DOCSLIB.ORG

Supplementary Table 1: Number of Variants in the Exome Sequence Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Table 1: Number of Variants in the Exome Sequence Of BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Supplementary Table 1: Number of variants in the exome sequence of patient IV-3 with allele frequency of less than 1% in the public databases: 1000 Genomes, gnomAD and ExAC Browsers and the reason for their negation as the causative mutation. The cause of negation of variants identified by WES Number of variants that were negated Common variants according to our internal laboratory Exome database of 5 the Bedouin population Common variants according to a database of healthy Saudi individuals with 4 LOF in varies genes (Alsalem et al. 2013) Supportive information for negation by low prediction for damage (Omicia score) 8 ( SIFT, PolyPhen, phyloP – Vertebrate, splice prediction) Segregation (the patient IV-9 not presenting variation in homozygosity) 9 Mouse model normal for male fertility ( MGI- Mouse Genome 3 Informatics) Low expression in testis 2 Arafat M, et al. J Med Genet 2021; 58:106–115. doi: 10.1136/jmedgenet-2019-106825 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Supplementary Table 2: List of variants that were negated by not segregating as expected for a causative mutation in patient IV-9. Positions are according to GRCh37/hg19. Variants identified by WES negated by not segregating as Zygosity in Patient expected for a causative mutation IV-9 1 Chromosome 1:150444609 , c. 3185G>A p. Arg1062His Normal homozygote Regulation Of Nuclear Pre-MRNA Domain Containing 2 (ref allele) (RPRD2) gene. 2 Chromosome 1:156212617, c.168G>A, p. Trp56*, Bone Gamma- Normal homozygote Carboxyglutamate Protein (BGLAP) gene. (ref allele) 3 Chromosome 2:190593090, c. 2975G>A, p. Gly992Glu, Ankyrin Heterozygote And Armadillo Repeat Containing (ANKAR) gene. 4 Chromosome 2:196822038, c. 3025C>T, p. Arg1009*, Dynein Heterozygote Axonemal Heavy Chain 7 (DNAH7) gene. 5 Chromosome2:197559839, c. 1579A>C, p. Met527Leu, Coiled- Heterozygote Coil Domain Containing 150 (CCDC150) gene. 6 Chromosome 2:203948150, c. 893A>G , p. Tyr298Cys, Heterozygote Neurobeachin Like 1 (NBEAL1) gene. 7 Chromosome 2:204161591, c. 1349C>T , p. Ser450Leu, Cytochrome P450 Family 20 Subfamily A Member 1 (CYP20A1) Heterozygote gene. 8 Chromosome 3:73434914, c. 1541A>G , p. Asp514Gly, PDZ Heterozygote Domain Containing Ring Finger 3 (PDZRN3) gene. 9 Chromosome 15:75651960, c. 1948+1G>A, splice donor, Normal homozygote Mannosidase Alpha Class 2C Member 1 (MAN2C1) gene. (ref allele) Arafat M, et al. J Med Genet 2021; 58:106–115. doi: 10.1136/jmedgenet-2019-106825 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Supplementary Table 3: Full list of the 31 homozygous variants that were negated and the cause of negation. Scores used to compute the omicia score: MutationTaster, Polyphen-2, SIFT, phyloP – Vertebrate, phyloP – Placental and phyloP – Primate. Variants identified by WES negated by presenting with a frequency of more than 3% in the internal laboratory Exome database of the Bedouin population Frequency in Position internal Bedouin oN Gene Change Effect database (72 dbSNP individuals) missense c. 5050C>G chr1:152189055 100% heterozygotes 1 1 HRNR splice site impact rs4845749 p. Arg1684Gly c. 22.2.