DOCSLIB.ORG

Márcio Lorencini Avaliação Global De Transcritos Associados Ao Envelhecimento Da Epiderme Humana Utilizando Microarranjos De

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Márcio Lorencini Avaliação Global De Transcritos Associados Ao Envelhecimento Da Epiderme Humana Utilizando Microarranjos De MÁRCIO LORENCINI AVALIAÇÃO GLOBAL DE TRANSCRITOS ASSOCIADOS AO ENVELHECIMENTO DA EPIDERME HUMANA UTILIZANDO MICROARRANJOS DE DNA GLOBAL EVALUATION OF TRANSCRIPTS ASSOCIATED TO HUMAN EPIDERMAL AGING WITH DNA MICROARRAYS CAMPINAS 2014 i ii UNIVERSIDADE ESTADUAL DE CAMPINAS Instituto de Biologia MÁRCIO LORENCINI AVALIAÇÃO GLOBAL DE TRANSCRITOS ASSOCIADOS AO ENVELHECIMENTO DA EPIDERME HUMANA UTILIZANDO MICROARRANJOS DE DNA GLOBAL EVALUATION OF TRANSCRIPTS ASSOCIATED TO HUMAN EPIDERMAL AGING WITH DNA MICROARRAYS Tese apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do título de Doutor em Genética e Biologia Molecular, na área de Genética Animal e Evolução. Thesis presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Doctor in Genetics and Molecular Biology, in the area of Animal Genetics and Evolution. Orientador/Supervisor: PROF. DR. NILSON IVO TONIN ZANCHIN ESTE EXEMPLAR CORRESPONDE À VERSÃO FINAL DA TESE DEFENDIDA PELO ALUNO MÁRCIO LORENCINI, E ORIENTADA PELO PROF. DR. NILSON IVO TONIN ZANCHIN. ________________________________________ Prof. Dr. Nilson Ivo Tonin Zanchin CAMPINAS 2014 iii iv COMISSÃO JULGADORA 31 de janeiro de 2014 Membros titulares: Prof. Dr. Nilson Ivo Tonin Zanchin (Orientador) __________________________ Assinatura Prof. Dr. José Andrés Yunes __________________________ Assinatura Profa. Dra. Maricilda Palandi de Mello __________________________ Assinatura Profa. Dra. Bettina Malnic __________________________ Assinatura Profa. Dra. Ana Paula Ulian Araújo __________________________ Assinatura Membros suplentes: Profa. Dra. Edi Lúcia Sartorato __________________________ Assinatura Profa. Dra. Cristina Pontes Vicente __________________________ Assinatura Profa. Dra. Daniela Sanchez Bassères __________________________ Assinatura v vi RESUMO Com o aumento do tempo de vida da população humana muitas modalidades médicas, incluindo a dermatologia, deparam-se com uma revolução na forma de garantir saúde e qualidade de vida aos pacientes. Em contato com o ambiente externo, a pele representa um órgão no qual as mudanças com o envelhecimento causam danos funcionais, além de potencial impacto estético e psicossocial. A epiderme, camada mais externa da pele, constitui uma barreira seletiva com destacada capacidade de renovação e manutenção da homeostasia corporal. Entretanto, o entendimento de diversos mecanismos associados à fisiologia e envelhecimento da epiderme permanece como desafio para a comunidade científica. Com base nesse cenário, o objetivo do presente trabalho foi compreender o atual estado da arte no tema de envelhecimento da epiderme e realizar experimentos voltados para lacunas existentes, com foco na integração de aspectos clínicos, fisiológicos, morfológicos, celulares e moleculares. O capítulo de abertura descreve uma avaliação global de transcritos associados ao envelhecimento da epiderme humana, com a técnica de microarranjos de DNA e coleta não invasiva com fitas adesivas. O estudo indica características moleculares específicas do fotoenvelhecimento epidermal, com alterações relevantes e complementares a dados clínicos e morfológicos prévios, como modulação das vias de organização do citoesqueleto de actina e sinalização de cálcio, expressão gênica alterada de proteínas do envelope córneo, e avaliação de um painel segmentado por décadas de vida que sugere aspectos inéditos de regulação homeostática da epiderme, além de genes com modulação contínua ao longo das idades. O segundo capítulo compara o envelhecimento nas regiões folicular e interfolicular da epiderme. Como um sistema biológico de simples obtenção e fácil manuseio, os bulbos dos folículos pilosos representam uma fonte rica de material epidermal distinto, conforme evidencias na ampla modulação gênica diferenciada. O terceiro capítulo inclui uma avaliação in vitro do envelhecimento da epiderme, com queratinócitos de indivíduos de diferentes idades cultivados em monocamada e no modelo de pele equivalente. Os vii resultados evidenciam diferenças na expressão de marcadores moleculares de proliferação e diferenciação entre queratinócitos neonatais e adultos, mas não entre adultos de diferentes idades. Não houve diferença nas populações de células tronco, entretanto, observou-se aumento de células na fase proliferativa do ciclo celular em neonatos, assim como predominância de células na fase estacionária do ciclo celular em adultos mais velhos. Concluindo, os resultados obtidos no presente trabalho contribuem de forma significativa para o avanço do entendimento dos mecanismos moleculares afetados pelo avanço da idade da epiderme, possilitando