated Disorders: Benefits and Limitations
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Comparative Transcriptome Analyses Indicate Molecular Homology of Zebrafish Swimbladder and Mammalian Lung
Comparative Transcriptome Analyses Indicate Molecular Homology of Zebrafish Swimbladder and Mammalian Lung Weiling Zheng1, Zhengyuan Wang1, John E. Collins2, Robert M. Andrews2, Derek Stemple2, Zhiyuan Gong1* 1 Department of Biological Sciences, National University of Singapore, Singapore, Singapore, 2 Vertebrate Development and Genetics, Wellcome Trust Genome Campus, Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom Abstract The fish swimbladder is a unique organ in vertebrate evolution and it functions for regulating buoyancy in most teleost species. It has long been postulated as a homolog of the tetrapod lung, but the molecular evidence is scarce. In order to understand the molecular function of swimbladder as well as its relationship with lungs in tetrapods, transcriptomic analyses of zebrafish swimbladder were carried out by RNA-seq. Gene ontology classification showed that genes in cytoskeleton and endoplasmic reticulum were enriched in the swimbladder. Further analyses depicted gene sets and pathways closely related to cytoskeleton constitution and regulation, cell adhesion, and extracellular matrix. Several prominent transcription factor genes in the swimbladder including hoxc4a, hoxc6a, hoxc8a and foxf1 were identified and their expressions in developing swimbladder during embryogenesis were confirmed. By comparison of enriched transcripts in the swimbladder with those in human and mouse lungs, we established the resemblance of transcriptome of the zebrafish swimbladder and mammalian lungs. Based on the transcriptomic data of zebrafish swimbladder, the predominant functions of swimbladder are in its epithelial and muscular tissues. Our comparative analyses also provide molecular evidence of the relatedness of the fish swimbladder and mammalian lung. Citation: Zheng W, Wang Z, Collins JE, Andrews RM, Stemple D, et al. -
HHS Public Access Author Manuscript
HHS Public Access Author manuscript Author Manuscript Author ManuscriptNat Genet Author Manuscript. Author manuscript; Author Manuscript available in PMC 2013 June 01. Published in final edited form as: Nat Genet. 2012 December ; 44(12): 1349–1354. doi:10.1038/ng.2466. Common genetic variants in the CLDN2 and PRSS1-PRSS2 loci alter risk for alcohol-related and sporadic pancreatitis A full list of authors and affiliations appears at the end of the article. Abstract Pancreatitis is a complex, progressively destructive inflammatory disorder. Alcohol was long thought to be the primary causative agent, but genetic contributions have been of interest since the discovery that rare PRSS1, CFTR, and SPINK1 variants were associated with pancreatitis risk. We now report two significant genome-wide associations identified and replicated at PRSS1-PRSS2 (1×10-12) and x-linked CLDN2 (p < 1×10-21) through a two-stage genome-wide study (Stage 1, 676 cases and 4507 controls; Stage 2, 910 cases and 4170 controls). The PRSS1 variant affects susceptibility by altering expression of the primary trypsinogen gene. The CLDN2 risk allele is associated with atypical localization of claudin-2 in pancreatic acinar cells. The homozygous (or hemizygous male) CLDN2 genotype confers the greatest risk, and its alleles interact with alcohol consumption to amplify risk. These results could partially explain the high frequency of alcohol- related pancreatitis in men – male hemizygous frequency is 0.26, female homozygote is 0.07. The exocrine pancreas is a simple digestive gland of only two primary cell types, each with a single function (Supplementary Figure 1). Recurrent acute pancreatic inflammation can, but does not always, progress to irreversible damage of the gland, including fibrosis, atrophy, pain, and exocrine and endocrine insufficiency,1-3 known as chronic pancreatitis Different genetic and environmental factors produce the same clinical phenotype4. -
Genome Wide Association Study of Response to Interval and Continuous Exercise Training: the Predict‑HIIT Study Camilla J
