RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 1, page 1 of 11
SUPPLEMENTAL TABLE 1
Oenothera strains of the subsections Oenothera and Munzia used in RAUWOLF et al. 20081)
Genetic Reference for complex Strain Reference for plastome Renner complex (α·β) Diakinesis Strain first described constitution (α and β)
Oenothera elata subsp. elata
h chapultepec AA-I STUBBE (1963) chapultepec 7 prs. STEINER (1951) STEINER (1951)
h cholula AA-I STUBBE (1963) cholula 7 prs. STEINER (1955) STEINER (1955)
h puebla AA-I STUBBE (1963) puebla 7 prs. STEINER (1955) STEINER (1955)
h toluca AA-I STUBBE (1963) toluca 7 prs. STEINER (1951) STEINER (1951)
Oenothera elata subsp. hookeri
2) h franciscana de Vries AA-I STUBBE (1959); franciscana de Vries 7 prs. CLELAND (1935) DAVIS (1916); STINSON (1960) RENNER (1941)
2) h franciscana E. & S. AA-I STUBBE (1959) franciscana E. & S. 7 prs. CLELAND (1935) DAVIS (1916); RENNER (1941)
h CLELAND and BLAKESLEE hookeri de Vries AA-I STUBBE (1959) hookeri de Vries 7 prs. DE VRIES (1913) (1931)
h johansen AA-I STINSON (1960) johansen 7 prs. CLELAND (1935) CLELAND (1935)
Oenothera villosa subsp. villosa
3) St St bauri Standard AA-I STUBBE 1959 laxans· undans 14 BAERECKE (1944) RENNER (1937)
RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 1, page 2 of 11
SUPPLEMENTAL TABLE 1 (continued)
Genetic Reference for complex Strain Reference for plastome Renner complex (α·β) Diakinesis Strain first described constitution (α and β)
Oenothera biennis
4, 5) dV dV biennis de Vries AB-II DE VRIES (1913); albicans· rubens 8, 6 CATCHESIDE (1940) DE VRIES (1901-1903); RENNER (1924) DE VRIES (1913)
4, 5) biM biM biennis München AB-II STUBBE (1959) albicans· rubens 8, 6 CATCHESIDE (1940) RENNER (1917)
Col Col chicaginensis Colmar BA-III STUBBE (1963) excellens· punctulans 12, 1 pr. RENNER (1956); RENNER (1950) STUBBE (1963)
6) lawrenceville 3 AB-II CLELAND (1962) α-lawrenceville 3·β-lawrenceville 3 14 CLELAND (1958) CLELAND (1958)
St St nuda Standard AB-II STUBBE (1963) calvans· glabrans 14 JEAN et al. (1966) RENNER (1956)
h purpurata AA-II STUBBE (1959) purpurata 7 prs. CATCHESIDE (1940) KLEBAHN (1914)
7) Th Th BAERECKE (1944) rubicaulis Thron AB-II STUBBE (1963) tinges· rubens 8, 6 BAERECKE (1944) CATCHESIDE (1940)
G G suaveolens Grado AB-II STUBBE (1959) albicans· flavens 14 STUBBE (1953); STUBBE (1953) STUBBE and DIERS (1958)
Fü Fü suaveolens Fünfkirchen AB-II STUBBE (1959) albicans· flavens 10, 2 prs. STUBBE (1953) STUBBE (1953)
St St suaveolens Standard AB-II STUBBE (1959) albicans· flavens 12, 1 pr. CLELAND and BLAKESLEE BLARINGHEM (1914) (1931); CATCHESIDE (1940)
Oenothera biennis x Oenothera glazioviana
St St conferta Standard AB-II STUBBE (1963) convelans· aemulans 12, 1 pr. RENNER and HIRMER (1956) RENNER (1950)
RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 1, page 3 of 11
SUPPLEMENTAL TABLE 1 (continued)
Genetic Reference for complex Strain Reference for plastome Renner complex (α·β) Diakinesis Strain first described constitution (α and β)
Oenothera glazioviana8)
9) St St coronifera Standard BA-II STUBBE (1963) quaerans· paravelans 12, 1 pr. ROSSMANN (1963) RENNER (1937)
10, 11) h blandina de Vries A/B-III DE VRIES (1913); blandina de Vries 7 prs. CATCHESIDE (1940) DE VRIES (1917) RENNER (1924)
