Current Science International Volume : 07 | Issue : 01| Jan.- Mar. | 2018 ISSN: 2077-4435 Pages: 101-115

Association of KRT35, KRT2.10 and BFMS Polymorphisms with Wool Quality Traits in Egyptian Sheep Breeds

Haidan M. El-Shorbagy1, Eman H. El-Awad1, Hassan R. Darwish2, Mahmoud M. Amer1 and Ibrahim M. Farag2

1Department of Zoology, Faculty of Science, Cairo University, Egypt. 2Cell Biology Department, National Research Centre, Dokki, Giza, P.O. Box 12622, Egypt. Received: 12 Feb. 2018 / Accepted: 21 Mar. 2018 / Publication date: 31 Mar. 2018

ABSTRACT

This study approach aimed to identify the genetic polymorphisms of some genes that have notable effect on wool quality traits in Egyptian sheep breeds, including staple length (STL), fiber diameter (FD), staple strength (STR) and clean fleece weight (CFW). KRT35 and KRT2.10 (KRT83) genes that code for the keratin intermediate-filament proteins (KRTs) along with microsatellites BFMS were targeted for this investigation. Data from PCR-SSCP assay of the KRT2.10 gene showed one PCR- SSCP pattern, confirmed by RFLP analysis using restriction enzyme (Bse3D I) showing one genotype of KRT2.10 gene with one undigested band at 191 bp. On the other hand, KRT35 using PCR-SSCP analysis revealed three different banding patterns corresponding to three genotypes AA, AB and AC (with frequencies 0.92, 0.02, 0.05 respectively). Sequencing analysis of different KRT35 genotypes revealed that A allele represents substitution of G/A at position 4016, allele B showed substitution of G/A at position 4056, and allele C revealed substitution of C/T at position 4027. This is the first study that recorded new SNPs for KRT 35 gene submitted in the DNA Data Bank of Japan (DDBJ) with Accession No LC191188, LC192801 and LC192802.1 for A/A, G/A and C/T respectively. AA genotype of KRT35 gene exhibited the highest degree of association with STR (P < 0.05) in all breeds except in Barki, whereas it exhibited the highest degree of association with STL (P<0.05) in Barki breed only. Standard polyacrylamide gel (PAGE) analysis of BFMS microsatellites revealed three different banding patterns corresponding to three genotypes frequencies AB (0.50), AC (0.25), BC (0.25). Sequencing analysis of BFMS revealed three different DNA sequences with different CA microsatellite repeats AB (17 CA) repeats, BC (13 CA) repeats and AC (14 CA) repeats. Only AB and AC genotypes showed significant effect P< 0.05 with wool traits. AC genotype exhibited the highest degree of association with (STL) (P < 0.04) in Barki, and genotype AB exhibited the highest degree of association with (STR) (P < 0.01) in Rahmani. This study adds evidence for using the polymorphisms of KRT35 and BFMS as gene markers of wool quality traits for effective selection program in Egyptian sheep breeds.

Key words: Clean fleece weight KRT2.10 gene, KRT35 gene, microsatellite (BFMS), Ovis aries, single strand conformation polymorphism, Restriction fragment length polymorphism

Introduction

Sheep are valuable resource for the animal fiber industry. In Egypt, Ossimi, Rahmani and Barki are the main sheep breeds that represent 65% of the total population (Galal, 2006). It is important to explore the inherent potential of native sheep in order to improve the quality of their wool and to select the best breeding stock of the next generation. Identification of genetic markers and vital genes which responsible for wool growth and quality traits is important for genetic enhancement of wool sheep (Dominik 2005; Ian William and Ian Robert 2005; Lamy et al. 2009; Rong et al. 2015). Genetic marker identification can be also used to develop transgenic lines and/or to introduce new therapeutic agents that can be used to modify the desirable attributes of fiber by changing gene expression (Ian William and Ian Robert 2005). Keratin intermediate-filament proteins (KRT) and keratin intermediate filament-associated proteins (KAP) are the main proteins constituents that make up the wool fiber (Powell and Rogers 1994;

Corresponding Author: Haidan M. El-Shorbagy, Department of Zoology, Faculty of Science, Cairo University, Egypt. Email: [email protected] 101 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435

Phuaa et al. 2015). They are encoded by the keratin genes (KRT) and keratin-associated protein genes (KRTAP), respectively. KRTs form filaments that imbedded within a matrix of the KAP proteins (Hediger et al. 1991; Ahlawat et al. 2014). It is plausible that variations in the KRT genes which alter protein products could affect the characteristics of wool fibers. The association of genetic markers for the KRT proteins and KAPs has been reported with variation in fiber diameter (Parsons et al. 1996; Beh et al. 2001), staple strength (Rogers et al. 1994; Rogers 1994), and wool color and brightness (McKenzie Grant 2002). Moreover, two alleles at BFMS microsatellite locus were found to be significantly associated with the variation of clean fleece weight (CFW) and greasy fleece weight (GFW) (Bot et al. 2004). Here, the authors performed the association analysis of the single nucleotide polymorphism (SNP) markers in two Ovine KRT genes and BFMS microsatellite regions with wool quality traits. Polymorphisms have been analyzed using different techniques including restriction fragment length polymorphisms (RFLPs), polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) and standard polyacrylamide gel (PAGE); and further confirmed by sequencing selective samples from different patterns, to determine the effect of these variations on wool quality traits within Egyptian domestic sheep.

Materials and Methods

Chemicals

All chemicals were of analytical grade and were purchased from Sigma-Aldrich (St. Louis, MO).

Animals

The study has been conducted with four breeds of Egyptian domestic sheep (32 months of age): Barki (14 males and 20 females), Rahmani (9 males and 12 females), Ossimi (9 males and 13 females), and one cross-bred Ossimi x Barki (10 males and 10 females). Barki breed was collected from Nubaria Farm, National Research Centre, Egypt, while other breeds were sourced from two animal production farms belong to Faculty of Agriculture, Ain Shams University and Faculty of Agriculture, Al-Azhar University, Egypt. This study was performed according to authorization and granted by the National Research Center. All procedures involving animals were approved by the Institutional Animal Care and Use Committee (IACUC), Faculty of Science, Cairo University, Egypt with Permit Number: CUFS F Mol. Biol. 50 15.