% chr1:175129924 in-frame deletion 2 2 KIAA0040 217_225delAAGAAGAAG heterozygotes rs150137790 p. Lys73_Lys75del 45.8% c. 195C>A chr1:175129955 heterozygotes 3 3 KIAA0040 missense rs3208835 8.33% homozygotes p. Asn65Lys ZNF717 chr3:75788152 c. 622A>G missense 36.1% rs76179262 heterozygotes 4 p. Thr208Ala 6.94% chr14:106091355 c. 539A>T heterozygotes 5 IGHG4 missense rs376761875 p. Tyr180Phe 1.38% homozygotes Variants identified by WES negated by presenting with a frequency of more than 2% in the database of healthy Saudi individuals with LOF in the listed genes (Alsalem et al. 2013) Position No Gene Change Effect dbSNP c. 2003C>T chr1:110884030 1 1 RBM15 missense 2.6% heterozygotes rs150900331 p. Ala668Val c. 1703G>C chr1:158639328 2 SPTA1 missense 2.6% heterozygotes rs200829664 p. Arg568Pro Arafat M, et al. J Med Genet 2021; 58:106–115. doi: 10.1136/jmedgenet-2019-106825 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet c. 167A>C chr15:76254253 3 3 NRG4 missense 3.9% heterozygotes rs768230628 p. Gln56Pro c. 2408A>T chr2:167289012 4 SCN7A missense 6.5% heterozygotes rs148715564 p. Asp803Val Supportive information for negating variants identified by WES by low prediction for damage (Omicia score) Omicia Score Position No Gene Change Effect Polyphen SIFT dbSNP 2 2 c. 466C>T 0.472 chr1:117663358 1 1 TRIM45 missense rs139632476 p. His156Tyr 0.5 0.054 c. 1550C>T 0.166 2 TCHHL1* chr1:152058608 missense p. Thr517Ile 0.649 0.271 c. 1103C>T 0.223 chr1:155002634 3 3 DCST2 missense rs138589439 p. Ala368Val 0.288 0.349 c. 4068T>A 0.095 4 4 IQGAP3 chr1:156502807 missense p. Asp1356Glu 0.332 1 c. 380G>A 0.561 chr1:184041317 5 TSEN15 missense rs184488794 p. Arg127Gln 0.011 0.435 c. 3040G>A 0.144 chr2:219508199 6 ZNF142 missense rs201639604 p. Glu1014Lys 0 0.64 c. 979G>T 0.052 7 STOML1 chr15:74277024 missense p. Ala327Ser 0 0.83 c. 438G>C 0.636 chr16:77465249 8 ADAMTS18* missense rs151326659 p. Gln146His 0.197 0.174 c. 252A>T missense 0.056 9 CRYGC chr2:208994165 p. Gln84His splice site impact 0 1 c. 230T>C 0.243 chr14:106552409 10 IGHV3-9 missense rs140101036 p. Ile77Thr - - Variants identified by WES Negated by not being homozygous in patient IV-9 Arafat M, et al. J Med Genet 2021; 58:106–115. doi: 10.1136/jmedgenet-2019-106825 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet Omicia Score Position No Gene Change Effect Polyphen SIFT dbSNP 2 2 c. 3185G>A 0.914 chr1:150444609 1 1 RPRD2 missense rs201638526 p. Arg1062His 0.999 0 c. 168G>A 0.623 chr1:156212617 2 2 BGLAP stop gained rs768282982 p. Trp56* - - c. 2975G>A 0.884 chr2:190593090 3 3 ANKAR missense rs139078107 p. Gly992Glu - 0 c. 3025C>T 0.475 chr2:196822038 4 4 DNAH7 stop gained rs371925699 p. Arg1009* - - c. 1579A>C missense 0.188 chr2:197559839 5 5 CCDC150 rs199761560 p. Met527Leu splice site impact 0.001 0.775 c. 893A>G 0.708 6 NBEAL1 chr2:203948150 missense p. Tyr298Cys 0.911 0 c. 1349C>T 0.336 7 CYP20A1 chr2:204161591 missense p. Ser450Leu 0.229 0.008 c. 1541A>G 0.896 chr3:73434914 8 PDZRN3 missense rs763924260 p. Asp514Gly 0.973 0.003 splice donor 0.584 9 9 MAN2C1 chr15:75651960 c. 1948+1G>A splice site impact - - Variants identified by WES negated by the Mouse model presenting with normal male fertility ( MGI- Mouse Genome Informatics Omicia Score Position No Gene Change Effect Polyphen SIFT dbSNP 2 2 c. 188C>G 0.421 chr1:146057424 1 1 NBPF11 missense rs781994456 p. Ser63Cys - - 0.8 c. -478_- 2 2 FAM78B chr1:166136070 splice donor 472+17delGGGGC... - - Arafat M, et al. J Med Genet 2021; 58:106–115. doi: 10.1136/jmedgenet-2019-106825 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Med Genet PMS1 0.252 3 3 chr2:190670372 c. 316-6 C>A splice region - - *Low expression in testis Reference: Alsalem AB, Halees AS, Anazi S, Alshamekh S, Alkuraya FS. Autozygome sequencing expands the horizon of human knockout research and provides novel insights into human phenotypic variation. PLoS Genet 2013;9:e1004030. Arafat M, et al. J Med Genet 2021; 58:106–115. doi: 10.1136/jmedgenet-2019-106825.
