DOCSLIB.ORG

Omar Salvador Acuña Meléndez 2015

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Omar Salvador Acuña Meléndez 2015 UNIVERSIDAD DE MURCIA FACULTAD DE VETERINARIA Análisis Transcriptómico y Proteómico del Oviducto y Útero Bovino en la Fase Periovulatoria D. Omar Salvador Acuña Meléndez 2015 UNIVERSIDAD DE MURCIA á ó ó ú Omar Salvador Acuña Meléndez 2015 Esta Tesis Doctoral ha sido propuesta para Mención de doctorado Internacional en virtud de la siguiente estancia de investigación e informes: Estancia de investigación: Ludwig Maximilians Universität München, Genzentrum, Laboratory for Functional Genome Analysis (LAFUGA-Genomics). Múnich, Alemania. Dr. Stefan Bauersachs, Priv. Doz. Dr. rer. nat., Dr. habil. vet. med. Período del 01/05/2013 al 31/07/2013. Informes de Tesis: Dr. Riccardo Focarelli, Universidad de Siena, Italia Dra. María Dolores Saavedra Leos, Universidad Autónoma de San Luis Potosí, México. Esta Tesis Doctoral ha sido realizada en el Departamento de Biología Celular e Histología de la Facultad de Medicina con la financiación de diferentes proyectos de investigación: AGL2009-12512-C02-02 del MEC AGL2012-40180-C03-02 del MIMECO Proyecto de Excelencia de la Fundación Séneca 04542/GERM/06. Omar Salvador Acuña Meléndez disfrutó de una beca de estudios de Doctorado otorgada por el Consejo Nacional de Ciencia y Tecnología CONACYT (México), registro 213560. Omar Salvador Acuña Meléndez disfrutó de una beca de estudios de Posgrado en el marco del programa ”Doctores Jóvenes” otorgada por la Universidad Autónoma de Sinaloa (México). Omar Salvador Acuña Meléndez disfrutó de apoyo de movilidad “Short Term Scientific Mission Grants” (STSM). COST- Epigenetics and Periconception Environment-Periconception environment as an epigenomic lever for optimising food production and health in livestock”. (COST-STSM-ECOST- STSM-FA 1201-010513-028404). Para la obtención de la Mención Internacional en el título de doctor. Algunos de los resultados de esta tesis han sido incluidos en las siguientes publicaciones: Artículos: Mondejar I.; Acuña O. S.; Izquierdo-Rico M. J.; Coy P.; Avilés M., 2012: The Oviduct: Functional Genomic and Proteomic Approach. Reproduction in Domestic Animals, 47 22-29. Comunicaciones a Congresos: Acuña O. S.; Vilella I.; Canovas S.; Coy P.; Jimenez-Movilla M.; Avilés M., 2014: Detection of SPAM1 in exosomes isolated from the bovine oviductal fluid. Reproduction in Domestic Animals, 49 97-98. Acuña O. S.; Jimenez-Movilla M.; Vilella I.; Jara L.; Canovas S.; Coy P.; Avilés M., 2014. Detection of SPAM1 in the bovine oviductal fluid. Poster. World Congress of Reproductive Biology (WCRB). Edimburgo, Reino Unido. Septiembre 2014. Acuña O. S.; Stetson I.; Izquierdo-Rico M. J; Coy P.; Avilés M., 2011: Expression of sperm adhesion molecule-1 (SPAM1) in cow and sow oviduct. Reproduction in Domestic Animals, 46 79-79. Acuña O. S.; Moros C.; Izquierdo-Rico M. J.; Avilés M., 2011. Expresión de la molécula de adhesión del espermatozoide 1 (SPAM1) en trompa de Falopio de mujer. Poster. Asociación Española de Biólogos de la Reproducción (ASEBIR), Girona, España, Octubre 2011. AGRADECIMIENTOS Quiero expresar mi más sincero agradecimiento a todas las personas que han hecho posible la realización de esta Tesis Doctoral. A mi tutor Manuel Avilés Sánchez quiero manifestarle mi gratitud por todo el apoyo recibido para la realización de esta Tesis, por la confianza que depositó en mi, por compartir sus conocimientos, consejos y proyectos, que acrecentaron en mi el interés de continuar una carrera científica. Agradezco muy especialmente el gran apoyo que me brindó fuera del ámbito profesional, que me permitió reconocer en él su gran sentido de solidaridad y calidad humana. A mi tutor Stefan Bauersachs, agradezco el que me haya permitido asistir a