Measurements of wool traits

Left mid-side wool samples were taken from animals and fleece samples were analyzed at Desert Research Center (DRC) Helmeyat AZ Zaytoun, Qesm Al Matareyah, Cairo Governorate. Ten staples were taken from each greasy sample and used for measuring the percentages of staple length (STL), fiber diameter (FD), staple strength (STR) and clean fleece weight (CFW) (El-Gabbas 1998). FD and CFW were measured as mentioned in our previously published study (Darwish et al. 2017), while STR and STL Measurements were as follow: Staple strength was estimated by measuring the force required to break the staple in Newton and dividing this value by the thickness of the staple in Kilotex. Two staples have been plucked at random from each greasy sample to be prepared for measuring their strength using the Agritest Staple Breaker (Caffin 1980) and to be in harmonious with the procedure displayed by (El-Gabbas 1999). Staple length was the average of 10 staples; measurements were made from the base to the dense part of the tip of the staple to the nearest 0.5 cm (Chapman 1960).

Blood sample collection and DNA extraction

Eight ml blood were collected from each animal, by jugular vein puncture.in vaccutioner tube containing EDTA as anticoagulant. Blood was transported to the laboratory in thermocol box on ice. The genomic DNA was extracted from blood using GeneJET mini kit (Thermo scientific Co. Lot

102 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435 number (00174737), USA) and processed using the manufacturer’s protocol. DNA concentration was determined, using Nano Drop1000 Thermo Scientific spectrophotometer. The quality of DNA was checked by 1.5% Ethidium Bromide stained agarose gel electrophoresis on UV trans- illuminator.

PCR amplification

All the primer sequences used in the study were obtained from previously published literature Table (1). All primers were synthesized by (Thermo-Scientific, USA). The PCR reaction mixture was set up in a total volume of 50µl containing: 21 l autoclaved ultrafiltered water, 2 l template DNA (50 ng), 1 l forward primer (100 pmol), 1 l reverse primer (100 pmol), and finally 25 l Taq enzyme (Qiagen).The amplification included initial denaturation at 94 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 30 seconds, annealing at the temperature specified in Table 1 for 30 seconds and extension at 72 °C for 45 seconds, with a final extension of 72 °C for 7 min. Finally, the PCR products were stored at 4°C. The amplicons were checked by 1.5% agarose gel electrophoresis at 85V for 30 min and was visualized under UV light and photographed by BioRad Documentation System Hercules, CA, USA.

Table 1: Primer sequences and source references for each locus investigated Annealing Product size Reference Locus Primer sequence temp (bp) source (o C) Forward primer: AAGCCAAGGCCATTGTATCCA (Yu et al. KRT35 57 241 Reverse primer: 2011) AAAACCTGACCCAGGAGGCA Forward primer: (Rogers ATGGCCTGCCTGCTCAAGGAGTAC KRT2.10 60 191 1994) Reverse primer: NC_019460.2 CTTAGGACTGAGACTAGGATGAGG Forward primer: CAACGGTCTGCAACCGAATTACC (Bot et al. BFMS 58 200 Reverse primer: 2004) CAATCCGTGGGTTGGAACACAA

Genotyping

I-Single Strand Conformational Polymorphism Analysis (SSCP)

5 µl of the purified PCR products were mixed with 5 µl of denaturing loading dye (95% formamide, 0.1% bromophenol blue, 0.1% xylene cyanol FF and 0.5 µl of 15 % Ficoll ), and 5 µl of TE buffer then the mixture was denatured by heating at 95°C for 5 min, and was immediately chilled on ice for 10 min (Gasser et al. 2006).The denaturized PCR samples were subjected to 12 % polyacrylamide gel electrophoresis (acrylamide: bisacrylamide = 29: 1 v/v). Each gel (8 cm x 7.3 cm x 1 mm) was cast using the Bio-Rad mini Protean II ™ set. Polyacrylamide gel (10 ml) was prepared by mixing 4ml of 30% acrylamide / bisacrylamide mixture, 1ml of 10% TBE buffer, 5ml of sterile double distilled water, 50 µl of 10% ammonium persulphate (freshly prepared) and at the last 5 µl of TEMED (tetramethylethylenediamine) in Erlenmeyer flask. Total 15 µl of each denaturized PCR sample were loaded. Specific SSCP gel electrophoresis conditions were performed for each locus used (Table 2). The gel was stained for 10 min in 100 ml of 1x TBE with Ethidium bromide to visualize the DNA bands using UV transilluminator (Stratagene, USA) and a picture of the DNA separation pattern was taken with a Medidoc gel documentation system (Herolab, Wiesloch, Germany).

Table 2: The optimized SSCP conditions for the investigated loci. Locus Run length (hrs) Voltage (V) KRT2.10 3.30 80 KRT35 5.30 75 BFMS 3.0 80

103 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435

II- RFLP assay for KRT2.10 gene

The PCR amplified product of KRT 2.10 locus was digested by incubating a mixture of 4 ml of PCR product, 1 ml of enzyme buffer, 4.6 ml of distilled water, and 0.3 ml of (Bse3D I) in 10 μl reaction volume at 60 °C for one hour. 10 ml of samples were electrophoresed in 2% agarose gel at a constant 80 V and 60 mA, and the genotyping patterns were photographed by Bio-Rad Documentation System (USA). Photographs were analyzed using LabImage Platform 3.2, Kapelan Bio-Imaging, Germany.