Williams et al. J Biomed Sci (2021) 28:37 https://doi.org/10.1186/s12929-021-00733-7 RESEARCH Open Access Genome wide association study of response to interval and continuous exercise training: the Predict-HIIT study Camilla J. Williams1†, Zhixiu Li2†, Nicholas Harvey3,4†, Rodney A. Lea4, Brendon J. Gurd5, Jacob T. Bonafglia5, Ioannis Papadimitriou6, Macsue Jacques6, Ilaria Croci1,7,20, Dorthe Stensvold7, Ulrik Wislof1,7, Jenna L. Taylor1, Trishan Gajanand1, Emily R. Cox1, Joyce S. Ramos1,8, Robert G. Fassett1, Jonathan P. Little9, Monique E. Francois9, Christopher M. Hearon Jr10, Satyam Sarma10, Sylvan L. J. E. Janssen10,11, Emeline M. Van Craenenbroeck12, Paul Beckers12, Véronique A. Cornelissen13, Erin J. Howden14, Shelley E. Keating1, Xu Yan6,15, David J. Bishop6,16, Anja Bye7,17, Larisa M. Haupt4, Lyn R. Grifths4, Kevin J. Ashton3, Matthew A. Brown18, Luciana Torquati19, Nir Eynon6 and Jef S. Coombes1* Abstract Background: Low cardiorespiratory ftness (V̇O2peak) is highly associated with chronic disease and mortality from all causes. Whilst exercise training is recommended in health guidelines to improve V̇O2peak, there is considerable inter-individual variability in the V̇O2peak response to the same dose of exercise. Understanding how genetic factors contribute to V̇O2peak training response may improve personalisation of exercise programs. The aim of this study was to identify genetic variants that are associated with the magnitude of V̇O2peak response following exercise training. Methods: Participant change in objectively measured V̇O2peak from 18 diferent interventions was obtained from a multi-centre study (Predict-HIIT). A genome-wide association study was completed (n 507), and a polygenic predictor score (PPS) was developed using alleles from single nucleotide polymorphisms= (SNPs) signifcantly associ- –5 ated (P < 1 10 ) with the magnitude of V̇O2peak response. -
Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R. -
Download Validation Data
PrimePCR™Assay Validation Report Gene Information Gene Name E3 ubiquitin-protein ligase PDZRN3 Gene Symbol Pdzrn3 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.3111 Ensembl Gene ID ENSRNOG00000005632 Entrez Gene ID 312607 Assay Information Unique Assay ID qRnoCIP0047702 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000039201 Amplicon Context Sequence CAAAGATTCCTTCACTGGAGGATCCATCTTGATTGTCCACACAGGGCCGGCCAC CAATGATATTGAATCCCAGGGAGCCAGAGTCCCGATGCAGGACAAGAGTCACAC TTTTGGTCTCTTC Amplicon Length (bp) 91 Chromosome Location 4:198408551-198415479 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 90 R2 0.9995 cDNA Cq 23.15 cDNA Tm (Celsius) 83.5 gDNA Cq 42.04 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Pdzrn3, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
New PDF Document
888.267.4436 [email protected] www.origene.com Name:CLDN6 mouse monoclonal antibody, clone OTI3E3 (formerly 3E3) Catalog: TA507011 Product Data Sheet - TRUEMAB Components: • CLDN6 mouse monoclonal antibody, clone OTI3E3 (formerly 3E3) (TA507011) • WB positive control also available: 20ug myc-DDK tagged CLDN6 HEK293T over-expression lysate lyophilized in RIPA buffer (LC412034). (Reconstitute into 20ul of 1x SDS sample buffer before loading; load 5ul per lane as WB control or as desired) Amount: 100ul Immunogen: Full length human recombinant protein of human CLDN6(NP_067018) produced in HEK293T cell. Host: Mouse Isotype: IgG1 Species Reactivity: Human Guaranteed WB, IF Applications: Suggested WB 1:1000, IF 1:100, Dilutions: Concentration: 1 mg/ml Buffer: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Purification: Purified from mouse ascites fluids by affinity chromatography Storage Condition: Shipped at -20C or with ice packs. Upon delivery store at -20C. Dilute in PBS (pH7.3) if necessary. Stable for 12 months from date of receipt. Avoid repeated freeze-thaws. Target Target Name: Homo sapiens claudin 6 (CLDN6) Alternative Name: OTTHUMP00000159248; claudin 6 Database Link: NP_067018 Entrez Gene 9074 Human Function: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. This gene encodes a component of tight junction strands, which This product is to be used for laboratory only. -