su laboratorio. Le agradezco por participar activamente proporcionando los medios para que este proyecto haya sido posible, agradezco también que haya atendido a todas mis dudas y cuestionamientos con especial profesionalismo y paciencia. Mein ganz besonderer Dank gilt bei Herr Dr. Stefan Bauersachs, Ich danke ihn dafür, dass ich in sein Labor zu besuchen. Ich schätze Ihre aktive Teilnahme an liefern die notwendige Ausrüstung dieses Projekt möglich zu machen. Ich schätze Ihre für die Beantwortung aller Fragen, mit Professionalität und Geduld. A mi tutora María Jiménez Movilla por la atención y consejos recibidos para que esta Tesis haya sido posible. Agradezco a la Dra. Susanne Ulbrich por facilitar las novillas e instalaciones para la obtención de muestras. Ich danke Frau Dr. Susanne Ulbrich erleichtern Färsen und Einrichtungen für die Probenahme. Agradezco al Dr. Helmut Blum por permitirme visitar su laboratorio y por su paciencia. A todo el personal del laboratorio LAFUGA de genómica, a Andrea Klanner, a Sylvia Mallok, al Dr. Krebs, a Alex y muy especialmente a Sylvia y Ernest Hornig, por su apoyo y agradable compañía. Bei Herr Dr. Helmut Blum Danke für die Erlaubnis, sein Labor zu besuchen und für Ihre Geduld. Vielen Dank an alle Laborpersonal LAFUGA Genomik, Andrea Klanner, Sylvia Mallok, Dr. Stefan Krebs, Alex und vor allem Sylvia und Ernest Hornig, für ihre Unterstützung und guter Gesellschaft. Un especial agradecimiento a María José Izquierdo por todo el apoyo y sus consejos, a todos los profesores del departamento de Biología Celular e Histología, Concha Ferrer, Emma Martínez, Luis Miguel Pastor, José Ángel Martínez, Francisco Hernández, Juan Francisco Madrid, Emilio Gómez, José Ballesta y María Teresa Castells, gracias por su ayuda y compañía durante estos años. A mis compañeros del departamento que compartieron conmigo todos estos años, por su ánimo, apoyo y compañerismo. A Lily, Carla, Narci, Wilson, Vicente, Blanca, Ascen, Lourdes, Sara, Esther, Tere y Luis Miguel. Un agradecimiento especialmente a Airyn por su paciencia en mis inicios en el laboratorio, por su apoyo y amistad. A Carla por su amable y atenta disposición que tiene siempre por ayudar. A todos los profesores de Fisiología Animal en la Facultad de Veterinaria. Por las facilidades otorgadas para trabajar en su laboratorio y facilitar sus muestras para nuestros proyectos. Agradezco a Juan y especialmente a Sole por permitirme acompañarle para la recogida de muestras de mataderos. A los compañeros de Fisiología Animal en la Facultad de Veterinaria Jon, Aitor, Luis, Irene, Rebeca, Karen y Cristina siempre dispuestos a ayudar. Gracias por todo el soporte técnico por parte de los diferentes departamentos del SACE y CAID. Hago un especial agradecimiento a Alejandro Torrecillas por su gran implicación en este proyecto y por su excelente apoyo técnico. Un especial agradecimiento a todas las personas de la Universidad Autónoma de Sinaloa que me apoyaron para poder lograr mis estudios de Doctorado. Al MC Héctor M. Cuen, a los Doctores Francisco Ríos, Alfredo Estrada, A. Corrales Burgueño, Mario Nieves, al Ing. A. Valle y especialmente a Blanca López por sus amables y atentas gestiones. A la memoria de mi abuelita Lucina López, por hacer de mi un hombre de bien. Agradezco a mi mamá, hermanas y hermano por su gran apoyo a pesar de la distancia. A mi papá por su siempre y acertado consejo, por su serenidad y madurez. A mis abuelos por sus consejos y por ser un modelo a seguir. A toda mi familia y a José Luis Cervantes. A mi esposa y compañera de vida Tere Caro por ser parte de esta aventura, por su paciencia y apoyo incondicional, por ser como es, por estar a mi lado y por darme lo más preciado que tengo, mi hijo Marcos. Ellos me dan la fuerza día a día para seguir adelante. A MI ESPOSA Y MI HIJO A MI ABUELITA LUCINA TABLA DE CONTENIDOS 1 RESUMEN _____________________________________________________________ 1 1.1.