10, 11) h decipiens de Vries A/B-III DE VRIES (1913); decipiens de Vries 7 prs CATCHESIDE (1939) DE VRIES (1919A) RENNER (1924)
10,11) h deserens de Vries A/B-III DE VRIES (1913); deserens de Vries 7 prs. RENNER (1943A) DE VRIES (1919b) RENNER (1924)
CLELAND and BLAKESLEE (1931); 12) S S rr-lamarckiana Sweden AB-III STUBBE (1959) r- velans·r- gaudens 12, 1 pr. EMERSON and STURTEVANT HERIBERT-NILSSON (1912) (1931); CATCHESIDE (1940)
Oenothera grandiflora
h bellamy A BB-III SCHUMACHER et al. (1992) bellamy A 7 prs. STEINER and STUBBE (1984) STEINER and STUBBE (1984)
A h A castleberry A-4 BB -III SCHUMACHER et al. (1992) B-castelberry A-4· B -castleberry A-4 12, 1 pr. SCHUMACHER et al. (1992); STEINER and STUBBE (1986) SCHUMACHER and STEINER (1993)
A h A chastang 7 BB -III SCHUMACHER et al. (1992) B-chastang 7· B -chastang 7 8, 3 prs. SCHUMACHER et al. (1992); STEINER and STUBBE (1986) SCHUMACHER and STEINER (1993)
h castleberry B-8 BB-III SCHUMACHER et al. (1992) castleberry B-8 7 prs. SCHUMACHER and STEINER (1993) STEINER and STUBBE (1986)
h stockton 1 BB-III SCHUMACHER et al. (1992) stockton 1 7 prs. CLELAND (1972) CLELAND (1972)
h tuscaloosa BB-III SCHUMACHER et al. (1992) tuscaloosa 7 prs. STEINER and STUBBE (1984) STEINER and STUBBE (1984)
RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 1, page 4 of 11
SUPPLEMENTAL TABLE 1 (continued)
Genetic Reference for complex Strain Reference for plastome Renner complex (α·β) Diakinesis Strain first described constitution (α and β)
Oenothera nutans elkins 2 BB-III WASMUND (1990) α-elkins 2·β-elkins 2 14 WASMUND (1990) WASMUND (1990)
CLELAND (1972); CLELAND (1972); horsesheads 2 BB-III α-horseshead 2·β-horseshead 2 14 CLELAND (1972) WASMUND (1990) WASMUND (1990) marienville 3 BB-III CLELAND (1962); α-marienville 3·β-marienville 3 14 CLELAND (1958); CLELAND (1958) WASMUND (1990) WASMUND (1990) mitchell BB-III CLELAND (1962); α-mitchell·β-mitchell 14 PEER (1950) PEER (1950) WASMUND (1990)
Oenothera oakesiana
St St HOEPPENER and RENNER ammophila Standard AC-IV STUBBE (1959) rigens· percurvans 12, 1 pr. BAERECKE (1944) (1929)
Oenothera parviflora
13) St St atrovirens Standard BC-IV STUBBE (1959) pingens· flectens 14 CATCHESIDE (1940); DE VRIES (1901-1903); BAERECKE (1944) DE VRIES (1913)
St St silesiaca Standard BC-IV STUBBE (1959) subpingens· subcurvans 14 BAERECKE (1944) RENNER (1942; 1943b)
6) CLELAND (1962); st. stephen BC-IV α-st. stephen·β-st. stephen NA CLELAND (1972) CLELAND (1972) CLELAND (1972)
RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 1, page 5 of 11
SUPPLEMENTAL TABLE 1 (continued)
Genetic Reference for complex Strain Reference for plastome Renner complex (α·β) Diakinesis Strain first described constitution (α and β)
Oenothera argillicola
h douthat 1 CC-V STINSON (1960) douthat 1 7 prs. STINSON (1953) STINSON (1953)
6) CLELAND (1962); h williamsville 2 CC-V williamsville 2 7 prs. STUBBE (unpublished) DIETRICH et al. (1997) CLELAND (1972)
6) CLELAND (1962); 14) wilson creek 1 CC-V NA NA GREINER (this work) GREINER (this work) CLELAND (1972)
Oenothera villaricae
15) berteriana Schwemmle NA NA B·l 14 HAUSTEIN (1952) SCHWEMMLE et al. (1938)
1) For a detailed taxonomy see DIETRICH et al. (1997) and DIETRICH (1977).