III- DNA sequencing

Sex samples of PCR amplicons representative of different SSCP patterns (two samples for each pattern) were selected for DNA sequencing. The selected PCR products were electrophoresed on 2% agarose gel and purified using QIAquick® Gel Extraction Kit (QIAGEN, USA), according to the manufacturer’s recommendations. The samples were sequenced in both directions by the dideoxy chain termination method, using the original set of primers. DNA sequencing was performed on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, USA), using ABI PRISM®BigDye™ Terminator v3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems, USA). Sequence alignments were compared against the corresponding KRT35 gene sequence in NCBI database (Genbank accession number NM_001114761.1, flanking region (1421 to 1661), and to the corresponding flanking region (849…1029) of BFMS microsatellite (Genbank accession number NC_019477.2) in Ski2 like RNA helicase (SKIV2L) gene. Sequence alignments were analyzed by cluster wide analysis using CodonCode Aligner software, Codon-Code Corporation, USA. The nucleotide sequences of the new KRT35 gene variants were submitted to DDBJ.

Statistical analysis

Genetic equilibrium for Egyptian sheep breeds were assessed according to Hardy-Weinberg equilibrium (HWE) and chi-square test by using SAS Genetics (v9.3, SAS Institute Inc., Cary, NC, USA). The effect of KRT35 and BFMS alleles on wool traits of Egyptian sheep was estimated by using general linear model (GLM) procedure and the least squares means of the genotypes were compared by the Tukey-Kramer test. The odds ratios were processed to evaluate the power of the relationship between KRT35 and BFMS genes polymorphisms and wool characteristics of Egyptian sheep. Significance was set at P ≤ 0.05, P ≤ 0.01 and P ≤ 0.001. All statistical analyses were performed by applying SAS program (v9.3, SAS Institute Inc., Cary, NC, USA).

Results

All the sheep blood samples generated PCR amplicons of the expected size (191, 241 and 200 bp) for KRT2.10, KRT35 and BFMS respectively.

Genotyping of KRT2.10 gene

There was only one pattern among all tested breeds after either SSCP or RFLP analysis using restriction enzyme (Bse3D I), confirming the persistence of only two alleles representing KRT2.10 gene (Fig.1).

Genotyping of KRT35 gene

KRT35 amplicons revealed three different patterns (AA, AB, and AC) upon SSCP analysis (Fig. 2), where AA genotype showed the highest frequency among them within all tested breeds, followed by AC genotype, while AB was the least frequent genotype. Among the investigated breeds, allele A was the most common and could be detected in all tested breeds while allele C could not be detected in O*B and allele B could not be found in Rahmani and Ossimi breeds, and thus AA genotype has considered as the wild type in our sample population. Genetic equilibrium was estimated based upon

104 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435 the Hardy-Weinberg equilibrium and Chi-square test and showed that the number of individuals with A allele is unequal to that of B or C alleles. Results showed that genotype distributions of KRT35 are not in agreement with Hardy-Weinberg equilibrium (P > 0.05) (Table 3).

Fig. 1: (A) PCR-SSCP assay of the ovine KRT2.10 gene showing one PCR-SSCP pattern. (B) RFLP analysis using restriction enzyme (Bse3D I) confirming one genotype of KRT2.10 gene with one undigested band at 191 bp.

A

B

Fig. 2: (A) PCR-SSCP of the ovine KRT35 gene in Sheep showing the three unique PCR-SSCP patterns corresponding to three alleles sequences A, B, C. (B) Sequencing analysis of the three PCR- SSCP patterns for PCR products of KRT35 gene.

105 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435

Table 3: Genotype distribution and allelic frequencies at the KRT35 locus of the Barki, Rahmani, Ossimi, and cross breed Ossimi* Barki Egyptian sheep. Observed genotypes and frequencies Allelic frequencies

Breed AA AB AC A B C χ2 P- value Total Barki 90.32 3.23 6.45 31 0.951 0.016 0.032 106.67 <0.0001a (28) (1) (2) Rahmani 93.75 0.00 6.25 16 0.968 0.00 0.031 28.12 <0.0001a (15) (0) (1) Ossimi 90.91 0.00 9.09 22 0.954 0.00 0.045 36.36 <0.0001a (20) (0) (2) O*B 94.74 5.26 0.00 19 0.973 0.026 0.00 34.10 <0.0001a (18) (1) (0) Total 81 2 5 88 3.3220 0.7675 AA, AB and AC genotype frequencies was at the KRT35 locus; n = 88 sheep; genotypes and alleles frequencies were assessed according to Hardy-Weinberg equilibrium (HWE) and χ2, chi-square value. The number of animals per genotype is indicated in parentheses.

Sequencing of PCR amplicons representative of the different SSCP patterns showed A allele that represents the substitution of G/A at position 4016 and this substitution could be detected in all sequenced samples. Two samples out of sex demonstrating allele B with G/A substitution at position 4056, and two samples out of sex showing allele C revealed the substitution of C/T at position 4027 on the wild type KRT35 gene (GU456629). Authors have found no any recorded SNPs within this region, and thus they submitted the new SNPs in the DNA Data Bank of Japan (DDBJ) with Accession No LC191188, LC192801 and LC192802.1 for A/A, G/A and C/T respectively. All the recorded SNPs have been found out of the coding sequences. The B and C alleles were defined as the nucleotide sequences with variants, and the A allele as the sequence without variant.

Effect of KRT35 genotypes on wool traits

The effects of KRT35 genotypes on wool characteristics of Egyptian sheep, like fiber diameter (FD) staple strength (STR), staple length (STL), and clean fleece weight (CFW), were chosen to be studied in this research work. The least square means and standard error for the effect of KRT35 genotypes on wool traits are presented in table 4. According to the statistical analysis, no significant effect (P > 0.05) of different KRT35 genotypes was found on FD, STR, STL, and CFW parameters (table 4). In order to identify which genotype has the greatest grade of association with wool characteristics, the binary logistic regression had applied to obtain the odds ratio (OR) of each genotype. The results indicated that the individuals of genotype AB and AC showed no significant association with FD, STL, STR, and CFW as displayed in table 5. Conversely, AA genotype exhibited the highest degree of association with STR (P < 0.05) in all breeds except in Barki, whereas it exhibited the highest degree of association with STL (P < 0.05) in Barki breed only (Table 5).