- RESUMEN ________________________________________________________ 3 1.2.- SUMMARY ________________________________________________________ 9 2 REVISIÓN BIBLIOGRÁFICA ______________________________________________ 17 2.1.- TRACTO GENITAL FEMENINO _______________________________________ 18 2.1.1.- El ciclo estral bovino _________________________________________ 18 2.1.2.- Generalidades del tracto genital de la vaca ________________________ 21 2.1.2.1.- Útero ________________________________________________ 22 2.1.2.1.1.- Anatomía __________________________________________ 22 2.1.2.1.2.- Histología _________________________________________ 23 2.1.2.1.3.- Transcriptoma ______________________________________ 24 2.1.2.1.4.- Proteoma _________________________________________ 27 2.1.2.2.- Oviducto _____________________________________________ 28 2.1.2.2.1.- Anatomía __________________________________________ 28 2.1.2.2.2.- Histología del oviducto _______________________________ 30 2.1.2.2.3.- Transcriptoma ______________________________________ 34 2.1.2.2.4.- Fluido oviductal _____________________________________ 37 2.1.2.3 Efecto del tracto genital femenino en el espermatozoide _________ 39 2.1.2.3.1.- Transporte espermático ______________________________ 39 2.1.2.3.2.- Reservorio espermático ______________________________ 43 2.1.2.3.3.- Capacitación espermática _____________________________ 46 2.1.2.3.3.1.- Modificación de la membrana plasmática del espermatozoide __________________________________________ 47 2.1.2.3.3.2.- Fosforilación de proteínas ________________________ 49 2.1.2.3.3.3.- Cambios en los patrones de motilidad espermática ___ 50 2.2.- ESPERMATOZOIDE ________________________________________________ 51 2.2.1.- Espermatogénesis ___________________________________________ 51 2.2.2.- Morfología y Estructura _______________________________________ 53 2.2.2.1.- Cabeza ______________________________________________ 55 2.2.2.1.1.-
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Differential Patterns of Allelic Loss in Estrogen Receptor-Positive Infiltrating Lobular and Ductal Breast Cancer
    GENES, CHROMOSOMES & CANCER 47:1049–1066 (2008) Differential Patterns of Allelic Loss in Estrogen Receptor-Positive Infiltrating Lobular and Ductal Breast Cancer L. W. M. Loo,1 C. Ton,1,2 Y.-W. Wang,2 D. I. Grove,2 H. Bouzek,1 N. Vartanian,1 M.-G. Lin,1 X. Yuan,1 T. L. Lawton,3 J. R. Daling,2 K. E. Malone,2 C. I. Li,2 L. Hsu,2 and P.L. Porter1,2,3* 1Division of Human Biology,Fred Hutchinson Cancer Research Center,Seattle,WA 2Division of Public Health Sciences,Fred Hutchinson Cancer Research Center,Seattle,WA 3Departmentof Pathology,Universityof Washington,Seattle,WA The two main histological types of infiltrating breast cancer, lobular (ILC) and the more common ductal (IDC) carcinoma are morphologically and clinically distinct. To assess the molecular alterations associated with these breast cancer subtypes, we conducted a whole-genome study of 166 archival estrogen receptor (ER)-positive tumors (89 IDC and 77 ILC) using the Affy- metrix GeneChip® Mapping 10K Array to identify sites of loss of heterozygosity (LOH) that either distinguished, or were shared by, the two phenotypes. We found single nucleotide polymorphisms (SNPs) of high-frequency LOH (>50%) common to both ILC and IDC tumors predominately in 11q, 16q, and 17p. Overall, IDC had a slightly higher frequency of LOH events across the genome than ILC (fractional allelic loss 5 0.186 and 0.156). By comparing the average frequency of LOH by chro- mosomal arm, we found IDC tumors with significantly (P < 0.05) higher frequency of LOH on 3p, 5q, 8p, 9p, 20p, and 20q than ILC tumors.
