Extended Methods
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts. -
Prioritization and Evaluation of Depression Candidate Genes by Combining Multidimensional Data Resources
Prioritization and Evaluation of Depression Candidate Genes by Combining Multidimensional Data Resources Chung-Feng Kao1, Yu-Sheng Fang2, Zhongming Zhao3, Po-Hsiu Kuo1,2,4* 1 Department of Public Health and Institute of Epidemiology and Preventive Medicine, College of Public Health, National Taiwan University, Taipei, Taiwan, 2 Institute of Clinical Medicine, School of Medicine, National Cheng-Kung University, Tainan, Taiwan, 3 Departments of Biomedical Informatics and Psychiatry, Vanderbilt University School of Medicine, Nashville, Tennessee, United States of America, 4 Research Center for Genes, Environment and Human Health, National Taiwan University, Taipei, Taiwan Abstract Background: Large scale and individual genetic studies have suggested numerous susceptible genes for depression in the past decade without conclusive results. There is a strong need to review and integrate multi-dimensional data for follow up validation. The present study aimed to apply prioritization procedures to build-up an evidence-based candidate genes dataset for depression. Methods: Depression candidate genes were collected in human and animal studies across various data resources. Each gene was scored according to its magnitude of evidence related to depression and was multiplied by a source-specific weight to form a combined score measure. All genes were evaluated through a prioritization system to obtain an optimal weight matrix to rank their relative importance with depression using the combined scores. The resulting candidate gene list for depression (DEPgenes) was further evaluated by a genome-wide association (GWA) dataset and microarray gene expression in human tissues. Results: A total of 5,055 candidate genes (4,850 genes from human and 387 genes from animal studies with 182 being overlapped) were included from seven data sources. -
A Comparative Analysis of Transcribed Genes in the Mouse Hypothalamus and Neocortex Reveals Chromosomal Clustering
A comparative analysis of transcribed genes in the mouse hypothalamus and neocortex reveals chromosomal clustering Wee-Ming Boon*, Tim Beissbarth†, Lavinia Hyde†, Gordon Smyth†, Jenny Gunnersen*, Derek A. Denton*‡, Hamish Scott†, and Seong-Seng Tan* *Howard Florey Institute, University of Melbourne, Parkville 3052, Australia; and †Genetics and Bioinfomatics Division, Walter and Eliza Hall Institute of Medical Research, Royal Parade, Parkville 3050, Australia Contributed by Derek A. Denton, August 26, 2004 The hypothalamus and neocortex are subdivisions of the mamma- representing all of the genes that are expressed (qualitative and lian forebrain, and yet, they have vastly different evolutionary quantitative) in the hypothalamus and neocortex under standard histories, cytoarchitecture, and biological functions. In an attempt conditions. to define these attributes in terms of their genetic activity, we have In the current study, we describe the use of the Serial Analysis compared their genetic repertoires by using the Serial Analysis of of Gene Expression (SAGE) database, which allows simulta- Gene Expression database. From a comparison of 78,784 hypothal- neous detection of the expression levels of the entire genome amus tags with 125,296 neocortical tags, we demonstrate that each without a priori knowledge of gene sequences (13). SAGE takes structure possesses a different transcriptional profile in terms of advantage of the fact that a small sequence tag taken from a gene ontological characteristics and expression levels. Despite its defined position within the transcript is sufficient to identify the more recent evolutionary history, the neocortex has a more com- gene (from known cDNA or EST sequences), and up to 40 tags plex pattern of gene activity. -
Download Validation Data
PrimePCR™Assay Validation Report Gene Information Gene Name E3 ubiquitin-protein ligase PDZRN3 Gene Symbol Pdzrn3 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.3111 Ensembl Gene ID ENSRNOG00000005632 Entrez Gene ID 312607 Assay Information Unique Assay ID qRnoCIP0047702 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000039201 Amplicon Context Sequence CAAAGATTCCTTCACTGGAGGATCCATCTTGATTGTCCACACAGGGCCGGCCAC CAATGATATTGAATCCCAGGGAGCCAGAGTCCCGATGCAGGACAAGAGTCACAC TTTTGGTCTCTTC Amplicon Length (bp) 91 Chromosome Location 4:198408551-198415479 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 90 R2 0.9995 cDNA Cq 23.15 cDNA Tm (Celsius) 83.5 gDNA Cq 42.04 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Pdzrn3, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. -
Use of Genomic Tools to Discover the Cause of Champagne Dilution Coat Color in Horses and to Map the Genetic Cause of Extreme Lordosis in American Saddlebred Horses
