DOCSLIB.ORG

King's Research Portal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
King's Research Portal King’s Research Portal DOI: 10.1242/dev.129171 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA): Gokhin, D. S., Ochala, J., Domenighetti, A. A., & Fowler, V. M. (2015). Tropomodulin 1 directly controls thin filament length in both wild-type and tropomodulin 4-deficient skeletal muscle. Development, 142(24), 4351- 4362. https://doi.org/10.1242/dev.129171 Citing this paper Please note that where the full-text provided on King's Research Portal is the Author Accepted Manuscript or Post-Print version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version for pagination, volume/issue, and date of publication details. And where the final published version is provided on the Research Portal, if citing you are again advised to check the publisher's website for any subsequent corrections. General rights Copyright and moral rights for the publications made accessible in the Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognize and abide by the legal requirements associated with these rights. •Users may download and print one copy of any publication from the Research Portal for the purpose of private study or research. •You may not further distribute the material or use it for any profit-making activity or commercial gain •You may freely distribute the URL identifying the publication in the Research Portal Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 23. Sep. 2021 © 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 4351-4362 doi:10.1242/dev.129171 RESEARCH ARTICLE Tropomodulin 1 directly controls thin filament length in both wild-type and tropomodulin 4-deficient skeletal muscle David S. Gokhin1,*, Julien Ochala2, Andrea A. Domenighetti3,4 and Velia M. Fowler1,* ABSTRACT actin subunit addition in mouse models of Duchenne muscular The sarcomeric tropomodulin (Tmod) isoforms Tmod1 and Tmod4 dystrophy (Gokhin et al., 2014b). Mis-specification of thin filament cap thin filament pointed ends and functionally interact with the lengths frequently occurs with alterations in thin filament activation leiomodin (Lmod) isoforms Lmod2 and Lmod3 to control myofibril and/or actomyosin crossbridge formation (Chandra et al., 2009; organization, thin filament lengths, and actomyosin crossbridge Ochala et al., 2012; Ottenheijm et al., 2013, 2010). formation in skeletal muscle fibers. Here, we show that Tmod4 is Crucial players in the simultaneous regulation of thin filament more abundant than Tmod1 at both the transcript and protein level in lengths, thin filament activation, and actomyosin crossbridge a variety of muscle types, but the relative abundances of sarcomeric formation are the tropomodulin (Tmod) family of tropomyosin Tmods are muscle specific. We then generate Tmod4−/− mice, which (TM)-binding and actin filament pointed-end capping proteins. exhibit normal thin filament lengths, myofibril organization, and Vertebrate skeletal muscles contain two sarcomeric Tmod isoforms: skeletal muscle contractile function owing to compensatory Tmod1, expressed in diverse, terminally differentiated cells, upregulation of Tmod1, together with an Lmod isoform switch including striated muscle, but also erythrocytes, neurons and wherein Lmod3 is downregulated and Lmod2 is upregulated. ocular lens fiber cells; and Tmod4, which is exclusive to skeletal However, RNAi depletion of Tmod1 from either wild-type or muscle fibers (Almenar-Queralt et al., 1999; Conley et al., 2001; Tmod4−/− muscle fibers leads to thin filament elongation by ∼15%. Gokhin and Fowler, 2011b; Yamashiro et al., 2012). Two