    [Show full text]
  • Pan-Cancer Analysis of Homozygous Deletions in Primary Tumours Uncovers Rare Tumour Suppressors
    Corrected: Author correction; Corrected: Author correction ARTICLE DOI: 10.1038/s41467-017-01355-0 OPEN Pan-cancer analysis of homozygous deletions in primary tumours uncovers rare tumour suppressors Jiqiu Cheng1,2, Jonas Demeulemeester 3,4, David C. Wedge5,6, Hans Kristian M. Vollan2,3, Jason J. Pitt7,8, Hege G. Russnes2,9, Bina P. Pandey1, Gro Nilsen10, Silje Nord2, Graham R. Bignell5, Kevin P. White7,11,12,13, Anne-Lise Børresen-Dale2, Peter J. Campbell5, Vessela N. Kristensen2, Michael R. Stratton5, Ole Christian Lingjærde 10, Yves Moreau1 & Peter Van Loo 3,4 1234567890 Homozygous deletions are rare in cancers and often target tumour suppressor genes. Here, we build a compendium of 2218 primary tumours across 12 human cancer types and sys- tematically screen for homozygous deletions, aiming to identify rare tumour suppressors. Our analysis defines 96 genomic regions recurrently targeted by homozygous deletions. These recurrent homozygous deletions occur either over tumour suppressors or over fragile sites, regions of increased genomic instability. We construct a statistical model that separates fragile sites from regions showing signatures of positive selection for homozygous deletions and identify candidate tumour suppressors within those regions. We find 16 established tumour suppressors and propose 27 candidate tumour suppressors. Several of these genes (including MGMT, RAD17, and USP44) show prior evidence of a tumour suppressive function. Other candidate tumour suppressors, such as MAFTRR, KIAA1551, and IGF2BP2, are novel. Our study demonstrates how rare tumour suppressors can be identified through copy number meta-analysis. 1 Department of Electrical Engineering (ESAT) and iMinds Future Health Department, University of Leuven, Kasteelpark Arenberg 10, B-3001 Leuven, Belgium.