Load more

Recommended publications
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name E3 ubiquitin-protein ligase PDZRN3 Gene Symbol Pdzrn3 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.3111 Ensembl Gene ID ENSRNOG00000005632 Entrez Gene ID 312607 Assay Information Unique Assay ID qRnoCIP0047702 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000039201 Amplicon Context Sequence CAAAGATTCCTTCACTGGAGGATCCATCTTGATTGTCCACACAGGGCCGGCCAC CAATGATATTGAATCCCAGGGAGCCAGAGTCCCGATGCAGGACAAGAGTCACAC TTTTGGTCTCTTC Amplicon Length (bp) 91 Chromosome Location 4:198408551-198415479 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 90 R2 0.9995 cDNA Cq 23.15 cDNA Tm (Celsius) 83.5 gDNA Cq 42.04 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Pdzrn3, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Regulation of Neuronal Gene Expression and Survival by Basal NMDA Receptor Activity: a Role for Histone Deacetylase 4
    The Journal of Neuroscience, November 12, 2014 • 34(46):15327–15339 • 15327 Cellular/Molecular Regulation of Neuronal Gene Expression and Survival by Basal NMDA Receptor Activity: A Role for Histone Deacetylase 4 Yelin Chen,1 Yuanyuan Wang,1 Zora Modrusan,3 Morgan Sheng,1 and Joshua S. Kaminker1,2 Departments of 1Neuroscience, 2Bioinformatics and Computational Biology, and 3Molecular Biology, Genentech Inc., South San Francisco, California 94080 Neuronal gene expression is modulated by activity via calcium-permeable receptors such as NMDA receptors (NMDARs). While gene expression changes downstream of evoked NMDAR activity have been well studied, much less is known about gene expression changes that occur under conditions of basal neuronal activity. In mouse dissociated hippocampal neuronal cultures, we found that a broad NMDAR antagonist, AP5, induced robust gene expression changes under basal activity, but subtype-specific antagonists did not. While some of the gene expression changes are also known to be downstream of stimulated NMDAR activity, others appear specific to basal NMDARactivity.ThegenesalteredbyAP5treatmentofbasalcultureswereenrichedforpathwaysrelatedtoclassIIahistonedeacetylases (HDACs), apoptosis, and synapse-related signaling. Specifically, AP5 altered the expression of all three class IIa HDACs that are highly expressed in the brain, HDAC4, HDAC5, and HDAC9, and also induced nuclear accumulation of HDAC4. HDAC4 knockdown abolished a subset of the gene expression changes induced by AP5, and led to neuronal death under
    [Show full text]
  • University of Alberta
    University of Alberta Tripartite-motif family members in the White Pekin duck (Anas platyrhynchos) modulate antiviral gene expression by Alysson Heather Blaine A thesis submitted to the Faculty of Graduate Studies and Research in partial fulfillment of the requirements for the degree of Master of Science in Physiology, Cell and Developmental Biology Biological Sciences ©Alysson Heather Blaine Fall 2013 Edmonton, Alberta Permission is hereby granted to the University of Alberta Libraries to reproduce single copies of this thesis and to lend or sell such copies for private, scholarly or scientific research purposes only. Where the thesis is converted to, or otherwise made available in digital form, the University of Alberta will advise potential users of the thesis of these terms. The author reserves all other publication and other rights in association with the copyright in the thesis and, except as herein before provided, neither the thesis nor any substantial portion thereof may be printed or otherwise reproduced in any material form whatsoever without the author's prior written permission. Abstract Wild waterfowl, including mallard ducks, are the natural reservoir of avian influenza A virus and are resistant to highly pathogenic strains. This is primarily due to the robust innate immune response of ducks. Shortly after exposure to both highly pathogenic (A/Viet Nam/1203/04 (H5N1)) and low pathogenic (A/mallard/BC/500/05 (H5N2)) avian influenza, many immune genes are upregulated including members of the diverse tripartite-motif (TRIM) family. TRIM proteins have species-specific antiviral roles in a variety of viral infections. I have identified a contig of TRIM genes located adjacent to the MHC locus in the White Pekin duck (Anas platyrhynchos) genome.