2) The strains franciscana de Vries and franciscana E. & S. are derivates of Davis’s franciscana B (DAVIS 1916), as summarized in RENNER (1941).
3) A very similar strain is known under the name “Oe. hungarica”.
4) Based on crossing data published by de Vries (DE VRIES 1901-1903; DE VRIES 1913) and own data, RENNER (1924) determined the plastid type of biennis de Vries to be identical to that of suaveolens. All suaveolens strains investigated carry plastome type II (STUBBE 1959).
5) dV biM The two strains of Oe. biennis differ in the inheritance of their rubens complex, rubens (♂) and rubens (♀♂) (DE VRIES 1913; RENNER 1917), but not in their meiotic configurations (CLELAND and OEHLKERS 1930). With respect to chromosomal arrangement of their α- and β-complexes (albicans and rubens) no distinction can be made
RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 1, page 6 of 11 between both strains (RENNER 1938; CATCHESIDE 1940; RENNER 1950). Both strains, as well as all strains of Oe. biennis in the strict genetic sense of albicans·rubens are phenotypically highly constant throughout Europe (RENNER 1937; RENNER 1950).
6) For the plastome type of this strain no primary data have been published in the literature. For its identification see CLELAND (1962; 1972), RAVEN and STUBBE (1979),
DIETRICH et al. (1997) and this work.
7) The rubens complex of rubricaulis Thron was identified to be identical to rubens of true Oe. biennis (albicans·rubens) (BAERECKE 1944 and citations therein).
8) Synonyms: Oe. erythrosepala and ex genetica: Oe. lamarckiana
9) This strain of Oe. glazioviana is not identical with Oe. lamarckiana in a strict genetic sense. In general it is a BA-II species (ROSSMANN 1963; STUBBE 1963) which basically does not exist in the taxonomic systems of CLELAND (1962) or DIETRICH et al. (1997). CLELAND (1972) assumes that the strain coronifera Standard is a hybrid between Oe. biennis and Oe. glazioviana and not a strain of Oe. glazioviana as assumed in DIETRICH et al. (1997).
10) Decipiens de Vries and deserens de Vries are a so called “full”-mutants (DE VRIES 1917; DE VRIES 1919a; DE VRIES 1919b). For review and a possible mechanism of “full”- mutant appearance see CLELAND (1942) and RENNER (1943a). Both originated from Oe. glazioviana strain lamarckiana de Vries (DE VRIES 1919a; DE VRIES 1919b), and are a mixture of the complexes velans (A) and gaudens (B). With hblandina de Vries the situation is more complex. That complex did not arise directly from lamarckiana de Vries but from a hybrid of two mutants of lamarckiana de Vries, mut. laxa x mut. semilata (DE VRIES 1917). Because the original material was lost, it is nearly impossible to reconstruct the h h mechanism of chromosome rearrangement, how blandina de Vries could have been developed. DIETRICH et al. (1997) state blandina de Vries as an A complex, which is true in various respects, especially as de Vries calls this mutant species “Oe. blandina” also “Oe. lamarckiana mut. veluntina”. He saw blandina de Vries as some kind of stable “velans species”. The reason why hblandina de Vries is described as an A/B-complex in this work is its association with plastome III (see footnote 11). Blandina de Vries does not show a h typical virescent phenotype, expected from an AA-III genotype STUBBE (1959). Therefore, it is assumed that there are still elements of gaudens (B) present in blandina de Vries genome.
11) As stated in footnote 10, blandina de Vries, deserens de Vries and decipiens de Vries are mutants that originated in Oe. glazioviana strain lamarckiana de Vries (DE VRIES
1917; DE VRIES 1919a; DE VRIES 1919b). As mutants they carry the same plastome as the strain they are originated from. The crossing data presented by de Vries (DE VRIES
RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 1, page 7 of 11
1901-1903; DE VRIES 1913; summarized in RENNER 1924) do not indicate a plastome type different from plastome III in lamarckiana de Vries. It is therefore fairly certain, that the genetic behavior of blandina de Vries, deserens de Vries and decipiens de Vries plastomes is identical to that of lamarckiana Sweden, although the former strains were not investigated directly with respect to their plastome types.