Genotyping of BFMS microsatellite

BFMS microsatellite revealed three different patterns (AB, AC, and BC) upon PAGE analysis (Fig.3). Sequencing of PCR amplicons representative of different PAGE patterns revealed three different DNA sequences with different CA microsatellite repeats: two of the sex samples showed (AB) genotype with 17 CA repeats, two samples showed (BC) genotype with 13 CA repeats and finally the remaining two samples showed (AC) genotype with 14 CA repeats (Fig.3). Among the investigated sheep breeds, Rahmani breed is the only one that show significant genotype distribution (P < 0.0074) and thus are not in agreement with Hardy-Weinberg equilibrium (Table 6).

106 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435

Table 4: The effect of KRT35 genotypes on fiber diameter (FD), staple strength (STR), staple length (STL), and clean fleece weight (CFW). KRT35 Number genotypes of FD STR STL CFW animals/ genotypes LSM±SE P LSM±SE P LSM±SE P LSM±SE P Barki AA 28 29.58± 0.66 34.08± 3.0 5.79± 0.63 67.61± 1.57 AB 1 25.72± 3.49 44.86± 15.87 5.33± 3.34 70.05± 8.35 AC 2 25.65 ± 2.47 19.71 ± 11.0 6.00 ± 2.36 67.47 ± 5.90 AA-AB 3.86 0.28 -10.77 0.51 0.46 0.89 -2.43 0.77 AA-AC 3.93 0.13 14.37 0.22 - 0.20 0.93 0.14 0.98 AB-AC 0.06 0.98 25.15 0.20 - 0.67 0.87 2.58 0.80 Rahmani AA 15 30.49 ±1.96 25.48 ± 2.42 7.40 ± 1.05 61.61 ± 2.11 AC 1 27.95 ± 7.59 29.28 ± 9.39 8.50 ± 4.09 65.21 ± 8.20 AA-AC 2.54 0.75 - 3.79 0.70 -1.10 0.79 -3.59 0.67 Ossimsi AA 20 31.01 ± 1.05 45.33 ± 3.83 7.01 ± 0.38 59.31 ± 2.11 AC 2 33.025 ± 3.32 58.43 ± 12.11 8.33 ± 1.20 71.42 ± 6.69 AA-AC -2.0 0.57 -13.09 0.31 - 1.31 0.31 -12.10 0.10 O*B AA 18 29.09 ± 0.80 45.60 ± 3.43 8.03 ± 0.50 69.16 ± 1.37 AB 1 28.90 ± 3.40 36.69 ± 14.57 6.67 ± 2.15 64.48 ± 5.83 AA-AB 0.18 0.95 8.92 0.55 1.36 0.54 4.68 0.44 Results were expressed as least-squares means (LSM) ± standard error (SE); P-value considered statistically significant if P ≤ 0.05.

Effect of BFMS genotypes on wool traits

The effects of BFMS genotypes on wool characteristics of Egyptian sheep, like fiber diameter (FD) staple strength (STR), staple length (STL), and clean fleece weight (CFW), were chosen to be studied in this research work. The least square means and standard error for the effect of BFMS genotypes on wool traits are presented in table 7. According to the statistical analysis, there were significant effect (P≤ 0.05) of AB genotype on (STR) within Barki breed, on (FD), (STL) and (CFW) in Rahmani breed, on (CFW), and (STL) in Ossimi breed, and on (FD) in O*B breed. In addition, AC showed marked effect on (FD) and (CFW) in Rahmani breed, and on (STR), (STL), and (CFW) in Ossimi breeds. While BC genotype showed no significant effect on wool traits. In order to identify which genotype has the greatest grade of association with wool characteristics, the binary logistic regression had applied to obtain the odds ratio (OR) of each genotype. The results indicated that the individuals of genotype BC showed no significant association with FD, STL, STR, and CFW as displayed in table 8. Conversely, AC genotype exhibited the highest degree of association with (STL) (P < 0.04) in Barki only, and genotype AB exhibited the highest degree of association with (STR) (P < 0.01) in Rahmani only (Table 8).

107 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435

Table 5: Association between KRT35 genotypes, fiber diameter (FD) staple strength (STR), staple length (STL), and clean fleece weight (CFW) traits of Barki, Rahmani, Ossimi and cross breed (O*b) Egyptian sheep using binary logistic regression analysis Genotype FD STR STL CFW High% Low% OR coefficient P-value High% Low% OR coefficient P-value High% Low% OR coefficient P-value High% Low% OR coefficient P-value

Barki AA 0.01a 48.28% 51.72% 0.93 -0.06 0.85 51.72% 48.28% 1.07 0.06 0.85 24.14% 75.86 0.31 -1.14 65.52% 34.48% 1.90 0.64 0.1

AC 0.89 0.0% 100.0% >999.9 9.20 0.0% 100.0% >999.9 9.20 0.89 50.0% 50.0% 1.00 0 1.00 100.0% 0.0% >999.9 9.20 0.89

AB 0.89 0.89 0.0% 100.0% >999.9 9.20 100.0% 0.0% >999.9 9.20 0.89 0.0% 100.0% >999.9 9.20 100.0% 0.0% >999.9 9.20 0.89

Rahmani AA 20.0% 80.0% 0.25 -1.38 0.03a 40.0% 0.66 -0.40 46.67% 53.33% 0.87 -0.13 0.79 60.0% 0.44 26.67% 73.33% 0.36 -1.01 0.08

AC 0.0% 100.0% >999.9 9.20 0.89 0.0% 100.0% >999.9 9.20 0.89 0.0% 100.0% >999.9 9.20 0.89 100.0% 0.0% >999.9 9.20 0.89 Ossimi AA 46.67% 53.33% 1.00 0 1.00 20.0% 80.0% 4.00 1.38 0.01a 40.0% 60.0% -0.66 -0.40 0.37 26.67% 73.33% 0.42 -0.84 0.08

