Supplementary Table 1. List of Genes Up-Regulated in LPAR6 Knocked Down Cells
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  Strategies to Increase ß-Cell Mass ExpansionThis electronic thesis or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ Strategies to increase -cell mass expansion Drynda, Robert Lech Awarding institution: King's College London The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENCE AGREEMENT Unless another licence is stated on the immediately following page this work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International licence. https://creativecommons.org/licenses/by-nc-nd/4.0/ You are free to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 02. Oct. 2021 Strategies to increase β-cell mass expansion A thesis submitted by Robert Drynda For the degree of Doctor of Philosophy from King’s College London Diabetes Research Group Division of Diabetes & Nutritional Sciences Faculty of Life Sciences & Medicine King’s College London 2017 Table of contents Table of contents .................................................................................................
- 
												  Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
- 
												  A Guide to Glutamate ReceptorsA guide to glutamate receptors 1 Contents Glutamate receptors . 4 Ionotropic glutamate receptors . 4 - Structure ........................................................................................................... 4 - Function ............................................................................................................ 5 - AMPA receptors ................................................................................................. 6 - NMDA receptors ................................................................................................. 6 - Kainate receptors ............................................................................................... 6 Metabotropic glutamate receptors . 8 - Structure ........................................................................................................... 8 - Function ............................................................................................................ 9 - Group I: mGlu1 and mGlu5. .9 - Group II: mGlu2 and mGlu3 ................................................................................. 10 - Group III: mGlu4, mGlu6, mGlu7 and mGlu8 ............................................................ 10 Protocols and webinars . 11 - Protocols ......................................................................................................... 11 - Webinars ......................................................................................................... 12 References and further reading . 13 Excitatory synapse pathway
- 
												  P2Y6 Receptors Regulate CXCL10 Expression and Secretion in Mouse Intestinal Epithelial Cellsfphar-09-00149 February 26, 2018 Time: 17:57 # 1 ORIGINAL RESEARCH published: 28 February 2018 doi: 10.3389/fphar.2018.00149 P2Y6 Receptors Regulate CXCL10 Expression and Secretion in Mouse Intestinal Epithelial Cells Mabrouka Salem1,2, Alain Tremblay2, Julie Pelletier2, Bernard Robaye3 and Jean Sévigny1,2* 1 Département de Microbiologie-Infectiologie et d’Immunologie, Faculté de Médecine, Université Laval, Québec City, QC, Canada, 2 Centre de Recherche du CHU de Québec – Université Laval, Québec City, QC, Canada, 3 Institut de Recherche Interdisciplinaire en Biologie Humaine et Moléculaire, Université Libre de Bruxelles, Gosselies, Belgium In this study, we investigated the role of extracellular nucleotides in chemokine (KC, MIP- 2, MCP-1, and CXCL10) expression and secretion by murine primary intestinal epithelial cells (IECs) with a focus on P2Y6 receptors. qRT-PCR experiments showed that P2Y6 was the dominant nucleotide receptor expressed in mouse IEC. In addition, the P2Y6 Edited by: ligand UDP induced expression and secretion of CXCL10. For the other studies, we Kenneth A. Jacobson, −=− National Institutes of Health (NIH), took advantage of mice deficient in P2Y6 (P2ry6 ). Similar expression levels of P2Y1, −=− United States P2Y2, P2X2, P2X4, and A2A were detected in P2ry6 and WT IEC. Agonists of Reviewed by: TLR3 (poly(I:C)), TLR4 (LPS), P2Y1, and P2Y2 increased the expression and secretion Fernando Ochoa-Cortes, of CXCL10 more prominently in P2ry6−=− IEC than in WT IEC. CXCL10 expression Universidad Autónoma de San Luis −=− Potosí, Mexico and secretion induced by poly(I:C) in both P2ry6 and WT IEC were inhibited by Markus Neurath, general P2 antagonists (suramin and Reactive-Blue-2), by apyrase, and by specific Universitätsklinikum Erlangen, Germany antagonists of P2Y1, P2Y2, P2Y6 (only in WT), and P2X4.