12) In the Oenothera genetics basically two strains of the true Oe. glazioviana are used, the strain of de Vries he found at Hilversum and the Swedish strain of Heribert-Nilsson.
The Swedish strain differs from that of de Vries, among other characters, in the absences of the phenotypical marker R (red midrip) (HERIBERT-NILSSON 1912; DE VRIES 1916;
RENNER 1917). However, in the literature is not always clearly stated which strain was used by a particular author. The chromosomal arrangement of velans and gaudens were described in at least four publications (CLELAND and BLAKESLEE 1931; EMERSON and STURTEVANT 1931; CATCHESIDE 1940; CLELAND and HAMMOND 1950). EMERSON and
STURTEVANT (1931) and CLELAND and HAMMOND (1950) used the Swedish strain to determine its chromosomal arrangement, for work of other authors this is unclear.
Furthermore, in the work of EMERSON and STURTEVANT (1931) and in earlier publications of CLELAND, diakinesis configurations of no further specified lamarckiana strains are cited. However, it is questionable whether a distinction between lamarckiana de Vries and lamarckiana Sweden is necessary in this context. De Vries argues that the Swedish strain represents an offspring of the strain he used (DE VRIES 1916). Stubbe has tested a large variety of strains of Oe. glazioviana (in the strict sense of Oe. lamarckiana) collected all over the world. Consistently, he found the Renner complexes velans·gaudens associated with plastome III, as in the Swedish strain (STUBBE, unpublished). CLELAND
(1972, p. 226) reports comparable data and KAPPUS (1957) also finds in the strain lamarckiana Altenheim velans and gaudens, but interestingly associated with plastome II. Therefore, with respect to chromosomal formulas or complex constitution no difference seems to exist between lamarckiana de Vries and Sweden and between strains of “Oe. lamarckiana” in general.
13) alternative designation of the strain: “Oe. cruciata de Vries”
14) Strain collected by Stephan Greiner and Jörg Meurer (09/26/2004). USA, Virginia, Alleghany County, Greiner FBA 9, shale barren along Wilson Creek near Douthat State Park (37°52’16,6’’N; 79°48’29,5’’W)
15) alternative designation of the strain: berteriana Erlangen
RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 1, page 8 of 11
LITERATURE CITED IN SUPPLEMENTAL TABLE 1
BAERECKE, M., 1944 Zur Genetik und Cytologie von Oenothera ammophila Focke, Bauri Boedijn, Beckeri Renner, parviflora L., rubricaulis Klebahn, silesiaca Renner. Flora 138: 57-92.
BLARINGHEM, L., 1914 L’Oenothera Lamackiana Seringe et les Oenothères de la forêt de Fontainebleau. Rev. gen. Bot. 25: 35.
CATCHESIDE, D. G., 1939 A position effect in Oenothera. J. Genet. 38: 345-352.
CATCHESIDE, D. G., 1940 Structural analysis of Oenothera complexes. Proc. R. Soc. Biol. Sci. Ser. B 128: 509-535.
CLELAND, R. E., 1935 Cyto-taxonomic studies on certain Oenotheras from California. Proc. Am. Philos. Soc. 75: 339-429.
CLELAND, R. E., 1942 The origin of hDecipiens from the complexes of Oenothera Lamarckiana and its bearing upon the phylogenetic significance of similarities in segmental arrangement. Genetics 27: 55-83.
CLELAND, R. E., 1958 The evolution of the North American Oenotheras of the “biennis” group. Planta 51: 378-398.
CLELAND, R. E., 1962 Plastid behaviour of the North American Euoenotheras. Planta 57: 699- 712.
CLELAND, R. E., 1972 Oenothera cytogenetics and evolution, pp. 1-370 in Experimental
botany 5, edited by J. F. SUTCLIFFE and P. MAHLBERG. Academic Press, San Diego/New York/London.
CLELAND, R. E., and A. F. BLAKESLEE, 1931 Segmental interchange, the basis of chromosomal attachments in Oenothera. Cytologia 2: 175-233.