AC 0.0% 100.0% 1.00 0 1.00 0.0% 100.0% >999.9 9.20 0.89 100.0% 0.0% >999.9 9.20 0.89 100.0% 0.0% 1.00 0 1.00 O*B AA 52.63% 47.37% 1.11 0.1 0.81 84.21% 15.79% 5.33 1.67 0.01a 63.16% 36.84% 1.71 0.53 0.25 68.42% 31.58% 2.16 0.77 0.11

AB 0.89 0.89 0.0% 100.0% >999.9 9.20 100.0% 0.0% >999.9 9.20 0.89 0.0% 100.0% >999.9 9.20 100.0% 0.0% >999.9 9.20 0.89

FD, fiber diameter; STR, staple strength; STL, staple length; CFW, clean fleece weight; OR, odds ratio and a P <0.05 considered statistically significant.

108 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435

Table 6: Genotype distribution and allelic frequencies at the BFMS locus of the Barki, Rahmani, Ossimi, and cross breed Ossimi* Barki Egyptian sheep. Observed genotypes and frequencies Allelic frequencies

Breed AB AC BC A B C χ2 P- value Total

Barki 56.67 13.33 0.350 0.216 30.00 (9) 30 0.433 (26) 4.30 0.11 (17) (4) (21) (13) Rahmani 80.00 10.00 0.450 0.10 10.00 (2) 20 0.450 (18) 9.80 0.0074a (16) (2) (18) (4) Ossimi 18.18 45.45 0.318 0.409 36.36 (8) 22 0.272 (12) 1.27 0.52 (4) (10) (14) (18) O*B 45.00 35.00 0.40 0.275 20.00 (4) 20 0.325 (13) 0.95 0.62 (9) (7) (16) (11) Total 37.5% 25% 46 23 23 92 37.5%(69) 12.205 0.057 (69) (46) AA, AC and BC genotype frequencies was at the BFMS locus; n = 92 sheep; genotypes and alleles frequencies were assessed according to Hardy-Weinberg equilibrium (HWE) and χ2, chi-square value. The number of animals per genotype is indicated in parentheses.

Fig. 3: (A) PCR-PAGE of the ovine BFMS microsatellite showing three unique PCR-PAGE patterns (LL, SS and LS). (B) Sequencing analysis of the three PCR-PAGE patterns for PCR products of BFMS microsatellite showing the repeat numbers of the three different genotypes.

109 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435

Table 7: The effect of BFMS genotypes on fiber diameter (FD), staple strength (STR), staple length (STL), and clean fleece weight (CFW). BFMS Number genotypes of FD STR STL CFW animal/ genotypes LSM±SE P LSM±SE P LSM±SE LSM±SE P P Barki AB 17 29.39± 0.86 28.10± 3.49 6.12± 0.80 67.30± 1.90 AC 9 28.32± 1.19 39.92± 4.80 4.81± 1.02 65.56± 2.61 BC 4 28.60± 1.78 44.03± 7.20 6.62± 1.65 67.60± 3.92 AB-AC 1.07 0.47 -11.81 0.05 a 1.31 0.34 1.74 0.59 AB-BC 0.78 0.69 15.93 0.05a -0.49 0.78 -0.29 0.94 AC-BC -0.28 0.89 -4.11 0.63 -1.81 0.37 -2.03 0.66 Rahmani AB 16 29.10± 1.40 26.26 ± 2.45 6.06± 0.79 64.04± 1.33 AC 2 44.40± 3.97 30.98± 6.95 13.66± 2.25 64.26± 3.77 BC 2 27.93± 3.97 28.45± 6.95 10.25± 2.25 46.75± 3.77 AB-AC -15.29 0.002a -4.72 0.53 -7.60 0.005a -0.21 0.95 AB-BC 1.17 0.78 -2.19 0.77 -4.18 0.09 17.50 0.0005a AC-BC 16.47 0.009a 2.53 0.80 3.40 0.29 17.50 0.004a Ossimsi AB 4 30.07± 2.26 48.72± 7.22 7.87 ± 0.72 64.46 ± 4.03 AC 8 29.50± 1.59 33.69± 5.11 8.09 ± 0.51 52.35 ± 2.85 BC 10 33.01± 1.43 55.90± 4.57 6.07 ± 0.46 65.25 ± 2.55 AB-AC 0.56 0.83 15.03 0.10 -0.22 0.80 12.11 0.02 a AB-BC -2.94 0.28 -7.18 0.41 1.79 0.05a -0.79 0.87 AC-BC -3.50 0.11 -22.21 0.004a 2.01 0.008a -12.90 0.003a O*B AB 9 30.65± 1.02 46.15± 4.57 8.04± 0.72 68.70± 1.81 AC 4 29.69± 1.53 56.13± 6.85 7.50± 1.08 72.94± 2.72 BC 7 27.21± 1.16 39.66± 5.18 8.08± 0.816 6.28± 2.05 AB-AC 0.96 0.60 - 9.98 0.24 0.54 0.67 - 4.23 0.21 AB-BC 3.44 0.03a 6.48 0.36 -0.03 0.97 2.42 0.38 AC-BC 2.48 0.21 16.47 0.07 - 0.58 0.67 6.66 0.06 Results were expressed as least-squares means (LSM) ± standard error (SE); a means P ≤ 0.05 considered statistically significant between different BFMS genotypes of FD, STR, STL, and CFW.