Thus, Tmod1 per se, rather than total sarcomeric Tmod levels, sarcomeric Tmod molecules cap each thin filament pointed end α β controls thin filament lengths in mouse skeletal muscle, whereas and bind to the N-termini of the terminal / TM molecules on the Tmod4 appears to be dispensable for thin filament length regulation. thin filaments (Almenar-Queralt et al., 1999; Fowler et al., 1993; These findings identify Tmod1 as the key direct regulator of thin Gokhin and Fowler, 2011b; Gokhin et al., 2012, 2010, 2014b). filament length in skeletal muscle, in both adult muscle homeostasis Tmod4 is approximately tenfold more abundant than Tmod1 in a and in developmentally compensated contexts. mixture of isolated tibialis anterior (TA) and extensor digitorum longus (EDL) myofibrils (Gokhin et al., 2014b), indicating that KEY WORDS: Actin filament, Pointed-end capping, Leiomodin, Tmod4 is probably the predominant pointed-end cap in skeletal Myofibril, Sarcomere muscle thin filaments, at least in fast muscle. In addition, an extrasarcomeric Tmod isoform, Tmod3, caps the pointed ends of INTRODUCTION cytoplasmic γ-actin filaments in a sarcoplasmic reticulum (SR)- The semicrystalline arrays of interdigitating, uniform-length actin associated cytoskeletal network (Gokhin and Fowler, 2011a). (thin) and myosin (thick) filaments found in the contracting Skeletal muscle also contains two leiomodin (Lmod) isoforms, sarcomeres of skeletal muscle fibers represent a striking example Lmod2 and Lmod3, which are larger Tmod family members that of long-range cytoskeletal organization and precise organelle size nucleate F-actin assembly and can antagonize the capping activity control. Whereas thick filament lengths are essentially constant in of Tmods (Chereau et al., 2008; Conley et al., 2001; Pappas et al., all skeletal muscles and species examined (∼1.65 µm), thin filament 2015; Tsukada et al., 2010; Yuen et al., 2014). lengths vary substantially across muscles and vertebrate species Tmod perturbation studies in cultured cardiomyocytes and (0.95-1.40 µm) (Castillo et al., 2009; Gokhin et al., 2012, 2010; Drosophila indirect flight muscle have demonstrated that Granzier et al., 1991; Ringkob et al., 2004). Thin filament lengths sarcomeric Tmods control thin filament lengths by dynamically are remarkably plastic during normal postnatal skeletal muscle regulating actin subunit association/dissociation from pointed ends development and aging (Gokhin et al., 2014a) but can become mis- (Bliss et al., 2014; Gregorio et al., 1995; Littlefield et al., 2001; specified in some congenital myopathies. For example, thin Mardahl-Dumesnil and Fowler, 2001; Sussman et al., 1998) and by filaments are abnormally short owing to aberrant F-actin assembly stabilizing pointed ends via their interactions with terminal α/βTMs and/or destabilization in some nemaline myopathies (Ochala et al., (Mudry et al., 2003). A role for sarcomeric Tmods in regulating thin 2012; Ottenheijm et al., 2010, 2009; Yuen et al., 2014), whereas filament lengths has also been implicated in mammalian skeletal thin filaments elongate as a result of pointed-end uncapping and muscle, in which calpain-mediated proteolysis of sarcomeric Tmods in dystrophic muscle is associated with thin filament elongation 1Department of Cell and Molecular Biology, The Scripps Research Institute, La (Gokhin et al., 2014b), although potential indirect effects due to Jolla, CA 92037, USA. 2Centre of Human and Aerospace Physiological Sciences, non-Tmod-related mechanisms have not been ruled out. However, King’s College London, London SE1 1UL, UK. 3Department of Physical Medicine and Rehabilitation, Feinberg