CLELAND, R. E., and B. L. HAMMOND, 1950 Anaylsis of segmental arragenments in certain race of Oenothera. Indiana Univ. Publ. Sci. Ser. 16: 10-72.
CLELAND, R. E., and F. OEHLKERS, 1930 Erblichkeit und Zytologie verschiedener Oenotheren und ihrer Kreuzungen. Jahrb. wiss. Bot. 73: 1-124.
DAVIS, B. M., 1916 Hybrids of Oenothera biennis and Oenothera franciscana in the first and second generations. Genetics 1: 197-251.
DE VRIES, H., 1901-1903 Die Mutationstheorie. von Veit, Leipzig.
DE VRIES, H., 1913 Gruppenweise Artbildung - Unter spezieller Berücksichtigung der Gattung Oenothera. Gebrüder Borntraeger, Berlin.
RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 1, page 9 of 11
DE VRIES, H., 1916 Gute, harte, und leere Samen von Oenothera. Z. indukt. Abstamm.- u. Vererbungsl. 16: 239-292.
DE VRIES, H., 1917 Oenothera Lamarckiana mut. velutina. Bot. Gaz. 63: 1-24.
DE VRIES, H., 1919a Oenothera Lamarckiana erythrina, eine neue Halbmutante. Z. indukt. Abstamm.- u. Vererbungsl. 21: 91-118.
DE VRIES, H., 1919b Oenothera rubrinervis, a half mutant. Bot. Gaz. 67: 1-26.
DIETRICH, W., 1977 The South American species of Oenothera sect. Oenothera (Raimannia, Renneria; Onagraceae). Ann. Mo. Bot. Gard. 64: 425–626.
DIETRICH, W., W. L. WAGNER and P. H. RAVEN, 1997 Systematics of Oenothera section Oenothera subsection Oenothera (Onagraceae), pp. 1–234 in Systematic botany
monographs 50, edited by C. ANDERSON. The American Society of Plant Taxonomists, Laramie.
EMERSON, S. H., and A. H. STURTEVANT, 1931 Genetical and cytological studies in Oenothera. III The translocation interpretation. Z. indukt. Abstamm.- u. Vererbungsl. 59: 395-419.
HAUSTEIN, E., 1952 Die Endenbezifferung der Chromosomen einiger Oenotheren aus dem Subgenus Raimannia. Z. indukt. Abstamm.- u. Vererbungsl. 84: 417-453.
HERIBERT-NILSSON, N., 1912 Die Variabilität der Oenothera Lamarckiana und das Problem der Mutation. Z. indukt. Abstamm.- u. Vererbungsl. 9: 89-231.
HOEPPENER, E., and O. RENNER, 1929 Genetische und zytologische Oenotherenstudien I. Zur Kenntnis der Oenothera ammophila Focke. Z. indukt. Abstamm.- u. Vererbungsl. 49: 1-25.
JEAN, R., A. M. LAMBERT and R. LINDER, 1966 Analyse cytogénétique de l’Oenothera nuda Renner. Bull. Soc. Bot. N. Fr. 19: 6-26.
KAPPUS, A., 1957 Wilde Oenotheren in Südwestdeutschland. Z. indukt. Abstamm.- u. Vererbungsl. 88: 38-55.
KLEBAHN, H., 1914 Formen, Mutationen, und Kreuzungen bei einigen Oenotheren aus der Lüneburger Heide. Jahrb. Hamb. Wiss. An. 31, 3. Beiheft: 1-64.
PREER, L. B., 1950 A cytogenetic study of certain broad-leaved races of Oenothera. Indiana Univ. Publ. Sci. Ser. 16: 82-159.
RENNER, O., 1917 Versuche über die gametische Konstitution der Oenotheren. Z. indukt. Abstamm.- u. Vererbungsl. 18: 121-294.
RENNER, O., 1924 Die Scheckung der Oenotherenbastarde. Biol. Zentralbl. 44: 309-336.
RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 1, page 10 of 11
RENNER, O., 1937 Wilde Oenotheren in Norddeutschland. Flora 31: 182-226.