110 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435

Table 8: Association between BFMS genotypes, fiber diameter (FD) staple strength (STR), staple length (STL), and clean fleece weight (CFW) traits of Barki, Rahmani, Ossimi and cross breed (O*b) Egyptian sheep using binary logistic regression analysis. Genotype FD STR STL CFW High% Low% OR coefficient P-value High% Low% OR coefficient P- value High% Low% OR coefficient P-value High% Low% OR coefficient P-value Barki AB 52.94% 47.06% 1.12 0.11 0.80 35.29% 64.71% 0.54 -0.60 0.23 29.41% 70.59% 0.41 -0.87 0.10 58.8% 41.18% 1.42 0.35 0.46 AC 22.22% 77.78% 0.28 -1.25 0.11 66.67% 33.33% 2.00 0.69 0.32 11.11% 88.89% 0.12 -2.07 0.04a 55.56% 44.44% 1.25 0.22 0.73 BC 50.0% 50.0% 1.00 0 1.00 75.0% 25.00% 3.00 1.09 0.34 50.0% 50.0% 1.00 0 1.00 100.0% 0.0% 999.9 9.20 0.85 Rahmani AB 31.25% 68.75% 0.45 -0.78 0.14 12.50% 87.50% 0.14 -1.94 0.01a 31.25% 68.75% 0.45 -0.78 0.14 37.50% 62.50% 0.60 -0.51 0.3 AC 100.0% 0.0% 999.9 9.20 0.89 50.0% 50.0% 1.00 0 1.00 100.0% 0.0% 999.9 9.20 0.89 50.0% 50.0% 1.00 0 1.00 BC 50.0% 50.0% 1.00 0 1.00 50.0% 50.0% 1.00 0 1.00 50.0% 50.0% 1.00 0 1.00 0.0% 100.0% 999.9 9.20 0.89 Ossimi AB 25.0% 75.0% 0.33 -1.09 0.34 75.0% 25.0% 3.00 1.09 0.34 75.0% 25.0% 3.00 1.09 0.34 50.0% 50.0% 1.00 0 1.00 AC 25.0% 75.0% 0.33 -1.09 0.17 62.0% 37.0% 1.66 0.51 0.48 62.50% 37.50% 1.66 0.51 0.48 0.0% 100.0% 999.9 9.20 0.79 BC 80.0% 20.0% 4.00 1.38 0.07 100.0% 0.0% 999.9 9.20 0.77 20.0% 80.0% 0.25 -1.38 0.07 50.0% 50.0% 1.00 0 1.00 O*B AB 77.78% 22.22% 3.50 1.25 0.11 100.0% 0.0% 999.9 9.20 0.78 77.78% 22.22% 3.50 1.25 0.11 66.67% 33.33% 2.00 0.69 0.32

AC 50.0% 50.0% 1.00 0 1.00 75.0% 25.0% 3.00 1.09 0.34 50.0% 50.0% 1.00 0 1.00 100.0% 0.0% 999.9 9.20 0.85

BC 28.57% 71.43% 0.40 -0.91 0.27 71.43% 28.57% 2.50 0.91 0.27 57.14% 42.86% 1.33 0.28 0.70 42.86% 57.14% 0.75 -0.28 0.70

FD, fiber diameter; STR, staple strength; STL, staple length; CFW, clean fleece weight; OR, odds ratio and a means P ≤ 0.05 considered statistically significant.

111 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435

Discussion

Genomic selection has played an important role in increasing profitability of livestock species by improving selection efficiency (Hayes and Goddard 2001; Brito et al. 2017). Characterization and genetic parameters estimation in the Egyptian sheep breeds were critical in the most recent two decades. However, in Egypt, the genetic markers of such breeds for wool quality and production are absent or inadequate. The successful breeding programs of livestock must recognize genes related to the improvement of fleece production and quality. Wool characteristics like staple length (STL), fiber diameter (FD), staple strength (STR) and clean fleece weight (CFW) are a very notable goal in assessing quality traits for favorable wool market and industry. Some studies have reported the presence of genes or gene families involved in fleece traits in sheep (Purvis and Franklin 2005). Identifying these candidate genes that effect on different wool traits would offer strategies for improving the quality and increasing the yield of fine wool. KRT2.10, KRT35 genes and BFMS microsatellites are one of these genes. In the present study, no KRT2.10 polymorphism could be detected using SSCP-PCR or RFLP-PCR. This data is in agreement with (Itenge 2012) who reported that KRT2.10 loci appeared to be homozygous in the sires, and thus unproductive, although the polymorphic genotypes of this gene that have been detected using PCR-RFLP (McLaren et al. 1997). The present data is also inconsistent with the recent report of (Chai et al. 2017), who revealed some SNPs in KRT2.10 (KRT83) gene. Two SNPs were found in exon 2 region, and five SNPs were detected in exon 3-4 region. In spite of there being no proof of variety in the amino acid sequence of KRT2.10 (KRT83), the SNPs in exon 3-4 were observed to be related with many wool traits. This might be expected to the linkage between KRT83 and further KRTs genes on chromosome 3, which are clustered and expressed in the wool fibre, and possibly all of them are variable (Yu et al. 2011; Chai et al. 2017). In addition, KRT83 variation effects on wool traits is rather linked to the effects of KRTAP1-2 (Gong et al. 2015; Chai et al. 2017), KRTAP6-1 (Zhou et al. 2015; Chai et al. 2017) and KRTAP22-1 (Chai et al. 2017; Li et al. 2017), although these KRTAPs being situated on different chromosomes. This would recommend that key fleece qualities are controlled by numerous genes not individual KRTs and KAPs. Moreover, (Steensel et al. 2015) reported that the novel mutations in the hard type II (basic) keratins KRT81, 83 and 86 causing monilethrix (Winter et al. 1997; Winter et al. 1997; Van Steensel et al. 2005), in which the hairs are fragile and break easily, resulting in scarring alopecia, may be specifically associated with heterozygosity for missense substitutions that change KRT83 function, and give a good evidence for the strong effect of KRT83 on hair quality. Similarly, (Shah et al. 2017) findings indicated that different types of mutations in KRT83 can result in quite different hair phenotypes. Wilson et al. 1988; Powell et al. 1992; Powell et al. 1993; Yu et al. 2011; Gong 2015; Zhao et al. 2017 have reported that DNA sequencing has revealed 17 hair keratin gene sequences in sheep, including ten for type I (KRT31, KRT32, KRT33A, KRT338, KRT34 - KRT36, KRT38 - KRT40) and 7 for type II (KRT81 - KRT87). KRT35 expression was found to be localized to the cortical and cuticle cells in the lower bulb of wool follicles (Yu et al. 2009). Asymmetrical expression of KRT27, KRT31, KRT35, KRT85 and trichohyalin genes in secondary follicles were associated with bulb deflection and follicle curvature, suggesting a role in the determination of follicle and fibre morphology (Yu et al. 2009). This data may rationalize the present results that represented the high degree of association between AA genotype and STR (P < 0.05) in all breeds except in Barki, and showed an association between AA genotype and STL (P < 0.05) in Barki breed. This suggests that genes such as KRT27, KRT35, KRT85 and trichohyalin are involved in the cortical structures creation that eventually may lead to fibre curvature (Yu et al. 2009). PCR-SSCP analysis in our study revealed three genotype patterns AA, AB and AC in KRT35 locus, those have no significant effect (P > 0.05) with FD, STR, STL, and CFW. However, the clustering of so many linked KRTAPs and KRTs that are all somehow polymorphic and expressed in the wool fibre, makes it difficult to distinguish the independent effects of the individual KRTAPs and KRTs (Gong et al. 2015). Polymorphisms of microsatellite BFMS using PCR-PAGE analysis in our study revealed three genotype patterns AB, AC and BC. The data is in harmony with (Itenge 2012) who reported that three alleles, designated A, B and C were identified at the BFMS microsatellite. The present results explored