University of Kentucky UKnowledge Theses and Dissertations--Veterinary Science Veterinary Science 2014 USE OF GENOMIC TOOLS TO DISCOVER THE CAUSE OF CHAMPAGNE DILUTION COAT COLOR IN HORSES AND TO MAP THE GENETIC CAUSE OF EXTREME LORDOSIS IN AMERICAN SADDLEBRED HORSES Deborah G. Cook University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Cook, Deborah G., "USE OF GENOMIC TOOLS TO DISCOVER THE CAUSE OF CHAMPAGNE DILUTION COAT COLOR IN HORSES AND TO MAP THE GENETIC CAUSE OF EXTREME LORDOSIS IN AMERICAN SADDLEBRED HORSES" (2014). Theses and Dissertations--Veterinary Science. 15. https://uknowledge.uky.edu/gluck_etds/15 This Doctoral Dissertation is brought to you for free and open access by the Veterinary Science at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Veterinary Science by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. -
Multiple Cellular Proteins Interact with LEDGF/P75 Through a Conserved Unstructured Consensus Motif
ARTICLE Received 19 Jan 2015 | Accepted 1 Jul 2015 | Published 6 Aug 2015 DOI: 10.1038/ncomms8968 Multiple cellular proteins interact with LEDGF/p75 through a conserved unstructured consensus motif Petr Tesina1,2,3,*, Katerˇina Cˇerma´kova´4,*, Magdalena Horˇejsˇ´ı3, Katerˇina Procha´zkova´1, Milan Fa´bry3, Subhalakshmi Sharma4, Frauke Christ4, Jonas Demeulemeester4, Zeger Debyser4, Jan De Rijck4,**, Va´clav Veverka1,** & Pavlı´na Rˇeza´cˇova´1,3,** Lens epithelium-derived growth factor (LEDGF/p75) is an epigenetic reader and attractive therapeutic target involved in HIV integration and the development of mixed lineage leukaemia (MLL1) fusion-driven leukaemia. Besides HIV integrase and the MLL1-menin complex, LEDGF/p75 interacts with various cellular proteins via its integrase binding domain (IBD). Here we present structural characterization of IBD interactions with transcriptional repressor JPO2 and domesticated transposase PogZ, and show that the PogZ interaction is nearly identical to the interaction of LEDGF/p75 with MLL1. The interaction with the IBD is maintained by an intrinsically disordered IBD-binding motif (IBM) common to all known cellular partners of LEDGF/p75. In addition, based on IBM conservation, we identify and validate IWS1 as a novel LEDGF/p75 interaction partner. Our results also reveal how HIV integrase efficiently displaces cellular binding partners from LEDGF/p75. Finally, the similar binding modes of LEDGF/p75 interaction partners represent a new challenge for the development of selective interaction inhibitors. 1 Institute of Organic Chemistry and Biochemistry of the ASCR, v.v.i., Flemingovo nam. 2, 166 10 Prague, Czech Republic. 2 Department of Genetics and Microbiology, Faculty of Science, Charles University in Prague, Vinicna 5, 128 44 Prague, Czech Republic. -
Downloaded from [266]
Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes. -
Supplemental Table 1. Complete Gene Lists and GO Terms from Figure 3C
Supplemental Table 1. Complete gene lists and GO terms from Figure 3C. Path 1 Genes: RP11-34P13.15, RP4-758J18.10, VWA1, CHD5, AZIN2, FOXO6, RP11-403I13.8, ARHGAP30, RGS4, LRRN2, RASSF5, SERTAD4, GJC2, RHOU, REEP1, FOXI3, SH3RF3, COL4A4, ZDHHC23, FGFR3, PPP2R2C, CTD-2031P19.4, RNF182, GRM4, PRR15, DGKI, CHMP4C, CALB1, SPAG1, KLF4, ENG, RET, GDF10, ADAMTS14, SPOCK2, MBL1P, ADAM8, LRP4-AS1, CARNS1, DGAT2, CRYAB, AP000783.1, OPCML, PLEKHG6, GDF3, EMP1, RASSF9, FAM101A, STON2, GREM1, ACTC1, CORO2B, FURIN, WFIKKN1, BAIAP3, TMC5, HS3ST4, ZFHX3, NLRP1, RASD1, CACNG4, EMILIN2, L3MBTL4, KLHL14, HMSD, RP11-849I19.1, SALL3, GADD45B, KANK3, CTC- 526N19.1, ZNF888, MMP9, BMP7, PIK3IP1, MCHR1, SYTL5, CAMK2N1, PINK1, ID3, PTPRU, MANEAL, MCOLN3, LRRC8C, NTNG1, KCNC4, RP11, 430C7.5, C1orf95, ID2-AS1, ID2, GDF7, KCNG3, RGPD8, PSD4, CCDC74B, BMPR2, KAT2B, LINC00693, ZNF654, FILIP1L, SH3TC1, CPEB2, NPFFR2, TRPC3, RP11-752L20.3, FAM198B, TLL1, CDH9, PDZD2, CHSY3, GALNT10, FOXQ1, ATXN1, ID4, COL11A2, CNR1, GTF2IP4, FZD1, PAX5, RP11-35N6.1, UNC5B, NKX1-2, FAM196A, EBF3, PRRG4, LRP4, SYT7, PLBD1, GRASP, ALX1, HIP1R, LPAR6, SLITRK6, C16orf89, RP11-491F9.1, MMP2, B3GNT9, NXPH3, TNRC6C-AS1, LDLRAD4, NOL4, SMAD7, HCN2, PDE4A, KANK2, SAMD1, EXOC3L2, IL11, EMILIN3, KCNB1, DOK5, EEF1A2, A4GALT, ADGRG2, ELF4, ABCD1 Term Count % PValue Genes regulation of pathway-restricted GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, SMAD protein phosphorylation 9 6.34 1.31E-08 ENG pathway-restricted SMAD protein GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, phosphorylation -
Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia. -
1 Supporting Information for a Microrna Network Regulates
Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia. -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
Supplemental Information
Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.