School of Medicine, Northwestern University, recent analyses of mouse knockouts have uncovered more complex Chicago, IL 60611, USA. 4Rehabilitation Institute of Chicago, Chicago, IL 60611, functions of sarcomeric Tmods in mammalian skeletal muscle USA. contractility, as well as unexpected compensatory mechanisms. In Tmod1−/− *Authors for correspondence ([email protected]; [email protected]) muscle, Tmod3 compensates for the absence of Tmod1 by translocating from its SR compartment to the thin filament Received 29 July 2015; Accepted 5 November 2015 pointed ends to preserve normal skeletal muscle development, DEVELOPMENT 4351 RESEARCH ARTICLE Development (2015) 142, 4351-4362 doi:10.1242/dev.129171 myofibril assembly and thin filament lengths (Gokhin and Fowler, sarcomeric Tmods in each muscle. Tmod4 was more abundant 2011a; Gokhin et al., 2010). The switch from pointed-end capping than Tmod1 in all muscles examined, but Tmod4 ranged from by Tmod1 and Tmod4 in wild-type muscle to pointed-end capping approximately nine- to tenfold more abundant than Tmod1 in TA, by Tmod3 and Tmod4 in Tmod1−/− muscle impairs initial α/βTM approximately fourfold more abundant in soleus, and approximately movement during thin filament activation, inhibiting the formation threefold more abundant in diaphragm (Table 1), indicating that of productive actomyosin crossbridges and depressing isometric sarcomeric Tmod isoform distributions are muscle type dependent. force production (Ochala et al., 2014). In all muscles, approximately two sarcomeric Tmods were Although analyses of dystrophic and Tmod1−/− skeletal muscles associated with each thin filament pointed end (Table 1), as have provided substantial insights into how sarcomeric Tmods observed previously (Gokhin et al., 2014b). Note that the higher regulate thin filament lengths and muscle physiology, direct Tmod1 levels observed in soleus and diaphragm muscles (Table
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Tropomodulin Isoform-Specific Regulation of Dendrite Development and Synapse Formation
    This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. Research Articles: Cellular/Molecular Tropomodulin Isoform-Specific Regulation of Dendrite Development and Synapse Formation Omotola F. Omotade1,3, Yanfang Rui1,3, Wenliang Lei1,3, Kuai Yu1, H. Criss Hartzell1, Velia M. Fowler4 and James Q. Zheng1,2,3 1Department of Cell Biology, Emory University School of Medicine, Atlanta, GA 30322. 2Department of Neurology 3Center for Neurodegenerative Diseases, Emory University School of Medicine, Atlanta, GA 30322. 4Department of Molecular Medicine, Scripps Research Institute, La Jolla, CA 92037 DOI: 10.1523/JNEUROSCI.3325-17.2018 Received: 22 November 2017 Revised: 25 September 2018 Accepted: 2 October 2018 Published: 9 October 2018 Author contributions: O.F.O. and J.Q.Z. designed research; O.F.O., Y.R., W.L., and K.Y. performed research; O.F.O. and J.Q.Z. analyzed data; O.F.O. and J.Q.Z. wrote the paper; Y.R., H.C.H., V.M.F., and J.Q.Z. edited the paper; V.M.F. contributed unpublished reagents/analytic tools. Conflict of Interest: The authors declare no competing financial interests. This research project was supported in part by research grants from National Institutes of Health to JQZ (GM083889, MH104632, and MH108025), OFO (5F31NS092437-03), VMF (EY017724) and HCH (EY014852, AR067786), as well as by the Emory University Integrated Cellular Imaging Microscopy Core of the Emory Neuroscience NINDS Core Facilities grant (5P30NS055077). We would like to thank Dr. Kenneth Myers for his technical expertise and help throughout the project. We also thank Drs.