112 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435 that AC genotype exhibited the highest degree of association with (STL) (P < 0.04) in Barki only, and genotype AB exhibited the highest degree of association with (STR) (P < 0.01) in Rahmani. These data is in agree with a study by (Bot et al. 2004) who reported eight alleles at the BFMS locus, where two of them were significantly associated with variation in CFW and GFW. We recommend to increase AC and AB genotypes of BFMS in Barki and Rahmani breeds respectively within the Egyptian sheep and also to select the animals possess AA genotypes of KRT35 gene and taking them in marker-assisted selection for high quality wool in Egyptian sheep breeds.

References

Ahlawat, A., P. Gajbhiye, L. Prince, A. Singh and S. Gajjar, 2014. Polymorphism of keratin intermediate filament (kif) type i gene association of wool quality traits in Patanwadi, Marwari and Dumba breeds of sheep. Indian Journal of Animal Sciences, 84(3): 316-319. Beh, K., M. Callaghan, Z. Leish, D. Hulme, I. Lenane and J. Maddox, 2001. A genome scan for QTL affecting fleece and wool traits in Merino sheep. Wool Technology and Sheep Breeding, 49(2). Bot, J., L. Karlsson, J. Greef and C. Witt, 2004. Association of the MHC with production traits in Merino ewes." Livestock Production Science, 86(1): 85-91. Brito, L. F., J. C. McEwan, S. P. Miller, N. K. Pickering, W. E. Bain, K. G. Dodds, F. S. Schenkel and S. M. Clarke, 2017. Genetic diversity of a New Zealand multi-breed sheep population and composite breeds’ history revealed by a high-density SNP chip." BMC genetics, 18(1): 25. Caffin, R., 1980. The Csiro staple strength/length system part I: Design and performance." Journal of the Textile Institute, 71(2): 65-70. Chai, W., H. Zhou, R. H. Forrest, H. Gong, S. Hodge and J. G. Hickford, 2017. "Polymorphism of KRT83 and its association with selected wool traits in Merino-cross lambs." Small Ruminant Research, 155: 6-11. Chapman, R., 1960. The biology of the fleece." Animal Research Laboratories Technical Paper, (3): 97-107. Darwish, H., H. El-Shorbagy, A. Abou-Eisha, A. El-Din and I. Farag, 2017. New polymorphism in the 5′ flanking region of IGF-1 gene and its association with wool traits in Egyptian Barki sheep. Journal of Genetic Engineering and Biotechnology, 15(2): 437-441. Dominik, S., 2005. Quantitative trait loci for internal nematode resistance in sheep: a review. Genetics Selection Evolution, 37(Suppl. 1): S83-S96. El-Gabbas, H., 1998. Wool fiber diameter and its distribution in Barki sheep with regard to the sampling positions and seasons." Egypt. J. Anim. Prod., 35(2): 123-141. El-Gabbas, H., 1999. Compressional properties of the coarse wool Barki fleeces." Alexandria Journal of Agricultural Research (Egypt). Galal, S., 2006. Characterization of small ruminant breeds in West Asia and North Africa, Elsevier. Gasser, R. B., M. Hu, N. B. Chilton, B. E. Campbell, A. J. Jex, D. Otranto, C. Cafarchia, I. Beveridge and X. Zhu, 2006. Single-strand conformation polymorphism (SSCP) for the analysis of genetic variation." Nature Protocols, 1(6): 3121-3128. Gong, H., 2015. Characterisation of Keratin-associated protein genes associated with wool traits, Lincoln University. Gong, H., H. Zhou, S. Hodge, J. M. Dyer and J. G. Hickford, 2015. Association of wool traits with variation in the ovine KAP1-2 gene in Merino cross lambs." Small Ruminant Research, 124: 24- 29. Hayes, B. and M. Goddard, 2001. Prediction of total genetic value using genome-wide dense marker maps." Genetics, 157(4): 1819-1829. Hediger, R., H. Ansari and G. Stranzinger, 1991. Chromosome banding and gene localizations support extensive conservation of chromosome structure between cattle and sheep." Cytogenetic and Genome Research, 57(2-3): 127-134. Ian William, P. and F. Ian Robert, 2005. Major genes and QTL influencing wool production and quality: a review." Genet. Sel. Evol., 37(1): S97-S107. Itenge, T. O., 2012. Identification of Polymorphism in the Keratin Genes (KAP3. 2, KAP6. 1, KAP7, KAP8) and Microsatellite BfMS in Merino Sheep Using Polymerase Chain Reaction-Single Strand Conformational Polymorphism (PCR-SSCP) Analysi. Electrophoresis, InTech.