a busca de novas alternativas no tratamento do envelhecimento cutâneo. viii ABSTRACT With the increase in lifetime of the human population many medical disciplines, including dermatology, are facing a revolution in the approaches to ensure healthcare and quality of life for patients. In contact with the external environment, the skin is an organ in which the changes of aging cause functional damage, in addition to potential aesthetic and psychosocial impact. Epidermis, the outermost skin layer, is a selective barrier with outstanding capacity for renewal and maintenance of the body homeostasis. However, the understanding of several mechanisms associated with skin physiology and aging remains a challenge for the scientific community. Considering this scenario, the objective of this work was to evaluate the state of the art knowledge on epidermal aging and to conduct experimental approaches to cover gaps that still exist on that theme, focusing on the integration of clinical, physiological, morphological, cellular and molecular aspects of epidermis aging. The opening chapter describes a study based on global transcriptional evaluation associated with aging of the human epidermis, using DNA microarrays and noninvasive tape stripping. This study reveals molecular characteristics specific of epidermal photoaging, with relevant findings complementary to previous clinical and morphological data, such as modulation of the actin cytoskeleton and calcium signaling pathways; altered gene expression of proteins of the cornified envelope; and evaluation of a segmented panel structured by decades of life, which suggests new aspects of homeostatic regulation in the epidermis and unvails genes with continuous modulation throughout different ages. The second chapter compares the gene expression patterns of the follicular and interfollicular regions of epidermis undergoing aging. As a biological system easily sampled and handled, the bulbs of plucked hair follicles represent a rich source of distinct epidermal material, as evidenced by the wide differential gene modulation that was detected. The third chapter includes an experimental in vitro evaluation of skin aging using keratinocytes isolated from individuals of different ages and cultured in monolayer and in skin equivalent models. Differences in the expression of proliferation and differentiation molecular markers between neonatal and adult ix keratinocytes were observed. No differences were found regarding the stem cell populations, however, neonates showed an increased percentage of cells in the proliferative phase of cell cycle, while older adults presented a predominance of cells in the stationary phase of cell cycle. The results herein presented provide novel insights on the molecular mechanisms affected by epidermal aging, enabling the search of new alternatives in the treatment of aging skin. x SUMÁRIO RESUMO ……………...……………………………………………….…………… vii ABSTRACT ………………………………………………………………………… ix AGRADECIMENTOS ……………………………………………………………… xv 1. INTRODUÇÃO ………………………………………………………………….. 1 1.1. Conceituação do envelhecimento humano …………...………… 1 1.2. Envelhecimento populacional ………………….…...……………. 2 1.3. Dermatologia e o envelhecimento cutâneo................................. 4 1.4. Funções, estrutura e tipos de pele ............................................. 5 1.5. Mudanças cutâneas com o envelhecimento .............................. 11 1.6. Mudanças funcionais e moleculares da epiderme com o envelhecimento .......................................................................... 13 1.7. Evolução contínua em biologia molecular impacta na dermatologia .............................................................................. 16 1.8. Justificativa e estrutura do trabalho ........................................... 17 2. OBJETIVOS .............................................................................................. 21 2.1. Objetivo geral ............................................................................. 21 2.2. Objetivos específicos ................................................................. 21 3. EXPERIMENTOS E RESULTADOS ......................................................... 23 3.1. Capítulo I (Artigo experimental I) ............................................... 23 3.2. Capítulo II (Artigo experimental II) ............................................. 89 3.3. Capítulo III (Artigo experimental III) ........................................... 123 4. DISCUSSÃO GERAL ................................................................................ 145 5. CONCLUSÕES ......................................................................................... 151 6. REFERÊNCIAS ......................................................................................... 153 7. ANEXOS ..................................................................................................