- 
												  Transcriptomic Profiling of Pancreatic Alpha, Beta and Delta Cell Populations Identifies Delta Cells As a Principal Target for Ghrelin in Mouse IsletsDiabetologia (2016) 59:2156–2165 DOI 10.1007/s00125-016-4033-1 ARTICLE Transcriptomic profiling of pancreatic alpha, beta and delta cell populations identifies delta cells as a principal target for ghrelin in mouse islets Alice E. Adriaenssens1 & Berit Svendsen2,3 & Brian Y. H. Lam1 & Giles S. H. Yeo1 & Jens J. Holst2,3 & Frank Reimann1 & Fiona M. Gribble 1 Received: 15 March 2016 /Accepted: 1 June 2016 /Published online: 7 July 2016 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract using islets with delta cell restricted expression of the calcium Aims/hypothesis Intra-islet and gut–islet crosstalk are critical reporter GCaMP3, and in perfused mouse pancreases. in orchestrating basal and postprandial metabolism. The aim Results A database was constructed of all genes expressed in of this study was to identify regulatory proteins and receptors alpha, beta and delta cells. The gene encoding the ghrelin underlying somatostatin secretion though the use of receptor, Ghsr, was highlighted as being highly expressed transcriptomic comparison of purified murine alpha, beta and enriched in delta cells. Activation of the ghrelin receptor and delta cells. raised cytosolic calcium levels in primary pancreatic delta Methods Sst-Cre mice crossed with fluorescent reporters were cells and enhanced somatostatin secretion in perfused used to identify delta cells, while Glu-Venus (with Venus re- pancreases, correlating with a decrease in insulin and gluca- ported under the control of the Glu [also known as Gcg]pro- gon release. The inhibition of insulin secretion by ghrelin was moter) mice were used to identify alpha and beta cells.
- 
												  Activation of Hypermethylated P2RY1 Mitigates Gastric Cancer by Promoting Apoptosis and Inhibiting ProliferationActivation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation Yinggang Hua Xiamen University Medical College Long Li Xiamen University Medical College Liangliang Cai Zhongshan Hospital Xiamen University Guoyan Liu ( [email protected] ) Zhongshan Hospital Xiamen University Research Article Keywords: Diffuse type gastric cancer, DNA methylation 450K array, P2RY1 receptor, ERK signal pathway, Tumor suppressor gene Posted Date: July 26th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-351723/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/16 Abstract P2RY1 receptor is known to cause cancer by activating the ERK signal pathway, its DNA methylation status or even the corresponding regulatory mechanism remains unknown. In this study, DNA methylation chip was used to prole the genome-wide DNA methylation level in gastric cancer tissues. Proliferation and apoptosis of the SGC7901 gastric cancer cell line were determined after treatment with a selective P2RY1 receptor agonist, MRS2365. The promoter region of P2RY1 was found to be highly methylated with 4 hypermethylated sites (|Δβ value| >0.2) in diffuse gastric cancer and then were validated by bioinformatic analysis in TCGA database. Analysis of MRS2365-treated cells by annexin-V/PI staining and Caspase-3 activity assays indicated the induction of apoptosis in SGC7901 cells. P2RY1 receptor activation in human SGC7901 gastric cancer cells via the MRS2365 agonist induced apoptosis and reduced cell growth. High DNA methylation in the promoter region of P2RY1 may have contributed to the reduced expression of P2RY1’s mRNA, which is likely responsible for the “aggressive” nature of the diffuse type gastric cancer.
- 
												  Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MSProtein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
- 
												  Lysophosphatidic Acid Signaling in the Nervous SystemNeuron Review Lysophosphatidic Acid Signaling in the Nervous System Yun C. Yung,1,3 Nicole C. Stoddard,1,2,3 Hope Mirendil,1 and Jerold Chun1,* 1Molecular and Cellular Neuroscience Department, Dorris Neuroscience Center, The Scripps Research Institute, La Jolla, CA 92037, USA 2Biomedical Sciences Graduate Program, University of California, San Diego School of Medicine, La Jolla, CA 92037, USA 3Co-first author *Correspondence: [email protected] http://dx.doi.org/10.1016/j.neuron.2015.01.009 The brain is composed of many lipids with varied forms that serve not only as structural components but also as essential signaling molecules. Lysophosphatidic acid (LPA) is an important bioactive lipid species that is part of the lysophospholipid (LP) family. LPA is primarily derived from membrane phospholipids and signals through six cognate G protein-coupled receptors (GPCRs), LPA1-6. These receptors are expressed on most cell types within central and peripheral nervous tissues and have been functionally linked to many neural pro- cesses and pathways. This Review covers a current understanding of LPA signaling in the nervous system, with particular focus on the relevance of LPA to both physiological and diseased states. Introduction LPA synthesis/degradative enzymes (reviewed in Sigal et al., The human brain is composed of approximately 60%–70% lipids 2005; Brindley and Pilquil, 2009; Perrakis and Moolenaar, by dry weight (Svennerholm et al., 1994). These lipids can be 2014). In view of the broad neurobiological influences of LPA divided into two major pools, structural and signaling, which signaling, its dysregulation may lead to diverse neuropathologies include well-known families such as cholesterol, fatty acids, ei- (Bandoh et al., 2000; Houben and Moolenaar, 2011; Yung et al., cosanoids, endocannabinoids, and prostaglandins (Figure 1).