    [Show full text]
  • Effect of Exercise Training on Tropomodulin-2 Gene Expression in Cerebellum of Diabetic Rats
    ORGINAL ARTICLE Effect of Exercise Training on Tropomodulin-2 Gene Expression in Cerebellum of Diabetic Rats Seyed Jalal Taherabadi 1, Masoud Rahmati 1*, Rahim Mirnasuri 1, Abdolreza Kazemi 2 Abstract 1. Department of Sport Sciences, Lorestan Objective: It is well documented that exercise training (ET) University, Khoram Abad, Iran. imposes beneficial effects on diabetes mellitus and its complication 2. Department of Sport Sciences, Vali-E-Asr University of Rafsanjan, Kerman, Iran. such as diabetic peripheral neuropathy (DPN). Regarding the importance of tropomodulin-2 (TMOD2) in nervous system plasticity, this protein may be recognized as a candidate mechanism for ET-induced neuroplasticity. The aim of this study was to *Correspondence: investigate the effects of ET on cerebellar gene expression of Masoud Rahmati, PhD, Department of TMOD2 in rats with DPN. Sport Sciences, Lorestan University, Materials and Methods: Animals were randomly divided into Khoram Abad, Iran. three groups: healthy control (C), diabetic control (DC) and diabetic Tel: (98) 912 452 5538 trained (DT). Diabetes was induced by a single intraperitoneal Email: [email protected] injection of streptozotocin. Behavioral nociception assessment was carried out by Von Frey Filaments and tail-flick tests. TMOD2 gene expression was assessed by real time-PCR . Received: 17 February 2019 Results: The mRNA levels of TMOD2 increased to 0.50-fold ( P- value: 0.005) in comparison of the sedentary controls after 6 weeks Accepted: 21 June 2019 of DPN. Also, TMOD2 gene expression in DT group was decreased Published in August 2019 to -0.68-fold changes in comparison of the C group ( P-value: 0.001).
    [Show full text]
  • Serum Albumin OS=Homo Sapiens
    Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo
    [Show full text]
  • Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle
    ORIGINAL RESEARCH published: 31 March 2016 doi: 10.3389/fphys.2016.00091 Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle Lise Mazelet 1, Matthew O. Parker 2, Mei Li 3, Anders Arner 3 and Rachel Ashworth 4* 1 School of Biological and Chemical Sciences, Queen Mary, University of London, London, UK, 2 School of Health Sciences and Social Work, University of Portsmouth, Portsmouth, UK, 3 Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden, 4 The Blizard Institute/Institute of Health Sciences Education, Barts and The London School of Medicine and Dentistry, London, UK Whilst it is recognized that contraction plays an important part in maintaining the structure and function of mature skeletal muscle, its role during development remains undefined. In this study the role of movement in skeletal muscle maturation was investigated in intact zebrafish embryos using a combination of genetic and pharmacological approaches. An immotile mutant line (cacnb1ts25) which lacks functional voltage-gated calcium channels (dihydropyridine receptors) in the muscle and pharmacological immobilization of embryos Edited by: with a reversible anesthetic (Tricaine), allowed the study of paralysis (in mutants and Catherine Coirault, anesthetized fish) and recovery of movement (reversal of anesthetic treatment). The Institut National de la Santé et de la Recherche Médicale, France effect of paralysis in early embryos (aged between 17 and 24 hours post-fertilization, hpf) Reviewed by: on skeletal muscle structure at both myofibrillar and myofilament level was determined Corrado Poggesi, using both immunostaining with confocal microscopy and small angle X-ray diffraction.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Lineage-Specific Programming Target Genes Defines Potential for Th1 Temporal Induction Pattern of STAT4
    Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021 is online at: average * The Journal of Immunology published online 26 August 2009 from submission to initial decision 4 weeks from acceptance to publication J Immunol http://www.jimmunol.org/content/early/2009/08/26/jimmuno l.0901411 Temporal Induction Pattern of STAT4 Target Genes Defines Potential for Th1 Lineage-Specific Programming Seth R. Good, Vivian T. Thieu, Anubhav N. Mathur, Qing Yu, Gretta L. Stritesky, Norman Yeh, John T. O'Malley, Narayanan B. Perumal and Mark H. Kaplan Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/suppl/2009/08/26/jimmunol.090141 1.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* • Why • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of October 1, 2021. Published August 26, 2009, doi:10.4049/jimmunol.0901411 The Journal of Immunology Temporal Induction Pattern of STAT4 Target Genes Defines Potential for Th1 Lineage-Specific Programming1 Seth R. Good,2* Vivian T. Thieu,2† Anubhav N. Mathur,† Qing Yu,† Gretta L.