    [Show full text]
  • Pdzrn3 Is Required for Pronephros Morphogenesis in Xenopus Laevis SILVIA MARRACCI, ALBERTO VANGELISTI, VITTORIA RAFFA, MASSIMILIANO ANDREAZZOLI and LUCIANA DENTE*
    Int. J. Dev. Biol. 60: 57-63 (2016) doi: 10.1387/ijdb.150381ld www.intjdevbiol.com pdzrn3 is required for pronephros morphogenesis in Xenopus laevis SILVIA MARRACCI, ALBERTO VANGELISTI, VITTORIA RAFFA, MASSIMILIANO ANDREAZZOLI and LUCIANA DENTE* Laboratory of Cell and Developmental Biology, Dept. of Biology, University of Pisa, Pisa, Italy ABSTRACT Pdzrn3, a multidomain protein with E3-ubiquitin ligase activity, has been reported to play a role in myoblast and osteoblast differentiation and, more recently, in neuronal and endo- thelial cell development. The expression of the pdzrn3 gene is developmentally regulated in vari- ous vertebrate tissues, including muscular, neural and vascular system. Little is known about its expression during kidney development, although genetic polymorphisms and alterations around the human pdzrn3 chromosomal region have been found to be associated with renal cell carcino- mas and other kidney diseases. We investigated the pdzrn3 spatio-temporal expression pattern in Xenopus laevis embryos by in situ hybridization. We focused our study on the development of the pronephros, which is the embryonic amphibian kidney, functionally similar to the most primitive nephric structures of human kidney. To explore the role of pdzrn3 during renal morphogenesis, we performed loss-of-function experiments, through antisense morpholino injections and analysed the morphants using specific pronephric markers. Dynamic pdzrn3 expression was observed in embryonic tissues, such as somites, brain, eye, blood islands, heart, liver and pronephros. Loss of function experiments resulted in specific alterations of pronephros development. In particular, at early stages, pdzrn3 depletion was associated with a reduction of the pronephros anlagen and later, with perturbations of the tubulogenesis, including deformation of the proximal tubules.
    [Show full text]
  • Role of PDZ-Binding Motif from West Nile Virus NS5 Protein on Viral
    www.nature.com/scientificreports OPEN Role of PDZ‑binding motif from West Nile virus NS5 protein on viral replication Emilie Giraud1*, Chloé Otero del Val2, Célia Caillet‑Saguy2, Nada Zehrouni2, Cécile Khou5, Joël Caillet4, Yves Jacob3, Nathalie Pardigon5 & Nicolas Wolf2 West Nile virus (WNV) is a Flavivirus, which can cause febrile illness in humans that may progress to encephalitis. Like any other obligate intracellular pathogens, Flaviviruses hijack cellular protein functions as a strategy for sustaining their life cycle. Many cellular proteins display globular domain known as PDZ domain that interacts with PDZ‑Binding Motifs (PBM) identifed in many viral proteins. Thus, cellular PDZ‑containing proteins are common targets during viral infection. The non‑structural protein 5 (NS5) from WNV provides both RNA cap methyltransferase and RNA polymerase activities and is involved in viral replication but its interactions with host proteins remain poorly known. In this study, we demonstrate that the C‑terminal PBM of WNV NS5 recognizes several human PDZ‑ containing proteins using both in vitro and in cellulo high‑throughput methods. Furthermore, we constructed and assayed in cell culture WNV replicons where the PBM within NS5 was mutated. Our results demonstrate that the PBM of WNV NS5 is important in WNV replication. Moreover, we show that knockdown of the PDZ‑containing proteins TJP1, PARD3, ARHGAP21 or SHANK2 results in the decrease of WNV replication in cells. Altogether, our data reveal that interactions between the PBM of NS5 and PDZ‑containing proteins afect West Nile virus replication. Arboviruses include numerous human and animal pathogens that are important global health threats responsible for arboviroses.