RENNER, O., 1938 Kurze Mitteilung über Oenothera. II. Zu den Chromosomenformel der Kompelxe albicans, curvans, flectens, gaudens (rubens), rigens. Flora 32: 319-324.
RENNER, O., 1941 Über die Entstehung homozygotischer Formen aus kompelx- heterozygotischen Oenotheren. Flora 135: 201-238.
RENNER, O., 1942 Europäische Wildarten von Oenothera. Ber. Dtsch. Bot. Ges. 60: 448-466.
RENNER, O., 1943a Über die Entstehung homozygotischer Formen aus komplexheterozygotischen Oenotheren II. Die Translokationshomozygoten. Z. Bot. 39: 49-106.
RENNER, O., 1943b Zur Kenntnis von O. silesiaca n. sp., parviflora L., ammophila Focke, rubricaulis Kleb. Flora 36: 325-335.
RENNER, O., 1950 Europäische Wildarten von Oenothera II. Ber. Dtsch. Bot. Ges. 63: 129- 138.
RENNER, O., 1956 Europäische Wildarten von Oenothera III. Planta 47: 219-254.
RENNER, O., and U. HIRMER, 1956 Zur Kenntnis von Oenothera. I. Über Oe. conferta n. sp. II. Über künstliche Polyploidie. Biol. Zentralbl. 75: 513-531.
ROSSMANN, G., 1963 Analyse der Oenothera coronifera Renner. Flora 153: 451-468.
SCHUMACHER, E., and E. E. STEINER, 1993 Cytological analysis of complex-heterozygotes in populations of Oenothera grandiflora (Onagraceae) in Alabama. Plant Syst. Evol. 184: 77-87.
SCHUMACHER, E., E. E. STEINER and W. STUBBE, 1992 The complex-heterozygotes of Oenothera grandiflora L'Her. Bot. Acta 105: 375-381.
SCHWEMMLE, J., E. HAUSTEIN, A. STURM and M. BINDER, 1938 Genetische und zytologische Untersuchungen an Eu-Oenotheren. Teil I bis VI. Z. indukt. Abstamm.- u. Vererbungsl. 75: 358-800.
STEINER, E. E., 1951 Phylogenetic relationships of certain races of Euoenothera from Mexico and Guatemala. Evolution 5: 265-272.
STEINER, E. E., 1955 A cytogenetic study of certain races of Oenothera elata. Bull. Torrey Bot. Club 82: 292-297.
STEINER, E. E., and W. STUBBE, 1984 A contribution to the population biology of Oenothera grandiflora L’Her. Am. J. Bot. 71: 1293-1301.
STEINER, E. E., and W. STUBBE, 1986 Oenothera grandiflora revisited: a new view of its population structure. Bull. Torrey Bot. Club 113: 406-412.
RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 1, page 11 of 11
STINSON, H. T., 1953 Cytogenetics and Phylogeny of Oenothera argillicola Mackenz. Genetics 38: 389-406.
STINSON, H. T., 1960 Extranuclear barriers to interspecific hybridization between Oenothera Hookeri and Oe. argillicola. Genetics 45: 815-838.
STUBBE, W., 1953 Genetische und zytologische Untersuchungen an verschiedenen Sippen von Oenothera suaveolens. Z. indukt. Abstamm.- u. Vererbungsl. 85: 180-209.
STUBBE, W., 1959 Genetische Analyse des Zusammenwirkens von Genom und Plastom bei Oenothera. Z. Vererbungsl. 90: 288-298.
STUBBE, W., 1963 Die Rolle des Plastoms in der Evolution der Oenotheren. Ber. Dtsch. Bot. Ges. 76: 154-167.
STUBBE, W., and L. DIERS, 1958 Die Chromosomenformel des albicans-Komplexes der Sippe Grado von Oenothera suaveolens. Z. Vererbungsl. 89: 320-322.
STUBBE, W., and P. H. RAVEN, 1979 A genetic contribution to the taxonomy of Oenothera sect. Oenothera (including subsection Euoenothera, Emersonia, Raimannia and Munzia). Plant Syst. Evol. 133: 39-59.
WASMUND, O., 1990 Cytogenetic investigation on Oenothera nutans (Onagraceae). Plant Syst. Evol. 169: 69-80.
RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 2, page 1 of 1
SUPPLEMENTAL TABLE 2 1) AFLP primers used in RAUWOLF et al. 2008
Oligonucleotide Sequence (5’-3’)
MseI adapter 1 cccagtcacgacgttgtaaaacg MseI adapter 2 agcggataacaatttcacacagg SacI adapter 1 ctcgtagactgcgtacaagct SacI adapter 2 tgtacgcagtctac MseI CAC gatgagtcctgagtaacac MseI CCG gatgagtcctgagtaaccg MseI CGG gatgagtcctgagtaacgg MseI CGT gatgagtcctgagtaacgt MseI CTA gatgagtcctgagtaacta MseI CTC gatgagtcctgagtaactc MseI CTT gatgagtcctgagtaactt SacI GG - FAM2) gactgcgtacaagctcgg SacI GA - FAM gactgcgtacaagctcga SacI GC - Joe3) gactgcgtacaagctcgc SacI GT - Joe gactgcgtacaagctcgt
1) amplified fragment length polymorphism
2) 6-FAM (6-carboxy-fluorescein)
3) Joe (2,7-dimethoxy-4,5-dichloro-6-carboxy-fluorescein)
RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 3, page 1 of 1
SUPPLEMENTAL TABLE 3 AFLP1) primer combinations used in RAUWOLF et al. 2008
Primer combinations MseI CAC MseI CCG MseI CGG MseI CGT MseI CTA MseI CTC MseI CTT
SacI GA - FAM2) sm267 NA NA sm299 NA NA NA SacI GC - Joe3) NA NA NA sm285 NA NA NA SacI GG - FAM sm263 sm261 sm290 NA NA NA NA SacI GT- Joe NA NA sm276 NA sm279 sm281 sm280
1) amplified fragment length polymorphism
1) 6-FAM (6-carboxy-fluorescein)
2) Joe (2,7-dimethoxy-4,5-dichloro-6-carboxy-fluorescein) RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 4, page 1 of 1
SUPPLEMENTAL TABLE 4
Segmental arrangements and chromosome configurations of Oe. biennis strain suaveolens Grado (Galbicans·Gflavens), Oe. grandiflora strain
tuscaloosa (htuscaloosa·htuscaloosa), and of their F1 twin hybrids Galbicans·htuscaloosa and Gflavens·htuscaloosa
Renner Basic Chromosome Strain or hybrid Segmental arrangement of chromosome arms complex genome configuration
Galbicans A /1·12 11·10 7·5 6·3 2·14 13·8 9·4 \ suaveolens Grado 14 Gflavens B \ 12·11 10·7 5·6 3·2 14·13 8·9 4·1/
htuscaloosa B /1·2\ /3·4\ /5·6\ /7·10\ /9·8\ /11·12\ /13·14\ tuscaloosa 7 prs. htuscaloosa B \1·2/ \3·4/ \5·6/ \7·10/ \9·8/ \11·12/ \13·14/
Gflavens B /1·4 3·2 \ /5·6\ /7·10\ /9·8\ /11·12\ /13·14\ Gflavens·htuscaloosa 4, 5 prs. htuscaloosa B \ 4·3 2·1/ \5·6/ \7·10/ \9·8/ \11·12/ \13·14/
Galbicans A /1·12 11·10 7·5 6·3 4·9 8·13 14·2 \ Galbicans·htuscaloosa 14 htuscaloosa B \ 12·11 10·7 5·6 3·4 9·8 13·14 2·1/ RAUWOLF et al. 2008, SUPPLEMENTAL TABLE 5, page 1 of 1
SUPPLEMENTAL TABLE 5 Assignment of PCR-based CAPS1) markers to the seven linkage groups of the hjohansen·htuscaloosa linkage map, representing Oenothera chromosomes 1·2 3·4 5·6 7·10 9·8 11·12 13·14, and their alleles in htuscaloosa·htuscaloosa and Stalbicans·htuscaloosa2)
Alleles found in Alleles found in Marker Linkage group htuscaloosa·htuscaloosa Stalbicans·htuscaloosa
M19 LG1 M19-B1/M19-B1 M19-A1/M19-B1
M40 LG2 M40-B4/M40-B4 M40-A1/M40-B4
M74 LG3 M74-B1/M74-B1 M74-A1/M74-B1
M47 LG4 M47-B1/M47-B1 M47-A1/M47-B1
M46 LG5 M46-B1/M46-B1 M46-A1/M46-B1
M41 LG6 M41-B1/M41-B1 M41-A1/M41-B1
M50 LG6 M50-B1/M50-B1 M50-A1/M50-B1
M58 LG7 M58-B1/M58-B1 M58-A1/M58-B1
1) cleaved amplified polymorphic sequence
2) The combination Stalbicans·Stalbicans could not be investigated directly, since it is not realizable genetically. All alleles presented for Stalbicans reassemble the restriction patterns of hjohansen (A genome) described in Table 4.