A Gene Expression Resource Generated by Genome-Wide Lacz
© 2015. Published by The Company of Biologists Ltd | Disease Models & Mechanisms (2015) 8, 1467-1478 doi:10.1242/dmm.021238 RESOURCE ARTICLE A gene expression resource generated by genome-wide lacZ profiling in the mouse Elizabeth Tuck1,**, Jeanne Estabel1,*,**, Anika Oellrich1, Anna Karin Maguire1, Hibret A. Adissu2, Luke Souter1, Emma Siragher1, Charlotte Lillistone1, Angela L. Green1, Hannah Wardle-Jones1, Damian M. Carragher1,‡, Natasha A. Karp1, Damian Smedley1, Niels C. Adams1,§, Sanger Institute Mouse Genetics Project1,‡‡, James N. Bussell1, David J. Adams1, Ramiro Ramırez-Soliś 1, Karen P. Steel1,¶, Antonella Galli1 and Jacqueline K. White1,§§ ABSTRACT composite of RNA-based expression data sets. Strong agreement was observed, indicating a high degree of specificity in our data. Knowledge of the expression profile of a gene is a critical piece of Furthermore, there were 1207 observations of expression of a information required to build an understanding of the normal and particular gene in an anatomical structure where Bgee had no essential functions of that gene and any role it may play in the data, indicating a large amount of novelty in our data set. development or progression of disease. High-throughput, large- Examples of expression data corroborating and extending scale efforts are on-going internationally to characterise reporter- genotype-phenotype associations and supporting disease gene tagged knockout mouse lines. As part of that effort, we report an candidacy are presented to demonstrate the potential of this open access adult mouse expression resource, in which the powerful resource. expression profile of 424 genes has been assessed in up to 47 different organs, tissues and sub-structures using a lacZ reporter KEY WORDS: Gene expression, lacZ reporter, Mouse, Resource gene. -
Structural Basis for Disruption of Claudin Assembly in Tight Junctions
www.nature.com/scientificreports OPEN Structural basis for disruption of claudin assembly in tight junctions by an enterotoxin Received: 11 May 2016 Takehiro Shinoda1,2, Naoko Shinya1,2, Kaori Ito1,2, Noboru Ohsawa1,2, Takaho Terada1,3, Accepted: 01 September 2016 Kunio Hirata4, Yoshiaki Kawano4, Masaki Yamamoto4, Tomomi Kimura-Someya1,2, Published: 20 September 2016 Shigeyuki Yokoyama1,3 & Mikako Shirouzu1,2 The food-poisoning bacterium Clostridium perfringens produces an enterotoxin (~35 kDa) that specifically targets human claudin-4, among the 26 human claudin proteins, and causes diarrhea by fluid accumulation in the intestinal cavity. The C-terminal domain of the Clostridium perfringens enterotoxin (C-CPE, ~15 kDa) binds tightly to claudin-4, and disrupts the intestinal tight junction barriers. In this study, we determined the 3.5-Å resolution crystal structure of the cell-free synthesized human claudin- 4•C-CPE complex, which is significantly different from the structure of the off-target complex of an engineered C-CPE with mouse claudin-19. The claudin-4•C-CPE complex structure demonstrated the mechanism underlying claudin assembly disruption. A comparison of the present C-CPE-bound structure of claudin-4 with the enterotoxin-free claudin-15 structure revealed sophisticated C-CPE- induced conformation changes of the extracellular segments, induced on the foundation of the rigid four-transmembrane-helix bundle structure. These conformation changes provide a mechanistic model for the disruption of the lateral assembly of claudin molecules. Furthermore, the present novel structural mechanism for selecting a specific member of the claudin family can be used as the foundation to develop novel medically important technologies to selectively regulate the tight junctions formed by claudin family members in different organs. -
XIST-Induced Silencing of Flanking Genes Is Achieved by Additive Action of Repeat a Monomers in Human Somatic Cells