    [Show full text]
  • Exdom: an Integrated Database for Comparative Analysis of the Exon
    Published online 4 November 2008 Nucleic Acids Research, 2009, Vol. 37, Database issue D703–D711 doi:10.1093/nar/gkn746 ExDom: an integrated database for comparative analysis of the exon–intron structures of protein domains in eukaryotes Ashwini Bhasi1, Philge Philip2, Vinu Manikandan2 and Periannan Senapathy1,2,* 1Department of Human Genetics, Genome International Corp, 8000 Excelsior Drive, Madison, WI 53717, USA and 2Department of Bioinformatics, International Center for Advanced Genomics and Proteomics, 83, 1st Cross Street, Nehru Nagar, Chennai 600096, India Received August 15, 2008; Revised October 2, 2008; Accepted October 3, 2008 ABSTRACT are abundantly found in proteins from different eukaryo- tic organisms (1,2). Eukaryotic genes coding for a protein We have developed ExDom, a unique database for with multiple domains may contain several introns within the comparative analysis of the exon–intron struc- the coding sequences of each domain. Since the origin and tures of 96 680 protein domains from seven eukar- evolution of the proteins are tightly linked to those of its yotic organisms (Homo sapiens, Mus musculus, Bos coding genes, modern research has increasingly focused taurus, Rattus norvegicus, Danio rerio, Gallus gallus on analyzing the relationship of the domain structure of and Arabidopsis thaliana). ExDom provides inte- eukaryotic proteins to the exon–intron structure of their grated access to exon-domain data through a coding split genes (3–7). Software tools to analyze the sophisticated web interface which has the following interrelated structures of domains, proteins, exons and analytical capabilities: (i) intergenomic and intrage- genes will be extremely useful to modern research in geno- nomic comparative analysis of exon–intron struc- mics and proteomics, and could enable new insights and ture of domains; (ii) color-coded graphical display discoveries concerning the origin and evolution of genes of the domain architecture of proteins correlated and proteins.
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • Comparative RNA-Seq Analysis Reveals Dys-Regulation of Major Canonical Pathways in ERG-Inducible Lncap Cell Progression Model of Prostate Cancer
    www.oncotarget.com Oncotarget, 2019, Vol. 10, (No. 42), pp: 4290-4306 Research Paper Comparative RNA-seq analysis reveals dys-regulation of major canonical pathways in ERG-inducible LNCaP cell progression model of prostate cancer Parameet Kumar1, Joyeeta Chakraborty2, Gauthaman Sukumar1,3, Clifton Dalgard1,4, Raghunath Chatterjee2 and Roopa Biswas1 1Department of Anatomy, Physiology and Genetics, Uniformed Services University of the Health Sciences, Bethesda, MD, USA 2Human Genetics Unit, Indian Statistical Institute, Kolkata, India 3Collaborative Health Initiative Research Program, Henry Jackson Foundation, Bethesda, MD, USA 4The American Genome Center, Uniformed Service University of the Health Sciences, Bethesda, MD, USA Correspondence to: Roopa Biswas, email: [email protected] Parameet Kumar, email: [email protected] Keywords: RNAseq; prostate cancer; LNCaP cells; ERG; mRNA Received: December 29, 2018 Accepted: May 30, 2019 Published: July 02, 2019 Copyright: Kumar et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Prostate Cancer (CaP) is the second leading cause of cancer related death in USA. In human CaP, gene fusion between androgen responsive regulatory elements at the 5'-untranslated region of TMPRSS2 and ETS-related genes (ERG) is present in at least 50% of prostate tumors. Here we have investigated the unique cellular transcriptome associated with over-expression of ERG in ERG-inducible LNCaP cell model system of human CaP. Comprehensive transcriptome analyses reveal a distinct signature that distinguishes ERG dependent and independent CaP in LNCaP cells.