113 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435

Lamy, E., G. Da Costa, R. Santos, F. C. e Silva, J. Potes, A. Pereira, A. Coelho and E. S. Baptista, 2009. Sheep and goat saliva proteome analysis: a useful tool for ingestive behavior research?" Physiology & behavior, 98(4): 393-401. Li, S., H. Zhou, H. Gong, F. Zhao, J. Wang, X. Liu, Y. Luo and J. G. Hickford, 2017. "Identification of the ovine keratin-associated protein 22-1 (KAP22-1) gene and its effect on wool traits." Genes, 8(1): 27. McKenzie Grant, W., 2002. A search for quantitative trait loci affecting wool colour, Lincoln University. McLaren, R. J., G. R. Rogers, K. P. Davies, J. F. Maddox and G. W. Montgomery, 1997. "Linkage mapping of wool keratin and keratin-associated protein genes in sheep." Mammalian genome, 8(12): 938-940. Parsons, Y., D. Cooper and L. Piper, 1996. Genetic variation in Australian Merino sheep." Animal genetics, 27(4): 223-228. Phuaa, S., D. Scobieb, D. O’Connellb, H. Henrya, K. Doddsa, R. Brauninga and S. Clerensb, 2015. Preliminary linkage studies in sheep of keratin and keratin-associated protein genes with fleece weight, wool fibre diameter and fibre curvature. Proceedings of the New Zealand Society of Animal Production. Powell, B., L. Crocker and G. Rogers, 1992. Hair follicle differentiation: expression, structure and evolutionary conservation of the hair type II keratin intermediate filament gene family. Development, 114(2): 417-433. Powell, B. and G. Rogers, 1994. Differentiation in hard keratin tissues: hair and related structures." The keratinocyte handbook, 401-436. Powell, B. C., L. A. Crocker and G. E. Rogers, 1993. Complete sequence of a hair-like intermediate filament type II keratin gene." DNA Sequence, 3(6): 401-405. Purvis, I. W. and I. R. Franklin, 2005. Major genes and QTL influencing wool production and quality: a review. Genetics Selection Evolution, BioMed Central. Rogers, G., J. Hickford and R. Bickerstaffe, 1994. A potential QTL for wool strength located on ovine chromosome 11. Proceedings of the 5th World Congress on Genetics Applied to Livestock Production, 7-12 August; Guelph. Rogers, G. R., 1994. Identification of a quantitative trait locus for wool strength in Romney sheep, Lincoln University. Rong, E., H. Yang, Z. Zhang, Z. Wang, X. Yan, H. Li and N. Wang, 2015. Association of methionine synthase gene polymorphisms with wool production and quality traits in Chinese Merino population. Journal of animal science, 93(10): 4601-4609. Shah, K., M. Ansar, F. S. Khan, W. Ahmad, T. M. Ferrara and R. A. Spritz, 2017. Recessive progressive symmetric erythrokeratoderma results from a homozygous loss-of-function mutation of KRT83 and is allelic with dominant monilethrix. Journal of medical genetics, 54(3): 186-189. Steensel, M., M. Vreeburg, M. T. Urbina, P. López, F. Morice‐Picard and M. Geel, 2015. "Novel KRT83 and KRT86 mutations associated with monilethrix." Experimental dermatology, 24(3): 222-224. Van Steensel, M., P. Steijlen, R. Bladergroen, M. Vermeer and M. van Geel, 2005. A missense mutation in the type II hair keratin hHb3 is associated with monilethrix. Journal of medical genetics, 42(3): e19-e19. Wilson, B., K. Edwards, M. Sleigh, C. Byrne and K. Ward, 1988. Complete sequence of a type-I microfibrillar wool keratin gene." Gene, 73(1): 21-31. Winter, H., M. A. Rogers, M. Gebhardt, U. Wollina, L. Boxall, D. Chitayat, R. Babul-Hirji, H. P. Stevens, A. Zlotogorski and J. Schweizer, 1997. A new mutation in the type II hair cortex keratin hHb1 involved in the inherited hair disorder monilethrix." Human genetics, 101(2): 165-169. Winter, H., M. A. Rogers, L. Langbein, H. P. Stevens, I. M. Leigh, C. Labrèze, S. Roul, A. Taieb, T. Krieg and J. Schweizer, 1997. Mutations in the hair cortex keratin hHb6 cause the inherited hair disease monilethrix. Nature genetics, 16(4): 372. Yu, Z., S. W. Gordon, A. J. Nixon, C. S. Bawden, M. A. Rogers, J. E. Wildermoth, N. J. Maqbool and A. J. Pearson, 2009. Expression patterns of keratin intermediate filament and keratin associated protein genes in wool follicles." Differentiation, 77(3): 307-316.

114 Curr. Sci. Int., 7(1): 101-115, 2018 ISSN: 2077-4435

Yu, Z., J. E. Wildermoth, O. A. Wallace, S. W. Gordon, N. J. Maqbool, P. H. Maclean, A. J. Nixon and A. J. Pearson, 2011.Annotation of sheep keratin intermediate filament genes and their patterns of expression. Experimental dermatology, 20(7): 582-588. Zhao, J., N. Liu, K. Liu, J. He, J. Yu, R. Bu, M. Cheng, W. De, J. Liu and H. Li, 2017. "Identification of genes and proteins associated with anagen wool growth." Animal genetics, 48(1): 67-79. Zhou, H., H. Gong, S. Li, Y. Luo and J. Hickford, 2015. A 57‐bp deletion in the ovine KAP6‐1 gene affects wool fibre diameter." Journal of Animal Breeding and Genetics, 132(4): 301-307.

115