    [Show full text]
  • The Correlation of Keratin Expression with In-Vitro Epithelial Cell Line Differentiation
    The correlation of keratin expression with in-vitro epithelial cell line differentiation Deeqo Aden Thesis submitted to the University of London for Degree of Master of Philosophy (MPhil) Supervisors: Professor Ian. C. Mackenzie Professor Farida Fortune Centre for Clinical and Diagnostic Oral Science Barts and The London School of Medicine and Dentistry Queen Mary, University of London 2009 Contents Content pages ……………………………………………………………………......2 Abstract………………………………………………………………………….........6 Acknowledgements and Declaration……………………………………………...…7 List of Figures…………………………………………………………………………8 List of Tables………………………………………………………………………...12 Abbreviations….………………………………………………………………..…...14 Chapter 1: Literature review 16 1.1 Structure and function of the Oral Mucosa……………..…………….…..............17 1.2 Maintenance of the oral cavity...……………………………………….................20 1.2.1 Environmental Factors which damage the Oral Mucosa………. ….…………..21 1.3 Structure and function of the Oral Mucosa ………………...….……….………...21 1.3.1 Skin Barrier Formation………………………………………………….……...22 1.4 Comparison of Oral Mucosa and Skin…………………………………….……...24 1.5 Developmental and Experimental Models used in Oral mucosa and Skin...……..28 1.6 Keratinocytes…………………………………………………….….....................29 1.6.1 Desmosomes…………………………………………….…...............................29 1.6.2 Hemidesmosomes……………………………………….…...............................30 1.6.3 Tight Junctions………………………….……………….…...............................32 1.6.4 Gap Junctions………………………….……………….….................................32
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • Proteomic Expression Profile in Human Temporomandibular Joint
    diagnostics Article Proteomic Expression Profile in Human Temporomandibular Joint Dysfunction Andrea Duarte Doetzer 1,*, Roberto Hirochi Herai 1 , Marília Afonso Rabelo Buzalaf 2 and Paula Cristina Trevilatto 1 1 Graduate Program in Health Sciences, School of Medicine, Pontifícia Universidade Católica do Paraná (PUCPR), Curitiba 80215-901, Brazil; [email protected] (R.H.H.); [email protected] (P.C.T.) 2 Department of Biological Sciences, Bauru School of Dentistry, University of São Paulo, Bauru 17012-901, Brazil; [email protected] * Correspondence: [email protected]; Tel.: +55-41-991-864-747 Abstract: Temporomandibular joint dysfunction (TMD) is a multifactorial condition that impairs human’s health and quality of life. Its etiology is still a challenge due to its complex development and the great number of different conditions it comprises. One of the most common forms of TMD is anterior disc displacement without reduction (DDWoR) and other TMDs with distinct origins are condylar hyperplasia (CH) and mandibular dislocation (MD). Thus, the aim of this study is to identify the protein expression profile of synovial fluid and the temporomandibular joint disc of patients diagnosed with DDWoR, CH and MD. Synovial fluid and a fraction of the temporomandibular joint disc were collected from nine patients diagnosed with DDWoR (n = 3), CH (n = 4) and MD (n = 2). Samples were subjected to label-free nLC-MS/MS for proteomic data extraction, and then bioinformatics analysis were conducted for protein identification and functional annotation. The three Citation: Doetzer, A.D.; Herai, R.H.; TMD conditions showed different protein expression profiles, and novel proteins were identified Buzalaf, M.A.R.; Trevilatto, P.C.
    [Show full text]
  • MALE Protein Name Accession Number Molecular Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean H Mean PDAC Mean T-Test PDAC Vs. H T-Test
    MALE t-test t-test Accession Molecular H PDAC PDAC vs. PDAC vs. Protein Name Number Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean Mean Mean H CP PDAC/H PDAC/CP - 22 kDa protein IPI00219910 22 kDa 7 5 4 8 1 0 6 6 1 0.1126 0.0456 0.1 0.1 - Cold agglutinin FS-1 L-chain (Fragment) IPI00827773 12 kDa 32 39 34 26 53 57 36 30 55 0.0309 0.0388 1.8 1.5 - HRV Fab 027-VL (Fragment) IPI00827643 12 kDa 4 6 0 0 0 0 5 0 0 - 0.0574 - 0.0 - REV25-2 (Fragment) IPI00816794 15 kDa 8 12 5 7 8 9 10 6 8 0.2225 0.3844 1.3 0.8 A1BG Alpha-1B-glycoprotein precursor IPI00022895 54 kDa 115 109 106 112 111 100 112 109 105 0.6497 0.4138 1.0 0.9 A2M Alpha-2-macroglobulin precursor IPI00478003 163 kDa 62 63 86 72 14 18 63 79 16 0.0120 0.0019 0.2 0.3 ABCB1 Multidrug resistance protein 1 IPI00027481 141 kDa 41 46 23 26 52 64 43 25 58 0.0355 