RAUWOLF et al. 2008, SUPPLEMENTAL FIGURE 1, page 1 of 2
SUPPLEMENTAL FIGURE 1 (panal A). - Crossing scheme that established the hybrid Oe. elata subsp. elata strain johansen with plastome III of Oe. glazioviana strain lamarckiana Sweden (hjohansen·hjohansen IIIlam). The final hybrid is marked in blue. The intermediate crossing product Galbicans·hjohansen is marked in red. The hybrid was produced four times during the crossing program, but homologous recombination or free segregation of chromosomes between the haploid genomes Galbicans and hjohansen was fairly no detected (see Text). RAUWOLF et al. 2008, SUPPLEMENTAL FIGURE 1, page 2 of 2
Symbols
Galbicans = egg cell or α-complex of Oe. biennis strain suaveolens Grado (Galbicans·Gflavens) [α-complex ♀; β-complex ♀♂]
Frflavens = pollen or β-complex of Oe. biennis strain suaveolens Friedrichshagen (Fralbicans·Frflavens) [α-complex ♀; β-complex ♀♂]; the complex is facultative found in egg cells hjohansen = lethal free or haplo-complex of Oe. elata subsp. hookeri strain johansen (hjohansen·hjohansen) [haplo-complex ♀♂]
Stpercurvans = pollen or β-complex of Oe. oakesiana strain ammophila Standard (Strigens·Stpercurvans) [α-complex ♀; β-complex ♂]
Stundans = pollen or β-complex of Oe. villiosa subsp. villiosa strain bauri Standard (Stlaxans·Stundans) [α-complex ♀; β-complex ♂]
Ijoh = basic plastome type I from Oe. elata subsp. hookeri strain johansen
IIIlam = basic plastome type III from Oe. glazioviana strain lamarckiana Sweden
IVatro = basic plastome type IV form Oe. parviflora strain atrovirens Standard
Ijohζ = plastome mutant ζ of plastome Ijoh; it occurred spontaneous in johansen Ijoh, during the crossing program; bleached phenotype
IIIlamβ = plastome mutant β of plastome IIIlam; bleached phenotype
IVatroδ = plastome mutant δ of plastome IVatro; bleached phenotype
7 prs. = chromosome configuration of seven bivalents (pairs) in diakinesis
4, 4, 3 prs. = chromosome configuration of two rings of four chromosomes and three free bivalents (pairs) in diakinesis
14 = chromosome configuration of a ring of 14 chromosomes in diakinesis; free segregation of chromosomes and of homologous recombination is suppressed in such a hybrid white or green = Plastome mutants were used in these crosses to mark different plastome types; due to somatic segregation, sorting out of the two plastome types occurs during development; in the crossing program either white branches (carrying exclusively the mutated plastome) or green branches (with wild-type plastomes), were used.
SUPPLEMENTAL FIGURE 1 (panel B). - List of symbols used in supplemental Figure 1 (panel A). RAUWOLF et al. 2008, SUPPLEMENTAL FIGURE 2, page 1 of 1
SUPPLEMENTAL FIGURE 2. - BamHI restriction pattern of the Oenothera rrn16-trnIGAU spacer region. So far, 17 alleles could be identified (Table 3), of which 13 can be distinguished by a BamHI digest on 2% agarose gels (lanes 2-14). Most headings represent allele names as defined in Table 3. Alleles not defined there, e.g. I1/2 (lane 2), represent two not distinguishable alleles via a BamHI digest on 2-3% agarose gels. The first lane (M) shows a 100 bp ladder (New England BioLabs, Ipswich, MA).