    [Show full text]
  • Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
    Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651
    [Show full text]
  • 1471-2164-2-7.Pdf
    BMC Genomics BioMed Central BMC Genomics :7 Research2 2001, article Genomic organization of Tropomodulins 2 and 4 and unusual intergenic and intraexonic splicing of YL-1 and Tropomodulin 4 Patrick R Cox1, Teepu Siddique5 and Huda Y Zoghbi*1,2,3,4 Address: 1Division of Neuroscience, Baylor College of Medicine, Houston, Texas, USA, 2Departments of Pediatrics, Baylor College of Medicine, Houston, Texas, USA, 3Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas, USA, 4Howard Hughes Medical Institute, Baylor College of Medicine, Houston, Texas, USA and 5Baylor College of Medicine, Houston, Northwestern University Medical School, Chicago, Illinois, USA E-mail: Patrick R Cox - [email protected]; Teepu Siddique - [email protected]; Huda Y Zoghbi* - [email protected] *Corresponding author Published: 17 October 2001 Received: 13 July 2001 Accepted: 17 October 2001 BMC Genomics 2001, 2:7 This article is available from: http://www.biomedcentral.com/1471-2164/2/7 © 2001 Cox et al; licensee BioMed Central Ltd. Verbatim copying and redistribution of this article are permitted in any medium for any non-commercial purpose, provided this notice is preserved along with the article's original URL. For commercial use, contact [email protected] Abstract Background: The tropomodulins (TMODs) are a family of proteins that cap the pointed ends of actin filaments. Four TMODs have been identified in humans, with orthologs in mice. Mutations in actin or actin-binding proteins have been found to cause several human diseases, ranging from hypertrophic cardiomyopathy to immunodefiencies such as Wiskott-Aldrich syndrome. We had previously mapped Tropomodulin 2 (TMOD2) to the genomic region containing the gene for amyotrophic lateral sclerosis 5 (ALS5).
    [Show full text]
  • Strand Breaks for P53 Exon 6 and 8 Among Different Time Course of Folate Depletion Or Repletion in the Rectosigmoid Mucosa
    SUPPLEMENTAL FIGURE COLON p53 EXONIC STRAND BREAKS DURING FOLATE DEPLETION-REPLETION INTERVENTION Supplemental Figure Legend Strand breaks for p53 exon 6 and 8 among different time course of folate depletion or repletion in the rectosigmoid mucosa. The input of DNA was controlled by GAPDH. The data is shown as ΔCt after normalized to GAPDH. The higher ΔCt the more strand breaks. The P value is shown in the figure. SUPPLEMENT S1 Genes that were significantly UPREGULATED after folate intervention (by unadjusted paired t-test), list is sorted by P value Gene Symbol Nucleotide P VALUE Description OLFM4 NM_006418 0.0000 Homo sapiens differentially expressed in hematopoietic lineages (GW112) mRNA. FMR1NB NM_152578 0.0000 Homo sapiens hypothetical protein FLJ25736 (FLJ25736) mRNA. IFI6 NM_002038 0.0001 Homo sapiens interferon alpha-inducible protein (clone IFI-6-16) (G1P3) transcript variant 1 mRNA. Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 GALNTL5 NM_145292 0.0001 (GALNT15) mRNA. STIM2 NM_020860 0.0001 Homo sapiens stromal interaction molecule 2 (STIM2) mRNA. ZNF645 NM_152577 0.0002 Homo sapiens hypothetical protein FLJ25735 (FLJ25735) mRNA. ATP12A NM_001676 0.0002 Homo sapiens ATPase H+/K+ transporting nongastric alpha polypeptide (ATP12A) mRNA. U1SNRNPBP NM_007020 0.0003 Homo sapiens U1-snRNP binding protein homolog (U1SNRNPBP) transcript variant 1 mRNA. RNF125 NM_017831 0.0004 Homo sapiens ring finger protein 125 (RNF125) mRNA. FMNL1 NM_005892 0.0004 Homo sapiens formin-like (FMNL) mRNA. ISG15 NM_005101 0.0005 Homo sapiens interferon alpha-inducible protein (clone IFI-15K) (G1P2) mRNA. SLC6A14 NM_007231 0.0005 Homo sapiens solute carrier family 6 (neurotransmitter transporter) member 14 (SLC6A14) mRNA.