Load more

Recommended publications
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Genome-Wide Approach to Identify Risk Factors for Therapy-Related Myeloid Leukemia
    Leukemia (2006) 20, 239–246 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE Genome-wide approach to identify risk factors for therapy-related myeloid leukemia A Bogni1, C Cheng2, W Liu2, W Yang1, J Pfeffer1, S Mukatira3, D French1, JR Downing4, C-H Pui4,5,6 and MV Relling1,6 1Department of Pharmaceutical Sciences, The University of Tennessee, Memphis, TN, USA; 2Department of Biostatistics, The University of Tennessee, Memphis, TN, USA; 3Hartwell Center, The University of Tennessee, Memphis, TN, USA; 4Department of Pathology, The University of Tennessee, Memphis, TN, USA; 5Department of Hematology/Oncology St Jude Children’s Research Hospital, The University of Tennessee, Memphis, TN, USA; and 6Colleges of Medicine and Pharmacy, The University of Tennessee, Memphis, TN, USA Using a target gene approach, only a few host genetic risk therapy increases, the importance of identifying host factors for factors for treatment-related myeloid leukemia (t-ML) have been secondary neoplasms increases. defined. Gene expression microarrays allow for a more 4 genome-wide approach to assess possible genetic risk factors Because DNA microarrays interrogate multiple ( 10 000) for t-ML. We assessed gene expression profiles (n ¼ 12 625 genes in one experiment, they allow for a ‘genome-wide’ probe sets) in diagnostic acute lymphoblastic leukemic cells assessment of genes that may predispose to leukemogenesis. from 228 children treated on protocols that included leukemo- DNA microarray analysis of gene expression has been used to genic agents such as etoposide, 13 of whom developed t-ML. identify distinct expression profiles that are characteristic of Expression of 68 probes, corresponding to 63 genes, was different leukemia subtypes.13,14 Studies using this method have significantly related to risk of t-ML.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Evidence for Differential Alternative Splicing in Blood of Young Boys With
    Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Download The
    PROBING THE INTERACTION OF ASPERGILLUS FUMIGATUS CONIDIA AND HUMAN AIRWAY EPITHELIAL CELLS BY TRANSCRIPTIONAL PROFILING IN BOTH SPECIES by POL GOMEZ B.Sc., The University of British Columbia, 2002 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Experimental Medicine) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2010 © Pol Gomez, 2010 ABSTRACT The cells of the airway epithelium play critical roles in host defense to inhaled irritants, and in asthma pathogenesis. These cells are constantly exposed to environmental factors, including the conidia of the ubiquitous mould Aspergillus fumigatus, which are small enough to reach the alveoli. A. fumigatus is associated with a spectrum of diseases ranging from asthma and allergic bronchopulmonary aspergillosis to aspergilloma and invasive aspergillosis. Airway epithelial cells have been shown to internalize A. fumigatus conidia in vitro, but the implications of this process for pathogenesis remain unclear. We have developed a cell culture model for this interaction using the human bronchial epithelium cell line 16HBE and a transgenic A. fumigatus strain expressing green fluorescent protein (GFP). Immunofluorescent staining and nystatin protection assays indicated that cells internalized upwards of 50% of bound conidia. Using fluorescence-activated cell sorting (FACS), cells directly interacting with conidia and cells not associated with any conidia were sorted into separate samples, with an overall accuracy of 75%. Genome-wide transcriptional profiling using microarrays revealed significant responses of 16HBE cells and conidia to each other. Significant changes in gene expression were identified between cells and conidia incubated alone versus together, as well as between GFP positive and negative sorted cells.
    [Show full text]
  • Expression of Human Endogenous Retrovirus K Envelope Transcripts in Human Breast Cancer1
    Vol. 7, 1553–1560, June 2001 Clinical Cancer Research 1553 Advances in Brief Expression of Human Endogenous Retrovirus K Envelope Transcripts in Human Breast Cancer1 Feng Wang-Johanning, Andra R. Frost, breast tumor sample showed nucleotide sequence differ- Gary L. Johanning, M. B. Khazaeli, ences, suggesting that multiple loci may be transcribed. Conclusions: These data indicate that HERV-K tran- Albert F. LoBuglio, Denise R. Shaw, and scripts with coding potential for the envelope region are 2 Theresa V. Strong expressed frequently in human breast cancer. The Comprehensive Cancer Center and Division of Hematology Oncology, Departments of Medicine [F. W-J., M. B. K., A. F. L., Introduction D. R. S., T. V. S.], Pathology [A. R. F.], and Nutrition Sciences 3 [G. L. J.], University of Alabama at Birmingham, Birmingham, HERVs are stably inherited sequences thought to have Alabama 35294-3300 entered the germ line of their host more than a million years ago (1, 2). These elements are widely dispersed throughout the genome and are estimated to comprise Ͼ1% of the entire human Abstract genome. Most HERVs are defective because of multiple termi- Purpose: We investigated the expression of human en- nation codons and deletions (3), but some appear to contain all dogenous retroviral (HERV) sequences in breast cancer. structural features necessary for viral replication (4). HERVs are Experimental Design: Reverse transcription-PCR (RT- grouped into single- and multiple-copy families, usually classi- PCR) was used to examine expression of the envelope (env) fied according to the tRNA used for reverse transcription (2). region of ERV3, HERV-E4-1, and HERV-K in breast cancer The type K family (HERV-K) is present in an estimated 30–50 cell lines, human breast tumor samples, adjacent uninvolved copies/human genome and includes some elements with long breast tissues, nonmalignant breast tissues, and placenta.