- 
												  Interplay Between Gating and Block of Ligand-Gated Ion Channelsbrain sciences Review Interplay between Gating and Block of Ligand-Gated Ion Channels Matthew B. Phillips 1,2, Aparna Nigam 1 and Jon W. Johnson 1,2,* 1 Department of Neuroscience, University of Pittsburgh, Pittsburgh, PA 15260, USA; [email protected] (M.B.P.); [email protected] (A.N.) 2 Center for Neuroscience, University of Pittsburgh, Pittsburgh, PA 15260, USA * Correspondence: [email protected]; Tel.: +1-(412)-624-4295 Received: 27 October 2020; Accepted: 26 November 2020; Published: 1 December 2020 Abstract: Drugs that inhibit ion channel function by binding in the channel and preventing current flow, known as channel blockers, can be used as powerful tools for analysis of channel properties. Channel blockers are used to probe both the sophisticated structure and basic biophysical properties of ion channels. Gating, the mechanism that controls the opening and closing of ion channels, can be profoundly influenced by channel blocking drugs. Channel block and gating are reciprocally connected; gating controls access of channel blockers to their binding sites, and channel-blocking drugs can have profound and diverse effects on the rates of gating transitions and on the stability of channel open and closed states. This review synthesizes knowledge of the inherent intertwining of block and gating of excitatory ligand-gated ion channels, with a focus on the utility of channel blockers as analytic probes of ionotropic glutamate receptor channel function. Keywords: ligand-gated ion channel; channel block; channel gating; nicotinic acetylcholine receptor; ionotropic glutamate receptor; AMPA receptor; kainate receptor; NMDA receptor 1. Introduction Neuronal information processing depends on the distribution and properties of the ion channels found in neuronal membranes.
- 
												  Datasheet: VMA00346 Product DetailsDatasheet: VMA00346 Description: MOUSE ANTI AKR1C2 Specificity: AKR1C2 Format: Purified Product Type: PrecisionAb™ Monoclonal Isotype: IgG2a Quantity: 100 µl Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Product Form Purified IgG - liquid Preparation Mouse monoclonal antibody prepared by affinity chromatography on Protein G Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide (NaN3) Stabilisers Immunogen Recombinant human AKR1C2 External Database Links UniProt: P52895 Related reagents Entrez Gene: 1646 AKR1C2 Related reagents Synonyms DDH2 Specificity Mouse anti Human AKR1C2 antibody recognizes the aldo-keto reductase family 1 member C2, also known as 3-alpha-HSD3, DD-2, DD/BABP, aldo-keto reductase family 1 member C2, Page 1 of 2 chlordecone reductase homolog HAKRD, dihydrodiol dehydrogenase 2, bile acid binding protein, 3-alpha hydroxysteroid dehydrogenase, type III, pseudo-chlordecone reductase, testicular 17,20-desmolase deficiency, trans-1,2-dihydrobenzene-1,2-diol dehydrogenase and type II dihydrodiol dehydrogenase. Encoded by the AKR1C2 gene, aldo-keto reductase family 1 member C2 is a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins.
- 
												  Supplementary Table 1: Adhesion Genes Data SetSupplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
- 
												  Type of the Paper (ArticleSupplementary Material A Proteomics Study on the Mechanism of Nutmeg-induced Hepatotoxicity Wei Xia 1, †, Zhipeng Cao 1, †, Xiaoyu Zhang 1 and Lina Gao 1,* 1 School of Forensic Medicine, China Medical University, Shenyang 110122, P. R. China; lessen- [email protected] (W.X.); [email protected] (Z.C.); [email protected] (X.Z.) † The authors contributed equally to this work. * Correspondence: [email protected] Figure S1. Table S1. Peptide fraction separation liquid chromatography elution gradient table. Time (min) Flow rate (mL/min) Mobile phase A (%) Mobile phase B (%) 0 1 97 3 10 1 95 5 30 1 80 20 48 1 60 40 50 1 50 50 53 1 30 70 54 1 0 100 1 Table 2. Liquid chromatography elution gradient table. Time (min) Flow rate (nL/min) Mobile phase A (%) Mobile phase B (%) 0 600 94 6 2 600 83 17 82 600 60 40 84 600 50 50 85 600 45 55 90 600 0 100 Table S3. The analysis parameter of Proteome Discoverer 2.2. Item Value Type of Quantification Reporter Quantification (TMT) Enzyme Trypsin Max.Missed Cleavage Sites 2 Precursor Mass Tolerance 10 ppm Fragment Mass Tolerance 0.02 Da Dynamic Modification Oxidation/+15.995 Da (M) and TMT /+229.163 Da (K,Y) N-Terminal Modification Acetyl/+42.011 Da (N-Terminal) and TMT /+229.163 Da (N-Terminal) Static Modification Carbamidomethyl/+57.021 Da (C) 2 Table S4. The DEPs between the low-dose group and the control group. Protein Gene Fold Change P value Trend mRNA H2-K1 0.380 0.010 down Glutamine synthetase 0.426 0.022 down Annexin Anxa6 0.447 0.032 down mRNA H2-D1 0.467 0.002 down Ribokinase Rbks 0.487 0.000