0.1660 2.4 1.3 ABHD14B Isoform 1 of Abhydrolase domain-containing proteinIPI00063827 14B 22 kDa 19 15 19 17 15 9 17 18 12 0.2502 0.3306 0.7 0.7 ABP1 Isoform 1 of Amiloride-sensitive amine oxidase [copper-containing]IPI00020982 precursor85 kDa 1 5 8 8 0 0 3 8 0 0.0001 0.2445 0.0 0.0 ACAN aggrecan isoform 2 precursor IPI00027377 250 kDa 38 30 17 28 34 24 34 22 29 0.4877 0.5109 1.3 0.8 ACE Isoform Somatic-1 of Angiotensin-converting enzyme, somaticIPI00437751 isoform precursor150 kDa 48 34 67 56 28 38 41 61 33 0.0600 0.4301 0.5 0.8 ACE2 Isoform 1 of Angiotensin-converting enzyme 2 precursorIPI00465187 92 kDa 11 16 20 30 4 5 13 25 5 0.0557 0.0847 0.2 0.4 ACO1 Cytoplasmic aconitate hydratase IPI00008485 98 kDa 2 2 0 0 0 0 2 0 0 - 0.0081 - 0.0
    [Show full text]
  • Original Article a Database and Functional Annotation of NF-Κb Target Genes
    Int J Clin Exp Med 2016;9(5):7986-7995 www.ijcem.com /ISSN:1940-5901/IJCEM0019172 Original Article A database and functional annotation of NF-κB target genes Yang Yang, Jian Wu, Jinke Wang The State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, People’s Republic of China Received November 4, 2015; Accepted February 10, 2016; Epub May 15, 2016; Published May 30, 2016 Abstract: Backgrounds: The previous studies show that the transcription factor NF-κB always be induced by many inducers, and can regulate the expressions of many genes. The aim of the present study is to explore the database and functional annotation of NF-κB target genes. Methods: In this study, we manually collected the most complete listing of all NF-κB target genes identified to date, including the NF-κB microRNA target genes and built the database of NF-κB target genes with the detailed information of each target gene and annotated it by DAVID tools. Results: The NF-κB target genes database was established (http://tfdb.seu.edu.cn/nfkb/). The collected data confirmed that NF-κB maintains multitudinous biological functions and possesses the considerable complexity and diversity in regulation the expression of corresponding target genes set. The data showed that the NF-κB was a central regula- tor of the stress response, immune response and cellular metabolic processes. NF-κB involved in bone disease, immunological disease and cardiovascular disease, various cancers and nervous disease. NF-κB can modulate the expression activity of other transcriptional factors. Inhibition of IKK and IκBα phosphorylation, the decrease of nuclear translocation of p65 and the reduction of intracellular glutathione level determined the up-regulation or down-regulation of expression of NF-κB target genes.
    [Show full text]
  • Open Data for Differential Network Analysis in Glioma
    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
    [Show full text]
  • Supplementary Material Contents
    Supplementary Material Contents Immune modulating proteins identified from exosomal samples.....................................................................2 Figure S1: Overlap between exosomal and soluble proteomes.................................................................................... 4 Bacterial strains:..............................................................................................................................................4 Figure S2: Variability between subjects of effects of exosomes on BL21-lux growth.................................................... 5 Figure S3: Early effects of exosomes on growth of BL21 E. coli .................................................................................... 5 Figure S4: Exosomal Lysis............................................................................................................................................ 6 Figure S5: Effect of pH on exosomal action.................................................................................................................. 7 Figure S6: Effect of exosomes on growth of UPEC (pH = 6.5) suspended in exosome-depleted urine supernatant ....... 8 Effective exosomal concentration....................................................................................................................8 Figure S7: Sample constitution for luminometry experiments..................................................................................... 8 Figure S8: Determining effective concentration .........................................................................................................
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]