Minks et al. Epigenetics & Chromatin 2013, 6:23 http://www.epigeneticsandchromatin.com/content/6/1/23 RESEARCH Open Access XIST-induced silencing of flanking genes is achieved by additive action of repeat a monomers in human somatic cells Jakub Minks, Sarah EL Baldry, Christine Yang, Allison M Cotton and Carolyn J Brown* Abstract Background: The establishment of facultative heterochromatin by X-chromosome inactivation requires the long non-coding RNA XIST/Xist. However, the molecular mechanism by which the RNA achieves chromosome-wide gene silencing remains unknown. Mouse Xist has been shown to have redundant domains for cis-localization, and requires a series of well-conserved tandem ‘A’ repeats for silencing. We previously described a human inducible XIST transgene that is capable of cis-localization and suppressing a downstream reporter gene in somatic cells, and have now leveraged these cells to dissect the sequences critical for XIST-dependent gene silencing in humans. Results: We demonstrated that expression of the inducible full-length XIST cDNA was able to suppress expression of two nearby reporter genes as well as endogenous genes up to 3 MB from the integration site. An inducible construct containing the repeat A region of XIST alone could silence the flanking reporter genes but not the more distal endogenous genes. Reporter gene silencing could also be accomplished by a synthetic construct consisting of nine copies of a consensus repeat A sequence, consistent with previous studies in mice. Progressively shorter constructs showed a linear relationship between the repeat number and the silencing capacity of the RNA. Constructs containing only two repeat A units were still able to partially silence the reporter genes and could thus be used for site-directed mutagenesis to demonstrate that sequences within the two palindromic cores of the repeat are essential for silencing, and that it is likely the first palindrome sequence folds to form a hairpin, consistent with compensatory mutations observed in eutherian sequences. -
Age-Associated DNA Methylation Changes in Immune Genes, Histone Modifiers and Chromatin Remodeling Factors Within 5 Years After Birth in Human Blood Leukocytes
Age-associated DNA methylation changes in immune genes, histone modifiers and chromatin remodeling factors within 5 years after birth in human blood leukocytes Acevedo, Nathalie; Reinius, Lovisa E; Vitezic, Morana; Fortino, Vittorio; Söderhäll, Cilla; Honkanen, Hanna; Veijola, Riitta; Simell, Olli; Toppari, Jorma; Ilonen, Jorma; Knip, Mikael; Scheynius, Annika; Hyöty, Heikki; Greco, Dario; Kere, Juha Published in: Clinical Epigenetics DOI: 10.1186/s13148-015-0064-6 Publication date: 2015 Document version Publisher's PDF, also known as Version of record Citation for published version (APA): Acevedo, N., Reinius, L. E., Vitezic, M., Fortino, V., Söderhäll, C., Honkanen, H., Veijola, R., Simell, O., Toppari, J., Ilonen, J., Knip, M., Scheynius, A., Hyöty, H., Greco, D., & Kere, J. (2015). Age-associated DNA methylation changes in immune genes, histone modifiers and chromatin remodeling factors within 5 years after birth in human blood leukocytes. Clinical Epigenetics, 7, [34]. https://doi.org/10.1186/s13148-015-0064-6 Download date: 30. Sep. 2021 Acevedo et al. Clinical Epigenetics (2015) 7:34 DOI 10.1186/s13148-015-0064-6 RESEARCH Open Access Age-associated DNA methylation changes in immune genes, histone modifiers and chromatin remodeling factors within 5 years after birth in human blood leukocytes Nathalie Acevedo1,2, Lovisa E Reinius2, Morana Vitezic3, Vittorio Fortino4, Cilla Söderhäll2, Hanna Honkanen5, Riitta Veijola6, Olli Simell7, Jorma Toppari8, Jorma Ilonen9, Mikael Knip10,11,13, Annika Scheynius1, Heikki Hyöty5,12, Dario Greco4 and Juha Kere2,13* Abstract Background: Age-related changes in DNA methylation occurring in blood leukocytes during early childhood may reflect epigenetic maturation. We hypothesized that some of these changes involve gene networks of critical relevance in leukocyte biology and conducted a prospective study to elucidate the dynamics of DNA methylation. -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,