    [Show full text]
  • Supplementary Table 1 Double Treatment Vs Single Treatment
    Supplementary table 1 Double treatment vs single treatment Probe ID Symbol Gene name P value Fold change TC0500007292.hg.1 NIM1K NIM1 serine/threonine protein kinase 1.05E-04 5.02 HTA2-neg-47424007_st NA NA 3.44E-03 4.11 HTA2-pos-3475282_st NA NA 3.30E-03 3.24 TC0X00007013.hg.1 MPC1L mitochondrial pyruvate carrier 1-like 5.22E-03 3.21 TC0200010447.hg.1 CASP8 caspase 8, apoptosis-related cysteine peptidase 3.54E-03 2.46 TC0400008390.hg.1 LRIT3 leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 1.86E-03 2.41 TC1700011905.hg.1 DNAH17 dynein, axonemal, heavy chain 17 1.81E-04 2.40 TC0600012064.hg.1 GCM1 glial cells missing homolog 1 (Drosophila) 2.81E-03 2.39 TC0100015789.hg.1 POGZ Transcript Identified by AceView, Entrez Gene ID(s) 23126 3.64E-04 2.38 TC1300010039.hg.1 NEK5 NIMA-related kinase 5 3.39E-03 2.36 TC0900008222.hg.1 STX17 syntaxin 17 1.08E-03 2.29 TC1700012355.hg.1 KRBA2 KRAB-A domain containing 2 5.98E-03 2.28 HTA2-neg-47424044_st NA NA 5.94E-03 2.24 HTA2-neg-47424360_st NA NA 2.12E-03 2.22 TC0800010802.hg.1 C8orf89 chromosome 8 open reading frame 89 6.51E-04 2.20 TC1500010745.hg.1 POLR2M polymerase (RNA) II (DNA directed) polypeptide M 5.19E-03 2.20 TC1500007409.hg.1 GCNT3 glucosaminyl (N-acetyl) transferase 3, mucin type 6.48E-03 2.17 TC2200007132.hg.1 RFPL3 ret finger protein-like 3 5.91E-05 2.17 HTA2-neg-47424024_st NA NA 2.45E-03 2.16 TC0200010474.hg.1 KIAA2012 KIAA2012 5.20E-03 2.16 TC1100007216.hg.1 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 7.43E-03 2.15 TC0400012977.hg.1 SH3D19
    [Show full text]
  • The Pdx1 Bound Swi/Snf Chromatin Remodeling Complex Regulates Pancreatic Progenitor Cell Proliferation and Mature Islet Β Cell
    Page 1 of 125 Diabetes The Pdx1 bound Swi/Snf chromatin remodeling complex regulates pancreatic progenitor cell proliferation and mature islet β cell function Jason M. Spaeth1,2, Jin-Hua Liu1, Daniel Peters3, Min Guo1, Anna B. Osipovich1, Fardin Mohammadi3, Nilotpal Roy4, Anil Bhushan4, Mark A. Magnuson1, Matthias Hebrok4, Christopher V. E. Wright3, Roland Stein1,5 1 Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 2 Present address: Department of Pediatrics, Indiana University School of Medicine, Indianapolis, IN 3 Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 4 Diabetes Center, Department of Medicine, UCSF, San Francisco, California 5 Corresponding author: [email protected]; (615)322-7026 1 Diabetes Publish Ahead of Print, published online June 14, 2019 Diabetes Page 2 of 125 Abstract Transcription factors positively and/or negatively impact gene expression by recruiting coregulatory factors, which interact through protein-protein binding. Here we demonstrate that mouse pancreas size and islet β cell function are controlled by the ATP-dependent Swi/Snf chromatin remodeling coregulatory complex that physically associates with Pdx1, a diabetes- linked transcription factor essential to pancreatic morphogenesis and adult islet-cell function and maintenance. Early embryonic deletion of just the Swi/Snf Brg1 ATPase subunit reduced multipotent pancreatic progenitor cell proliferation and resulted in pancreas hypoplasia. In contrast, removal of both Swi/Snf ATPase subunits, Brg1 and Brm, was necessary to compromise adult islet β cell activity, which included whole animal glucose intolerance, hyperglycemia and impaired insulin secretion. Notably, lineage-tracing analysis revealed Swi/Snf-deficient β cells lost the ability to produce the mRNAs for insulin and other key metabolic genes without effecting the expression of many essential islet-enriched transcription factors.
    [Show full text]