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]
  • Method of Prognosing Cancers Verfahren Zur Prognose Von Krebsarten Procédé De Prognostic Des Cancers
    (19) TZZ Z _T (11) EP 2 295 602 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: G01N 33/574 (2006.01) C12Q 1/68 (2006.01) 11.07.2012 Bulletin 2012/28 (21) Application number: 10178350.4 (22) Date of filing: 26.07.2006 (54) Method of prognosing cancers Verfahren zur Prognose von Krebsarten Procédé de prognostic des cancers (84) Designated Contracting States: • KIHARA C ET AL: "Prediction of sensitivity of AT BE BG CH CY CZ DE DK EE ES FI FR GB GR esophageal tumors to adjuvant chemotherapy by HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI cDNA microarray analysis of gene-expression SK TR profiles", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, (30) Priority: 27.07.2005 US 703263 P BALTIMORE, MD, US, vol. 61, no. 17, September 2001 (2001-09), pages 6474-6479, XP002960719, (43) Date of publication of application: ISSN: 0008-5472 16.03.2011 Bulletin 2011/11 • PORTE H ET AL: "Overexpression of stromelysin-3, BM-40/SPARC, and MET genes in (62) Document number(s) of the earlier application(s) in human esophageal carcinoma: implications for accordance with Art. 76 EPC: prognosis.", CLINICAL CANCER RESEARCH : 06782211.4 / 1 907 582 AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH. JUN (73) Proprietor: Oncotherapy Science, Inc. 1998, vol. 4, no. 6, June 1998 (1998-06), pages Kawasaki-shi 1375-1382, XP002407525, ISSN: 1078-0432 Kanagawa 213-0012 (JP) • "Affimetrix GeneChip Human Genome U133 Array Set HG-U133A", GEO, 11 March 2002 (72) Inventors: (2002-03-11), XP002254749, • Nakamura, Yusuke • WIGLE DENNIS A ET AL: "Molecular profiling of Tokyo 1138654 (JP) non-small cell lung cancer and correlation with • Daigo, Yataro disease-free survival", CANCER RESEARCH, Tokyo 1138654 (JP) AMERICAN ASSOCIATION FOR CANCER • Nakatsuru, Shuichi REREARCH, US, vol.
    [Show full text]
  • High Levels of Genetic Diversity Within Nilo-Saharan Populations: Implications for Human Adaptation
    ARTICLE High Levels of Genetic Diversity within Nilo-Saharan Populations: Implications for Human Adaptation Julius Mulindwa,1,2 Harry Noyes,3 Hamidou Ilboudo,4 Luca Pagani,5,6 Oscar Nyangiri,1 Magambo Phillip Kimuda,1 Bernardin Ahouty,7 Olivier Fataki Asina,8 Elvis Ofon,9 Kelita Kamoto,10 Justin Windingoudi Kabore,11,15 Mathurin Koffi,7 Dieudonne Mumba Ngoyi,8 Gustave Simo,9 John Chisi,10 Issa Sidibe,11 John Enyaru,2 Martin Simuunza,12 Pius Alibu,2 Vincent Jamonneau,14 Mamadou Camara,15 Andy Tait,16 Neil Hall,17 Bruno Bucheton,14,15 Annette MacLeod,16 Christiane Hertz-Fowler,3 Enock Matovu,1,* and the TrypanoGEN Research Group of the H3Africa Consortium Summary Africa contains more human genetic variation than any other continent, but the majority of the population-scale analyses of the African peoples have focused on just two of the four major linguistic groups, the Niger-Congo and Afro-Asiatic, leaving the Nilo-Saharan and Khoisan populations under-represented. In order to assess genetic variation and signatures of selection within a Nilo-Saharan population and between the Nilo-Saharan and Niger-Congo and Afro-Asiatic, we sequenced 50 genomes from the Nilo-Saharan Lugbara population of North-West Uganda and 250 genomes from 6 previously unsequenced Niger-Congo populations. We compared these data to data from a further 16 Eurasian and African populations including the Gumuz, another putative Nilo-Saharan population from Ethiopia. Of the 21 million variants identified in the Nilo-Saharan population, 3.57 million (17%) were not represented in dbSNP and included predicted non-synonymous mutations with possible phenotypic effects.
    [Show full text]