    [Show full text]
  • Differential Proteomics of the Cerebral Cortex of Juvenile, Adult and Aged Rats
    ics om & B te i Wille et al., J Proteomics Bioinform 2017, 10:2 ro o P in f f o o DOI: 10.4172/jpb.1000424 r l m a Journal of a n t r i c u s o J ISSN: 0974-276X Proteomics & Bioinformatics Research Article Article Open Access Differential Proteomics of the Cerebral Cortex of Juvenile, Adult and Aged Rats: An Ontogenetic Study Michael Wille1, Antje Schümann, Michael Kreutzer2, Michael O Glocker2, Andreas Wree1, Grit Mutzbauer3 and Oliver Schmitt1* 1Department of Anatomy, Gertrudenstraße 9, 18055 Rostock, Germany 2Proteome Center Rostock, Schillingallee 69, 18055 Rostock, Germany 3Department of Pathology, Josef-Schneider-Straße 2, 97080 Würzburg, Germany Abstract The identification of up- and downregulated as well as absent proteins in the central nervous system is necessary to understand the interplay of migration, differentiation and integration of neuronal progenitor cells at different stages of development. In a first step, differentially expressed proteins of the cerebral cortex of the laboratory rat at three significant stages of development were identified. The cerebral cortex needs differential abundances of proteins during ontogenesis and uses its high plasticity postnatally to adapt to many types of intrinsic and extrinsic changes. This study focuses on the identification of specific proteins which are differentially expressed during postnatal development. Cerebral cortices of P7, P90 and P637 old wistar rats were dissected and analyzed by two- dimensional polyacrylamide gel electrophoresis (2DE) and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) analysis. The identified and differentially expressed proteins are subdivided into 13 different classes.
    [Show full text]
  • Supporting Information for Proteomics DOI 10.1002/Pmic.200600056
    Supporting Information for Proteomics DOI 10.1002/pmic.200600056 Barbara Celegato, Daniele Capitanio, Mario Pescatori, Chiara Romualdi, Beniamina Pacchioni, Stefano Cagnin, Agnese Vigan, Luca Colantoni, Shajna Begum, Enzo Ricci, Robin Wait, Gerolamo Lanfranchi and Cecilia Gelfi Parallel protein and transcript profiles of FSHD patient muscles correlate to the D4Z4 arrangement and reveal a common impairment of slow to fast fibre differentiation and a general deregulation of MyoD-dependent genes ª 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com Table A. List of genes discriminating among the two classes of patients with the same range of size deletion (EcoRI fragment > 21Kb), but differing by age at biopsy. NA: not available value. Table B. Mass spectrometry data of up and down regulated proteins of unclusterised patients, as shown in Figure 3. Table C. Mass spectrometry data of up and down regulated proteins of patients after gene transcripts cluster analysis. Table D. Common altered genes in FSHD muscle compared to a deltoideous control muscle are listed according to their biological process. Table E. Functionally classified transcripts with an increasing profile according to KpnI repeats number at D4Z4 locus. Single patient ratios and intra-class averaged ratios are reported. Table F. Functionally classified transcripts with a decreasing profile according to KpnI repeats number at D4Z4 locus. Single patient ratios and intra-class averaged ratios are reported. Table G. Ratios values of selected transcripts altered in FSHD muscle, suggesting an enrichment in slow-oxidative fibers in the most severely affected patients. Table H. MyoD target genes with an altered expression in FSHD muscle.
    [Show full text]